METHODS OF ACTIVATING CELLS VIA PTP 1B INHIBITION
20210207095 ยท 2021-07-08
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
A61K38/1774
HUMAN NECESSITIES
A61K31/575
HUMAN NECESSITIES
C12N5/0638
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K31/575
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention generally relates to methods of activating cells for use in therapy. For example, the invention relates to preparing cells ex vivo for use in immunotherapy, particularly cancer immunotherapy. More specifically, the invention relates to methods for the preparation of leukocytes, particularly T cells through PTP1B inhibition, exhibiting cytotoxic properties for use in adoptive cell transfer. The invention also relates to cells and compositions including them for cancer immunotherapy. The invention also relates to methods of immunotherapy, particularly cancer immunotherapy.
Claims
1. A method for producing a leukocyte that has an enhanced capacity for killing a target cell, the method comprising contacting the leukocyte with a PTP1B inhibitor in conditions for enabling the inhibitor to inactivate PTP1B in the leukocyte, thereby producing a leukocyte that has an enhanced capacity for killing a target cell.
2. The method of claim 1, wherein the leukocyte is contacted with the PTP1B inhibitor in the absence of a T helper cell.
3. The method of claim 1 or 2, wherein the leukocyte is contacted ex vivo with the PTP1B inhibitor.
4. A method for preparing an ex vivo population of T cells exhibiting at least one property of a cytotoxic T cell, comprising culturing T cells in the presence of a PTP1B inhibitor.
5. A method for preparing an ex vivo population of T cells exhibiting at least one property of a cytotoxic T cell comprising the steps of: culturing a T cell population from a biological sample in the presence of a PTP1B inhibitor; expanding the cells in culture; thereby preparing an ex vivo population of T cells exhibiting cytotoxic properties.
6. The method of claim 5, wherein the biological sample is derived from a subject having a cancer or have been conditioned or engineered to have specificity for a cancer.
7. An ex vivo method for preparing a composition comprising antigen-specific cytotoxic T cells, the method comprising: providing a biological sample containing a population of T cells; co-culturing antigenic material with the T cell population in the presence of a PTP1B inhibitor; and expanding the cells in culture, thereby preparing a composition comprising antigen-specific cytotoxic T cells ex vivo.
8. A method for increasing the level of T cells in a subject exhibiting an effector memory phenotype comprising the steps of: culturing a T cell population from a biological sample ex vivo in the presence of a PTP1B inhibitor; expanding the cells in culture; administering the cultured cells to the subject; thereby increasing the level of T cells in a subject exhibiting an effector memory phenotype.
9. A method for forming an immune response in a subject suitable for the treatment of cancer comprising the steps of obtaining T cells from the subject or a histocompatible donor subject; culturing the T cells in the presence of a PTP1B inhibitor ex vivo for a sufficient time and under conditions for to generate a population of T cells exhibiting at least one cytotoxic T cell property, thereby forming a population of cytotoxic T cells, administering the population of cytotoxic T cells to the subject, thereby producing an immune response in a subject suitable for the treatment of cancer.
10. A method of increasing CD8+ T cell mediated immunity in a subject having a disease state comprising: contacting CD8+ T cells with a PTP1B inhibitor ex vivo for a sufficient time and under conditions to generate a population of CD8+ T cells exhibiting at least one property of a cytotoxic T cell; administering the population of CD8+ T cells to the subject, thereby increasing CD8+ T cell mediated immunity in a subject.
11. A method of increasing CD8+ T cell mediated immunity in a subject having a disease state comprising: isolating a population of the subject's CD8+ T cells; introducing a nucleic acid molecule encoding an siRNA, shRNA or gRNA directed to PTP1B into the isolated CD8+ T cells, thereby reducing the level of PTP1B in a CD8+ T cell; and reintroducing the CD8+ T cells into said subject, thereby increasing the CD8+ T cell mediated immunity in a subject.
12. A method of promoting regression of a cancer in a subject comprising the steps of: culturing T cells obtained from a subject in the presence of a PTP1B inhibitor, administering the cultured T cells to the subject, whereupon regression of the cancer is promoted.
13. A method of promoting regression of a cancer in a subject having cancer comprising the steps of: culturing CAR-T cells specific for a tumour antigen expressed by the cancer in the presence of a PTP1B inhibitor, administering the cultured CAR-T cells to the subject, whereupon regression of the cancer is promoted.
14. A method of prolonging survival of a subject having cancer comprising the steps of: culturing CAR-T cells specific for a tumour antigen expressed by the cancer in the presence of a PTP1B inhibitor, administering the cultured CAR-T cells to the subject, whereupon survival of the subject is prolonged.
15. The method of claims 12 to 14, wherein the cancer is selected from a Her-2 positive cancer, a CD19 positive cancer, a CD171 positive cancer, an EGFR-positive cancer, a CD22-positive cancer, a CD123-positive cancer, a Lewis Y positive cancer cells, or an MSLN-positive cancer, an FAP-positive cancer, or CD131-positive cancer.
16. The method of any one of claims 1 to 15, wherein the PTP1B inhibitor is an interfering RNA or a small molecule inhibitor.
17. The method of claim 16, wherein the small molecule inhibitor is claramine or trodusquemine, or derivatives thereof.
18. The method of any one of claims 1 to 15, wherein the PTP1B inhibitor is a CRISPR/Cas9 system for directly inhibiting PTP1B.
19. A population of tumour antigen-specific cytotoxic T cells for use in adoptive immunotherapy comprising an exogenous nucleic acid coding an interfering RNA.
20. An isolated, purified or recombinant cell comprising an antigen-specific T cell receptor and an exogenous nucleic acid encoding an interfering RNA.
21. The population of cells of claim 19 or the isolated, purified or recombinant cell of claim 20, wherein the interfering RNA is a microRNA, shRNA, siRNA or gRNA molecule that can reduce the level of PTP1B in a cell.
22. The isolated, purified or recombinant cell of claim 20 or 21, wherein the T cell receptor (TCR) is specific for a cancer antigen and the cell is a CD8+ T cell.
23. The cell of claim 22, wherein the CD8+ T cell is a tumour infiltrating lymphocyte or a peripheral blood lymphocyte isolated from a host afflicted with cancer.
24. A method for proliferating, enriching or expanding a composition of cells comprising a CD8+ T cell, the method comprising culturing a composition of cells in a medium, the medium comprising a PTP1B inhibitor, wherein the PTP1B inhibitor is provided in the medium to permit contact with a CD8+ T cell during culture.
25. The method of claim 24, wherein the proliferating, enriching or expanding will result in a doubling of the number of CD8+ T cells that exhibit at least one cytotoxic T cell property.
26. The method of claim 25, wherein the expanding results in 3 or 4 number of CD8+ T cells that exhibit at least one cytotoxic T cell property, preferably at least 5, 6, 7, 8, 9 or over 10.
27. The method of any one of claims 22 to 26, wherein the relative number of CD8+ T cells in the composition that exhibit at least one cytotoxic T cell property is increased.
28. A composition of cytotoxic cells wherein greater than 20% of the cells have complete or partial inhibition of PTP1B.
29. The composition of claim 28, wherein, the composition includes greater than 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 or 99% of cells that have complete or partial inhibition of PTP1B, or wherein preferably, all cells in the composition have complete or partial inhibition of PTP1B.
30. A composition comprising a leukocyte and a PTP1B inhibitor.
31. The composition of claim 30, wherein the PTP1B inhibitor is an interfering RNA or a small molecule inhibitor.
32. The composition of claim 31, wherein the small molecule inhibitor is claramine or trodusquemine or derivatives thereof.
33. The composition of any one of claims 28 to 32, wherein the composition further includes a cytokine for enhancing cell killing, such as IL-2 or IFN.
34. The composition of any one of claims 30 to 33, wherein the leukocyte is a CAR T cell, preferably a CAR T cell that is specific for a cell surface tumour antigen, more preferably wherein the CAR T cell is specific for a tumour antigen selected from Her-2, CD19, CD171, EGFR, CD22, CD123, Lewis Y, MSLN, FAP, or CD131
35. The composition of any one of claims 30 to 34, wherein the leukocyte is selected from the group consisting of tumour infiltrating lymphocytes, peripheral blood lymphocyte, genetically engineered to express anti-tumour T cell receptors or chimeric antigen receptors (CARs), T cells, enriched with mixed lymphocyte tumour cell cultures (MLTCs) or cloned using autologous antigen presenting cells and tumour derived peptides.
36. The composition of claim 35, wherein the lymphocytes are isolated from a histocompatible donor, or from a cancer-bearing subject.
37. The method of any one of claims 1 to 17, or of 24 to 27, wherein the cells are purified or substantially purified prior to culture in the presence of a PTP1B inhibitor.
38. A method of treating cancer in a subject comprising administering a population of isolated or purified CD8+ T cells effective to treat the cancer, the CD8+ T cell comprising an antigen-specific T cell receptor and an exogenous nucleic acid encoding an interfering RNA for inhibiting PTP1B.
39. The method of claim 28, wherein the interfering RNA is a microRNA, shRNA, siRNA or gRNA molecule directed to PTP1B.
40. A method for increasing the level of T cells in a subject exhibiting an effector memory phenotype comprising the steps of: administering a PTP1B inhibitor to the subject; thereby increasing the level of T cells in a subject exhibiting an effector memory phenotype.
41. A method for forming an immune response in a subject suitable for the treatment of cancer comprising administering a PTP1B inhibitor to the subject, thereby producing an immune response in a subject suitable for the treatment of cancer.
42. A method of increasing CD8+ T cell mediated immunity in a subject having a disease state comprising, administering a PTP1B inhibitor to the subject, thereby increasing CD8+ T cell mediated immunity in a subject.
43. A method of treating cancer in a subject comprising administering a PTP1B inhibitor to the subject, thereby treating cancer in the subject.
44. A method of promoting regression of a cancer in a subject having cancer comprising administering a PTP1B inhibitor to the subject, whereupon regression of the cancer is promoted.
45. A method of prolonging survival of a subject having cancer comprising administering a PTP1B inhibitor to the subject, whereupon survival of the subject is prolonged.
46. The method of any one of claims 38 to 45, wherein the cancer is a Her-2 positive cancer, a CD19 positive cancer, a CD171 positive cancer, an EGFR-positive cancer, a CD22-positive cancer, a CD123-positive cancer, a Lewis Y positive cancer cells, or an MSLN-positive cancer, an FAP-positive cancer, or CD131-positive cancer.
47. The method of any one of claims 40 to 46 wherein the method further comprises the administration of CAR-T cells to the individual.
48. The method of claim 47 wherein the CAR-T cells are Her-2 specific CAR CD8+ T cells.
49. The method of any one of claims 38 to 48, wherein the PTP1B inhibitor is administered directly to the individual.
50. The method of claim 49, wherein the inhibitor is administered systemically or by any means that allows the PTP1B inhibitor to enter the circulation.
51. The method of claim 49 or 50, wherein the PTP1B inhibitor is an interfering RNA or a small molecule inhibitor.
52. The method of claim 51, wherein the small molecule inhibitor is claramine or trodusquemine or derivatives thereof.
53. The method of claim 51, wherein the PTP1B inhibitor is an interfering RNA selected from a microRNA, shRNA, siRNA or gRNA molecule that can reduce the level of PTP1B in a cell.
54. Use of a PTP1B inhibitor in the manufacture of a medicament for: increasing the level of T cells in a subject exhibiting an effector memory phenotype; forming an immune response in a subject suitable for the treatment of cancer; increasing CD8+ T cell mediated immunity in a subject having a disease state; treating cancer in a subject; promoting regression of a cancer in a subject having cancer; or prolonging survival of a subject having cancer.
55. A PTP1B inhibitor or pharmaceutical composition comprising a PTP1B inhibitor for use in: increasing the level of T cells in a subject exhibiting an effector memory phenotype; forming an immune response in a subject suitable for the treatment of cancer; increasing CD8+ T cell mediated immunity in a subject having a disease state; treating cancer in a subject; promoting regression of a cancer in a subject having cancer; or prolonging survival of a subject having cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0148] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.
[0149] Reference will now be made in detail to certain embodiments of the invention. While the invention will be described in conjunction with the embodiments, it will be understood that the intention is not to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the present invention as defined by the claims.
[0150] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described. It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.
[0151] All of the patents and publications referred to herein are incorporated by reference in their entirety.
[0152] For purposes of interpreting this specification, terms used in the singular will also include the plural and vice versa.
[0153] The inventors have developed a method for the efficient preparation of cells for use in adoptive cell transfer, particularly for cancer immunotherapy. The inventors have surprisingly found that inhibiting the activity of PTP1B in T cells enhances the activation of such cells and their capacity for killing a target cell. Further, an advantage of the present invention is that T cells which are tolerised but would otherwise be useful in adoptive cell transfer (ADC), for example as they are specific for tumour antigens in the case of tumour infiltrating lymphocytes, can be reinvigorated and tolerance reduced.
[0154] Still further, the inventors have found that inhibition of PTP1B in T cells substantially reduces the need for concomitant stimulation with cytokines (for example, to enhance expansion of the cells intended for ADC). Without wishing to be bound by theory, the inventors believe that cells for ADC which are also treated to inhibit PTP1B activity are more sensitive to cytokines such as IL-17, IL-15 and IL-2 so that patients treated with the cells may not need concomitant treatment with cytokines. Alternatively, fewer cells can be used for ADC, given the increased responsiveness of T cells to cytokines when PTP1B is inhibited.
[0155] Without being bound by any theory or mode of action, it is believed that inhibition of PTP1B activity causes alteration in T cell receptor (TCR) signalling thereby reversing or avoiding tolerance and instead promoting differentiation of T cells down the cytotoxic T cell lineage. For example, isolated CD8.sup.+ T cells treated so as to reduce PTP1B activity lead to any one or more of the following functions: develop cytotoxic activity towards cells that bear an antigen to which an enhanced immune response would be desirable, enhanced sustenance and/or antigen-recall responses to presentation of the antigen, or have functional and/or phenotypic characteristics of effector T cells.
[0156] Although cancer immunotherapies of ex vivo cultured CD8.sup.+ T cells have been demonstrated to exhibit remarkable efficacy, such therapies are not effective in every patient as it is difficult to obtain an effective number of CD8.sup.+ T cells that have the ability to target the tumour cells and kill the tumour cell once recognised. The present invention provides a means for producing cells that have an enhanced capacity to kill a target cell, such as a tumour cell.
[0157] A further advantage identified by the inventors is that inhibition of PTP1B in T cells increases persistence of central memory and effector memory T cells. This means that in addition to providing for an increase in cytotoxic killing in the period immediately after PTP1B inhibition, the methods of the present invention provide for better adaptation and preparation of the immune system to deal with long term or subsequent exposure to a relevant antigen (for example, upon relapse of the relevant disease or condition).
[0158] Anatomic sources of leukocytes, preferably T cells, from a subject include peripheral blood, tumours, malignant effusions, and draining lymph nodes. Lymphocytes used for adoptive transfer can either be derived from the stroma of resected tumours (tumour infiltrating lymphocytes), or from blood and: genetically engineered to express antitumour T cell receptors or chimeric antigen receptors (CARs), enriched with mixed lymphocyte tumour cell cultures (MLTCs) or cloned using autologous antigen presenting cells and tumour derived peptides. The lymphocytes used for infusion can be isolated from an allogenic donor, preferably HLA matched, or from the cancer-bearing subject. In one embodiment, the leukocytes, preferably T cells, from a subject are not obtained or derived from the bone marrow.
[0159] In any method of the invention the leukocytes, preferably T cells that have been cultured in the presence of a PTP1B inhibitor can be transferred into the same mammal from which cells were obtained. In other words, the cells used in a method of the invention can be an autologous cell, i.e., can be obtained from the mammal in which the medical condition is treated or prevented. Alternatively, the cell can be allogenically transferred into another subject. Preferably, the cell is autologous to the subject in a method of treating or preventing a medical condition in the subject.
[0160] One source of T cells targeted for cancer immunotherapy may be to use artificial chimeric receptors derived, for example, from the antigen binding domain of a monoclonal antibody. When coupled to appropriate intracellular signaling domains, T cells expressing these chimeric antigen receptors (CAR) can kill tumour cell targets. CAR T cells have the advantage of acting in a MHC unrestricted manner, allowing them to target tumour cells in which antigen processing or presentation pathways are disrupted. Moreover, they can be directed to nonpeptide antigens on the cell surface, broadening the range of target structures that can be recognized on malignant cells. Hence, CAR-expressing T cells can complement MHC restricted cytotoxic T cells, and increase the overall effectiveness of this cellular immunotherapy.
[0161] When nave CD8+ and CD4+ T cells engage peptide antigen presented by major histocompatibility complex (MHC) molecules, the T cell receptor signal strength determines whether T cells progress past the Gi restriction point and commit to cellular division, produce interleukin-2 (IL-2) and undergo clonal expansion/proliferation and differentiate and acquire various effector functions. TCR signaling is reliant on tyrosine phosphorylation mediated by the Src family protein tyrosine kinases, Lck and Fyn, and the Syk family PTK ZAP-70. Engagement of the TCR allows for Lck to phosphorylate the immunoreceptor tyrosine-based activation motifs of the TCR that result ZAP-70 recruitment and activation and the phosphorylation of adaptor proteins such as LAT. This in turn allows for the nucleation of signaling complexes and the phosphorylation and activation of multiple effector pathways. Upon TCR engagement, the activation and/or functions of Lck are regulated by the localisation of Lck and its substrates, as well as the abundance, activity and segregation of regulatory molecules within the immunological synapse. Such regulatory molecules include protein tyrosine phosphatases (PTPs) that regulate the phosphorylation of the Lck Y505 inhibitory site, as well as the Lck Y394 activating site.
[0162] PTP1B (also known as PTPN1, PTP1B, protein tyrosine phosphatase, non-receptor type 1, Tyrosine-protein phosphatase non-receptor type 1 or protein-tyrosine phosphatase 1B) is a ubiquitous phosphatase anchored in the endoplasmic reticulum by its C-terminal end and has its catalytic regions exposed to the cytosol. PTP1B is known to dephosphorylate a wide variety of phosphoproteins, such as receptors for the growth factors insulin and epidermal growth factor (EGF), c-Src and beta-catenin. PTP1B also dephosphorylates Janus-activated protein kinase 9JAK) family members including Tyk-2 and JAK-2. PTP1B is reported to be a major negative regulator of the insulin receptor and also of leptin signalling. The PTPN1 gene, which encodes PTP1B, is located in 20q13, a genomic region that is linked to insulin resistance and diabetes in human populations from different geographical origins. More than 20 single nucleotide polymorphisms (SNPs) that are associated with increased risk of type 2 diabetes have been identified within the PTPN1 gene. Whole-body deletion of PTP1B in mice results in increased insulin sensitivity and improved glucose tolerance. In addition, PTP1B has been shown to modulate cytokine receptor signalling, including IFN- signalling. The role of PTP1B in cancer is unclear, with either increased or reduced expression observed in different cancer types.
[0163] In order to determine if the presence of a PTP1B inhibitor has inhibited PTP1B, experiments such as the following could be performed: measure PTP1B activity in PTP1B immunoprecipitates using p-NPP (para-nitrophenylphosphate) and p-tyr-RCML (p-tyr-reduced, carboxyamidomethylated and maleylated lysozyme) as substrates as described previously (Bukczynska P et al. Biochem. J. 2004 Jun. 15; 380(Pt 3):939-49; Tiganis T et al. J. Biol. Chem. 1997 Aug. 22; 272(34):21548-57). Alternatively, analysis of known substrates of PTP1B such as c-Src, insulin receptor, EGF receptor, Tyk-2, JAK-2 and the transcription factor STAT5 for tyrosine-phosphorylation by flow cytometry and immuno-blotting can be performed.
[0164] A PTP1B inhibitor useful in the present invention is one that completely or partially reduces one or more functions of PTP1B as described herein. Preferably, a PTP1B inhibitor reduces phosphatase activity of PTP1B (such as a small molecule, peptide or peptidomimetic), reduces the transcriptional activity of the PTP1B gene, or reduces the amount of PTP1B mRNA or protein present in the cell.
[0165] In any embodiment of the invention, the inhibition of PTP1B may be inhibition of at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% inhibition. In further embodiments, the inhibition is of PTP1B only, such that there are minimal-to-no off-target effects resulting in inhibition of other targets. Accordingly, in preferred embodiments, the inhibition of targets other than PTP1B is no more than 20%, no more than 10%, no more than 5% inhibition.
[0166] As used herein, a PTP1B inhibitor may be any molecule that inhibits the phosphatase activity of PTP1B or reduces the level of PTP1B in a cell. The inhibitor may be a direct inhibitor of the phosphatase active site, may act allosterically to inhibit phosphatase activity, inhibit interaction of PTP1B with its substrate, or may reduce the level of PTP1B by reducing the transcriptional activity of the PTP1B gene, or reducing the amount of PTP1B mRNA or protein present in the cell.
[0167] An example of a direct inhibitor of the phosphatase active site, an inhibitor that acts allosterically to inhibit phosphatase activity, or an inhibitor that inhibits interaction of PTP1B with its substrate is a small molecule, for example:
[0168] Claramine (Sigma, 1545; also referred to as (3,6)-6-[[3-[[4-[(3-Aminopropyl)amino]butyl]amino]propyl]amino]-cholestan-3-ol) and derivatives thereof;
[0169] Trodusquemine (MSI-1436, produlestan, Trodulamine, troduscemine, CAS No: 186139-09-3, a naturally-occurring cholestane and non-competitive, allosteric inhibitor of PTP1B, trodusquemine selectively targets and inhibits PTP1B, thereby preventing PTP1B-mediated signalling) and derivatives thereof including DPM-1001 (Krishnan et al 2018, JBC, 293:1517-1525);
[0170] 3-(3,5-dibromo-4-hydroxy-benzoyl)-2-ethyl-benzofuran-6-sulfonicacid-(4-(thiazol-2-ylsulfamyl)-phenyl)-amide (also referred to as PTP Inhibitor XXII, CAS no: 765317-72-4, Thermofisher Scientific or Calbiochem) and derivatives thereof;
[0171] 3-Hexadecanoyl-5-hydroxymethyl-tetronic acid calcium salt (RK-682, CAS no: 332131-32-5, Santa Cruz Biotechnology) and derivatives thereof;
[0172] 2-[(Carboxycarbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS-401, CAS no: 243966-09-8, Santa Cruz Biotechnology) and derivatives thereof;
[0173] 6-Methyl-2-(oxalylamino)-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid trifluoroacetic acid salt (BML-267, Santa Cruz Biotechnology) and derivatives thereof;
[0174] or a peptide, or peptidomimetic.
[0175] An example of an inhibitor that may reduce the amount of PTP1B mRNA or protein present in the cell is an inhibitory or interfering RNA, such as antisense RNA, siRNA, microRNA or shRNA.
[0176] An example of an shRNA sequences which may reduce the amount of PTP1B mRNA include:
TABLE-US-00001 (SEQIDNO:1) AATTGCACC-AGGAAGATAATGACTATATC
[0177] Exemplary siRNA sequences include:
TABLE-US-00002 Sense: (SEQIDNO:2) 5-UAGGUACAGAGACGUCAGUdTdT-3; Antisense: (SEQIDNO:3) 5-ACUGACGUCUCUGUACCUAdTdT-3 Sense, (SEQIDNO:4) 5-UAGGUACAGAGACGUCAGUdTdT-3; Antisense, (SEQIDNO:5) 5-ACUGACGUCUCUGUACCUAdTdT-3 Sense, (SEQIDNO:6) 5-AAATCAACGGAAGAAGGGTCT-3 Sense: (SEQIDNO:7) 5-NNUGACCAUAGUCGGAUUAAA-3 Sense: (SEQIDNO:8) 5-UUGAUGUAGUUUAAUCCGACUAUGG-3 Anti-sense: (SEQIDNO:9) 5-CCAUAGUCGGAUUAAACUACAUCAA-3
[0178] The skilled person will also appreciate that it is possible to obtain shRNAs or siRNAs, which can be used to reduce PTP1B mRNA, from a number of commercial sources, including from Dharmacon (Madrid, Spain) and Thermofisher (USA). Commercially available shRNA targeted to ptp1b can be purchased, for example, from Open Biosystems (Dharmacon) under catalog no. RHS3979-9571385.
[0179] Preferably, the siRNA, shRNA target is (GenBank NCBI Reference Sequences referred to):
[0180] exon 2, preferably starting at position 291 of NM_001278618.1;
[0181] exon 3, preferably starting at position 382 of NM_002827.3;
[0182] exons 3 and 4, preferably starting at position 466 of NM_001278618.1;
[0183] exons 4 and 5, preferably starting at position 557 of NM_002827.3; or exons 2 and 3, preferably starting at position 360 of NM_002827.3.
[0184] Preferably, the shRNA has a sequence of at least 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to any sequence described herein provided the shRNA still retains the ability to reduce PTP1B levels in a cell.
[0185] Further, the inhibition of PTP1B may also include genome editing to delete or modify all or part of a sequence encoding PTP1B. An exemplary genome editing technique is the CRISPR/Cas9 system (Jinek, M., et al. (2012) Science, 337, 816-821; Cong L., et al. (2013) Science, 339, 819-823; and Qi, L. S., et al. (2013) Cell, 152, 1173-1183). As such, in accordance with the present invention, the PTP1B inhibitor may include a gRNA (including an sgRNA) for use in CRISPR-Cas9 genome editing to inhibit or delete PTP1B activity. More specifically, the present invention contemplates the use of CRISPR-Cas9 to delete Ptp1b in human CAR T cells. Moreover, use of CRISPR-Cas9 enables the inhibition to be of PTP1B alone (i.e., wherein only PTP1B is inhibited). In certain embodiments, the inhibition of only PTP1B may be complete inhibition (i.e., knock-out) of PTP1B function, or a reduction in PTP1B activity/expression (i.e., knock-down or partial knock-out).
[0186] The skilled person will be able to purchase or design gRNAs or crRNAs which target a variety of PTP1B sequences. Examples of such gRNA target sequences include:
TABLE-US-00003 (SEQIDNO:10) TTCGAGCAGATCGACAAGTC (SEQIDNO:11) GATGTAGTTTAATCCGACTA (SEQIDNO:12) GAGCTGGGCGGCCATTTACC (SEQIDNO:13) TGACGTCTCTGTACCTATTT (SEQIDNO:14) CAAAAGTGACCGCATGTGTT (SEQIDNO:15) GTCTTTCAGTTGACCATAGT
[0187] The miRNA, siRNA or shRNA can be delivered to the relevant T cell by using a viral vector. There are a large number of available viral vectors that are suitable for use with the present invention, including those identified for human gene therapy applications. Suitable viral vectors include vectors based on RNA viruses, such as retrovirus-derived vectors, e.g., Moloney murine leukemia virus (MLV)-derived vectors, and include more complex retrovirus-derived vectors, e.g., Lentivirus-derived vectors. Human Immunodeficiency virus (HIN-1)-derived vectors belong to this category. Other examples include lentivirus vectors derived from HIN-2, feline immunodeficiency virus (FIN), equine infectious anaemia virus, simian immunodeficiency virus (SIV) and Maedi-Visna virus.
[0188] Preferably a modified retrovirus, even more preferably a modified lentivirus, is used to deliver the specific miRNA, siRNA or shRNA. This virus may also include sequences that encode the chimeric antigen T cell receptor for targeting the specific cell to be killed. The polynucleotide and any associated genetic elements are thus integrated into the genome of the host cell as a provirus. The modified retrovirus is preferably produced in a packaging cell from a viral vector that includes the sequences necessary for production of the virus as well as the miRNA, siRNA or shRNA and/or CAR. The viral vector may also include genetic elements that facilitate expression of the miRNA, siRNA or shRNA, such as promoter and enhancer sequences. In order to prevent replication in the target cell, endogenous viral genes required for replication may be removed.
[0189] The skilled person will be familiar with methods for virally introducing Cas9 and guide RNAs (gRNAs) into cells for the purpose of targeting PTP1B (for example, utilising lentiviral methods). In addition, the present invention contemplates the use of Cas9 ribonucleoprotein (RNP)-mediated gene-editing to delete PTP1B (for example using GeneArt Platinum Cas9 Nuclease pre-loaded with synthesized crRNA:tracrRNA (Dharmacon) targeting human PTP1B using the Neon Transfection system).
[0190] The skilled person will be able to determine whether PTP1B mRNA levels have been reduced using standard quantitative PCR methods. For example, the Taqman gene expression assay to determine Ptpn1 expression can be used (Mm00448427_m1, Thermofisher Scientific). The skilled person will understand that such assays can be used to confirm PTP1B mRNA reduction resulting from siRNA or shRNA targeting or alternatively as the result of gRNA-derived CRISPR-Cas9 genome editing to reduce PTP activity.
[0191] A composition comprising the CD8+ T cells and the PTP1B inhibitor may further include the cancer specific antigen and/or one or more cytokines to enhance cell killing (such as IL-2 or IFN). When the antigen is present in the composition comprising the isolated, enriched or purified CD8+ T cells, the antigen may be present as an independent entity, or in any context by which the antigen can interact with the T cell receptor or CAR present on the CD8+ T cells. When the antigen can interact with the TCR of the CD8+ T cells the CD8+ T cells can become activated. Examples of various embodiments by which the antigen can be provided in the composition such that it can be recognized by the CD8+ TCR include but are not limited to it the antigen being present in association with MHC-I (or the equivalent presentation in an animal model) on the surface of antigen presenting cells, such as dendritic cells, macrophages or certain activated epithelial cells. Alternatively, the antigen could be in physical association with any other natural or synthesized molecule or other compound, complex, entity, substrate, etc., that would facilitate the recognition of the antigen by the TCR on the CD8+ T cells. For example, the antigen could be complexed to a MHC-I or other suitable molecule for presenting the antigen to the CD8+ TCR, and the MHC-I or other suitable molecule could be in physical association with a substrate, such as a latex bead, plastic surface of any plate, or any other suitable substrate, to facilitate appropriate access of the antigen to the CD8+ T cell TCR such that the antigen is recognized by the CD8+ T cell.
[0192] CD8+ T cells may be obtained using routine cell sorting techniques that discriminate and segregate T cells based on T cell surface markers can be used to obtain an isolated population CD8+ T cells for use in the compositions and methods of the invention. For example, a biological sample including blood and/or peripheral blood lymphocytes can be obtained from an individual and CD8+ T cells isolated from the sample using commercially available devices and reagents, thereby obtaining an isolated population of CD8+ T cells. Murine CD8+ T cells may be further characterized and/or isolated on a phenotypic basis via the use of additional cell surface markers such as CD44, L-selectin (CD62L), CD25, CD49d, CD122, CD27, CD43, CD69, KLRG-1, CXCR3, CCR7, IL-7R and KLRG-1. CD8+ T cells may be initially enriched by negatively selecting CD4+, NK1.1+, B220+, CD11b+, TER119+, Gr-1+, CD11c+ and CD19+ cells. Nave CD8+ T cells are characterized as CD44 low, CD62L high, CCR7 high, CD25 low, CD43 low, CD49d low, CD69 low, IL-7R high and CD122 low, whereas antigen experienced memory T cells are CD44 high, CD49d high, CD122 high, CD27 high, CD43 high and CXCR3 high. Memory CD8+CD44 high T cells can be further sub-divided into lymphoid-tissue residing Central Memory T cells (CD62L high, CCR7 high) and non-lymphoid tissue residing Effector Memory T cells (CD62L low, CCR7 low) (Klonowski et al. Immunity 2004, 20:551-562). The isolated population of CD8+ T cells can be mixed with the PTP1B and/or antigen in any suitable container, device, cell culture media, system, etc., and can be cultured in vitro and/or exposed to the one or more antigens, and any other reagent, or cell culture media, in order to expand and/or mature and/or differentiate the T cells to have any of various desired cytotoxic T cell characteristics.
[0193] Human CD8+ T-cell types and/or populations can be identified using the phenotypic cell-surface markers CD62L, CCR7, CD27, CD28 and CD45RA or CD45RO (Sallusto F et al. Nature 1999, 401:708-712). As used herein, CD8+ T-cell types and/or populations have the following characteristics or pattern of expression of cell surface markers: Nave T cells are characterized as CD45RA+, CD27+, CD28+, CD62L+ and CCR7+; CD45RO+ Central Memory T cells are CD45RA, CD27+, CD28+, CD62L+ and CCR7+; CD45RO+ Effector Memory T cells are defined by the lack of expression of these five markers (CD45RA, CD27, CD28, CD62L and CCR7); and terminally differentiated Effector Memory CD45RA+ T cells are characterized as CD45RO+, CCR7, CD27, CD28, CD62L. Terminally differentiated Effector Memory cells further up-regulate markers such as CD57, KLRG1, CX3CR1 and exhibit strong cytotoxic properties characterized by their ability to produce high levels of Granzyme A and B, Perforin and IFN. Therefore, various populations of T cells can be separated from other cells and/or from each other based on their expression or lack of expression of these markers. In this manner, the invention provides methods of separating different populations of CD8+ T cells and also separated or isolated populations of CD8+ T cells. The CD8+ T cell types described herein may also be isolated by any other suitable method known in the art; for example, if a particular antigen or antigens are used to produce antigen-specific CD8+ T cells, those cells can be separated or isolated from other cells by affinity purification using that antigen or antigens; appropriate protocols are known in the art.
[0194] Different CD8+ T cell types can also exhibit particular functions, including, for example: secretion of IFN-; secretion of IL-2; production of Granzyme B; expression of FasL and expression of CD 107. However, while the expression pattern of cell surface markers is considered diagnostic of each particular CD8+ T cell type and/or population as described herein, the functional attributes of each cell type and/or population may vary depending on the amount of stimulation the cell(s) has or have received.
[0195] Effector functions or properties of T cells can be determined by the effector molecules that they release in response to specific binding of their T-cell receptor with antigen:MHC complex on the target cell, or in the case of CAR T-cells interaction of the chimeric antigen receptor, e.g. scFv, with the antigen expressed on the target cell. Cytotoxic effector molecules that can be released by cytotoxic CD8+ T cells include perforin, granzymes A and B, granulysin and Fas ligand. Generally, upon degranulation, perforin inserts itself into the target cell's plasma membrane, forming a pore, granzymes are serine proteases which can trigger apoptosis (a form of cell death), granulysin induces apoptosis in target cells, and Fas ligand can also induce apoptosis. Typically, these cytotoxic effector molecules are stored in lytic granules in the cell prior to release. Other effector molecules that can be released by cytotoxic T cells include IFN-, TNF- and TNF-. IFN- can inhibit viral replication and activate macrophages, while TNF- and TNF- can participate in macrophage activation and in killing target cells. In any method of the invention, before administration or reintroduction of the cells contacted with a PTP1B inhibitor, those cells will be assessed for their cytotoxic activity by flow cytometry using fluorochrome-conjugated antibodies against surface and intracellular markers that specify cytotoxic effector T cells including Granzyme A and B, Perforin and IFN.
[0196] An activated T cell is a cell that is no longer in GO phase, and begins to produce one or more cytotoxins, cytokines and/or other membrane-associated markers characteristic of the cell type (e.g., CD8+) as described herein and is capable of recognizing and binding any target cell that displays the particular peptide:MHC complex or antigen alone on its surface and releasing its effector molecules.
[0197] The methods of the invention that promote the differentiation of T cells into a population of cytotoxic T cells lead to a statistically significant increase in the population of cytotoxic T cells. A population is increased when the cells are present in an amount which is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% higher in comparison to an appropriate control such as, for example, the size of the population prior to treatment with a method of the invention. The cytotoxic CD8+ T cell effector function is increased when cells have a function which is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% higher, than an appropriate control, such as, for example, the performance of a sample of cells in a particular assay in the absence of a particular event or condition. Where appropriate, in vivo function or the presence of a cell population in vivo may be measured using cells isolated from a subject in in vitro assays.
[0198] An enriched or purified population of cells is an increase in the ratio of particular cells to other cells, for example, in comparison to the cells as found in a subject's body, or in comparison to the ratio prior to exposure to a PTP1B inhibitor. In some embodiments, in an enriched or purified population of cells, the particular cells include at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95% or 99% of the total cell population. A population of cells may be defined by one or more cell surface markers and/or properties.
[0199] CD8+ T cells exposed to, or contacted with, a PTP1B inhibitor that exhibit at least one property of a cytotoxic T cell as described herein, upon administration to the subject, elicit a cytotoxic T cell response to a tumour cell. Preferably, that CTL response to a tumour cell is effective in causing cell death, such as lysis, of tumour cells having the targeted antigen.
[0200] CD8+ T cells exposed to, or contacted with, a PTP1B inhibitor can be administered to the subject by any method including, for example, injection, infusion, deposition, implantation, oral ingestion, or topical administration, or any combination thereof. Injections can be, e.g., intravenous, intramuscular, intradermal, subcutaneous or intraperitoneal. Single or multiple doses can be administered over a given time period, depending upon the cancer, the severity thereof and the overall health of the subject, as can be determined by one skilled in the art without undue experimentation. The injections can be given at multiple locations. Administration of the CD8+ T cells can be alone or in combination with other therapeutic agents. Each dose can include about 1010.sup.3 CD8+ T cells, 2010.sup.3 cells, 5010.sup.3 cells, 10010.sup.3 cells, 20010.sup.3 cells, 50010.sup.3 cells, 110.sup.6 cells, 210.sup.6 cells, 2010.sup.6 cells, 5010.sup.6 cells, 10010.sup.6 cells, 20010.sup.6, 50010.sup.6, 110.sup.9 cells, 210.sup.9 cells, 510.sup.9 cells, 1010.sup.9 cells, and the like. Administration frequency can be, for example, once per week, twice per week, once every two weeks, once every three weeks, once every four weeks, once per month, once every two months, once every three months, once every four months, once every five months, once every six months, and so on. The total number of days where administration occurs can be one day, on 2 days, or on 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, and so on. It is understood that any given administration might involve two or more injections on the same day. For administration, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, of the CD8.sup.+ T cells that are administered exhibit at least one property of a cytotoxic T cell.
[0201] In one illustrative embodiment, when the cells have been treated with a PTP1B inhibitor (such as a small molecule inhibitor, an inhibitor RNA or including an inhibitor in the form of CRISPR/Cas9 system for inhibiting PTP1B, a composition comprising the CD8+ T cells can be prepared and administered to the patient. In one embodiment, culture media that lacks any animal products, such as bovine serum, can be used to culture the CD8+ T cells. In another embodiment, tissue culture conditions typically used by the skilled artisan to avoid contamination with bacteria, fungi and mycoplasma can be used. In an exemplary embodiment, prior to being administered to a patient, the CD8+T (e.g. CAR-T cells) are pelleted, washed, and are resuspended in a pharmaceutically acceptable carrier or diluent. Exemplary compositions comprising CAR-expressing T lymphocytes (e.g., cytotoxic T lymphocytes) include compositions comprising the cells in sterile 290 mOsm saline, in infusible cryomedia (containing Plasma-Lyte A, dextrose, sodium chloride injection, human serum albumin and DMSO), in 0.9% NaCl with 2% human serum albumin, or in any other sterile 290 mOsm infusible materials. Alternatively, in another embodiment, depending on the identity of the culture medium, the CAR-T cells can be administered in the culture media as the composition, or concentrated and resuspended in the culture medium before administration. In various embodiments, the CAR-T cell composition, can be administered to the patient via any suitable means, such as parenteral administration, e.g., intradermally, subcutaneously, intramuscularly, intraperitoneally, intravenously, or intrathecally.
[0202] In further embodiments, the present application includes administration of a PTP1B inhibitor directly to an individual who is receiving or has received a treatment with CD8+ T cells. The CD8+ T cells may have been contacted with a PTP1B inhibitor prior to administration to an subject requiring treatment, according to any method described herein. Alternatively, the CD8+ T cells are administered to the subject, without receiving prior exposure or contact with a PTP1B inhibitor, and instead, the PTP1B inhibitor is administered directly to the subject.
[0203] The PTP1B inhibitor may be administered prior to, at the same time as, or after the subject receives treatment with the CD8+ T cells. Where the PTP1B inhibitor and CD8+ T cells are administered to the subject at the same time, they can be administered via the same route of administration (including in a single composition), or alternatively via different routes of administration. For example, the CD8+ T cells may be administered by injection into the blood stream of the subject, while the PTP1B inhibitor may be administered orally, or via another route of administration such as intramuscularly, intradermally, subcutaneously or intraperitoneally.
[0204] In a particularly preferred embodiment, the PTP1B inhibitor is directly administered to the subject following administration of CAR-T cells to the subject, for the purpose of enhancing the efficacy of the CAR-T treatment. The inhibitor can be subsequently administered once every two weeks, or once or twice weekly, or more, to facilitate CAR-T cell expansion and the formation of memory CAR-T cells.
[0205] In particularly preferred embodiments, the PTP1B inhibitor is trodusquemine, administered by injection, or a derivative (for example DPM-1001) administered orally before, during or after intravenous administration of CAR-T cells.
[0206] It will be clearly understood that, although this specification refers specifically to applications in humans, the invention is also useful for veterinary purposes. Thus in all aspects the invention is useful for domestic animals such as cattle, sheep, horses and poultry; for companion animals such as cats and dogs; and for zoo animals. Therefore, the general term subject or subject to be/being treated is understood to include all animals (such as humans, apes, dogs, cats, horses, and cows) that require an enhanced immune response, for example subjects having cancer.
[0207] As used herein, the term ex vivo or ex vivo therapy refers to a therapy where cells are obtained from a patient or a suitable alternate source, such as, a suitable allogenic donor, and are modified, such that the modified cells can be used to treat a disease which will be improved by the therapeutic benefit produced by the modified cells. Treatment includes the administration or re-introduction of the modified cells into the patient. A benefit of ex vivo therapy is the ability to provide the patient the benefit of the treatment, without exposing the patient to undesired collateral effects from the treatment.
[0208] The term administered means administration of a therapeutically effective dose of the aforementioned composition including the respective cells to an individual. By therapeutically effective amount is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art and described above, adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.
[0209] Subjects requiring treatment include those already having a benign, pre-cancerous, or non-metastatic tumour as well as those in which the occurrence or recurrence of cancer is to be prevented. Subjects may have metastatic cells, including metastatic cells present in the ascites fluid and/or lymph node.
[0210] The objective or outcome of treatment may be to reduce the number of cancer cells; reduce the primary tumour size; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumour metastasis; inhibit, to some extent, tumour growth; and/or relieve to some extent one or more of the symptoms associated with the disorder.
[0211] Efficacy of treatment can be measured by assessing the duration of survival, time to disease progression, the response rates (RR), duration of response, and/or quality of life.
[0212] The method is particularly useful for extending time to disease progression.
[0213] The method is particularly useful for extending survival of the human, including overall survival as well as progression free survival.
[0214] The method is particularly useful for providing a complete response to therapy whereby all signs of cancer in response to treatment have disappeared. This does not always mean the cancer has been cured.
[0215] The method is particularly useful for providing a partial response to therapy whereby there has been a decrease in the size of one or more tumours or lesions, or in the extent of cancer in the body, in response to treatment.
[0216] The objective or outcome of treatment may be any one or more of the following: [0217] to reduce the number of cancer cells; [0218] reduce the primary tumour size; [0219] inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; [0220] inhibit (i.e., slow to some extent and preferably stop) tumour metastasis; [0221] inhibit, to some extent, tumour growth; [0222] relieve to some extent one or more of the symptoms associated with the disorder.
[0223] In one embodiment, animals requiring treatment include those having a benign, pre-cancerous, non-metastatic tumour.
[0224] In one embodiment, the cancer is pre-cancerous or pre-neoplastic.
[0225] In one embodiment, the cancer is a secondary cancer or metastases. The secondary cancer may be located in any organ or tissue, and particularly those organs or tissues having relatively higher hemodynamic pressures, such as lung, liver, kidney, pancreas, bowel and brain. The secondary cancer may be detected in the ascites fluid and/or lymph nodes.
[0226] In one embodiment, the cancer may be substantially undetectable.
[0227] Pre-cancerous or pre-neoplasia generally refers to a condition or a growth that typically precedes or develops into a cancer. A pre-cancerous growth may have cells that are characterized by abnormal cell cycle regulation, proliferation, or differentiation, which can be determined by markers of cell cycle.
[0228] In one embodiment, the cancer is pre-cancerous or pre-neoplastic.
[0229] In one embodiment, the cancer is a secondary cancer or metastases. The secondary cancer may be located in any organ or tissue, and particularly those organs or tissues having relatively higher hemodynamic pressures, such as lung, liver, kidney, pancreas, bowel and brain.
[0230] In one embodiment, the cancer expresses the cell surface tumour antigen Her-2. An example of a cancer that expresses the cell surface tumour antigen Her-2 is a sarcoma.
[0231] Other examples of cancer include blastoma (including medulloblastoma and retinoblastoma), sarcoma (including liposarcoma and synovial cell sarcoma), neuroendocrine tumours (including carcinoid tumours, gastrinoma, and islet cell cancer), mesothelioma, schwannoma (including acoustic neuroma), meningioma, adenocarcinoma, melanoma, leukemia or lymphoid malignancies, lung cancer including small-cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung and squamous carcinoma of the lung, epidermoid lung cancer, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer (including metastatic breast cancer), colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, testicular cancer, esophagael cancer, tumours of the biliary tract, as well as head and neck cancer.
[0232] Pre-neoplastic, neoplastic and metastatic diseases are particular examples to which the methods of the invention may be applied. Broad examples include breast tumours, colorectal tumours, adenocarcinomas, mesothelioma, bladder tumours, prostate tumours, germ cell tumour, hepatoma/cholangio, carcinoma, neuroendocrine tumours, pituitary neoplasm, small round cell tumour, squamous cell cancer, melanoma, atypical fibroxanthoma, seminomas, nonseminomas, stromal leydig cell tumours, Sertoli cell tumours, skin tumours, kidney tumours, testicular tumours, brain tumours, ovarian tumours, stomach tumours, oral tumours, bladder tumours, bone tumours, cervical tumours, esophageal tumours, laryngeal tumours, liver tumours, lung tumours, vaginal tumours and Wilms' tumour.
[0233] Examples of particular cancers include but are not limited to adenocarcinoma, adenoma, adenofibroma, adenolymphoma, adontoma, AIDS related cancers, acoustic neuroma, acute lymphocytic leukemia, acute myeloid leukemia, adenocystic carcinoma, adrenocortical cancer, agnogenic myeloid metaplasia, alopecia, alveolar soft-part sarcoma, ameloblastoma, angiokeratoma, angiolymphoid hyperplasia with eosinophilia, angioma sclerosing, angiomatosis, apudoma, anal cancer, angiosarcoma, aplastic anaemia, astrocytoma, ataxia-telangiectasia, basal cell carcinoma (skin), bladder cancer, bone cancers, bowel cancer, brain stem glioma, brain and CNS tumours, breast cancer, branchioma, CNS tumours, carcinoid tumours, cervical cancer, childhood brain tumours, childhood cancer, childhood leukemia, childhood soft tissue sarcoma, chondrosarcoma, choriocarcinoma, chronic lymphocytic leukemia, chronic myeloid leukemia, colorectal cancers, cutaneous T-cell lymphoma, carcinoma (e.g. Walker, basal cell, basosquamous, Brown-Pearce, ductal, Ehrlich tumour, Krebs 2, Merkel cell, mucinous, non-small cell lung, oat cell, papillary, scirrhous, bronchiolar, bronchogenic, squamous cell, and transitional cell), carcinosarcoma, cervical dysplasia, cystosarcoma phyllodes, cementoma, chordoma, choristoma, chondrosarcoma, chondroblastoma, craniopharyngioma, cholangioma, cholesteatoma, cylindroma, cystadenocarcinoma, cystadenoma, dermatofibrosarcoma-protuberans, desmoplastic-small-round-cell-tumour, ductal carcinoma, dysgerminoam, endocrine cancers, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, extra-hepatic bile duct cancer, eye cancer, eye: melanoma, retinoblastoma, fallopian tube cancer, fanconi anaemia, fibroma, fibrosarcoma, gall bladder cancer, gastric cancer, gastrointestinal cancers, gastrointestinal-carcinoid-tumour, genitourinary cancers, germ cell tumours, gestationaltrophoblastic-disease, glioma, gynaecological cancers, giant cell tumours, ganglioneuroma, glioma, glomangioma, granulosa cell tumour, gynandroblastoma, haematological malignancies, hairy cell leukemia, head and neck cancer, hepatocellular cancer, hereditary breast cancer, histiocytosis, Hodgkin's disease, human papillomavirus, hydatidiform mole, hypercalcemia, hypopharynx cancer, hamartoma, hemangioendothelioma, hemangioma, hemangiopericytoma, hemangiosarcoma, hemangiosarcoma, histiocytic disorders, histiocytosis malignant, histiocytoma, hepatoma, hidradenoma, hondrosarcoma, immunoproliferative small, opoma, ontraocular melanoma, islet cell cancer, Kaposi's sarcoma, kidney cancer, langerhan's cell-histiocytosis, laryngeal cancer, leiomyosarcoma, leukemia, li-fraumeni syndrome, lip cancer, liposarcoma, liver cancer, lung cancer, lymphedema, lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, leiomyosarcoma, leukemia (e.g. B-cell, mixed cell, null-cell, T-cell, T-cell chronic, HTLV-II associated, lymphangiosarcoma, lymphocytic acute, lymphocytic chronic, mast-cell and myeloid), leukosarcoma, leydig cell tumour, leiomyoma, lymphangioma, lymphangiocytoma, lymphangioma, lymphangiomyoma, lymphangiosarcoma, male breast cancer, malignant-rhabdoid-tumour-of-kidney, medulloblastoma, melanoma, Merkel cell cancer, mesothelioma, metastatic cancer, mouth cancer, multiple endocrine neoplasia, mycosis fungoides, myelodysplastic syndromes, myeloma, myeloproliferative disorders, malignant carcinoid syndrome carcinoid heart disease, meningioma, melanoma, mesenchymoma, mesonephroma, myoblastoma, myoma, myosarcoma, myxoma, myxosarcoma, nasal cancer, nasopharyngeal cancer, nephroblastoma, neuroblastoma, neurofibromatosis, Nijmegen breakage syndrome, non-melanoma skin cancer, non-small-cell-lung-cancer-(nscic), neurilemmoma, neuroblastoma, neuroepithelioma, neurofibromatosis, neurofibroma, neuroma, neoplasms (e.g. bone, breast, digestive system, colorectal, liver), ocular cancers, oesophageal cancer, oral cavity cancer, oropharynx cancer, osteosarcoma, ostomy ovarian cancer, pancreas cancer, paranasal cancer, parathyroid cancer, parotid gland cancer, penile cancer, peripheral-neuroectodermal-tumours, pituitary cancer, polycythemia vera, prostate cancer, osteoma, osteosarcoma, ovarian carcinoma, papilloma, paraganglioma, paraganglioma nonchromaffin, pinealoma, plasmacytoma, protooncogene, rare-cancers-and-associated-disorders, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, Rothmund-Thomson syndrome, reticuloendotheliosis, rhabdomyoma, salivary gland cancer, sarcoma, schwannoma, Sezary syndrome, skin cancer, small cell lung cancer (scic), small intestine cancer, soft tissue sarcoma, spinal cord tumours, squamous-cell-carcinoma-(skin), stomach cancer, synovial sarcoma, sarcoma (e.g. Ewing's experimental, Kaposi's and mast-cell sarcomas), Sertoli cell tumour, synovioma, testicular cancer, thymus cancer, thyroid cancer, transitional-cell-cancer-(bladder), transitional-cell-cancer-(renal-pelvis-/-ureter), trophoblastic cancer, teratoma, theca cell tumour, thymoma, trophoblastic tumour, urethral cancer, urinary system cancer, uroplakins, uterine sarcoma, uterus cancer, vaginal cancer, vulva cancer, Waldenstrom's macroglobulinemia and Wilms' tumour.
[0234] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.
EXAMPLES
Example 1: Loss of Ptp1b Increases Overall Cellularity of T Cells without Affecting CD4/CD8 T Cells Development in Thymus
[0235] Ptpn1.sup.fl/fl mice have previously been described previously (Bence et al., 2006 Nature Medicine 12, 917-24). To delete PTP1B in T cells we crossed Ptp1b.sup.fl/fl mice Lck-Cre transgenic to generate Lck-Cre; Ptpn1.sup.fl/fl mice.
[0236] Lck-Cre; Ptpn1.sup.fl/fl mice (n=8) and wild-type counter parts (n=8) were sacrificed at age of 8 weeks old. Single cells from thymus and various lymphoid organs were isolated for FACS analysis.
[0237]
[0238] Meanwhile, increased cellularity was also discovered among various stages of development (p=0.002, p=0.001, p=0.053, p=0.001) (
[0239] Statistics was performed with Mann-Whitney test. Charts were representative from two independent experiments.
Example 2: Loss of Ptp1b Increases Cellularity of Various T Cell Subpopulations in Periphery
[0240] Lck-Cre; Ptpn1.sup.fl/fl mice (n=8) and wild-type counter parts (n=8) were sacrificed at age of 8 weeks. Single cells from thymus and various lymphoid organs were isolated as for Example 1.
[0241]
[0242] In addition, T cells was increased in spleen (p=0.003). CD4.sup.+CD25.sup.+ FoxP3.sup.+ regulatory T cells were increased in number in lymph nodes (p=0.0002), spleen (p=0.0019), and thymus (p=0.0281). (
[0243] Statistics was performed with Mann-Whitney test. Charts were representative from two independent experiments.
Example 3: Loss of Ptp1b Enhances TCR Signaling and Activation of T Cells
[0244] Lymphoid cells from Lck-Cre; Ptpn1.sup.fl/fl mice (n=5) and wild-type counter parts (n=5) were isolated and stimulated with anti-CD3 (1.25 ug/ml) and anti-CD28 (1.25 ug/ml) antibodies for 48 hours.
[0245] Activation markers CD25, CD44, and CD69 were all significantly up-regulated among Lck-Cre; Ptpn1.sup.fl/fl CD4.sup.+ or CD8.sup.+ T cells. CD62L was on the other way round significantly decreased.
[0246] When stimulated with anti-CD3 (1 g/ml) antibodies, phosphorylation of ERK was significantly enhanced in CD4.sup.+ T cells but not CD8.sup.+ T cells.
[0247] Statistics was performed with Mann-Whitney test for activation markers and with 2-way ANOVA analysis for phosphorylation. Charts were representative from two independent experiments.
Example 4: Loss of Ptp1b Enhances Cytokine Signaling in T Cells
[0248] Lymphoid cells from Lck-Cre; Ptpn1.sup.fl/fl mice (n=5) and wild-type counter parts (n=5) were isolated and stimulated with either IL-7 (
[0249] Phosphorylation of STAT5 was enhanced among overall CD4.sup.+ and CD8.sup.+ T cells or nave and central memory subpopulations. Statistics was performed with 2-way ANOVA analysis. Charts were representative from two independent experiments.
Example 5: Loss of Ptp1b Enhances Proliferation of T Cells
[0250] Lymphoid cells from Lck-Cre; Ptpn1.sup.fl/fl mice (n=5) and wild-type counter parts (n=5) were isolated and stimulated with various concentration of anti-CD3 and 1.25 g/ml anti-CD28 antibodies for 72 hours. The proliferating cell numbers were significantly increased in CD4.sup.+ T cells and CD8.sup.+ T cells in various strength of anti-CD3 stimulation (see
[0251] Statistics was performed with Mann-Whitney test. Charts were representative from two independent experiments.
Example 6: Loss of Ptp1b Enhances the Killing Capacity of Chimeric Antigen Receptor (CAR) T Cells
[0252] Splenic cells from Lck-Cre; Ptpn1.sup.fl/fl mice (n=5) and wild-type counter parts (n=5) were isolated and stimulated with 5 g/ml anti-CD3 and 5 g/ml anti-CD28 antibodies supplied with 5 ng/ml IL-2 and 0.2 ng/ml IL-7 on D0. Cells were then transduced twice with CAR-expressing vectors through retrovirus on D1 and D2. Transduced cells were then cultured with 5 ng/ml IL-2 and 0.2 ng/ml IL-7 in complete medium until D7 for the phenotype analysis and D10 for the killing assay.
[0253] CAR-T cells were co-cultured with target cells in different ratio for 4 hours before analysis. The Lck ptp1b CAR-T cells showed significantly better killing capacity in comparison to wild-type counter parts (
[0254] Loss of ptp1b leads to increased effector/effector memory subpopulations (
[0255] The activation markers CD25, Lag3, and PD-1 were significantly increased the Lck-Cre; Ptpn1.sup.fl/fl CAR-T cells. Meanwhile, functional markers granzyme B and interferon gamma were also increased. (
[0256] Statistics was performed with 2-way ANOVA analysis in killing assay and with Mann-Whitney test for the phenotypes. Charts were representative from two independent experiments.
Example 7: Loss of Ptp1b Augments CAR-T Mediated Tumor Suppression and CAR-T Longevity
[0257] CAR-T cells were manufactured as described above in Example 6.
[0258] 210.sup.5 Her-2 expressing E0771 cells were inoculated into mammary fat pad of Her-2 transgenic mice. CAR-T manufacturing was initiated simultaneously. 110.sup.7 CAR-T cells were adoptively transferred i.v. along with and followed by 500 IU IL-2 for three times (
[0259] Tumor growth was monitored (
[0260] Statistics was performed with 2-way ANOVA for the tumor growth and with Mann-Whitney t-test for the cell numbers of CAR-T cells.
Example 8: Loss of Ptp1b Maintained CAR-T Cells with Less Exhausted Phenotypes
[0261] CAR-T cells were isolated from lymph nodes and spleens 20 days after being adoptively transferred into tumor bearing mice as described in Example 7.
[0262] The expression level of the exhaustion markers PD-1 and Lag-3 was analyzed with flow cytometry.
[0263] PD-1 expression level was significantly lower in Lck-Cre; Ptpn1.sup.fl/fl effector\effector memory CAR-T cells in draining lymph nodes (
[0264] (
[0265] Statistics was performed with Mann-Whitney t-test.
Example 8: PTP1B Inhibition Represses Tumour Growth Via Action on T Cells
[0266] Breast cancer cells were transplanted into mammary fat pads of mice that were globally ptp1b-deficient (Ptpn1.sup./) or T-cell specific ptp1b-deficient (Lck-Cre; Ptpn1.sup.fl/fl). Tumour growth was monitored for 28 days after transplantation. Mice that were globally deficient in ptp1b or heterozygous for ptp1b demonstrated significant suppression of tumour growth in comparison with controls (ptp1b+/+). (
[0267] The results presented in
[0268] These results indicate that inhibition of PTP1B to elicit an anti-tumour effect can be accomplished either through direct inhibition of PTP1B in T cells prior to administration of the T cells to an individual, or alternatively by directly targeting PTP1B in T cells by direct administration of the inhibitor to the individual.