VIRAL DELIVERY OF RNA UTILIZING SELF-CLEAVING RIBOZYMES AND CRISPR-BASED APPLICATIONS THEREOF
20210207169 ยท 2021-07-08
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
C12N2760/18843
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N2760/10121
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to viral delivery of RNA utilizing self-cleaving ribozymes and applications of such, including but not limited to CRISPR-Cas related applications.
Claims
1. A viral particle comprising a nucleic acid comprising a genome sequence of a single-stranded RNA (ssRNA) virus or antigenome sequence that is complementary to the genome sequence, the antigenome sequence comprising a first region comprising (i) a target segment; and (ii) a first segment encoding a first self-cleaving ribozyme, wherein the target segment is adjacent to the first segment.
2. The viral particle of claim 1, wherein the first region further comprises (iii) a second segment encoding a second self-cleaving ribozyme, wherein the target segment is flanked by the first segment and the second segment.
3. The viral particle of claim 1, wherein the first self-cleaving ribozyme is a 3 self-cleaving ribozyme or a 5 self-cleaving ribozyme.
4. The viral particle of claim 3, wherein the first self-cleaving ribozyme comprises one of a hammerhead ribozyme and a hepatitis delta virus (HDV) ribozyme.
5. The viral particle of claim 1, wherein the antigenome sequence further comprises a second region comprising a third segment encoding a nuclease.
6. The viral particle of claim 5, wherein the second region further comprises a fourth segment encoding a reporter molecule.
7. The viral particle of claim 5, wherein the nuclease comprises Cas9 or Cpf1.
8. The viral particle of claim 1, wherein the target segment comprises guide RNA (gRNA), wherein the gRNA has a scaffold sequence and a targeting sequence.
9. The viral particle of claim 1, wherein the first self-cleaving ribozyme comprises a hammerhead ribozyme.
10. The viral particle of claim 1, further comprising a third region comprising a fifth segment, wherein the fifth segment comprises a mutant P gene.
11. The viral particle of claim 1, further comprising a fourth region comprising a fourth region comprising a sixth segment, wherein the sixth segment comprises a mutant L gene.
12. The viral particle of claim 1, wherein the viral particle is within the order mononegavirales.
13. The viral particle of claim 1, wherein the viral particle is within the family paramyxoviridae.
14. The viral particle of claim 1, wherein the viral particle is a Sendai virus (SeV) or a Newcastle disease virus (NDV).
15. The viral particle of claim 1, wherein the viral particle is a temperature sensitive mutant.
16. A method of introducing into a host cell a target RNA, comprising (i) contacting the viral particle of claim 1 with said host cell; and (ii) culturing the host cell under conditions allowing (a) producing a target RNA; and (b) liberating the target RNA, wherein the first self-cleaving ribozyme liberates the target RNA from the transcribed first region.
17. The method of claim 16, wherein the host cell is selected from the group consisting of an archaea cell, bacterial cell, and a eukaryotic cell.
18. The method of claim 17, wherein the host cell is a stem cell.
19. A method of introducing a site-specific modification to target DNA in a host cell comprising (i) contacting the viral particle of claim 1 with said host cell; (ii) culturing the host cell under conditions allowing (a) producing the gRNA flanked by the 5 self-cleaving ribozyme and the nuclease; (b) liberating the gRNA, wherein the 5 self-cleaving ribozyme liberates the gRNA; (c) expressing the nuclease; (d) forming a complex between the nuclease and the gRNA, wherein the scaffold sequence of the gRNA is bound to the nuclease; and (e) contacting the target DNA with the complex, wherein the targeting sequence of the gRNA binds to a sequence on the target DNA adjacent to a protospacer adjacent motif (PAM); and (iii) introducing the site-specific modification to the target DNA.
20. The method of claim 19, wherein the site-specific modification is one of an insertion, a deletion, a frameshift, and a point mutation.
21. The method of claim 19, wherein the DNA is genomic.
22. The method of claim 19, wherein the host cell is selected from the group consisting of an archaea cell, bacterial cell, and a eukaryotic cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION OF THE INVENTION
[0030] One embodiment of the present disclosure relates to novel nucleic acids, including but not limited to, RNA expression cassettes. The nucleic acids generally relate to genetically modified genomes or antigenomes complementary to the genomes of ssRNA viruses, e.g. the Sendai virus (SeV). The genome of mononegavirales, including but not limited to paramyxoviruses and SeV, is antisense RNA (i.e. having negative polarity). Thus, when the present specification refers to a nucleic acid comprising a genome sequence of a single-stranded RNA (ssRNA) virus, the genome sequence is understood as being antisense RNA. The antigenome sequence is therefore sense RNA. Accordingly, an RNA antigenome transcribed from the negative polarity genome of, e.g. Sendai virus, will contain sense RNA. mRNA transcribed from the genome of an ssRNA virus will likewise contain sense RNA that can be translated, or in the instance where the mRNA contains a target sequence adjacent to one or more self-cleaving ribozymes (e.g. flanked by self-cleaving ribozymes), the self-cleaving ribozymes will be able to liberate the target sequence. Because the antigenome of the present disclosure is oriented in the 5 to 3 direction, similar to the biologically active mRNA transcribed from the negative polarity genome, elements of the nucleic acids of the present disclosure are typically referred to by their antigenome components. However, the invention as described herein is explicitly not limited to just the antigenome components, as the genomic components, e.g. as contained within the viral particles of the present disclosure (discussed infra) represent novel nucleic acids that may be transcribed in vitro or in vivo into an antigenome or antigenomic elements thereof or transcribed into mRNA fragments which undertake a biologically active role.
[0031] The antigenome sequences of the present disclosure generally comprise a first region comprising (i) a target segment, and (ii) a first segment encoding a first self-cleaving ribozyme. The target segment is to be understood as being a payload, e.g. an RNA payload, that is capable of being liberated from mRNA transcribed from the genome by the one or more self-cleaving ribozymes adjacent to the target segment. This self-cleaving ribozyme may be either a 5 self-cleaving ribozyme or a 3 self-cleaving ribozyme. Preferred embodiments of the present disclosure utilize both a 5 self-cleaving ribozyme and a 3 self-cleaving ribozyme that flank the target segment to be delivered to the cell.
[0032] The self-cleaving ribozymes of the present disclosure can take a number of forms. The exemplary self-cleaving ribozymes are hammerhead ribozymes, as shown in
[0033] As an exemplary method of use of the novel nucleic acids, the target segments may comprise guide RNA (gRNA), and/or tracrRNA. In such embodiments, the nucleic acids may further (but not necessarily) comprise a second region. The second region of the genome may contain a nucleotide sequence that, when transcribed, produces mRNA that is capable of being translated to code for a nuclease, e.g. Cas9, including but not limited to Cas9 homologs, or Cpf1, although other nucleases may be suitable for incorporation into the present disclosure. An exemplary embodiment of this nucleic acid is shown at
[0034] Another aspect of the present disclosure relates to viral particles that comprise the foregoing nucleic acids discussed in the above section titled nucleic acids. As mentioned supra, the nucleic acids of the present disclosure relate to modified genomes and antigenomes of ssRNA viruses. Thus, this aspect of the disclosure relates to the modified ssRNA viruses. As previously discussed, any ssRNA virus where the RNA is negative polarity (i.e. antisense) is considered to be within the scope of this disclosure and thus suitable for use. Explicitly, the viruses of the order mononegavirales are considered to be within the scope of this disclosure. This is because viruses of the order mononegavirales have common attributes that lend them suitable to incorporate the nucleic acids of the present disclosure. Mononegavirales possess a linear, single-stranded, non-infectious RNA strand having negative polarity. Mononegavirales have characteristic gene order, produce 5-10 distinct mRNAs via polar sequential transcription, and replicate by synthesizing complete antigenomes.
[0035] Families within mononegavirales include bornaviridae, filoviridae, nyamiviridae, paramyxodiridae, and rhabdoviridae. Genera within bornaviridae include bornavirus. Genera within filoviridae include cuevavirus, ebolavirus, and marburgvirus. Genera within nyamiviridae include nyavirus. Genera within paramyxoviridae include aquaparamyxovirus, avulavirus, feravirus, heniparvirus, morbillivirus, respirovirus, rubulavirus, pneumovirus, and metapneumovirus. Genera within rhabdoviridae include alemndravirus, baiavirus, curiovirus, cytorhabdovirus, dichorhavirus, ephemerovirus, hapavirus, ledantevirus, lyssavirus, novirhabdovirus, nuclearhabdovirus, perhabdovirus, sawgravirus, sigmavirus, sprivivirus, tibrovirus, tupavirus, and vesiculovirus. While one of ordinary skill in the art will readily realize that not all of these candidates may be as suitable for incorporation into certain embodiments of the present disclosure as paramyxoviridae, including but not limited to Newcastle disease virus (NDV) and the Sendai virus, each of these viruses possess the necessary features from a compositional standpoint to incorporate the nucleic acids of the present disclosure.
[0036] Viral particles of the present disclosure may be generated by routines known to those of ordinary skill in the art. For example, the viral particles of the present disclosure may be generated from packaging cells that are transfected with vectors, e.g. one or more plasmids of the present disclosure, that contain DNA encoding a nucleic acid of the present disclosure, e.g. a viral genome or antigenome of the present disclosure. This allows for scalable production of the viral particles, especially in instances where the viral particles are attenuated, e.g. not replication-competent. Expression of the vectors is induced in the packaging cells and the viruses assemble for harvesting. This process is exemplified in Example 1, where E. coli cells were transfected with plasmid containing elements of the rSev-Cas9 recombinant genome/antigenome. Other packaging cells are known to one of ordinary skill in the art and may include, but are explicitly not limited to, HEK293 cells and PA317 cells.
[0037] Of the ssRNA viruses suitable for the present disclosure, the Sendai virus (SeV) is of particular interest, and is an exemplary virus used throughout Example 1 infra. The present disclosure has surprisingly shown that certain ssRNA viruses, e.g. paramyxoviruses, exemplified by the Sendai virus, can tolerate self-cleaving ribozymes within the genome. While not wishing to be bound by theory, as discussed supra, this is likely due to co-transcriptional encapsidation of the genomic and antigenomic RNA by the nucleoprotein and thus prevention of ribozyme activity during replication of the full-length RNA. Along with further incorporation of Cas9 expression, the rescued replication-competent virus was able to efficiently induce mutagenesis of the guide RNA target sequence in the genome. For example, although the efficiency of the ccr5-targeting virus is not directly comparable to other studies due to the differing guide RNA sequences and target cells used, rates of ccr5 mutagenesis (75-88%) was achieved similar to or higher than those achieved via lentivirus or AAV CRISPR/Cas9 transduction. Further, because infection with Sendai virus was highly efficient, achieving these high rates of mutagenesis did not require sorting or selection for infected cells, another distinct advantage.
[0038] In addition to the advantages of broad tropism, growth to high titers, and robust expression of foreign genes previously mentioned, ssRNA viruses, e.g. Sendai virus, have additional important advantages as a gene therapy vector. First, such viruses are amenable to envelope switching or modification, in which envelope proteins with different cell type specificities can be substituted for the original, or the original attachment or fusion protein itself can be modified to have a different specificity. Second, Sendai virus, like other paramyxoviruses, has a polar transcriptional gradient (
[0039] Although the disclosure is strictly not limited to Sendai virus (SeV), the Sendai virus has several characteristics that render it surprisingly effective. The Sendai virus has been extensively studied and modified to develop temperature-sensitive, non-cytopathic, and replication-incompetent Sendai viruses that are useful for ex vivo and in vivo gene therapy applications. Mutations and variants of Sendai virus have been characterized that allow replication of Sendai virus at a permissive temperature until a temporary shift to a non-permissive temperature, after which replication is blocked and can no longer be detected. Such control of Sendai viral replication with temperature sensitivity can allow for temporal control of Cas9 and guide RNA expression, which would reduce off-target effects by removing the vector once editing is complete, again speaking to the particular utility of the Sendai virus. Mutations that further confer the ability to avoid triggering innate immune responses and concomitant cytopathogenicity would avoid disturbing sensitive cell types such as hematopoietic stem cells or other primary cells. Finally, the Sendai virus is amenable to single and multiple deletions of the envelope and/or matrix genes such that the virus can only replicate when these viral factors are supplied in trans. Upon infection of target cells in the absence of these exogenously supplied factors, the virus can produce the factors encoded on its genome but cannot amplify via production of subsequent infectious virus.
[0040] Example 2 infra illustrates preferred embodiments of the recombinant Sendai viral vectors, having mutant P and L genes, designated as PL mutants. The PL mutants are temperature sensitive, efficiently transfecting at 34 C. but not at 37 C. More surprisingly, however, is that the PL mutants do not induce a host interferon (IFN) response, i.e. do not stimulate production of IFN in a host when infected with the PL mutant vectors. The IFN-silent phenotype is particularly important when applying the viral vectors to sensitive cells like CD34+ hematopoietic stem cells where induction of IFN can drive differentiation and compromise sternness. Accordingly PL mutants, particularly PL mutants of the Sendai virus, represent a surprisingly effective vehicle for RNA transfection in a host cell, e.g. stem cell.
[0041] The viral particles of the present disclosure may be utilized to introduce an RNA payload into a target cell, e.g. a gRNA payload in the case of CRISPR-related applications. Generally, the a host cell is infected with a viral particle of the present disclosure and the host cell is cultured under conditions that allow for the liberation of the target RNA. Cell culturing techniques are known to one of ordinary skill in the art. As detailed supra, transcription of the viral genome or a portion of the viral genome, e.g. transcription of an RNA expression cassette inserted into the viral genome, into mRNA allows for the one or more self-cleaving ribozyme(s) to cleave themselves out of the transcribed mRNA and the target RNA along with it. In such embodiments, there need be only one self-cleaving ribozyme present, e.g. 5 self-cleaving ribozyme or a 3 self-cleaving ribozyme. The self-cleaving ribozyme must be adjacent to or flank the target RNA payload so that it is capable of liberating the payload upon transcription of the viral genome into mRNA.
[0042] The target RNA may be, e.g., microRNA (miRNA), gRNA, or any other RNA. The RNA payload does not have to have any particular therapeutic use, but one of ordinary skill in the art can envision many such uses. For example, the target RNA may be involved in RNA silencing. The RNA may be utilized to regulate gene expression, e.g. post-transcriptionally. Some non-limiting examples of a target RNA include siRNA and miRNA, which may or may not have specific therapeutic uses. siRNA may be utilized for RNA interference (RNAi) to promote gene silencing. miRNAs are used for similar therapeutic end means, and may represent a particularly useful therapeutic non-CRISPR related application of the present disclosure. miRNAs are currently being utilized to treat many distinct types of diseases, from autoimmune disease to neurodegenerative disorders to cancer. miRNAs are typically endogenous 17-24 base-long single-stranded, non-coding RNAs that regulate gene expression in a sequence-specific manner in plants and animals. Endogenously, miRNAs are derived from longer RNA transcripts by Drosha and Dicer. The resultant miRNAs bind to their target sequence, typically within the 3 untranslated region (UTR) of mRNA, thus leading to repression of translation. The present disclosure provides an alternative delivery mechanism for miRNA by simply cleaving the miRNA from the transcribed antigenome, e.g. by flanking self-cleaving ribozyme(s). One of ordinary skill in the art will appreciate that the class of miRNAs which can be delivered in this manner are vast, and are not considered to be limited according to the therapeutic use of such, rather they are to be considered within the scope of delivering a target RNA to a cell according to the present disclosure.
[0043] An exemplary use of the nucleic acids/viral particles of the present disclosure relates to gene editing via CRISPR-related technology. CRISPR stands for clustered regularly interspaced short palindromic repeats type II system. CRISPR is a bacterial immune system that is modified for genetic engineering purposes. Prior to CRISPR the most common genomic engineering approaches utilized zinc finger nucleases. CRISPR relies on two components, a guide RNA (gRNA) and a non-specific CRISPR-associated endonuclease, e.g. Cas9. The gRNA is a synthetic RNA having a scaffold sequence and a target sequence. The scaffold sequence is necessary for binding to the nuclease, e.g., Cas9. The targeting sequence, often approximately (although explicitly not necessarily) 20 nucleotides in length, defines the genomic target to be modified. Thus, one of ordinary skill in the art can change the genomic target by simply changing the targeting sequence present in the gRNA. The genomic target can be any 20 nucleotide DNA sequence, provided it meets two conditions: 1) the sequence is unique compared to the rest of the organism's genome and 2) the target is present immediately upstream of a Protospacer Adjacent Motif (PAM). The PAM sequence is dependent upon the exact species from which the nuclease was originally derived from. For example, the PAM for Cas9 derived from S. pyogenes is 5-XGG-3, wherein X is any nucleobase, whereas the PAM for Cfp1 is 5-TTX-3. One of ordinary skill in the art will be familiar with different nucleases, e.g. Cas9 and related proteins, and their corresponding PAMs.
[0044] Cas9 was originally isolated from S. pyogenes, and while that remains an exemplary nuclease in the disclosure, there are many different nucleases, including Cas9 variants, which are suitable for use in this aspect of the disclosure. For example, there are synthetic Cas9 proteins that have artificial PAM recognition sequences, e.g. as described in Kleinstiver B P et al., Nature, 2015 Jun. 23; 523(7561):481-5, hereby incorporated by reference in its entirety. There are Cas9 homologs derived from organisms other than S. pyogenes, for example, Cas9 from S. aureus (SaCas9). SaCas9 is approximately 1 kilobase smaller in size than Cas9 from S. pyogenes, which may render it more suitable for incorporation into the viral particles of the present disclosure due to the limited genome size of some viral particles, although this is not an issue for Sendai virus as illustrated in Example 1 infra. One of ordinary skill in the art will appreciate that Cas9 derived from other organisms are only compatible with tracrRNA and crRNA or synthetic gRNA derived from the same host species. Furthermore, there are alternatives to Cas9 derived from S. pyogenes, synthetic Cas9, or Cas9 homologs. One such alternative is Cpf1, described in Zetsche B et al., Cell. 2015 Oct. 22; 163(3):759-71 and Kleinstiver B. P. et al., Nature Methods 2016 Aug. 30; 714(13), both references incorporated by reference in their entireties. Cpf1 has a PAM of 5-TTX-3, wherein X is any nucleobase, and is located immediately upstream of the target DNA, instead of the target DNA being immediately upstream of the PAM in the case of Cas9. Furthermore, Cpf1 cleavage results in a 5 nucleotide 5 overhang 18 base pairs from the PAM sequence, whereas Cas9 cutting results in blunt DNA ends 3 base pairs distal to the PAM sequence. Additionally, Cpf1 only requires CRISPR RNA (crRNA) for successful targeting whereas Cas9 requires both crRNA and transactivating crRNA (tracrRNA). Further CRISPR proteins may include C2c1, C2c2, and C2c3 proteins, disclosed in, for example, Shmakov et al., Molecular Cell 2015 Oct. 22; 60(3): 385-397, hereby incorporated by reference in its entirety.
[0045] CRISPR-Cas gene editing systems have recently been reclassified into two primary classes spanning five types and sixteen subtypes, reviewed in Makarova, K., et al., Nature Reviews Microbiology 13:1-15 (2015), hereby incorporated by reference in its entirety. Classification was based upon identifying all cas genes in a CRISPR-Cas locus and subsequently determining key genes in each locus. This lead to a conclusion that currently known CRISPR-Cas systems can classified as either Class 1 or Class 2 depending on the genes encoding the proteins involved in the interference stage. A recent sixth CRISPR-Cas system has been identified, described in Abudayyeh O., et al. Science 2016, hereby incorporated by reference in its entirety.
[0046] Class 1 systems generally comprise a multi-subunit crRNA-effector complex, whereas Class 2 systems generally comprise a single protein, such as Cas9, Cpf1, C2c1, C2c2, C2c3, or a crRNA-effector complex. Class 1 systems comprise Type I, Type III and Type IV systems. Class 2 systems comprise Type II and Type V systems. Class 1 CRISPR-Cas systems are characterized by effector modules consisting of multiple subunits. Class 1 systems comprise about 90% of all CRISPR-Cas loci identified in bacteria and archaea and can target both DNA and RNA, as described in Makarova et al., Cell (2017) 168(5), hereby incorporated by reference in its entirety.
[0047] Type I systems are characterized by a Cas3 protein that has helicase activity and cleavage activity. Type I systems are further divided into seven specific sub-types (I-A, I-B, I-C, I-D, I-E, I-F, and I-U). Each Type I subtype has a defined combination of signature genes and distinct operon organization. Type I systems additionally have a multiprotein crRNA-effector complex that is involved in the processing and interference stages of the CRISPR-Cas immune system, known as CRISPR-associated complex for antiviral defense (Cascade). Sub-type I-A comprises a csa5 gene which encodes a small subunit protein, a cas8 gene that encodes degraded large and small subunits, and a split cas3 gene. Archaeoglobus fulgidus is an exemplary organism with a sub-type I-A CRISPR-Cas system. Sub-type I-B has a set cas1-cas2-cas3-cas4-cas5-cas6-cas7-cas8 gene arrangement while lacking a csa5 gene. Clostridium kluyveri is an exemplary organism with a sub-type I-B CRISPR-Cas system. Sub-type I-C lacks a cash gene. Bacillus halodurans is an exemplary organism with a sub-type I-C CRISPR-Cas system. Sub-type I-D has a cas10d gene instead of a cas8 gene. Cyanothece spp. is an exemplary organism with a sub-type I-D CRISPR-Cas system. Sub-type I-E lacks a cas4 gene. Escherichia coli is an exemplary organism with a sub-type I-E CRISPR-Cas system. Sub-type I-F lacks a cas4 gene and has a cas2 fused to a cas3. Yersinia pseudotuberculosis is an exemplary organism with a sub-type I-F CRISPR-Cas system. Geobacter sulfurreducens is an exemplary organism with a sub-type I-U CRISPR-Cas system.
[0048] All type III CRISPR-Cas systems have a cas10 gene, which encodes a multidomain protein containing a Palm domain, which is a variant of the RNA recognition motif (RRM), that is homologous to the core domain of numerous nucleic acid polymerases and cyclases and that is the largest subunit of type III crRNA-effector complexes. Type III loci encode the small subunit protein, one Cas5 protein and typically several Cas7 proteins. Type III are further divided into four sub-types, (III-A, III-B, III-C, and III-D). Sub-type III-A has a csm2 gene encoding a small subunit and also has cas1, cas2 and cas6 genes. Staphylococcus epidermidis is an exemplary organism with a sub-type III-A CRISPR-Cas system. Sub-type III-B has a cmr5 gene encoding a small subunit, lacking cas1, cas2 and cas6 genes. Pyrococcus furiosus is an exemplary organism with a sub-type III-B CRISPR-Cas system. Sub-type III-C has a Cas10 protein, but with an inactive cyclase-like domain, further lacking a cast and cas2 gene. Methanothermobacter thermautotrophicus is an exemplary organism with a sub-type III-C CRISPR-Cas system. Sub-type III-D has a Cas10 protein that lacks the HD domain, further lacking a cas1 and cas2 gene, but having a cas5-like gene known as csx10. Roseiflexus spp. is an exemplary organism with a sub-type III-D CRISPR-Cas system.
[0049] Type IV CRISPR-Cas systems encode a minimal multisubunit crRNA-effector complex comprising a partially degraded large subunit, Csf1, Cas5, Cas7, and in some cases, a putative small subunit. Type IV systems lack cast and cas2 genes. Type IV systems do not have sub-types, however there are two Type IV system variants. One Type IV variant has a DinG family helicase while the other does not, but the other has a gene encoding a small -helical protein. Acidithiobacillus ferrooxidans is an exemplary organism with a Type IV CRISPR-Cas system.
[0050] Type II CRISPR-Cas systems have cas1, cas2 and cas9 genes. The cas9 gene encodes the Cas9 protein, a multidomain protein that combines the functions of the crRNA-effector complex with target DNA cleavage. Type II systems also encode a tracrRNA. Type II systems are further divided into three sub-types, sub-types II-A, II-B and II-C. Sub-type II-A comprises the additional gene, csn2. Streptococcus thermophiles is an exemplary organism with a sub-type II-A CRISPR-Cas system. Sub-type II-B lacks the csn2 gene, but has the cas4 gene. Legionella pneumophilai is an exemplary organism with a sub-type II-B CRISPR-Cas system. Sub-type II-C is the most common Type II system has only three proteins, Cas1, Cas2 and Cas9. Neisseria lactamica is an exemplary organism with a sub-type II-C CRISPR-Cas system
[0051] Type V systems have a cpf1 gene and cas1 and cast genes. The cpf1 gene encodes a protein, Cpf1, that has a RuvC-like nuclease domain that is homologous to the respective domain of Cas9, but lacks the HNH nuclease domain that is present in Cas9 proteins. Type V systems have been identified in several bacteria, including Parcubacteria bacterium GWC2011_GWC2_44_17 (PbCpf1), Lachnospiraceae bacterium MC2017 (Lb3 Cpf1), Butyrivibrio proteoclasticus (BpCpf1), Peregrinibacteria bacterium GW2011 GWA 33_10 (PeCpf1), Acidaminococcus spp. BV3L6 (AsCpf1), Porphyromonas macacae (PmCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), Porphyromonas crevioricanis (PcCpf1), Prevotella disiens (PdCpf1), Moraxella bovoculi 237(MbCpf1), Smithella spp. SC_KO8D17 (SsCpf1), Leptospira inadai (L1Cpf1), Lachnospiraceae bacterium MA2020 (Lb2Cpf1), Franciscella novicida U112 (FnCpf1), Candidatus methanoplasma termitum (CMtCpf1), and Eubacterium eligens (EeCpf1). It has also been demonstrated that Cpf1 also has RNase activity and it is responsible for pre-crRNA processing, as disclosed in Fonfara, I et al., Nature 28; 532(7600):517-21 (2016), hereby incorporated by reference in its entirety.
[0052] In Class 1 systems, the expression and interference stages involve multisubunit CRISPR RNA (crRNA)-effector complexes. In contrast, in Class 2 systems, the expression and interference stages involve a single large protein, e.g., Cas9, Cpf1, C2c1, C2c1, or C2c3, each of which is explicitly considered within the scope of this invention.
[0053] In Class 1 systems, the expression and interference stages involve multisubunit CRISPR RNA (crRNA)-effector complexes. In contrast, in Class 2 systems, the expression and interference stages involve a single large protein, e.g., Cas9, Cpf1, C2c1, C2c1, or C2c3.
[0054] In Class 1 systems, pre-crRNA is bound to the multisubunit crRNA-effector complex and processed into a mature crRNA. In Type I and III systems this involves an RNA endonuclease, for example, Cash. In Class 2 Type II systems, pre-crRNA is bound to Cas9 and processed into a mature crRNA in a step that involves RNase III and a tracrRNA. However, in at least one described Type II CRISPR-Cas system, crRNAs with mature 5-ends are directly transcribed from internal promoters where crRNA processing does not occur.
[0055] In Class 1 systems, the crRNA is associated with the crRNA-effector complex and achieves interference by combining nuclease activity with RNA-binding domains and base pair formation between the crRNA and a target nucleic acid.
[0056] In Type I systems, the crRNA and target binding of the crRNA-effector complex involves Cas7, Cas5, and Cas8 fused to a small subunit protein. The target nucleic acid cleavage of Type I systems involves the HD nuclease domain, which is either fused to the superfamily 2 helicase Cas3 or is encoded by a separate gene, cas3.
[0057] In Type III systems, the crRNA and target binding of the crRNA-effector complex involves Cas7, Cas5, Cas10 and a small subunit protein. The target nucleic acid cleavage of Type III systems involves the combined action of the Cas7 and Cas10 proteins, with a distinct HD nuclease domain fused to Cas10, which, while not wishing to be bound by theory, is thought to cleave single-strand DNA during interference.
[0058] In Class 2 systems, the crRNA is associated with a single protein and achieves interference by combining nuclease activity with RNA-binding domains and base pair formation between the crRNA and a target nucleic acid.
[0059] In Type II systems, the crRNA and target binding involves Cas9 as does the target nucleic acid cleavage. In Type II systems, the RuvC-like nuclease (RNase H fold) domain and the HNH (McrA-like) nuclease domain of Cas9 each cleave one of the strands of the target nucleic acid. The Cas9 cleavage activity of Type II systems also requires hybridization of crRNA to tracrRNA to form a duplex that facilitates the crRNA and target binding by the Cas9.
[0060] In Type V systems, the crRNA and target binding involves Cpf1 as does the target nucleic acid cleavage. In Type V systems, the RuvC-like nuclease domain of Cpf1 cleaves one strand of the target nucleic acid and a putative nuclease domain cleaves the other strand of the target nucleic acid in a staggered configuration, producing 5 overhangs, which is in contrast to the blunt ends generated by Cas9 cleavage. While not wishing to be bound by theory, these 5 overhangs may facilitate insertion of DNA through non-homologous end-joining methods.
[0061] As discussed herein, the Cpf1 cleavage activity of Type V systems also does not require hybridization of crRNA to tracrRNA to form a duplex, rather the crRNA of Type V systems use a single crRNA that has a stem loop structure forming an internal duplex. Cpf1 binds the crRNA in a sequence and structure specific manner, that recognizes the stem loop and sequences adjacent to the stem loop, most notably, the nucleotide 5 of the spacer sequences that hybridizes to the target nucleic acid. This stem loop structure is typically in the range of 15 to 19 nucleotides in length. Substitutions that disrupt this stem loop duplex abolish cleavage activity, whereas other substitutions that do not disrupt the stem loop duplex do not abolish cleavage activity. In Type V systems, the crRNA forms a stem loop structure at the 5 end and the sequence at the 3 end is complementary to a sequence in a target nucleic acid.
[0062] Other proteins associated with Type V crRNA and target binding and cleavage include Class 2 candidate 1 (C2c1) and Class 2 candidate 3 (C2c3). C2c1 and C2c3 proteins are similar in length to Cas9 and Cpf1 proteins, ranging from approximately 1,100 amino acids to approximately 1,500 amino acids. C2c1 and C2c3 proteins also contain RuvC-like nuclease domains and have an architecture similar to Cpf1. C2c1 proteins are similar to Cas9 proteins in requiring a crRNA and a tracrRNA for target binding and cleavage, but have an optimal cleavage temperature of 50 C. C2c1 proteins target an AT-rich PAM, which similar to Cpf1, is 5 of the target sequence. In contrast, Class 2 candidate 2 (C2c2) does not share sequence similarity to other CRISPR effector proteins, and was recently identified as a Type VI system. C2c2 proteins have two HEPN domains and demonstrate ssRNA-cleavage activity. C2c2 proteins are similar to Cpf1 proteins in requiring a crRNA for target binding and cleavage, while not requiring tracrRNA. Also like Cpf1, the crRNA for C2c2 proteins forms a stable hairpin, or stem loop structure, that aid in association with the C2c2 protein.
[0063] Specifically regarding Class 2 Type II CRISPR Cas systems, a large number of Cas9 orthologs are known in the art as well as their associated polynucleotide components (tracrRNA and crRNA) (see, e.g., Fonfara, I., et al., Nucleic Acids Research 42.4 (2014): 2577-2590, and Chylinski K., et al., Nucleic Acids Research, 2014; 42(10):6091-6105, both references hereby incorporated by reference in their entireties. Cas9-like synthetic proteins are known in the art (see, e.g., U.S. 2014/0315985 and U.S. 2016/0362667, both references hereby incorporated by reference in their entireties). Aspects of the present disclosure can be practiced by one of ordinary skill in the art following the guidance of the specification to use Type II CRISPR Cas proteins and Cas-protein encoding polynucleotides, including, but not limited to Cas9, Cas9-like, proteins encoded by Cas9 orthologs, Cas9-like synthetic proteins, and variants and modifications thereof. Cognate RNA components of these Cas proteins can be manipulated and modified for use in the practice of the present disclosure.
[0064] In CRISPR-Cas related embodiments, the target sequence comprises a gRNA sequence. The target sequence may also further comprise transactivating crRNA (tracrRNA), and may comprise other elements. Furthermore, in such CRISPR-related embodiments, the viral genome and antigenome contains a second region that includes a sequence encoding a nuclease, e.g. Cas9. The second region may or may not contain a sequence encoding a reporter molecule or any other additional sequences. As detailed supra, the second region, like the first region, may be subcloned practically anywhere in the viral genome. However, in the case of paramyxoviruses, e.g. the Sendai virus, one of ordinary skill in the art will take into consideration the relative rates of transcription.
[0065] One of ordinary skill in the art will be generally familiar with how to introduce an alternation to target DNA after a double-stranded break has been introduced, however for exemplary purposes, the most common pathways utilized are the non-homologous end joining (NHEJ) DNA repair pathway and the homology directed repair (HDR) pathway. These pathways allow for introduction of alterations, most commonly insertions or deletions (indels) but these alterations may include deletions, additions, substitutions, frameshift mutations, or point insertions. One potential advantage of the NHEJ pathway over the HDR pathway is that, unlike HDR, the NHEJ pathway is active throughout the cell cycle and has a higher capacity for repair, as there is no requirement for a repair template. Furthermore, NHEJ also repairs most types of breaks within minutes, which is significantly faster than HDR. However, HDR is the more accurate mechanisms of the two due to the requirement of higher sequence homology between the damaged and intact donor strands of DNA. HDR can be error-free if the DNA template used for repair is identical to the original DNA sequence at the location of the break. Thus, HDR can introduce very specific mutations into the damaged DNA. The HDR pathway generally follows the following steps. First, the 5-ended DNA strand is resected at the break to create a 3 overhang. This serves as a substrate for proteins required for strand invasion and a further as a primer for DNA repair synthesis. The invasive strand then displaces a strand of the homologous DNA duplex and pair with another. This results in the formation of hybrid DNA referred to as the displacement loop (D loop). The recombination intermediates are then resolved to complete the DNA repair process. In contrast, the NHEJ pathway generally follows the following steps. First, after a double-stranded break has been introduced, the broken ends are recognized by a heterodimer, e.g. a Ku70/Ku80 heterodimer. The heterodimer will act as a scaffold for recruitment of a kinase, e.g. DNA-PKcs and a ligase, as well as some accessory factors, e.g. PAXX, XLF. This forms a paired end complex, which then ligates the compatible DNA ends together. NHEJ utilizes a number of polymerases, e.g. Pol and Polk, nucleases as well as structure specific enzymes, e.g. Tdp2 and Aprataxin. The processing of DNA ends is where mutations are introduced in the NHEJ pathway.
[0066] Another aspect of the present disclosure relates to vectors, aside from the viral particles of the present disclosure that comprise the nucleic acids of the present disclosure. The vectors may be DNA or RNA vectors. In an exemplary embodiment, the vectors comprise plasmids that contain DNA encoding both the genome and the antigenome. The plasmids may be induced to generate the viral particles. The vector may include appropriate sequences for amplifying expression. In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell cultures, or such as tetracycline or ampicillin resistance in E. coli.
[0067] Some embodiments of the present disclosure are directed to cells transformed with the plasmids. Any of the procedures known in the art for introducing foreign nucleotide sequences into host cells may be used. Examples include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell.
[0068] Another aspect of the present disclosure relates to kits comprising the vectors of the present disclosure. The kits may further include reagents. In an exemplary embodiment, the reagents include T7 RNA polymerase. The kits may contain controls. The kits may contain instructions or directions for use. The kit may be comprised of one or more containers and may also include collection equipment, for example, bottles, bags (such as intravenous fluids bags), vials, syringes, and test tubes. Other components may include needles, diluents and buffers. Usefully, the kit may include at least one container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. Optionally, the kits of the disclosure further include software to expedite the generation, analysis and/or storage of data, and to facilitate access to databases. The software includes logical instructions, instructions sets, or suitable computer programs that can be used in the collection, storage and/or analysis of the data. Comparative and relational analysis of the data is possible using the software provided.
[0069] The terms conservative sequence modifications or conservative substitutions as used herein may refer to nucleotide substitutions that do not significantly affect or alter the activity or characteristics of the self-cleaving ribozymes of the present disclosure.
[0070] The term CRISPR as used herein may refer to clustered regularly interspaced short palindromic repeat, which in the scope of the present disclosure is understood to be utilized in conjunction with a nuclease such as Cas9 to edit a target DNA sequence, e.g. CRISPR/Cas9 system. The term Cas as used herein may refer to CRISPR associated protein, and includes but is not limited to the nuclease Cas9 and Cas9 proteins. Cas9 or Cas9 protein as used herein includes Cas9 wild-type protein derived from CRISPR-Cas9 systems, modifications of Cas9 proteins, analogs of Cas9 proteins, variants of Cas9 proteins, proteins expressed by cas9 orthologs, and combinations thereof. Other Cas proteins are known in the art and are considered to be within the scope of this disclosure, including Cas9-like synthetic proteins, Cpf1 proteins (including wild-type Cpf1), Cpf1-like synthetic proteins, C2c1 proteins, C2c2 proteins, C2c3 proteins, and variants and modifications thereof Cpf1 or Cpf1 proteins as used herein includes Cpf1 wild-type protein derived from CRISPR-Cpf1 systems, modifications of Cpf1 proteins, variants of Cpf1 proteins, Cpf1 analogs, proteins expressed by cpf1 orthologs, and combinations thereof.
[0071] As used herein, the term guide RNA or gRNA may refer to an RNA molecule that can bind to a nuclease and guide the nuclease to a specific location within a target DNA. A guide RNA can comprise two segments: a targeting sequence and a scaffold sequence. Targeting sequence as used herein may refer to a nucleotide sequence that is complementary to, or at least can hybridize to under stringent conditions, a target DNA sequence. The protein-binding segment binds to nuclease, e.g. Cas9, Cpf1, or a related CRISPR associated protein (Cas) disclosed herein. The targeting sequence and the scaffold sequence can be located in the same RNA molecule or in two or more separate RNA molecules.
[0072] The term heterologous as used herein may refer to biological elements that are from different sources, e.g. foreign DNA or RNA introduced into an organism. For example, in the present disclosure, a nuclease may be from a first source, e.g. Cas9 from S. pyogenes bacterium. Or, a target sequence, e.g., gRNA may be from a second organism or may be synthetic. One of ordinary skill in the art will appreciate that introduction of foreign genetic material into an organism, e.g. introduction of an expression cassette, may introduce many heterologous elements to the organism.
[0073] The term homology as used herein may refer to the existence of shared structure between two compositions. The term homology in the context of proteins may refer to the amount (e.g. expressed in a percentage) of overlap between two or more amino acid and/or peptide sequences. In the context of nucleic acids, the term may refer to the amount (e.g. expressed in a percentage) of overlap between two or more nucleic acid sequences. As used herein, the percent (%) homology between two sequences is equivalent to the percent identity between the two sequences. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology=# of identical positions/total # of positions100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. Such homology is well-represented in the art via local alignment tools and/or algorithms, and may include pairwise alignment, multiple sequence alignment methods, structural alignment methods, and/or phylogenetic analysis methods.
[0074] As used herein, the term expression refers to transcription of a polynucleotide from a DNA template, resulting in, for example, an mRNA or other RNA transcript (e.g., non-coding, such as structural or scaffolding RNAs). The term further refers to the process through which transcribed mRNA is translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be referred to collectively as gene products. Expression may include splicing the mRNA in a eukaryotic cell, if the polynucleotide is derived from genomic DNA.
[0075] The terms polynucleotide, nucleotide sequence or nucleic acid as used herein may refer to a polymer composed of a multiplicity of nucleotide units (ribonucleotide or deoxyribonucleotide or related structural variants) linked via phosphodiester bonds, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA. Examples of a nucleic acid include and are not limited to mRNA, miRNA, tRNA, rRNA, snRNA, siRNA, dsRNA, cDNA and DNA/RNA hybrids. Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil (U), adenine (A), thymine (T), cytosine (C), guanine (G), and their derivative compounds. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.
[0076] The term ribozyme as used herein refers to RNA molecules that are capable of catalyzing specific biochemical reactions. The activity of a ribozyme is similar to that of a protein enzyme, the chief difference being the composition of the two. The term self-cleaving ribozyme as used herein refers to a RNA molecule motif that catalyzes cleavage and related reactions at a specific site within an RNA polymer. Examples of self-cleaving ribozymes include but are not limited to hammerhead ribozymes, hepatitis delta virus (HDV) ribozymes, twister ribozymes, twister sister ribozymes, pistol ribozymes, hairpin irobzymes, and hatchet ribozymes.
[0077] The term treating or treatment of a disease refers to executing a protocol, which may include administering one or more drugs to a patient (human or otherwise), in an effort to alleviate signs or symptoms of the disease. Alleviation can occur prior to signs or symptoms of the disease appearing as well as after their appearance. Thus, treating or treatment includes preventing or prevention of disease. The terms prevent or preventing refer to prophylactic and/or preventative measures, wherein the object is to prevent or slow down the targeted pathologic condition or disorder. In addition, treating or treatment does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols that have only a marginal effect on the patient.
[0078] As used herein, a host cell generally refers to a biological cell. A cell can be the basic structural, functional and/or biological unit of a living organism. A cell can originate from any organism having one or more cells. Examples of host cells include, but are not limited to: a prokaryotic cell, a eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant, an algal cell, a fungal cell (e.g., a yeast cell), an animal cell, a cell from an invertebrate animal, a cell from a vertebrate animal (e.g., fish, amphibian, reptile, bird, mammal), a cell from a mammal (e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a non-human primate, a human, etc.). A host cell can be a stem cell or progenitor cell.
[0079] The term patient as used herein may refer to a biological system to which a treatment can be administered. A biological system can include, for example, an individual cell, a set of cells (e.g., a cell culture), an organ, a tissue, or a multi-cellular organism. A patient can refer to a human patient or a non-human patient.
[0080] The term protospacer adjacent motif or PAM as used herein refers to the DNA sequence immediately following the target DNA sequence that is targeted by the nuclease in a CRISPR application setting. The PAM is nuclease specific, and the nuclease will not successfully bind to or cleave the target DNA sequence if it is not followed by the PAM. The term vector as used herein may refer to a nucleic acid sequence containing an origin of replication. A vector may be a plasmid, bacteriophage, bacterial artificial chromosome, yeast artificial chromosome or a virus. A vector may be a DNA or RNA vector. A vector may be either a self-replicating extrachromosomal vector or a vector which integrates into a host genome. The term expression vector refers to a nucleic acid assembly containing a promoter which is capable of directing the expression of a sequence or gene of interest in a cell. Vectors typically contain nucleic acid sequences encoding selectable markers for selection of cells that have been transfected by the vector. Generally, vector construct, expression vector, and gene transfer vector, refer to any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells or host cells.
[0081] As used herein and in the appended claims, the singular forms a, and and the include plural references unless the context clearly dictates otherwise.
[0082] The term about refers to a range of values which would not be considered by a person of ordinary skill in the art as substantially different from the baseline values. For example, the term about may refer to a value that is within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value, as well as values intervening such stated values.
[0083] Publications disclosed herein are provided solely for their disclosure prior to the filing date of the present disclosure.
[0084] Each of the applications and patents cited in this text, as well as each document or reference, patent or non-patent literature, cited in each of the applications and patents (including during the prosecution of each issued patent; application cited documents), and each of the PCT and foreign applications or patents corresponding to and/or claiming priority from any of these applications and patents, and each of the documents cited or referenced in each of the application cited documents, are hereby expressly incorporated herein by reference in their entirety. More generally, documents or references are cited in this text, either in a Reference List before the claims; or in the text itself; and, each of these documents or references (herein-cited references), as well as each document or reference cited in each of the herein-cited references (including any manufacturer's specifications, instructions, etc.), is hereby expressly incorporated herein by reference.
[0085] The following non-limiting examples serve to further illustrate the present disclosure.
EXAMPLES
Example 1: Sendai Virus Delivers CRISPR/Cas9 for Gene Editing
A. Materials and Methods
[0086] Cell Lines
[0087] Flp-In T-REx HEK293 cells (Invitrogen), Vero cells (ATCC CCL-81), BSR-T7 cells (BHK-based cell line with stable expression of T7 polymerase), and Affinofile cells (HEK293-based cell line with inducible overexpression of CD4 and CCR5) were propagated in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Atlanta Biologicals) and penicillin/streptomycin at 37 C. Flp-In T-REx HEK293 cells were additionally maintained in blasticidin and zeocin according to manufacturer protocol, BSR-T7 cells were additionally maintained in 1 mg/mL G418 to maintain the T7 transgene, and Affinofile cells were additionally maintained in 50 g/mL blasticidin. To generate the mCherry-inducible cells, the mCherry gene was inserted into pcDNA5/FRT/TO and co-transfected with pOG44 (Flp-recombinase) into parental Flp-In T-REx HEK293 cells. Selection with hygromycin (replacing zeocin) and blasticidin according to manufacturer protocol yielded a stable cell line with doxycycline-inducible expression of mCherry.
[0088] Whole human blood was obtained from the New York Blood Center. Peripheral blood mononuclear cells were isolated using Ficoll-Paque (GE Healthcare), and monocytes were further purified using CD14 MicroBeads (Miltenyi Biotec). Monocytes were propagated in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals).
[0089] Sendai Virus Reverse Genetics Plasmids
[0090] The basis for rSeV-Cas9 was a recombinant Sendai virus with an EGFP reporter inserted between the N and P genes via duplication of the N-to-P intergenic region, derived from RGV0, a Fushimi strain SeV with mutations in the F and M genes that allow trypsin-independent growth. All modifications to the plasmid encoding the T7-driven antigenome were performed using standard and overlapping PCRs with Velocity DNA polymerase (Bioline), with subsequent insertion into the construct at unique restriction sites by In-Fusion ligation-independent cloning (Clontech). All cloning was performed with Stb12 E. coli (Invitrogen) with growth at 30 C. FLAG-tagged codon-optimized S. pyogenes Cas9 was amplified from px330 (Addgene, cat #42230) and inserted into rSeV following the EGFP reporter, linked with a P2A ribosomal skipping sequence (ATNFSLLKQAGDVEENPGP) (SEQ ID NO: 4). The P2A sequence was preceded by a GSG linker to ensure complete ribosomal skipping. An additional two nucleotides were added after the stop codon of Cas9 to maintain the rule of six, by which the genome length of paramyxoviruses must be an exact multiple of six to ensure efficient replication. The Cas9 is flanked by unique NotI and FseI restriction sites to aid in any future modifications. To create the guide RNA and ribozyme cassette, the mCherry-targeting 20 bp sequence was cloned into px330 (discussed supra), and the full chimeric guide RNA cassette (SEQ ID NO: 1, see Table 1 below) was then PCR-amplified. The hammerhead ribozymes were incorporated via overhangs in the synthesized primers in subsequent PCRs. This cassette was inserted between the P and M genes via duplication of the P-to-M intergenic region, with unique AsiSI and SnaBI restriction sites flanking the cassette to aid in future modifications including changing the guide RNA target sequence. The guide RNA target sequences were chosen based on high predicted specificity using a CRISPR design tool available online through MIT.
TABLE-US-00001 (SEQIDNO:1,GuideRNACassette) ATCCCGGGTGAGGCATCCCACCATCCTCAGTCACAGAGAGACCC AATCTACCATCAGCATCAGCCAGTAAAGATTAAGAAAAACTTAG GGTGAAAGAAATTTCACCTAACACGGCGCAGCGATCGCGTGGCC CTGATGAGTCCGTGAGGACGAAACGGTAGGAATTCCTACCGTCG GCCACGAGTTCGAGATCGAGTTTTAGAGCTAGAAATAGCAAGTT AAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG TCGGTGCACGTATCACCGGAGTCGACTCCGGTCTGATGAGTCCG TGAGGACGAAATACGTATCCCGGGTGAGGCATCCCACCATCCTC AGTCACAGAGAGACCCAATCTACCATCAGCATCAGCCAGTAAAG ATTAAGAAAAACTTAGGGTGAAAGAAATTTCACCTAACACGGCG CA
TABLE-US-00002 TABLE 1 Annotated sequence of gRNA Cassette. Nucleotide Positions Within Guide RNA Cassette (SEQ ID NO: 1) Description 1-118, 325-442 P-to-M intergenic region; guide RNA cassette inserted via duplication of this region in this instance 73-83, 397-407 Gene stop signal 84-86, 408-410 Intergenic trinucleotide 87-96, 411-420 Gene start signal 119-126 Restriction site, e.g. modified AsiSI restriction site in this instance 127-132, 176-181 Stem for 5 ribozyme (e.g. rbz 1). Note: 1.sup.st part of stem, e.g. GTGGCC in this instance, must be the reverse complement of the beginning of the gRNA targeting sequence. See, e.g., FIG. 1B for stem structure. 133-175 5 ribozyme (e.g. rbz 1) 176-195 Guide RNA (gRNA), e.g. mCherry-targeting sequence in this instance 196-271 TracrRNA 272-277, 319-324 Stem for 3 ribozyme (e.g. rbz 2) 278-318 3 ribozyme (e.g. rbz 2) 320-325 Restriction site, e.g. modified SnaBI restriction site in this instance 135 Mutated to C to abolish 5 ribozyme activity 299 Mutated to C to abolish 3 ribozyme activity
[0091] Cleavage Assay
[0092] qRT-PCR primers were designed to flank ribozyme 1 (product A), ribozyme 2 (product B), and within the downstream M gene (product C, representing total RNA) (see
[0093] Viruses and Infections
[0094] BSR-T7 cells in 6-well were transfected with 4 ug T7-driven antigenome, 1.44 g T7-N, 0.77 g T7-P, 0.07 g T7-L, and 4 g codon-optimized T7 polymerase, using Lipofectamine LTX (Invitrogen) according to manufacturer's recommendations. Virus rescue was monitored by appearance and spread of EGFP fluorescence, and rescued virus was further expanded on BSR-T7 cells. Stocks of clarified virus were stored at 80 C. Virus titers were determined by titration on Vero cells, with individual infection events detected and counted by EGFP fluorescence at 24 hours post-infection in an Acumen plate reader (TTP Labtech).
[0095] For SeV infection of HEK293-based cell lines, 510.sup.4 cells were mixed with the virus inoculum immediately prior to plating in poly-L-lysine-coated wells. Media was changed the following day and every 2 days thereafter. For induction of mCherry, 100 ng/mL doxycycline was used. For Affinofile cells, 2 g/mL ponasterone A and 8 ng/mL doxycycline were used to induce CCR5 and CD4, respectively. For further HIV-1 infection of Affinofile cells, JR-FL HIV-1 was spinoculated onto cells at 2000 rpm for 2 hours at 37 C. in the presence of 2 g/mL polybrene (Sigma).
[0096] For SeV infection of monocytes, virus stocks were further purified by ultracentrifugation into a discontinuous 20% to 65% sucrose gradient. The interface was collected, titered on Vero cells, and stored at 80 C. until use. 510.sup.5 cells in serum-free medium were plated for 30 minutes at 37 C. to allow adherence before infection with virus inoculum via spinoculation at 2000 rpm for 2 hours at 37 C. Media was changed to RPMI with 10% FBS following spinoculation and changed every 2 days thereafter. 100 ng/mL GM-CSF (Peprotech) was included in the media following infection to stimulate macrophage differentiation and concomitant upregulation of CCR5.
[0097] Flow Cytometry
[0098] For CCR5 staining, cells were lifted and blocked in phosphate-buffered saline (PBS) with 2% FBS. Alexa 647-conjugated rat anti-human CCR5 (BioLegend, cat #313712) was added at 1:100 for 30 minutes at 4 C. before washing and resuspension in 2% paraformaldehyde (PFA). For p24 staining (RD1-conjugated mouse anti-p24 clone KC57, Beckman Coulter, cat #6604667, 1:100 dilution), cells were fixed and permeabilized using the Cytofix/Cytoperm kit (BD Biosciences) before blocking. Flow cytometry was performed on a BD LSR II at the Flow Cytometry Core at the Icahn School of Medicine at Mount Sinai.
[0099] Characterization of Mutagenesis
[0100] Genomic DNA was extracted using the PureLink Genomic DNA Mini Kit (Invitrogen). Specific genomic loci were amplified using Velocity DNA Polymerase (Bioline) and primers as shown in Table 2 below. Off-target loci represent the top predicted off-target sites in the CRISPR Design Tool. For Sanger sequencing of individual alleles, primers contained appropriate overhangs for insertion between the HindIII and XhoI sites of pcDNA3 via In-Fusion ligation-independent cloning (Clontech). PCR products were gel-extracted (NucleoSpin Gel and PCR Clean-up kit, Clontech), transformed into Stellar competent E. coli (Clontech), and selected on ampicillin LB agar. Individual colonies were prepped and sequenced. For deep sequencing, the gel-extracted products were pooled and further prepared for sequencing via paired-end 2300 bp MiSeq (IIlumina) sequencing by Genewiz, Inc. Unique sequences were identified and quantified from merged sequenced reads. For each on-target and off-target amplicon reference sequence, 18 bp sequences were selected just beyond 35 bp upstream and downstream from the 20 bp guide RNA target sequence. Unique sequences with exact matches to both of these 18 bp sequences were extracted and collated, with an average of 170,432 reads per amplicon. For each amplicon, sequences with lengths divergent from the reference sequence were identified as having insertions or deletions (indels).
TABLE-US-00003 TABLE2 On-targetandoff-targetgenomiclocations,sequences,andamplification primersutilized. Genomic Target+PAM Sequence Location (underlined) PrimerSequences mCherry n/a GGCCACGAGTTCGAGATCGAGGG Forward:GGCGAGGAGGATAACATGG (SEQIDNO:5) (SEQIDNO:18) Reverse: CTTCAGCCTCTGCTTGATCTC (SEQIDNO:19) ccr5on- chr3,+146373721 CAGGTTGGACCAAGCTATGCAGG Forward: target (SEQIDNO:6) TTGTCATGGTCATCTGCTACTC (SEQIDNO:20) Reverse: GTGTCACAAGCCCACAGATATT (SEQIDNO:21) ccr5off#1 chrl,1179505884 CAGACTGGATCAAGCTATGCCAG Forward: (SEQIDNO:7) CTCCACTTTCCATAACAGTCTAGG (SEQIDNO:22) Reverse: GGTCCTTGGAACAGTAGAGATAG (SEQIDNO:23) ccr5off#2 chr3,132755718 CAAGTTACAACAAGCTATGCAAG Forward: (SEQIDNO:8) TGTTTGCTGTGAGGCTACTTTG (SEQIDNO:24) Reverse: TCACTGTCCAATCTGCTTTACC (SEQIDNO:25) ccr5off#3 chr20,117216675 AAGGTTTTTCCAAGCTATGCTAG Forward: (SEQIDNO:9) GCAGAGGCATTATAAACCCAATATG (SEQIDNO:26) Reverse: CCAGGAGGAACTGGCAAAT (SEQIDNO:27) ccr5off#4 chr2,+1140172166 CAGGATTCACCAAGCTCTGCCAG Forward: (SEQIDNO:10) AAGCTCCATCTTCTTCGTTCTT (SEQIDNO:28) Reverse: AGTAGGAGATGGATTTACAGGTATT (SEQIDNO:29) ccr5off#5 chr12,+159746621 CAGTTTGGTTCAAGCTATGTTAG Forward: (SEQIDNO:11) CAGTGACATGAGCACCTGAA (SEQIDNO:30) Reverse: GCAAGGACATCCTCATCCATAA (SEQIDNO:31) efnb2on- chr13,1106512590 AGAATTCAGCCCTAACCTCTGGG Forward: target (SEQIDNO:12) CCTGGACAAGGACTGGTACTAT (SEQIDNO:32) Reverse: TAGCACAGGGTCCCAAATTC (SEQIDNO:33) efnb2off chr7,1136299453 AGAATTCAGGCTTAACCTCTTAG Forward: #1 (SEQIDNO:13) GCAGGCTGGTAATTGATCTTTC (SEQIDNO:34) Reverse: TGATCCACAGTTGGTTGAATCC (SEQIDNO:35) efnb2off chr2,+136596395 AAAATTCTTCCCTAACCTCTAAG Forward: #2 (SEQIDNO:14) CCAGAATGTGTCCTGGGTTTAG (SEQIDNO:36) Reverse: GTGTCAGAGCGAGACTTTGT (SEQIDNO:37) efnb2off chr7,+198992870 ACATTTCAGCTCTAACCTCTGGG Forward: #3 (SEQIDNO:15) GGAGTATCTTCAGCTGTGAGAAG (SEQIDNO:38) Reverse: CTGTTACACGTTCCTTGCTACT (SEQIDNO:39) efnb2off chr14,+198564083 ATAAATCAGCCCTAACATCTGAG Forward: #4 (SEQIDNO:16) CTGATTGAGTGGGTCATCAGAA (SEQIDNO:40) Reverse: GCTACGTGCTGGTGCTAAA (SEQIDNO:41) efnb2off chr3,16909191 AAAAGTTTGCCCTAACCTCTCAG Forward: #5 (SEQIDNO:17) GTCCAGGAAAGAAAGTTGCATAAG (SEQIDNO:42) Reverse: GCTGTCTGCTGGAAAGATAGT (SEQIDNO:43)
B. Results
[0101] Sendai Virus Incorporating Cas9 and a Guide RNA Flanked by Self-Cleaving Ribozymes Replicates to High Titer
[0102] Paramyxoviruses have a single-stranded, negative-sense RNA genome. During replication, the virus replication complex (nucleoprotein (N), phosphoprotein (P), and large RNA-dependent RNA polymerase (L)) uses the genome as a template for production of both full length antigenome (the reverse complement of the genome) and individual capped and polyadenylated mRNAs (
TABLE-US-00004 Rbz1: (SEQIDNO:2) GUGGCCCUGAUGAGCGAAACGGUAGGAAUUCCUACCGUC Rbz2: (SEQIDNO:3) CACCGGAGUCGACUCCGGUCUGAUGAGUCCGUGAGGACGAAAUACGU
[0103] The ribozymes were confirmed as functional for cleavage by transfecting the DNA construct encoding the T7-driven rSeV-Cas9 positive-sense antigenome (the ribozymes are functional in the RNA positive-sense orientation) into BSR-T7 cells (BHK cells stably expressing T7 polymerase). qRT-PCR on T7-transcribed antigenomic RNA extracted from transfected cells showed efficient self-cleavage for both ribozymes (
[0104] rSeV-Cas9 Targeting mCherry Gene Achieves Almost Complete Mutagenesis of a Reporter Cell Line
[0105] The initial rSeV-Cas9 incorporated a guide RNA specific for the mCherry gene (rSeV-Cas9-mCherry). A HEK293-based reporter cell line was generated with inducible mCherry, and this cell line was infected at a multiplicity of infection (MOI) of 25 with either rSeV-Cas9-mCherry or a control virus expressing Cas9 but lacking the guide RNA cassette (rSeV-Cas9-control). Induction of mCherry expression at various days post-infection showed a progression of knockout over time, with knockout appearing more pronounced starting at 4 days post-infection (
[0106] The reporter cell line was utilized to confirm the requirement for the ribozymes to preserve guide RNA function. Mutation of the 3 ribozyme (rbz 2) strongly reduced reporter knockout efficiency, while mutation of both the 5 and 3 ribozymes (rbz 1/2) abrogated knockout activity (
[0107] To quantitatively assess the degree of mutagenesis induced by rSeV-Cas9-mCherry, deep sequencing was performed on the mCherry locus amplified from reporter cells collected at day 6 post-infection. 98% of alleles had indels, indicating nearly complete mutagenesis of the reporter (
[0108] rSeV-Cas9 Efficiently Mutates Endogenous Ccr5 and Efnb2
[0109] As opposed to the single allele of mCherry in the reporter cell line, there are two or more alleles of most endogenous genes per cell. To test the ability of the Sendai virus vector to target the more abundant endogenous alleles, rSeV-Cas9 viruses were generated targeting coding exons of the human ccr5 and efnb2 genes. A preliminary test of the ability of rSeV-Cas9-CCR5 was performed to induce mutagenesis resulting in functional disruption of ccr5. HEK293 cells were utilized since HEK293 cells express negligible levels of CCR5, which contain inducible CD4 and CCR5 transgenes in addition to their endogenous alleles. CD4 and CCR5 are cell surface receptors required for infection by R5-tropic HIV-1, and Affinofile cells have been used extensively to characterize CCR5-mediated HIV entry. Affinofile cells were infected with rSeV-Cas9-CCR5, and at 2 days post-infection, CD4/CCR5 overexpression was induced, and the cells were further infected with an R5-tropic HIV-1 isolate the following day (
[0110] To examine mutagenesis of endogenous alleles, HEK293 cells were infected with the ccr5- and efnb2-targeting rSeV-Cas9 viruses at a MOI of 25 and were collected at 6 days post-infection. The on-target loci as well as the top five predicted off-target sites were PCR amplified. HEK293 cells are known to generally have 3 copies of chromosome 3 (encoding ccr5) and 2-3 copies of chromosome 13 (encoding efnb2). Deep sequencing revealed high rates of on-target mutagenesis (75% and 88% for ccr5 and efnb2, respectively) (
[0111] Ccr5-Targeting rSeV-Cas9 Edits Primary Human Monocytes at High Frequency
[0112] Primary human CD14+ monocytes were infected with rSev-Cas9, which are normally resistant to lentiviral transduction, at a MOI of 50. To better visualize reduction in CCR5 expression upon mutagenesis, monocytes were also stimulated with GM-CSF to induce macrophage differentiation with concomitant upregulation of CCR5. Cells were collected at 5 days post-infection, and deep sequencing revealed 88% on-target mutagenesis (
Example 2: Temperature Sensitive Mutants of rSeV-Cas9 Vector
[0113] A temperature sensitive (ts) mutant of the rSev-Cas9 vector described in Example 1 above was created. This mutant was made by introducing several mutations into the P (D433A, R434A, K437A) and L (L15581, N1197S, K1795E) genes of the recombinant Sendai virus vector, referred to herein as the PL mutant. The PL mutant efficiently edits at permissive temperatures, for example, temperatures up to and around 34 C., but is eliminated upon shifting to non-permissive temperatures, for example, temperatures above 37 C. and above. PL mutants of the Sendai virus have been previously reported in literature, but not for purposes of CRISPR-Cas gene editing. Generation of PL mutants can be found at, for example, Ban H. et al. PNAS 2011 Aug. 23; 108(34): 14234-14239, hereby incorporated by reference in its entirety. The PL mutant generated in Ban H. et al. was a Z strain of Sendai virus, whereas the present rSev-Cas9 vector used was a Fushimi F1R strain. A schematic of the ts mutations adapted from Ban H. et al. in the rSev-Cas9 vector (PL mutant) is illustrated in
[0114] The PL mutant has been shown to be capable of infecting human CD34+ hematopoietic stem cells (HSCs) from both human fetal liver and peripheral blood mobilized CD34+ HSCs at 80-90% efficiency. Furthermore, editing frequency in these HSCs at about 80%. For example, as shown in
[0115] Infected CD34+ HSCs have been transplanted into immunodeficient SCID-Hu mice (n=9 for each group). All except one mice remained healthy at 10 weeks post-transplant. This illustrated that the PL mutants did not revert in vivo to a pathogenic virus, as wild type Sendai virus is highly pathogenic even in wild-type immunocompetent mice, and likely would have killed the immunodeficient SCID-Hu mice. Phenotyping of infected CD34+ HSCs (
[0116] Additionally, the PL mutants generated were essentially silent in inducing the IFN response compared to the non PL-mutants (i.e. non-temperature sensitive rSeV-Cas9 vectors). This is a highly surprising but important phenotype. Furthermore, the PL mutants generated in Ban H. et al. did not mention the effect (positive or negative) of the PL mutants on the interferon response. There is additionally no present indication why the PL mutant generated in this Example possesses an IFN-silent phenotype, as Sendai virus infection is known to induce the production of IFN.
Example 3: Additional Modifications to the rSeV-Cas9 Vectors
[0117] An additional deletion mutant of the rSeV-Cas9 vector described in Example 1 was created, missing the Fusion protein (i.e. F mutants). These are only capable of growing in an F-complementing cell line. The temperature sensitive PL mutants of Example 2 are generated to be F mutants. rSev-Cas9 vectors that can deliver two gRNAs are generated and illustrated in
[0118] The foregoing examples and description of the preferred embodiments should be taken as illustrating, rather than as limiting the present disclosure as defined by the claims. As will be readily appreciated, numerous variations and combinations of the features set forth above can be utilized without departing from the present disclosure as set forth in the claims. Such variations are not regarded as a departure from the scope of the disclosure, and all such variations are intended to be included within the scope of the following claims. All references cited herein are incorporated by reference in their entireties.