METHOD FOR PRODUCING MONOTERPENOID COMPOUNDS
20210207183 ยท 2021-07-08
Inventors
Cpc classification
C12P5/007
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
C07D311/94
CHEMISTRY; METALLURGY
International classification
C12P17/06
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The invention relates to enzymes and methods for producing a monoterpenoid compound. In one aspect, the invention is a method for producing a monoterpenoid compound, comprising the steps of (1) providing a monoterpenoid precursor; (2) providing a NEPS enzyme; and (3) contacting the monoterpenoid precursor with the enzyme under catalytic conditions to produce an monoterpenoid compound.
Claims
1. A method for producing a monoterpenoid compound, comprising: (1) providing a monoterpenoid precursor; (2) providing an enzyme; and (3) contacting the monoterpenoid precursor with the enzyme under catalytic conditions to produce an monoterpenoid compound; wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 [NEPS1], and/or SEQ ID NO: 2 [NEPS2], and/or SEQ ID NO: 3 [NEPS3], or a functional variant or homologue thereof.
2. The method of claim 1, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and is encoded by a nucleotide sequence comprising SEQ ID NO: 4, and/or the enzyme comprises an amino acid sequence comprising SEQ ID NO: 2 and is encoded by a nucleotide sequence comprising SEQ ID NO: 5, and/or the enzyme comprises an amino acid sequence comprising SEQ ID NO: 3 and is encoded by a nucleotide sequence comprising SEQ ID NO: 6.
3. The method of claim 1, wherein the monoterpenoid compound comprises a monoterpene indole alkaloid (MIA).
4. The method of claim 1 or 2, wherein the monoterpenoid precursor comprises 8-oxocitronellyl enol and/or 8-oxocitronellal and/or derivatives thereof.
5. The method of any preceding claim, wherein the enzyme further comprises an iridoid synthase (ISY), for example an ISY comprising an amino acid sequence of SEQ ID NO: 7 [AmISY], SEQ ID NO: 8 [NmISY2] or SEQ ID NO: 9 [CrISY], or a functional variant or homologue thereof.
6. The method of claim 5, wherein the ISY comprising an amino acid sequence of SEQ ID NO: 7 is encoded by a nucleotide sequence comprising SEQ ID NO: 10, the ISY comprising an amino acid sequence of SEQ ID NO: 8 is encoded by a nucleotide sequence comprising SEQ ID NO: 11, or the ISY comprising an amino acid sequence of SEQ ID NO: 9 is encoded by a nucleotide sequence comprising SEQ ID NO: 12.
7. The method of claim 6, wherein the monoterpenoid precursor comprises 8-oxogeranial.
8. The method of any preceding claim, wherein the monoterpenoid precursor or compound comprises nepetalactol.
9. The method of claim 8, wherein the nepetalactol comprises cis-trans nepetalactol, and wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 2, or a functional variant or homologue thereof.
10. The method of claim 8 or 9, wherein the nepetalactol comprises cis-cis nepetalactol, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 3, or a functional variant or homologue thereof.
11. The method of any preceding claim, wherein the monoterpenoid compound comprises nepetalactone.
12. The method of any of claim 11, wherein the nepetalactone comprises cis-trans nepetalactone, and wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 2, or a functional variant or homologue thereof.
13. The method of claim 11 or 12, wherein the nepetalactone comprises cis-cis nepetalactone, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 3, or a functional variant or homologue thereof.
14. The method of claim 13, wherein the nepetalactone comprises both cis-trans nepetalactone and cis-cis nepetalactone.
15. The method of any preceding claim 1, wherein the monoterpenoid compound comprises a cyclopentapyran.
16. The method of claim 1 wherein the monoterpenoid compound comprises a oxadecalin.
17. The method of any of claims 1 to 16, wherein the method is performed in vivo, for example in planta.
18. The method of any of claims 1 to 17, wherein the enzyme or enzymes are provided by expression in vivo, for example heterologous expression.
19. The method of any of claims 1 to 16, wherein the method is performed in vitro, for example in an isolated plant cell such as a plant cell from Nicotiana benthalmiana, Catharanthus roseus, or Nepeta ssp, for example Nepeta cataria, Nepeta racemosa, Nepeta faassenii or Nepeta or in yeast, for example Pichia pastoris or Saccharomyces cerevisiae, or in bacteria, for example E. coli.
20. A method for producing a biologically active compound, comprising the steps of: (1) preforming the steps as defined in any of claims 1-19; and (2) converting the monoterpenoid compound into a biologically active compound.
21. The method of claim 20, wherein the biologically active compound is selected from: an insect repellent; an insect attractant; a feline attractant; and a monoterpene indole alkaloid, for example vinblastine, vincristine, camptothecin, quinine and/or yohimbine.
22. An isolated enzyme selected from: an enzyme having an amino acid sequence comprising SEQ ID NO: 1, or a functional variant or homologue thereof; an enzyme having an amino acid sequence comprising SEQ ID NO: 2, or a functional variant or homologue thereof; and an enzyme having an amino acid sequence comprising SEQ ID NO: 3, or a functional variant or homologue thereof.
23. An isolated nucleic acid selected from: a nucleotide sequence having a nucleotide sequence comprising SEQ ID NO: 4, or a functional variant or homologue thereof; a nucleic acid having a nucleotide sequence comprising SEQ ID NO: 5, or a functional variant or homologue thereof; and a nucleic acid having a nucleotide sequence comprising SEQ ID NO: 6, or a functional variant or homologue thereof.
24. A kit comprising: a first enzyme having a first amino acid sequence selected from the group comprising: SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3, or a functional variant or homologue thereof; and optionally also comprising: a second enzyme having an amino acid sequence selected from the group comprising: SEQ ID NO: 7, SEQ ID NO: 8 and/or SEQ ID NO: 9 or a functional variant or homologue thereof.
25. A plant which has been gene edited to express the enzyme(s) of claim 22, and optionally also gene edited to express a second enzyme having an amino acid having an amino acid sequence selected from the group comprising: SEQ ID NO: 7, SEQ ID NO: 8 and/or SEQ ID NO: 9, or a functional variant or homologue thereof.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0015]
[0016] A, Nepetalactone 1 stereoisomers observed in Nepeta species (1a=cis-trans-nepetalactone, 1b=cis-cis-nepetalactone, 1c=trans-cis-nepetalactone), 1d=trans-trans-nepetalactone.
[0017] B, Representative canonical (mono)terpene biosynthesis mechanism. Typical terpene synthases (TS) activate linear precursors by removal of diphosphate or protonation (A=activation). The activated carbocation intermediates undergo selective cyclisation inside the sameterpene (C=cyclisation) synthase active site. Limonene synthase is depicted as an example.
[0018] C, Iridoid biosynthesis mechanism. Iridoid synthase (ISY) activates (A) its linear precursor (8-oxogeranial 2) by reduction to form the 8-oxocitronellyl enol/enolate intermediate 3. This then undergoes cyclisation (C) to form a mixture of cis-trans-nepetalactol 4a and iridodials 5.
[0019] D, This work: nepetalactone biosynthesis in Nepeta. Biosynthetic origin of cis-trans and cis-cis-nepetalactone stereoisomers in Nepeta as reported in this paper (R=reduction, T=tautomerisation, C=cyclisation, O=oxidation, GA=general acid, 4b=cis-cis-nepetalactol, 6=8-oxocitronellal).
[0020]
[0021] A, Product mixture observed in the ISY catalysed reductive cyclisation of 8-oxogeranial 2. Products: cis-trans-nepetalactol 4a, cis-cis-nepetalactol 4b, cis-trans-iridodial 5a, trans-cis-iridodial 5c, trans-trans-iridodial 5d, tetrahydro-8-oxogeranial 7 and S-8-oxocitronellal 6. B, 8-oxogeranial 2 reduction catalysed by ISYs from Antirrhinum majus (AmISY), Catharanthus roseus (CrISY) and N. mussinii (NmISY2). The enzymes form nearly identical product mixtures despite their evolutionary distance and sequence identity. *AmISY produces the opposite enantiomeric series to that depicted in panel a. Reactions were incubated for 3 h. Conditions: 0.5 M ISY, 0.5 mM 2, 1 mM NADPH, 0.1 M MOPS pH 7.5. See
[0022] C, ISY catalysed reduction of 2 at different buffer concentrations. At low buffer concentrations, the main product is cis-trans-nepetalactol 4a. As buffer concentrations increase, higher quantities of cis-trans-iridodials 5a are observed. At high MOPS (buffer) concentrations (>100 mM) 8-oxocitronellal (6) becomes a major product. We propose ISY reduces 2 and then releases the activated 3 into the solvent, where cyclisation occurs. Buffer appears to act as a general acid catalyst (GA), promoting tautomerisation in place of cyclisation. At low general acid concentrations, cyclisation is favoured but at high general acid concentrations tautomerisation is promoted. Conditions: 0.5 mM 2, 0.5 M NmISY2, 1 mM NADPH, MOPS pH 7.5 (varying concentrations). Reactions were incubated for 3 h. RT=retention time. See
[0023] D, General acid catalysed cyclisation of S-8-oxocitronellal 6. Non-enzymatic (NE) formation of 4a and 5 achieved via tautomerisation to 3 and spontaneous cyclisation catalysed by general acid (buffer, GA). The product profile at 0.5 M buffer mimics the equivalent ISY catalysed reduction, supporting a non-enzyme catalysed cyclisation. No enzyme (NE) conditions: MOPS pH 7.5 (varying concentration), 0.5 mM 6, incubation for 16 h. NmISY2 conditions: 0.5 M NmISY2, 0.5 mM 2, 1 mM NADPH, 0.1 M MOPS pH 7.5. See
[0024]
[0025] A, Summary of NEPS enzyme activities described in this figure. R=reduction, C=cyclisation, O=oxidation.
[0026] B, Cis-trans-nepetalactol dehydrogenase activity of NEPS1. NEPS1 catalyses the NAD.sup.+-dependent dehydrogenation of cis-trans-nepetalactol 4a to cis-trans-nepetalactone 1a. Conditions: 0.5 mM 4a 0.5 M NEPS1. 1 mM NAD.sup.+, 50 mM HEPES pH 8, 0.1 M NaCl. RT=retention time, STDS=standards, B=boiled.
[0027] C, Cis-cis-nepetalactol dehydrogenase activity of NEPS1. NEPS1 catalyses the NAD.sup.+-dependent dehydrogenation of cis-cis-nepetalactol 4b to cis-trans-nepetalactone 1b. Conditions: 0.5 mM 4b 0.5 M NEPS1. 1 mM NAD.sup.+, 50 mM HEPES pH 8, 0.1 M NaCl.
[0028] D, Combined activities of ISY and NEPS enzymes. Incubation of 8-oxogeranial 2, CrISY, NEPS and cofactors enables the production of products (P) including these main bicyclic products (MBP): cis-trans-nepetalactol 4a (no NEPS or NEPS2), cis-trans-nepetalactone 1a (NEPS1), cis-cis-nepetalactol 4b (NEPS3) or cis-cis-nepetalactone 1b (NEPS1 and NEPS3). Conditions: 0.5 mM 2, 0.5 M CrISY, 2 M NEPS, 1 mM NADPH, 5 mM NAD.sup.+, 0.1 M MOPS pH 7.5. See
[0029] E, NEPS-catalysed formation of cis-trans-nepetalactol 4a. Adjusting the NAD.sup.+ and/or NEPS concentrations reveals NEPS1 and NEPS2 can promote the formation of cis-trans-nepetalactol 4a. Conditions: 0.5 mM 2, 0.5 M CrISY, NEPS1 or 2 (varied concentration), 1 mM NADPH, 0 or 5 mM NAD.sup.+, 0.1 M MOPS pH 7.5.
[0030] All reactions were incubated for 3 h and are presented as GC-MS TICs. See
[0031]
[0032] A, Summary of NEPS enzyme activities described in this figure. T=tautomerisation, C=cyclisation, O=oxidation, GA=general acid (buffer).
[0033] B, NEPS activities with S-8-oxocitronellal 6, buffer and NAD.sup.+, presented as GC-MS TICs. The panel largely recapitulates observations of
[0034] C, Buffer dependence of NEPS activity with S-8-oxocitronellal 6. In the absence of buffer, NEPS1 and NEPS3 have no detectable activity; addition of buffer reveals enzyme activities. Buffer-catalysed tautomerisation of 6 appears to be necessary for enzyme activity, supporting the hypothesis that the activated 8-oxocitronellyl enol 3 and not S-8-oxo-citronellal 6 is the key NEPS substrate. Conditions: 0.5 mM 6, 2 M NEPS, 5 mM NAD.sup.+, MOPS pH 7.5 (0.5M, or no buffer). P=products.
[0035] D, NEPS3 catalysed cyclisation to form cis-cis-nepetalactol 4b. The addition of NAD.sup.+ is not required for NEPS3 cyclisation activity, though addition does promote the reaction. We hypothesise that the cyclisation is not oxidoreductive, but NAD.sup.+ acts in a non-chemical manner (i.e. protein stabilisation). Conditions: 0.5 mM 6, 2 or 20 M NEPS, 0 or 5 mM NAD.sup.+, 0.5 M MOPS pH 7.5. All reactions analyses are presented as GC-MS TICs.
[0036]
[0037] X-ray crystal structure of NEPS3 (6F9Q) and homology model (HM, template 6F9Q) structures of NEPS1 and NEPS2. Active site NAD.sup.+ and residues are depicted as sticks. Dashed lines represent proposed H-bonds. The NEPS3 active site lacks the characteristic Ser/Thr of the SDR catalytic tetrad (G152). It also features a chloride bound to S154 and H-bonding between S153 and P190, features absent from NEPS1 (L156) and NEPS2 (L152). The role of residues in bold and underlined have been analysed by mutation. See
[0038]
[0039] A, Coupled assay with 8-oxogeranial 2, ISY and NEPS variants, presented as GC-MS TICs. The product profile was measured after 3 h. The substitution S154L in NEPS3 appears to remove the cis-cis cyclase activity (absence of 4b), but with 10 M enzyme the formation of cis-trans-nepetalactol 4a appears to be promoted relative to iridodials 5. The L156S substitution in NEPS1 largely removes dehydrogenase activity of NEPS1 (less cis-trans-nepetalactone 1a) but no increase in cis-cis-nepetalactol 4b is observed. Conditions: 0.5 mM 2, 0.5 M CrISY, 2 or 10 M NEPS, 1 mM NADPH, 5 mM NAD.sup.+ and 0.1 M MOPS pH 7.5. SP=side products, RT=retention time.
[0040] B, Time course of coupled assay with 8-oxogeranial 2, ISY and NEPS1 WT or T154G. Quantities of cis-trans-nepetalactol 4a (open squares) and cis-trans-nepetalactone 1a (closed circles) measured over the course of the reaction. Product proportions described as GC-MS TIC peak areas as a percent proportion of total product peak area (PA). NEPS1-WT oxidises 4a into 1a rapidly whilst NEPS1-T154G oxidises 4a with less efficiency. See
[0041] C, Putative binding mode of cis-trans-nepetalactol 4a in the NEPS1 active site. Binding mode generated by computational docking calculations using the NEPS1 homology model. The putative H-bond interaction between the lactol and T154 is highlighted with a dotted line. The depicted binding mode was ranked third of ten predicted binding modes (rank 1 score=6.4 kcal.Math.mol-1, depicted rank 3 energy=6.3 kcal.Math.mol-1).
[0042] D, Scheme of NEPS1 activities and interactions. NEPS1 appears to have two distinct activities-cyclisation and dehydrogenation. The behaviour of the mutant T154G suggests that T154 is involved in dehydrogenation. The two activities appear distinct and may even involve different active site interactions. The slightly improved cyclase activity of T154G may be due to poor binding of 4a which frees more enzyme for binding and cyclising 3 into 4a. SP=side products, S=solvent.
[0043]
[0044] All spectra were obtained from the centre of the peaks, except for the CrISY trans-trans-iridodial 5d spectrum which was taken from the peak tail to avoid overlap with cis-trans-iridodial 5a. The identity of the standards presented here have been verified by NMR characterisation as previously reported (see methods). STD=standard, A=abundance.
[0045] A, cis-trans-nepetalactol 4a.
[0046] B, cis-cis-nepetalactol 4b.
[0047] C, cis-trans-iridodials 5a.+5a.
[0048] D, trans-cis-iridodial 5c.+5c.
[0049] E, trans-trans-iridodials 5d.+5d.
[0050] F, S-8-oxocitronellal 6.
[0051] G, tetrahydro-8-oxogeranial 7.
[0052]
[0053] A, Reduction of 8-oxogeranial 2 by ISY forming cis-trans nepetalactol 4a, cis-cis-nepetalactol 4b, cis-trans-iridodial 5a, trans-cis-iridodial 5c, trans-trans-iridodial 5d, tetrahydro-8-oxogeranial 7 and S-8-oxocitronellal 6. Conditions: 0.5 M ISY, 1 mM NADPH buffer.
[0054] B, Reduction of 2 with CrISY at different MOPS pH 7.5 concentrations, presented as GC-MS TICs. Note the similarity to similar plots with NmISY2 (
[0055] C, Reduction of 2 with AmISY at different MOPS pH 7.5 concentrations. Note the similarity to similar plots with NmISY2 (
[0056] D, Effect of buffer choice on product profile. Reduction of 2 with CrISY with different buffers. Note the different product profiles: the absence of 6 from POPSO, the presence of 7 in KPi and most crucially the different ratio of diastereomeric ratio 5a and 5a in POPSO. This indicates direct involvement of buffer in the tautomerisation mechanisms.
[0057] E, Effect of pH on product profile of CrISY catalysed reduction of 2. Reducing the pH (more acidic) has a similar result to increasing buffer (general acid) concentrations. The buffer employed was a combination of Good's Buffers (50 mM each of HEPES, CHES and MES).
[0058]
[0059] A, MOPS (3-(N-morpholino)propanesulfonic acid);
[0060] B, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid);
[0061] C, KPi (potassium phosphate);
[0062] D, POPSO (Piperazine-1,4-bis(2-hydroxypropanesulfonic acid)). In all cases concentration of cis-trans-nepetalactol 4a decreases as buffer concentration increases. Between 0-100 mM buffer concentrations of cis-trans-iridodials 5a increase. Above 100 mM buffer the effects are more buffer dependent: for MOPS, HEPES and KPi, the concentration of 8-oxocitronellal 6 increases; for KPi we also see an increase in tetrahydro-8-oxogeranial 7; and for POPSO we see no 6 but an increase in specific iridodial 5 diastereomers. Furthermore, POPSO appears to produce different diastereomer ratios of 5 compared to the other buffers. This data is evidence of direct buffer involvement in cyclisation/tautomerisation processes in the ISY catalysed reduction of 2. Product peak areas are represented as percentage product proportions, obtained by dividing product peak area by total product peak areas (PA). Product peak areas are not normalised by standard curves so do not represent absolute concentrations. Note that peaks of 5a and 5d overlap in the GC methodpeak areas for these compounds were measured as a split peak (i.e. both to baseline) and not as a peak shoulder. MOPS, HEPES, and POPSO chemical structures depicted in zwitterionic form, KPi depicted as major phosphate forms at pH 7.5.
[0063]
[0064] Cis-trans-nepetalactol (4a,
[0065]
[0066] A, Outline of cyclisation reaction. S-8-oxocitronellal 6 cyclises to cis-trans-nepetalactol 4a, cis-trans-iridodial 5a, trans-cis-iridodial 5c and trans-trans-iridodial 5d in the presence of H.sup.+ or OH.sup. and H.sub.2O.
[0067] B, Incubation of S-8-oxocitronellal 6 (0.5 mM) in water at acidic (HCl) or alkaline (NaOH) pH. Samples were incubated at 30 C. for 3 h. Samples at pH 2, 3, 4, 5, 6, 7, 8 and 9 were also examined, but no conversions were observed. RT=retention time (min).
[0068] C, As in panel b but after 24 h incubation at 30 C. Between pH 2 and 10 very little conversion was observed. Samples at pH 12 appeared to show complete degradation of 6 and products. No cis-cis-nepetalactol 4b was detected at any pH.
[0069] D, Incubation of S-8-oxocitronellal 6 (0.5 mM) in water between pH 10.5 and 11.0 (NaOH). Samples were incubated at 30 C. for 16 h. Samples between pH 10.0-10.5 were also examined, but little conversion was observed. It is notable that whilst the bicyclic cis-trans-nepetalactol 4a is a major product in alkaline conditions, cis-cis-nepetalactol 4b is absent. It appears that the spontaneous formation of cis-cis-nepetalactol 4b is unfavourable.
[0070]
[0071] Comparison of EI spectra from non-enzymatic reaction with 8-oxocitronellal 6 and 0.5 M MOPS pH 7.5 and enzymatic reaction with 8-oxogeranial 2, NmISY2, NADPH and 0.5 M MOPS pH 7.5. The spectra verify the products are chemically identical despite their different origin. Spectra of two unknown compounds produced in the non-enzymatic reactions are included. These appear to be non-cyclic isomers of 6. All spectra were obtained from the centre of the peaks, except for the trans-trans-iridodial 5d spectra which were taken from the peak tail to avoid overlap with cis-trans-iridodial 5a.
[0072] A, cis-trans-nepetalactol 4a.
[0073] B, S-8-oxocitronellal 6.
[0074] C, cis-trans-iridodials 5a.+5a.
[0075] D, trans-cis iridodials 5c.+5c.
[0076] E, trans-trans-iridodials 5d.+5d.
[0077] F, unknown peaks a and b from reaction containing 0.5 mM 6 and 0.5 M MOPS.
[0078] RT=retention time (min).
[0079]
[0080] A, Isolation of trichomes using dry ice abrasion. Representative micrograph of isolated trichomes. Trichome types: non-glandular hairs (a), peltate trichomes (b) and capitate trichomes (c).
[0081] B, Isoprenoid 2-C-methylerythritol 4-phosphate (MEP) pathway and iridoid biosynthetic pathway.
[0082] C, Enrichment of MEP and iridoid biosynthetic proteins in the trichome. Proteins were putatively identified by Swiss-Prot annotations and shotgun proteomics. All proteins were significantly trichome enriched (trichome compared to trichome-depleted leaves, Fisher's exact test, p<0.05) except for MCS and CMS. TDL=trichome depleted leaves, L=leaves, T=trichomes. PA=protein abundance (total spectra).
[0083] D, Enrichment of selected oxidoreductases in the trichome. Proteins were selected based on trichome enrichment and functional annotation. All proteins were significantly trichome enriched (trichome compared to trichome-depleted leaves, Fisher's exact test, p<0.05). Characterised N. mussinii ISY included for comparison.
[0084] E, Observation of cis-trans-nepetalactol dehydrogenase activity. Trichome enriched oxidoreductases were cloned, expressed, and assayed as clarified lysate with 1 mM NAD+, 0.5 mM cis-trans-nepetalactol 4a and 50 mM sodium phosphate pH 8.8. Formation of NADH was monitored by absorbance at 340 nm. Blue bars are averages of A340 over the first 5 mins of reaction, green bars are averages of A340 over the final 5 mins of reaction (reaction time 30 minutes). Error bars show one standard deviation from the mean. A=absorbance (340 nm) AU, B=blank, EV=empty vector.
[0085]
[0086] A, Spectra of products (cis-trans-nepetalactone 1a and cis-cis-nepetalactone 1b) from
[0087] B, cis-trans-nepetalactol 4a product from
[0088] C, cis-cis-nepetalactol 4b from
[0089] D, cis-trans-nepetalactone 1a from
[0090] E, cis-cis-nepetalactone 1b from
[0091] F, trans-cis-nepetalactone 1c from
[0092] STD=standard, A=abundance.
[0093]
[0094] A, Amino acid sequences of NEPS enzymes cloned from Nepeta mussinii. Mentha x piperita isopiperitenol/carveol dehydrogenase (MpIPDH) (Uniprot Q5C9I9) included for comparison. Important residues highlighted below the sequence: * are the SDR catalytic tetrad (N-Y-K-T/S) and hypothesised to be involved in oxyanion binding in NEPS3.
[0095] B, Sequence identity (%) between NEPS enzymes and MpIPDH. Based on alignment in panel a.
[0096] C, Evolutionary context of NEPS enzymes. NEPS enzymes examined in this study are in bold, as is the previously characterised MpIPDH enzyme. The NEPS1 sequence was used to obtain the closely related sequences from across the entire mint plant family (Lamiaceae). Sequences for Lamiaceae and outgroups were obtained from the Mint Genome Project (http://mints.plantbiology.msu.edu/, NCBI BioProject PRJNA359989). Homologous sequences were identified by BLAST and curated, keeping only full-length sequences and removing close paralogs (>95% identity). The codon sequences were aligned and a maximum-likelihood phylogenetic tree was estimated. NEPS enzymes appear to locate to a single clade unique to Nepeta (bold), implying that these enzymes evolved within the Nepeta lineage. Sequences from two cultivars of Nepeta mussinii are included: the cultivar used in this study (and a cultivar used in the Mint Genome Project. Species acronyms: AGFO, Agastache foeniculum; AUPE, Aureolaria pectinata (outgroup); BAPS, Ballota pseudodictamnus; COPY, Cornutia pyramidata; GLHE, Glechoma hederacea; GMPH, Gmelina philippensis; HOSA, Holmskioldia sanguinea; HYOF, Hyssopus officinalis; HYSU, Hyptis suaveolens; LAAL, Lamium album; LATI, Lancea tibetica (outgroup); LECA, Leonurus cardiaca; LYAM, Lycopus americanus; MAVU, Marrubium vulgare; MEOF, Melissa officinalis; MEPI, Mentha x piperita; MESP, Mentha spicata; MODI, Monarda didyma; NECA, Nepeta cataria; NEMU, Nepeta mussinii; ORMA, Origanum majorana; PEAT, Perovskia atriplicifolia; PEBA, Petraeovitex bambusetorium; PHFR, Phlomis fruticosa; ROMY, Rotheca myricoides; ROOF, Rosmarinus officinalis; SAHI, Salvia hispanica; SCBA, Scutellaria baicalensis; STOF, Stachys officinalis/Betonica officinalis; THVU, Thymus vulgaris; VIAG, Vitex agnus-castus. Selected gene labels: a=NECA_c35378_g1_i1, b=NEMU_c14104_g1_i1, c=SAHI_c28856_g3_i1, d=SAHI_c28856_g1_i2, e=MESP_c41507_g1_i, f=MpIPDH. CS=clade support, SPC=substitutions per codon.
[0097]
[0098] A, cis-trans-nepetalactol 4a to cis-trans-nepetalactone 1a.
[0099] B, cis-cis-nepetalactol 4b to cis-cis-nepetalactone 1b.
[0100] C, cis-trans-iridodial 5a to cis-trans-nepetalactone 1a.
[0101] D, cis-cis-iridodial 5b to cis-cis-nepetalactone 1b.
[0102] E, trans-cis-iridodial 5c to trans-cis-nepetalactone 1c.
[0103] F, cis-trans-nepetalactone 1a to unknown product.
[0104] G, 8-oxogeranial 2 reduction to unknown product.
[0105] Besides NEPS1 dehydrogenase activity with 4a and 4b, no other notable activities are observed (i.e. substrates are not converted into products). NEPS1 appears to produce trace quantities of 1a with 5a, however this may be simply conversion of residual 4a present in the substrate sample. There is also trace formation of nepetalactones 1b and 1c by NEPS1 in samples with 5b and 5c respectively. An unknown degradation product of 1a (marked with *) is present in samples using 1a as the substrate. This is also present in the boiled enzyme control so was not considered to be a NEPS activity. Reactions presented as GC-MS TICs. All conditions: 0.5 mM substrate, 1 mM NAD.sup.+, 50 mM HEPES pH 8, 0.1 M NaCl, with the exception of g which used NADH in place of NAD.sup.+. RT=retention time (min), B=boiled.
[0106]
[0107] Cascade reactions with 2, ISY (CrISY or NmISY2), NEPS (1 and/or 3), co-factors and buffer. Products formed: cis-trans-nepetalactone 1a, cis-cis-nepetalactone 1b, trans-cis-nepetalactone 1c, cis-trans-nepetalactol 4a, cis-cis-nepetalactol 4b, iridodials 5, tetrahydro-8-oxogeranial 7 and S-8-oxocitronellal 6. Conditions: 2 M NEPS, 0.5 M ISY, 1 mM NADPH, 5 mM NAD.sup.+ and 0.1 M MOPS pH 7.5. The behaviour of NEPS enzymes does not appear to be influenced by the ISY employed. This is especially notable due to the evolutionary distance and low sequence identity of CrISY and NmISY2. This outcome suggests the interplay between the ISY and NEPS activities is chemical in nature and does not rely on specific protein-protein interactions. The only observable difference between the chromatograms is the trace presence of the double reduction product 7 in reactions with CrISYthis is a result of a promiscuous CrISY activity. RT=retention time (min)
[0108]
[0109] Products measured: cis-trans-nepetalactol 4a, cis-cis-nepetalactol 4b, cis-trans-iridodials 5a, trans-trans-iridodials 5d, trans-cis-iridodials 5c, cis-cis-nepetalactone 1b, 8-oxogeranial 2, 8-oxoneral ON. Conversions reported as PA=peak area (% of total).
[0110] A, Influence of NEPS3 concentration on products. As NEPS3 concentration is increased, the proportion of cis-cis-nepetalactol 4b formed increases. The proportion of cis-trans-nepetalactol 4a, cis-trans-iridodials 5a and trans-cis-iridodials 5c decrease. At high NEPS3 concentrations, trace formation of cis-cis-nepetalactone is observed. Reactions were conducted with 0.5 M CrISY, 0.5 mM 2, 1 mM NAD+, 1 mM NADPH, 50 mM HEPES pH 8 and 100 mM NaCl. B, Influence of NAD+ concentration. Reactions contained 0.5 mM 8-oxogeranial 2, and the equivalent quantity of NAD+ is represented as a dotted vertical line. If NAD+ is consumed in the reaction (with equal stoichiometry to 2), then we would expect maximum conversion at 500 M and no change beyond this concentration. However, at 50-150 M [NAD+] the product proportions reach a maximum, and >200 M appear relatively stable, most notably proportions of cis-trans-nepetalactol 4a and cis-cis-nepetalactol 4b. Only cis-cis-nepetalactone 1b, an oxidation product which requires consumption of NAD+, shows different behaviour. Furthermore, no remaining substrate 2 was observed in any samples, suggesting full conversion. Between 0-150 M [NAD+] the proportions of 4a and 4b do appear to change, with 4b concentration increasing as NAD+ is supplemented. This data indicates that NAD+ is not consumed in the NEPS3 catalysed formation of 4b (i.e. the cyclisation is not oxidoreductive) but its presence does aid the formation of 4b. It appears to play a strictly catalytic role, for example contributing to the NEPS3 structure. Reactions were conducted as in panel a but with varying [NAD+] and fixed 5 M NEPS3.
[0111] C, Influence of NADPH concentration. Reactions contained 0.5 mM 8-oxogeranial 2, and the equivalent stoichiometric quantity of NADPH is represented as a dotted vertical line. If NADPH is consumed in the reaction (with equal stoichiometry to 2), then we would expect maximum conversion at 500 M and no change beyond this concentration. This is essentially what is observed. The relative proportions of cis-trans-nepetalactol 4a and cis-cis-nepetalactol 4b are unaffected by changing [NADPH], but the overall conversion appears to be limited when [NADPH]<500 M. This is also observed in the unreacted substrate 2 at [NADPH]<500 M. NADPH appears to be consumed by ISY catalysed reduction, and does not affect NEPS3 cyclisation. Reactions were conducted as in panel a but with varying [NADPH] and fixed 5 M NEPS3. Product peak areas are represented as percentage product proportions, obtained by dividing product peak area by total product peak areas. Product peak areas are not normalised by standard curves so do not represent absolute concentrations. Note that peaks of 5a and 5d overlap in the GC methodpeak areas for these compounds were measured as a split peak (i.e. both to baseline) and not as a peak shoulder.
[0112]
[0113] A, GC-MS TICs of reactions with 0.5 mM S-8-oxocitronellal 6, 0.5 M CrISY, 2 M NEPS, 0 or 5 mM NAD+, 1 mM NADPH and 0.5 M MOPS pH 7.5. Compounds formed: tetra-hydro-8-oxogeranial 7, and products. The production of tetrahydro-8-oxogeranial 7 when both CrISY and NEPS are present is notable. TIC abundances for CrISY+NEPS2 and CrISY+NEPS3 have been reduced threefold. STD=standard, RT=retention time (min), E=enzyme.
[0114] B, EI spectra of tetrahydro-8-oxogeranial 7 in different reactions from panel a. A=abundance. C, Scheme of proposed processes occurring in cascades with 8-oxocitronellal 6, CrISY and NEPS. B=binding, T=tautomerisation, C=cyclisation, R=reduction, EB=enzyme bound, CP=cyclic products, FS=free in solution (low conc in presence of NEPS).
[0115] When no enzymes are present, 6 undergoes buffer catalysed tautomerisation (to enol 3) and cyclisation to form 4a and iridodials 5 (panel a, second chromatogram from top). CrISY reduces 6 to tetrahydro-8-oxogeranial 7. This reduction is in competition with the spontaneous tautomerisation/cyclisationthe 6 that CrISY is not able to reduce will undergo tautomerisation/cyclisation (panel a, third chromatogram from top). When both CrISY and NEPS enzymes are added, the tautomerisation/cyclisation process appears to be minimised, and 7 accumulates (panel a, bottom three chromatograms). To account for this, we hypothesise that NEPS are reversibly binding 6, reducing the concentration of free 6 in solution. CrISY is then able to reduce all the free 6 into 7, depleting 6 before it undergoes tautomerisation/cyclisation. In reactions with NEPS2 or 3 this process appears to ultimately convert all 6 into 7 (panel a, bottom two chromatograms). A crucial aspect of this process is that NEPS enzymes appear to be binding 6 without turning it over. This supports the notion that the enol 3 and not 6 is the key substrate for NEPS enzymes.
[0116]
[0117] A, NEPS3 tetramer structure. Subunit main-chain ribbons are rainbow coloured from N-termini (blue) to C-termini (red). NAD+co-factors depicted as black spheres.
[0118] B, NEPS3 subunit A structure aligned to secoisolariciresinol dehydrogenase (2BGL). NEPS3 depicted as light brown ribbons, secoisolariciresinol dehydrogenase depicted as cyan ribbons. Active site residues and NAD+ depicted as sticks. The two enzymes have 42% sequence identity. C, NEPS3 subunit A main chain depicted as ribbons, with NAD+ depicted as sticks. The 1.4 resolution electron density for the cofactor only (blue mesh, 2mFo-DFc, contoured at 1) is also shown.
[0119] D, Comparison of CrISY substrate binding site (SDBI) and NEPS3 chloride binding site. We hypothesise that the chloride occupies an oxyanion site (S154), analogous to the site on CrISY (K146). The chloride in NEPS3 is discreetly disordered and was refined in two positions A and B each with 50% occupancy. The chloride position B has a lower B-factor than position A in all four subunits. Due to this, it appears that position B is the major contributor to the electron density.
[0120]
[0121] NEPS1 and NEPS3 mutants were grown in 10 mL cultures, partially purified and assayed. The assays were conducted with 0.5 mM 8-oxogeranial 2, 0.25 M CrISY, 2.5 mM NAD+, 1 mM NADPH and 0.1 M MOPS pH 7.5. Products observed were cis-trans-nepetalactol 4a, cis-cis-nepetalactol 4b and cis-trans-nepetalactone 1a. Reactions were incubated for 8 h at 30 C. NEPS concentrations were approximately 2 M (total protein including impurities) based on absorbance at 280 nm. RT=retention time (min).
[0122] A, NEPS3 variants with soluble expression. N150T has maintained NEPS3 activity. S154L, K169M and M196S demonstrate low or no detectable formation of cis-cis-nepetalactol 4b. Variants A151T, G152T, S153P, Y165F had no detectable soluble expression.
[0123] B, NEPS1 variants demonstrating no detectable formation of cis-trans-nepetalactone 1a: T152N, L156S, Y176F, K171M, T202A. Variants labelled * (TT152NA, S198M) demonstrated poor soluble expression and thus low conversions may be a result of low NEPS concentrations and not simply activity.
[0124] C, NEPS1 variants demonstrating detectable formation of cis-trans-nepetalactone 1a. V110A demonstrated the greatest conversion to cis-trans-nepetalactone 1a, superior even WT. Variants T153A and V199A demonstrated reasonable conversions. Variants N125A and P155S catalysed trace but detectable formation of 1a. N125A demonstrated poor soluble expression/purification and thus low conversions may be a result of low NEPS concentrations and not simply activity.
[0125] D, NEPS1 variants containing the T154G substitution. All variants containing T154G showed increased formation of cis-trans-nepetalactol 4a compared to WT. T154G and TTT152NAG demonstrated the greatest cyclase activity (formation of 4a and decrease in iridodials 5), whilst maintaining reasonable dehydrogenase activity (evidenced by presence of 1a). TTTP152NAGS and TTTPL152NAGSS showed greater formation of 4a than WT but only trace dehydrogenase activity (1a). T154G is examined further in
[0126]
[0127] A, Time course of coupled assay with 8-oxogeranial 2, ISY and NEPS1 WT or T154G, presented as GC-MS TICs. Peak areas of 4a and 1a described in
[0128] B, Cyclase activity of NEPS1 investigated with 8-oxocitronellal 6. In the absence of additional co-factor, NEPS1 does not appear to detectably form cis-trans-nepetalactol 4a in the presence of 6 and buffer at greater than background levels. In contrast, NEPS1-T154G forms 4a at greater than background levels in the same conditions. Kinetic analysis of NEPS-T154G can be found in Table 2. Conditions: 0.5 mM S-8-oxocitronellal 6, 20 M NEPS1, 0.5 M MOPS pH 7.5, No NAD.sup.+. Formation of cis-trans-nepetalactol 4a detected.
[0129] References to colour features correspond with colour figures of a journal paper entitled Uncoupled activation and cyclisation in catmint reductive terpenoid biosynthesis (see Lichman et al., 2019, Nat Chem Biol 15: 71-79). Greyscale features in the figures filed herewith corresponding to the colour features of the paper figures and can be cross-referenced with the colour features noted in the examples below.
DETAILED DESCRIPTION OF THE INVENTION
[0130] In a first aspect the invention relates to a method for producing a monoterpenoid compound, comprising: [0131] (1) providing a monoterpenoid precursor; [0132] (1) providing an enzyme; and [0133] (1) contacting the monoterpenoid precursor with the enzyme under catalytic conditions to produce an monoterpenoid compound,
[0134] wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 [NEPS1], and/or SEQ ID NO: 2 [NEPS2], and/or SEQ ID NO: 3 [NEPS3], or a functional variant or homologue of any or all of these enzymes.
[0135] The enzyme may comprise an amino acid sequence comprising SEQ ID NO: 1 and be encoded by a nucleotide sequence comprising SEQ ID NO: 4 [NEPS1], and/or the enzyme may comprise an amino acid sequence comprising SEQ ID NO: 2 and be encoded by a nucleotide sequence comprising SEQ ID NO: 5 [NEPS2], and/or the enzyme may comprise an amino acid sequence comprising SEQ ID NO: 3 and be encoded by a nucleotide sequence comprising SEQ ID NO: 6 [NEPS3].
[0136] The monoterpenoid compound may comprise a monoterpene indole alkaloid (MIA).
[0137] The monoterpenoid precursor may comprise 8-oxocitronellyl enol and/or 8-oxocitronellal and/or derivatives thereof.
[0138] The method may further comprise an iridoid synthase (ISY) for example an ISY comprising an amino acid sequence of SEQ ID NO: 7 [AmISY], SEQ ID NO: 8 [NmISY] or SEQ ID NO: 9 [CrISY], or a functional variant or homologue thereof.
[0139] The ISY may further comprise an amino acid sequence of SEQ ID NO: 7 encoded by a nucleotide sequence comprising SEQ ID NO: 10 [AmISY], or an amino acid sequence of SEQ ID NO: 8 is encoded by a nucleotide sequence comprising SEQ ID NO: 11 [NmISY2], or an amino acid sequence of SEQ ID NO: 9 is encoded by a nucleotide sequence comprising SEQ ID NO: 12 [CrISY]. The monoterpenoid precursor may comprise 8-oxogeranial.
[0140] The monoterpenoid precursor or compound may comprise nepetalactol. The nepetalactol may comprise cis-trans nepetalactol, for example wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 2, or a functional variant or homologue thereof. The nepetalactol may comprise cis-cis nepetalactol, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1, or a functional variant or homologue thereof.
[0141] The monoterpenoid compound may comprise nepetalactone. The nepetalactone may comprise cis-trans nepetalactone, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 2, or a functional variant or homologue thereof. The nepetalactone may comprise cis-cis nepetalactone, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 3, or a functional variant or homologue thereof.
[0142] The nepetalactone may comprise both cis-trans nepetalactone and cis-cis nepetalactone, wherein the enzyme comprises an amino acid sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 3, or a functional variant or homologue thereof.
[0143] The catalytic conditions may comprise an oxidizing agent, for example oxidized nicotinamide adenine dinucleotide (NAD.sup.+).
[0144] The monoterpenoid compound may comprise a cyclopentapyran and/or oxadecalin.
[0145] The method of the invention may be performed in vivo, for example in planta.
[0146] The enzyme or enzymes may be provided by expression in vivo, for example heterologous expression.
[0147] The method of the invention may be performed in vitro, for example in an isolated plant cell, wherein the plant may be Nicotiana benthalmiana, Catharanthus roseus, or Nepeta ssp, for example Nepeta cataria, Nepeta racemosa, Nepeta faassenii or Nepeta mussinii.
[0148] The method may be performed in yeast, for example Pichia pastoris or Saccharomyces cerevisiae, or in bacteria, for example E. coli. The enzyme or enzymes may be provided by expression, for example heterologous expression, in the yeast, bacteria or plant cell.
[0149] In another aspect the invention relates to a method for producing a biologically active compound according to a method of the invention, and converting the monoterpenoid compound into a biologically active compound. The biologically active compound may be an insect repellent, insect attractant and/or feline attractant.
[0150] The biologically active compound may be a monoterpene indole alkaloid, for example vinblastine, vincristine, camptothecin, quinine and/or yohimbine.
[0151] In another aspect the invention relates to an isolated enzyme having an amino acid sequence comprising SEQ ID NO: 1, or a functional variant or homologue thereof.
[0152] In another aspect the invention relates to an isolated enzyme having an amino acid sequence comprising SEQ ID NO: 2, or a functional variant or homologue thereof.
[0153] In another aspect the invention relates to an isolated enzyme having an amino acid sequence comprising SEQ ID NO: 3, or a functional variant or homologue thereof.
[0154] In another aspect the invention relates to an isolated nucleic acid having a nucleotide sequence comprising SEQ ID NO: 4, or a functional variant or homologue thereof.
[0155] In another aspect the invention relates to an isolated nucleic acid having a nucleotide sequence comprising SEQ ID NO: 5, or a functional variant or homologue thereof.
[0156] In another aspect the invention relates to an isolated nucleic acid having a nucleotide sequence comprising SEQ ID NO: 6, or a functional variant or homologue thereof.
[0157] In another aspect the invention relates to a kit comprising: [0158] a first enzyme having a first amino acid sequence selected from the group comprising: SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3, or a functional variant or homologue thereof; and optionally also comprising: [0159] a second enzyme having an amino acid sequence selected from the group comprising: SEQ ID NO: 7, SEQ ID NO: 8 and/or SEQ ID NO: 9 or a functional variant or homologue thereof.
[0160] In another aspect the invention relates to an expression vector encoding an isolated enzyme of the invention, and optionally also encoding: a second enzyme having an amino acid sequence selected from the group comprising: SEQ ID NO: 7, SEQ ID NO: 8 and/or SEQ ID NO: 9, or a functional variant or homologue thereof. The expression vector optionally includes an artificial regulatory sequence.
[0161] In another aspect the invention relates to a host cell comprising the nucleic acid of and/or the expression vector of the invention.
[0162] In another aspect the invention relates to a host cell which has been genetically modified to express the enzyme of the invention and optionally also to express: a second enzyme having an amino acid sequence selected from the group comprising: SEQ ID NO: 7, SEQ ID NO: 8 and/or SEQ ID NO: 9, or a functional variant or homologue thereof.
[0163] In another aspect the invention relates to a host cell of the invention, wherein the cell is a yeast cell such as a Pichia pastoris cell, or a plant cell, for example a Nicotiana benthalmiana, Catharanthus roseus, or Nepeta ssp cell, for example Nepeta cataria, Nepeta racemosa, Nepeta faassenii or Nepeta mussinii cell.
[0164] In another aspect the invention relates to an a genetically modified plant comprising the nucleic acid and/or the expression vector of the invention.
[0165] In yet another aspect the invention relates to a plant which has been gene edited to express the enzyme(s) the invention, and optionally also gene edited to express a second enzyme having an amino acid having an amino acid sequence selected from the group comprising: SEQ ID NO: 7, SEQ ID NO: 8 and/or SEQ ID NO: 9, or a functional variant or homologue thereof.
[0166] The plant of the invention may be Nicotiana benthalmiana, Catharanthus roseus, or Nepeta ssp, for example Nepeta cataria, Nepeta racemosa, Nepeta faassenii or Nepeta mussinii.
[0167] References to variant include a genetic variation in the native, non-mutant or wild type sequence. Examples of such genetic variations include mutations selected from: substitutions, deletions, insertions and the like.
[0168] More generally, as used herein the term polypeptide refers to a polymer of amino acids. The term does not refer to a specific length of the polymer, so peptides, oligopeptides and proteins are included within the definition of polypeptide. The term polypeptide may include polypeptides with post-expression modifications, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition of polypeptide are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids), polypeptides with substituted linkages, as well as other modifications known in the art both naturally occurring and non-naturally occurring.
[0169] As used herein, a functional variant or homologue is defined as a polypeptide or nucleotide with at least 50% sequence identity, for example at least 55% sequence identity, at least 60% sequence identity, at least 65% sequence identity, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity with the reference sequence.
[0170] Sequence identity between nucleotide or amino acid sequences can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical amino acids or bases at positions shared by the compared sequences. When comparing sequences, optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences. Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties.
[0171] Suitable computer programs for carrying out sequence comparisons are widely available in the commercial and public sector. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4: 29; program available from http://bitincka.com/ledion/matgat), Gap (Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443-453), FASTA (Altschul et al., 1990, J. Mol. Biol. 215: 403-410; program available from http://www.ebi.ac.uk/fasta), Clustal W 2.0 and X 2.0 (Larkin et al., 2007, Bioinformatics 23: 2947-2948; program available from http://www.ebi.ac.uk/tools/clustalw2) and EMBOSS Pairwise Alignment Algorithms (Needleman & Wunsch, 1970, supra; Kruskal, 1983, In: Time warps, string edits and macromolecules: the theory and practice of sequence comparison, Sankoff & Kruskal (eds), pp 1-44, Addison Wesley; programs available from http://www.ebi.ac.uk/tools/emboss/align). All programs may be run using default parameters.
[0172] For example, sequence comparisons may be undertaken using the Needle method of the EMBOSS Pairwise Alignment Algorithms, which determines an optimum alignment (including gaps) of two sequences when considered over their entire length and provides a percentage identity score. Default parameters for amino acid sequence comparisons (Protein Molecule option) may be Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: Blosum 62. Default parameters for nucleotide sequence comparisons (DNA Molecule option) may be Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: DNAfull.
[0173] In one aspect of the invention, the sequence comparison may be performed over the full length of the reference sequence.
[0174] Particular non-limiting embodiments of the present invention will now be described in detail.
EXAMPLES
Example 1
Introduction
[0175] Terpene synthases typically form complex molecular scaffolds by concerted activation and cyclization of linear starting materials in a single enzyme active site. Here we show that iridoid synthase, an atypical reductive terpene synthase, catalyses the activation of its substrate 8-oxogeranial into a reactive enol intermediate but does not catalyse the subsequent cyclisation into nepetalactol. This discovery led us to identify a class of nepetalactol-related short-chain dehydrogenase enzymes (NEPS) from catmint (Nepeta mussinii) which capture this reactive intermediate and catalyse the stereoselective cyclisation into distinct nepetalactol stereoisomers. Subsequent oxidation of nepetalactols by NEPS1 provides nepetalactones, metabolites that are well known for both insect-repellent activity and euphoric effect in cats. Structural characterisation of the NEPS3 cyclase reveals it binds to NAD.sup.+ yet does not utilise it chemically for a non-oxidoreductive formal [4+2] cyclisation. These discoveries will complement metabolic reconstructions of iridoid and monoterpene indole alkaloid biosynthesis.
[0176] Results
[0177] The Mechanism of Iridoid Synthase (ISY)
[0178] Recently we hypothesised that synthesis of the different nepetalactone stereoisomers in Nepeta was controlled by species-specific ISYs catalysing both the reduction of 2 and the subsequent stereodivergent cyclisations. However, this was not the case; Nepeta ISYs produced the same stereoisomeric product profile as CrISY. Therefore, an alternative mechanism for the control of iridoid stereochemistry was developed.
[0179] The first step toward understanding the origin of the divergent stereochemistry of nepetalactones 1 was to further explore the ISY mechanism. As observed in previous studies, the ISY catalysed reduction of 8-oxogeranial 2 generates a number of isomeric products (
[0180] Although the product profile was invariant with respect to the enzyme catalyst, it was strongly influenced by the reaction conditions, especially the concentration of the buffer (
[0181] The sensitivity of the product distribution to changes in solvent conditions led us to hypothesise that ISY reduces 2 to form the activated intermediate 3 which then leaves the enzyme active site and diffuses into the solvent. In the solvent, 3 can quench through either cyclisation or tautomerisation to form a mixture of products. We propose that the buffer acts as a general acid catalyst, promoting tautomerisation. Using MOPS buffer, this results in three regimes (
[0182] To validate that the ISY product profile was a result of the non-enzymatic cyclisation of 3, we aimed to form 3 in the absence of enzyme. This was achieved by incubation of S-8-oxocitronellal 6 in unbuffered water at acidic (<2) or alkaline (>10) pHs (
[0183] Therefore, unlike canonical terpene synthases which catalyse concerted activation and cyclisation (
[0184] Identification of Nepetalactol Related Short-Chain-Reductases (NEPS)
[0185] Identifying a cyclase that works in partnership with ISY presents a challenge: because this proposed reaction is unprecedented, it is difficult to predict what type of enzyme family would catalyse such a cyclisation. However, nepetalactone biosynthesis in Nepeta is localised to a specific plant organ, glandular trichomes. Therefore, we could compare the proteome of trichomes to trichome-depleted leaves to identify genes that are selectively expressed at the site of nepetalactone biosynthesis, thereby considerably narrowing the pool of potential gene candidates.
[0186] We obtained proteomes for Nepeta mussinii trichomes, leaves and trichome-depleted leaves (
[0187] As a starting point, we initially used these proteomes to identify the enzyme that converts nepetalactol 4 to nepetalactone 1, an NAD.sup.+ dependent enzyme. An enzyme with such activity had previously been isolated from the trichomes of Nepeta mussinii but its sequence was not identified. Six trichome enriched dehydrogenase genes were cloned and recombinantly expressed in E. coli (
[0188] The active enzyme is a short-chain reductase (SDR), part of the SDR110C family, a large and diverse family of NAD-dependent dehydrogenases often associated with plant secondary metabolism. Consequently, it was named Nepetalactol-related SDR 1 (NEPS1). NEPS1 could catalyse the NAD.sup.+-dependent dehydrogenation of either cis-trans-nepetalactol 4a or cis-cis-nepetalactol 4b to the corresponding nepetalactones 1a and 1b (
[0189] Sequence analysis of NEPS1 and the remaining dehydrogenase candidates revealed two additional trichome enriched paralogs of NEPS1, NEPS2 and NEP3 (
[0190] NEPS Activities in Conjunction with ISY
[0191] As described above, mechanistic investigations of ISY led us to hypothesise that a separate cyclase enzyme may act on the activated intermediate 3 that is generated by ISY. To test whether NEPS act as such cyclases, we performed one-pot cascade reactions combining NEPS enzymes with the ISY catalysed reduction of 8-oxogeranial 2 (
[0192] The cyclisation of 3 into 4 is a non-oxidoreductive net [4+2] cycloaddition. The cyclase activities of NEPS also do not appear to be oxidoreductive. Investigation into the co-factor dependence of the ISY-NEPS3 reactions demonstrated this: NAD.sup.+ concentrations were not limiting to overall reaction conversions, suggesting that NAD.sup.+ was not consumed (
[0193] NEPS Activities with S-8-Oxocitronellal
[0194] To verify the NEPS activities, reactions were conducted with S-8-oxocitronellal 6 and without ISY (
[0195] Neither NEPS1 nor NEPS3 were active when incubated with 6 in the absence of buffer (
[0196] Support for the non-oxidoreductive nature of the NEPS3 cyclisation came from incubating NEPS3 with 6 and buffer in the absence of supplemented NAD.sup.+ or NADPH: formation of cis-cis-nepetalactol 4b was still observed (
[0197] Structure and Mechanism of NEPS Enzymes
[0198] To understand the mechanism of the NEPS3 cis-cis cyclisation reaction, we obtained an X-ray crystal structure of NEPS3 bound to NAD.sup.+ (6F9Q, Table 3). In common with structural homologs, it forms a homotetramer with 222 symmetry, with the four active centres contained entirely within individual protomers (
[0199] Homology models of NEPS1 and NEPS2, based on the NEPS3 structure, were generated to enable comparison of the enzyme active sites (
[0200] Interestingly, the NEPS3 structure appeared to feature a chloride anion bound to the amide NH and side chain of S154. Based on the presence of the chloride, and the similarity to the substrate oxyanion binding site in CrISY, this position may be a substrate oxyanion binding site (
[0201] Active site residue roles in NEPS1 and NEPS3 were probed via mutational screens (Table 4). NEPS3 was especially sensitive to mutation, with several active site substitutions abolishing detectable soluble expression (A151T, G152T, S153P, Y165F). These mutations may have disrupted the H-bonding network in the active site, reducing protein stability. Of the mutations yielding soluble protein, only N150T maintained native levels of activity, whilst S154L, K169M and M196S had a severe reduction or complete loss of activity (
[0202] The role of the NEPS3 S154 putative oxyanion binding site was examined by further characterisation of NEPS3-S154L and the complementary NEPS1-L156S variant. NEPS3-S154L (2 M) demonstrated no detectable cis-cis cyclase activity, though at higher enzyme concentrations (10 M), the variant appeared to promote the formation of cis-trans-nepetalactol 4a (
[0203] The NEPS1-T154G variant was also characterised further. Compared to NEPS1-WT, the variant accumulated 4a and showed impaired formation of 1a (
Discussion
[0204] Here we demonstrate how a mechanistic analysis of ISY led to the hypothesis that a separate cyclase is responsible for setting the stereochemistry of the iridoid framework. A comparative proteomic analysis allowed discovery of these cryptic enzymes. These NEPS enzymes demonstrate the plasticity and innovation characteristic of plant secondary metabolism enzymes. NEPS3, for example, is an SDR by structure and sequence yet its primary catalytic activity is non-oxidoreductive; NAD.sup.+ is utilised not as a co-substrate but as a protein structural scaffold. Interestingly, at very high NAD.sup.+ concentrations NEPS3 can catalyse dehydrogenation with low catalytic efficiency, a phenomenon that may be a glimpse into its evolutionary past.
[0205] Due to its inherent reactivity, in situ generation of the substrate 3 was required to reveal the activity of the NEPS enzymes. Reactive non-isolable substrates appear elsewhere in plant specialised metabolism, including monoterpene indole alkaloid and lignan biosynthesis. NEPS are reminiscent of dirigent proteins, proteins in lignan biosynthesis that control the stereoselective cyclisation of a reactive intermediate that is generated by a separate enzyme. There may be similar undiscovered steps in other metabolic pathways; these cannot be revealed in simple one substrate, one enzyme assays, but require multi-enzyme cascade strategies, making discovery of such enzymes challenging.
[0206] Based on the structural and mutant data, we propose that NEPS1/2 and NEPS3 catalyse cyclisation in different fashions. NEPS1/2 appear to allow the enol 3 to proceed down a default uncatalysed path, forming the same product as formed in water (
[0207] Phylogenetic analysis suggests the NEPS enzymes are unique to Nepeta. Yet ISYs from other organisms also do not catalyse iridoid cyclisation. Thus, it is likely that different cyclases, unrelated to NEPS, are operating in other iridoid producing species. The absence of such cyclases from iridoid pathways reconstituted in microbial organisms may have negatively impacted yields. The NEPS cyclases described here, especially NEPS2, a dedicated cis-trans cyclase, can be incorporated into such systems to improve yield.
[0208] We have revealed the biosynthetic origin of cis-trans and cis-cis-nepetalactone, compounds in Nepeta responsible for cat attraction and insect repellence. In doing so we have discovered three novel enzymes: two dedicated cyclases and one multifunctional cyclase-dehydrogenase. The structure of one of these enzymes reveals it has re-purposed a dehydrogenase structure for a different catalytic function. We have shown that iridoid biosynthesis involves uncoupled activation and cyclisation: a reactive, non-isolable enol is formed by reduction and cyclised by separate enzymes. Such findings will contribute to synthetic biology metabolic reconstructions and inform the de novo design of (bio)synthetic pathways; they also highlight the dynamic and innovative nature of plant natural product biosynthesis.
[0209] Materials and Methods
[0210] Data Availability
[0211] The sequences of N. mussinii NEPS enzyme have been deposited in GenBank/EMBL/DDBJ with the accession codes: MG677124 (NmNEPS1), MG677125 (NmNEPS2) and MG677126 (NmNEPS3). The NAD.sup.+ bound NmNEPS3 (7S-cis-cis-nepetalactol cyclase) X-ray structure has been deposited in the PDB with the accession code 6F9Q. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD008704.
[0212] Chemicals
[0213] All chemicals were purchased from Sigma-Aldrich unless noted. Compound identity and purity were determined using NMR spectroscopy, using a Bruker 400 MHz/54 mm UltraShield Plus, long hold time automated spectrometer at 400 MHz (.sup.1H-NMR) and 100 MHz (.sup.13C-NMR).
[0214] 8-oxogeranial 2 was synthesized. Geranyl acetate (5 g, 29.5 mmole) was added to a mixture of selenium dioxide (433 mg), dichloromethane (12.5 mL) and tert-butyl hydroperoxide (12 mL, 70% w/v water), and stirred at room temperature for 30 h. The mixture was diluted in Et.sub.2O (up to 40 mL) and then filtered through celite, washed with Na.sub.2S.sub.2O.sub.3 (60 g/L, 340 mL), sat. NaHCO.sub.3 (40 mL), H.sub.2O (240 mL) and brine (40 mL). The organic fractions were dried over MgSO.sub.4/charcoal and concentrated in vacuo. The crude product was purified by silica flash chromatography using hexane and 0-30% v/v EtOAc in a gradient elution. Fractions were concentrated in vacuo to yield 8-oxogeranyl acetate (1.45, 27%) and 8-hydroxygeranyl acetate (1.42, 26%). 8-oxogeranyl acetate (1 g, 4.75 mmole) was then added to a mixture of K.sub.2CO.sub.3 (329 mg, 0.5 eq), MeOH (9.5 mL) and H.sub.2O (0.5 mL). The reaction was stirred at room temperature for 2 h, then H.sub.2O (60 mL) and brine (20 mL) were added. This was extracted into EtOAc (920 mL) and concentrated in vacuo. The compound was purified by silica flash chromatography using hexane and 0-50% v/v EtOAc in a gradient elution. Fractions were concentrated in vacuo to yield 8-oxogeraniol (0.57 g, 71%). Finally, to 8-oxogeraniol (500 mg, 2.97 mmole) was added dichloromethane (35 mL), NaHCO.sub.3 (1.5 g, 6 eq) and Dess-Martin periodinane (1.51 g, 1.2 eq). this mixture was stirred on ice for 1 h. The crude product was partially purified by silica chromatography using Et.sub.2O/hexane and then Et.sub.2O as eluant. Fractions were concentrated in vacuo to yield partially purified 8-oxogeranial (416 mg). A portion of this was purified further using Florisil gel chromatography and Et.sub.2O/hexane and then Et.sub.2O as eluants. The identity and purity of the final 8-oxogeranial compound was confirmed by NMR and GC-MS.
[0215] S-8-oxocitronellal 6 was synthesised. S-citronellal (1 g, 6.48 mmole) was added to a mixture of selenium dioxide (115 mg), dichloromethane (2.5 mL) and tert-butyl hydroperoxide (2.6 mL, 70% w/v water). The mixture was stirred at room temperature. After 48 h, the mixture was diluted with Et.sub.2O (to 10 mL) and filtered over celite. The filtrate was washed with aq. Na.sub.2S.sub.2O.sub.3 (60 g/L, 310 mL), sat. NaHCO.sub.3 (10 mL), H.sub.2O (210 mL) and brine (10 mL). The organic fractions were dried over MgSO.sub.4/charcoal and concentrated in vacuo. The crude product was purified by silica flash chromatography using a hexane and 0-30% v/v EtOAc in a gradient elution. The fractions containing the product S-8-oxocitronellal were identifiable by TLC by their strong UV absorbance and anisaldehyde staining. These fractions were combined and concentrated to yield S-8-oxocitronellal 6 (152 mg, 14%). The identity and purity of this compound was confirmed by NMR and GC-MS. This compound contained approximately 10% of an inseparable impurity tentatively identified as S-8oxocitronellal-1-di-tert-butyl acetal.
[0216] 2,3,6,7-tetrahydro-8-oxogeranial 7 was obtained by biotransformation. 8-oxocitronellal 6 (10 mole) was added to a mixture (20 mL) containing CrISY (0.5 M), NEPS3 (2 M), NADPH (1 mM), NAD.sup.+ (5 mM) and MOPS (0.5 M, pH 7.5). The reaction was incubated at 30 C. for 16 h and then extracted with EtOAc (320 mL). The organic fractions were washed with brine (20 mL), dried with MgSO.sub.4 and concentrated in vacuo to yield 2,3,6,7-tetrahydro-8-oxogeranial (0.4 mg, 23%). The identity of this compound was confirmed by NMR and GC-MS. The compound was not completely pure, but was sufficient for use as a GC-MS compound standard.
[0217] Cis-trans-nepetalactone 1a was isolated from Nepeta fassinii Six Hills Giant (Burncoose Nurseries, Gwennap, Redruth, Cornwall, TR16 6BJ, UK). Cis-cis-nepetalactone 1b was isolated from Nepeta mussinii Snowflake (Burncoose Nurseries, Gwennap, UK). Trans-cis-nepetalactone 1c was isolated from catnip oil. Cis-trans-nepetalactol 4a was obtained by DIBAL-H reduction of 1a. Cis-cis-nepetalactol 4b was obtained by DIBAL-H reduction of 1b. Cis-trans-iridodial 5a was obtained by acid hydrolysis of cis-trans-nepetalactol 4a. Cis-cis-iridodial 5b was obtained by acid hydrolysis of cis-trans-nepetalactol 4a. Trans-cis-iridodial 5c was obtained by DIBAL-H reduction of trans-cis-nepetalactone 1c. Chemical identity and purity of these compounds were verified by NMR and GC-MS as reported previously. Trans-trans-iridodial 5d was obtained. First cis-cis-nepetalactone 1b was epimerised to trans-trans-nepetalactone and then this compound underwent DIBAL-H reduction to yield 5d.
[0218] Proteome Analysis
[0219] Whole leaves from N. mussinii (1.5 g4, obtained from Herbal Haven, Coldhams Farm, Rickling, Saffron Walden, CB11 3YL, UK) were placed into a 50 mL centrifuge tube and to this was added powdered dry ice (approximately 20 mL). This was vortexed (1 min, 20,000 rpm) and the dry material was poured through meshes (200 m and 100 m) and the material passing through the meshes was collected. To maximise yield, leaves and tubes were washed with cold isolation buffer (200 mM sorbitol, 25 mM HEPES, 5 mM MgCl2, 5 mM succinic acid, 1 mM EGTA, 0.5 mM NaH.sub.2PO.sub.4, 5 mM DTT, 2 mM sucrose, pH 7) and this was filtered through a mesh (100 m) and collected. Samples were inspected by light microscopy to determine success of the extraction step. The samples were centrifuged (700g, 10 min), the supernatant removed to yield a pellet containing trichomes. Leaves and trichome-depleted leaves were frozen in liquid nitrogen and homogenised with a pestle and mortar. Trichomes were resuspended in extraction buffer (1 mL, 0.1 M Tris-HCl pH 8, 2% w/v SDS, 30% w/v sucrose, 5% v/v 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride), vortexed and homogenised by sonication (10 s ON, 10 s OFF, 20 cycles). Tris-buffered phenol (1 mL) was added to homogenised samples, then vortexed (10 min) and centrifuged (10,000g, 10 min). The upper layer was obtained and to this was added extraction buffer (1 mL) and the mixture vortexed (5 min) and centrifuged (10,000g, 10 min). The upper layer was transferred to a new tube and to this, four volumes of methanol/0.1 M NH.sub.4Ac (1:1, 20 C.) were added, the sample mixed and then incubated at 20 C. overnight. The precipitated protein was pelleted by centrifugation, and the pellet was washed twice with methanol/0.1 M NH.sub.4Ac (1:1, 20 C.) and then with acetone (20 C.). The acetone was removed and the pellet air-dried.
[0220] Protein pellets from leaves and depleted leaves were dissolved in 5% sodium deoxycholate (SDC), 50 mM phosphate buffer pH 8, pellets from trichomes in 1% SDC, 50 mM phosphate buffer pH 8. Protein concentration was determined using the Direct Detect spectrometer (Merck Millipore, UK). The total protein amount was 400 g for leaves, 225 g for depleted leaves and 20 g for trichomes. Samples were treated with DTT and iodoacetamide to reduce and alkylate cysteine residues. The total trichome sample and 50 g of the leaf samples were digested with trypsin. SDC was removed by acid precipitation, and aliquots of approx. 1 g were used for data dependent LC-MS/MS analysis on an Orbitrap-Fusion mass spectrometer (Thermo Fisher, Hemel Hempstead, UK) equipped with an UltiMate 3000 RSLCnano System using an Acclaim PepMap 018 column (2 m, 75 m500 mm, Thermo). The samples were loaded and trapped using a pre-column which was then switched in-line to the analytical column for separation. Peptides were eluted with a gradient of 6-38% acetonitrile in water/0.1% formic acid at a rate of 0.4% min.sup.1. The column was connected to a 10 m SilicaTip nanospray emitter (New Objective, Woburn, Mass., USA) for infusion into the mass spectrometer. Data dependent analysis was performed using a parallel HCD/CID fragmentation method with the following parameters: positive ion mode, orbitrap MS resolution=60k, mass range (quadrupole)=300-1500 m/z, MS2 in ion trap, threshold 2e4, isolation window 1.6 Da, charge states 2-5, inject for all available parallelisable time with 3 s cycle time, AGC target 2e3, max inject time 100 ms, dynamic exclusion 1 count within 10 s and 60 s exclusion, exclusion mass window 7 ppm. MS scans were saved in profile mode while MSMS scans were saved in centroid mode.
[0221] Raw files from the Orbitrap were processed with MaxQuant (version 1.5.3.30) to generate recalibrated peaklist files which were used for database searches with the Mascot search engine (version 2.4.1, Matrixscience, London). A predicted peptide library was generated from the N. mussinii transcriptome by translation of predicted open reading frames (minimum size 100 bp, ATG start codon, start/stop codons can be outside sequence). This predicted peptide library was annotated with phmmer using Swiss-Prot reference proteins (http://www.uniprot.org/) and used for the Mascot database search using trypsin/P with 2 missed cleavages, carbamidomethylation (C) as fixed and oxidation (M), acetylation (protein N-terminus), and deamidation (N,Q) as variable modifications. Mass tolerances were 6 ppm for precursor ions and 0.6 Da for fragment ions. Mascot search results were imported into the Scaffold software and the Scaffold quantitative value (normalised total spectra) was used for a pairwise comparison between trichome and trichome-depleted leaves samples using Fisher's exact test with Benjamini-Hochberg multiple test correction. MEP pathway enzymes were putatively identified by functional annotation. Nepetalactol dehydrogenase candidates were selected by the following criteria: functionally uncharacterised, statistically significant trichome enrichment (p<0.05) and enzyme class EC 1.1.1.-(oxidoreductase, acting on alcohols, NAD(P).sup.+ dependence).
[0222] Cloning
[0223] cDNA was obtained. Primers for dehydrogenase candidates were designed based on the transcriptome sequence and 5-overhangs were added for cloning into the pOPINF vector (forward: 5-AAGTTCTGTTTCAGGGCCCG-3 (SEQ ID NO: 13), reverse: 5-CTGGTCTAGAAAGCTTTA-3 (SEQ ID NO: 14)). The primers were used to PCR amplify the genes from the cDNA. These were purified from an agarose gel and then cloned into a linearised pOPINF vector using an InFusion HD cloning kit (Clontech). Plasmid sequences were verified with Sanger sequencing. Cloned sequences NEPS2 and NEPS3 did not precisely match full length sequences from the transcriptome, but appeared to contain regions from multiple transcripts. The poor assembly of these genes is indicative of close paralogs or alternative splicing. SoluBL21 E. coli cells (Genlantis) were transformed with the plasmids for expression.
[0224] Mutations were introduced into the NEPS1 and NEPS3 genes by PCR. First, two gene fragments were amplified. The first fragment was cloned using the gene specific forward primer from the original cloning and a reverse primer ending 5 of the mutation site (reverse mutation primer). The second fragment cloned employed a forward mutation primer encompassing the mutation site (forward mutation primer) and the reverse primer from the original cloning. The fragments were gel-purified and then a third PCR, using the original gene specific forward and reverse primers, was used to assemble the fragments. This gene-length amplicon was gel-purified and then cloned into the pOPINF vector using an InFusion HD cloning kit (Clontech). Plasmid sequences were verified with Sanger sequencing. SoluBL21 cells (Genlantis) were transformed with the plasmids for expression.
[0225] Enzyme Expression and Purification
[0226] Expression strain cells containing the plasmids of interest were grown overnight (LB media, 10 mL, 100 g/mL carbenicillin). 2xYT media with 100 g/mL carbenicillin was innoculated with overnight culture (5% v/v) and grown at 37 C. until OD.sub.600=0.5. The culture was then grown at 18 C. until OD.sub.600=0.6-0.8 and then protein production was induced with addition of IPTG (500 M). The cells were incubated at 18 C. for 16 hours before harvesting by centrifugation (4000g, 10 min). If the pellets were not used immediately, they were washed in PBS before storage at 20 C.
[0227] For the lysate assays used for screening for dehydrogenase activity, cultures (1 mL) of each dehydrogenase candidate were grown as described above. Cell pellets were resuspended in BugBuster MasterMix (100 L) (Merck), incubated at 4 C. for 10 min and then centrifuged (20,000g, 10 min). Supernatant lysate (1 L) was added to a mixture (100 L total) containing cis-trans-nepetalactol 4a (0.5 mM), NAD.sup.+ (1 mM) and sodium phosphate buffer (50 mM, pH 8.8). The reactions were followed for 30 min on a FLUOStar Omega multiplate reader (BMG Labtech) using absorbance at 340 nm (positioning delay 0.2 s, 22 flashes per well, 32 s cycle time, 1 s 200 rpm shaking each cycle). For each candidate, two control samples lacking both NAD.sup.+ and 4a or lacking just 4a were included. Control reactions with empty vector were also measured. Averages of absorbance measurements between 0-5 min and 25-30 min were obtained and compared to identify increases in absorbance (i.e. formation of NADH).
[0228] For initial screening of NEPS1 and NEPS3 variants, cultures (10 mL) of each NEPS variant were grown as described above. Cell pellets were resuspended in BugBuster MasterMix (1 mL, with cOmplete EDTA-free protease inhibitors (Roche)), incubated at 4 C. for 20 min and then centrifuged (20,000g, 20 min). Nickel-NTA agarose (100 L) (Qiagen) was washed in binding buffer (50 mM Tris-HCl pH 8, 50 mM glycine, 5% v/v glycerol, 0.5 M NaCl, 20 mM imidazole, 1 mM DTT), added to the supernatant lysate and the mixture was incubated at 4 C. for 1 h, gently rocking. The mixture was centrifuged (1000g, 1 min) and the supernatant discarded. The Ni-NTA pellet was washed twice with 1 mL binding buffer, and then elution buffer (50 mM Tris-HCl pH 8, 50 mM glycine, 5% v/v glycerol, 0.5 M NaCl, 500 mM imidazole, 1 mM DTT) was added (500 L). The mixture was centrifuged (1000g, 1 min), the supernatant collected and filtered (Ultrafree-MC VV Centrifugal Filter, Merck). The buffer was exchanged into sample buffer (20 mM HEPES pH 7.5, 150 mM NaCl) by four concentration-dilution steps using a centrifugal filtration (Amicon Ultra 10 kDa MWCO, (Merck)). The proteins were aliquoted and flash frozen in liquid nitrogen and stored at 80 C. SDS-PAGE analysis and spectrophotometric analysis (absorbance at 280 nm) was used to check purity and approximate quantity of protein.
[0229] For all enzyme assays, excluding the activity screens described above, and for crystal trials, cultures (1 L) were grown as described above. Cell pellets were resuspended in lysis buffer (binding buffer plus cOmplete EDTA-free protease inhibitors (Roche) and 0.4 mg/mL lysozyme) and incubated at 4 C. for 30 min. The lysate was then centrifuged (35,000g, 45 min, 4 C.) and the supernatant filtered (Minisart NML Plus 0.7 m GF (Sartorius)). The filtrate was applied to a 5 mL HisTrap HP column (GE Lifesciences) attached to a AKTA pure system (GE Lifesciences). The column was washed with binding buffer until no protein could be detected coming off the column (detection using absorbance at 280 nm). The protein of interest was then eluted by application of elution buffer to the column. The eluted protein was pooled, filtered (PES membrane, 0.45 m (Starlab)) and further purified by size-exclusion chromatography on a Superdex 200 16/60 GF column (GE Lifesciences). During this process, the protein was exchanged into sample buffer. Eluant fractions were analysed by SDS-PAGE, and those containing the protein of interest were pooled, concentrated by centrifugation (Amicon 10 kDa MWCO), flash frozen in liquid nitrogen and stored at 80 C. Protein purity was confirmed by SDS-PAGE analysis. Protein concentration was determined by spectrophotometric analysis at 280 nm using extinction coefficients calculated by ProtParam (http://web.expasy.org/protparam/).
[0230] Enzyme Assays
[0231] Kinetics and dehydrogenase activity measurements were conducted spectrophotometrically on a PerkinElmer Lambda 35 instrument at a wavelength of 340 nm and in cuvettes with 1 cm path length. The reactions were conducted at 25 C. and with 50 mM HEPES pH 8.0, 100 NaCl. Reactions were initiated by addition of the enzyme, and absorbance values were recorded at a rate of 1 Hz. Enzyme concentration was varied from 0.025-0.25 M to maintain a linear rate. The R software environment was used to fit linear initial rates over the first 20 s of the enzyme reaction. For Michaelis-Menten experiments, at least 8 data points were obtained for each substrate combination. The Michaelis-Menten equation was fitted to the data points in R by the nls function to obtain values for the kinetic parameters. Kinetic parameters are reported as a best fit estimateSE. For activity measurements with NADP.sup.+ and NADH, single substrate concentrations were employed. Velocity values (in italics) are provided as a mean of triplicate measurementsstandard deviation from the mean.
[0232] End-point assays with purified enzymes were conducted at a total volume of 100 L. Reactions using either 8-oxogeranial 2 or 8-oxocitronellal 6 as a substrate contained 1% v/v MeCN. In experiments examining the effect of buffer concentrations, enzymes were diluted with water. Trace residual concentrations of sample buffer in the enzyme sample were too low to effect product profiles. All reactions were conducted at 30 C. Reactions containing 8-oxogeranial 2 as a substrate were incubated for 3 h, whilst reactions with 8-oxocitronellal 6 were incubated for 16 h, unless noted. At reaction termination, a camphor standard (10 L, stock 1 mM in MeCN) and EtOAc (100 L) were added. The reactions were vortexed, centrifuged (10,000g, 10 min) and the organic layer was used in GC-MS analysis. The concentrations of components in reactions varied extensively and so for each reaction the Figure or Figure legend describe the exact conditions employed.
[0233] Gas Chromatography-Mass Spectroscopy
[0234] Samples were injected in split mode (2 L, split ratio 5:1) at an inlet temperature of 220 C. on a Hewlett Packard 6890 GC-MS equipped with a 5973 mass selective detector (MSD), and an Agilent 7683B series injector and autosampler. Separation was performed on a Zebron ZB5-HT-INFERNO column (5% phenyl methyl siloxane; length: 35 m; diameter: 250 m) with guard column. Helium was used as mobile phase at a constant flow rate of 1.2 mL/min and average velocity 37 cm/s. After 5 min at 80 C., the column temperature was increased to 110 C. at a rate of 2.5 K/min, then to 280 C. at 120 K/min, and kept at 280 C. for another 4 min. A solvent delay of 5 min was allowed before collecting MS spectra at a fragmentation energy of 70 eV. An internal standard of (+)-camphor was used for retention time calibration. Chemically characterised standards were used to identify compounds by retention time and electron impact spectra.
[0235] Crystallisation and Data Collection
[0236] NEPS3 was purified as described above. The protein (7 mg/mL) was thawed and incubated with C3-protease (0.36 mg/mL) for 1 h at room temperature. The protein was filtered (Ultrafree-MC VV Centrifugal Filter) and passed through Nickel-NTA agarose, removing the cleaved His-Tag and tagged C3-protease. The eluant (NEPS3 without tag) was concentrated to 7 mg/mL (Am icon 10 kDa MWCO) in sample buffer. Crystals were formed using the hanging drop method (3 L total, 1:2 protein:buffer, 1 mM NAD.sup.+ final concentration), using a precipitant comprised of 29% w/v PEG 4000 with 0.1 M MES pH 6.5. The crystals were cryo-protected with crystallisation buffer containing 20% v/v ethylene glycol, then flash-cooled in liquid nitrogen using LithoLoops (Molecular Dimensions), and stored in Unipuck cassettes (MiTeGen) prior to data collection. Crystals were transferred robotically to the goniostat on beamline I03 at the Diamond Light Source (Oxfordshire, UK), and maintained at 173 C. with a Cryojet cryocooler (Oxford Instruments). X-ray diffraction data were recorded to 1.4 resolution using a Pilatus 6M hybrid photon counting detector (Dectris), then integrated and scaled using XDS, via the XIA2 expert system, and then merged in a primitive monoclinic unit cell using AIMLESS; the resultant data collection statistics are summarized in Table 3.
[0237] Structure Solution and Refinement
[0238] The majority of the downstream analysis was performed through the CCP4i2 graphical user interface (http://www.ccp4.ac.uk/). A molecular replacement template for the NEPS3 subunit was prepared from PDB entry 2BGK, with which it shares 42% sequence identity, using SCULPTOR. The high resolution of the X-ray data was indicative of a low solvent content, and a value of 40% was estimated for four copies of the 28 kDa subunit in the asymmetric unit (ASU). Moreover, inspection of a self-rotation function revealed several non-crystallographic two-fold axes, in addition to the crystallographic two-fold. The functional unit of the template structure, secoisolariciresinol dehydrogenase, is a homotetramer with 222 symmetry, which prompted us to prepare an equivalent tetramer from the SCULPTOR output. The latter was used as the input for PHASER which produced a very convincing solution (TFZ score=15) in space group P21. This model was rebuilt with BUCCANEER and then improved with iterations of manual editing in COOT and refinement with REFMAC5. Initially, we had modelled elongated peaks of electron density, adjacent to the nicotinamide ring in each of the four independent active sites in the tetramer, as discretely disordered water molecules. However, after refinement, these were associated with significant amounts of positive difference electron density and they had refined temperature factor values significantly lower than those of the surrounding atoms, indicative of more electron dense species. Given that in each case the atom was within 3.6 of two backbone amides, it was re-assigned as a discretely disordered chloride ion (NaCl was present at 150 mM in the sample buffer). After refinement, the chloride ion temperature factors were comparable to, or slightly higher than, those of the surrounding atoms. The statistics of the final refined model, including analysis by MolProbity, are shown in Table 3. This model was deposited in the Protein Data Bank with accession code 6F9Q. Figures and structural alignments were made using UCSF-Chimera (http://www.rbvi.ucsf.edu/chimera/). Homology models of NEPS1 and NEPS2 were constructed using the iTasser server. NAD.sup.+ was added to the structures (using NEPS3 as a model) and then the complexes were energy minimised using the Yasara energy minimisation server. Docking calculations were performed with AutoDock Vina (exhaustiveness=8).
[0239] Phylogenetics and Sequence Analysis
[0240] Protein multiple sequence alignment NEPS and MpIPDH was performed with ClustalW2 and depicted with ESPript. For phylogenetic analysis, Lamiaceae and outgroup sequences were obtained from the Mint Genome Project (http://mints.plantbiology.msu.edu/, NCBI BioProject PRJNA359989). Sequences with homology to NEPS were identified by BLAST (https://blast.ncbi.nlm.nih.gov/). Mentha x piperita isopiperitenol dehydrogenase (MpIPDH, AY641428) was also included in the analysis. Prior to alignment, incomplete sequences and duplicated sequences were removed. The codon alignment was performed with MUSCLE, and then manually reviewed and curated to remove ragged ends. Phylogenetic tree inference was performed with 10-Tree 1.5.4. First, the substitution model (TIM+I+G4) was determined by ModelFinder. The maximum likelihood tree was then determined heuristically over 146 iterations, and branch support values were calculated using ultrafast bootstrapping (1000 replicates). The tree was visualised in FigTree v1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/).
TABLES
[0241]
TABLE-US-00001 TABLE1 PrimersusedtoclonedehydrogenasecandidatesfromN.mussiniicDNA. Primersweresynthesisedwithvectorspecificoverhangsasdescribedinmethods.Cloned sequencesNEPS2andNEPS3didnotpreciselymatchfulllengthsequencescontigsfromthe transcriptome,butappearedtocontainregionsfrommultiplecontigs.Thepoorassemblyofthese genesisindicativeofcloseparalogsoralternativesplicing. Contributing Original contigs Enzyme SwissProt contig (after Genespecificprimer name Annotation number sequencing) Forward GenespecificprimerReverse NEPS1 Q5C919 c20589_g1_i1 ATGGCAAGCACTGCAAAT CTGAAGGAGCAAAGAATGGTAA CC ACAAAGC (SEQIDNO:63) (SEQIDNO:69) NEPS2 Q5C919 c20589_g2_i1 c47141_g1_i1 ATGGGCAACAAGAAGACG TGATGTTGGTGCAAAGAATGG C T (SEQIDNO:64) (SEQIDNO:70) NEPS3 Q5C919 c20589_g3_i1 c43881_g1_i1 ATCGCTAACAATTCAGTG TGCTGAACCGAGGAGAAATGG ATGATGAAG (SEQIDNO:71) (SEQIDNO:65) Q6V4H0 C21160_g1_i1 ATGGCGAAATCACCAGAA GTCGGCTTTCAGTGAACCG ACAG (SEQIDNO:72) (SEQIDNO:66) Q6V4H0 C29133_g1_i1 ATGGCGAAATCAGTGAAC ATCGGTTTCAGTCAGCGTATT GC CC (SEQIDNO:67) (SEQIDNO:73) P25141 c30293_g1_i1 ATGGCCGACAACACCAC GAACTTGATAATAACCTTGAC (SEQIDNO:68) ACAATCAGG (SEQIDNO:74)
TABLE-US-00002 TABLE 2 Kinetic parameters of NEPS1 dehydrogenase activity. Enzyme Substrate [Substrate] M Co-substrate [Co-substrate] mM k.sub.cat or V s.sup.1 K.sub.m M NEPS1-WT 4a 0.25-100 NAD.sup.+ 1 0.148 0.002 1.6 0.1 NEPS1-WT 4b 1-100 NAD.sup.+ 1 0.32 0.01 4.9 0.8 NEPS1-WT NAD.sup.+ 1-250 4a 0.1 0.173 0.003 3.5 0.3 NEPS1-WT NADP.sup.+ 1000 4a 0.1 0.020 0.005 NEPS1-WT 1a 1000 NADH 0.1 no reaction NEPS1-T154G 4a 50-750 NAD.sup.+ 1 0.0804 0.005 251 37 NEPS1-T154G NAD.sup.+ 7.8-1000 4a 0.5 0.0599 0.002 26 4 Activity measured spectrophotometrically by absorbance at 340 nm. Activities are reported as k.sub.cat when substrate concentration was varied, and velocity (V, italics) when a single substrate concentration was used. Kinetic Michaelis-Menten parameters are reported as a best fit estimate SE. Velocity (italics) is reported as a mean of triplicate measurements standard deviation from the mean.
TABLE-US-00003 TABLE 3 X-ray data collection and refinement statistics Data collection Beamline I03, Diamond Light Source, UK Wavelength () 0.9763 Detector Pilatus 6M Resolution range.sup.a () 47.16-1.40 (1.42-1.40) Space Group P2.sub.1 Cell parameters (/) a = 63.9 b = 107.8, c = 69.4, = 104.3 Total no. of measured intensities.sup.a 1205639 (59269) Unique reflections.sup.a 175909 (8610) Multiplicity.sup.a 6.9 (6.9) Mean //(/).sup.a 11.2 (1.2) Completeness.sup.a (%) 98.6 (97.0) R.sub.merge.sup.a,b 0.090 (1.564) R.sub.meas.sup.a,c 0.097 (1.690) CC.sub.1/2.sup.a,d 0.999 (0.561) Wilson B value (.sup.2) 14.5 Refinement Resolution range.sup.a () 47.16-1.40 (1.42-1.40) Reflections: working/free.sup.e 167049 (8822) R.sub.work/R.sub.free.sup.a,f 0.150/0.168 (0.276/0.283) Ramachandran: favoured/allowed/disallowed.sup.g (%) 97.6/2.4/0.0 R.m.s. bond distance deviation () 0.011 R.m.s. bond angle deviation () 1.56 No. of protein residues (ranges): chains A, B, C, D 257 (9-265), 257 (9-265), 260 (7-266), 258 (9-266) No. of water molecules/NAD.sup.+ molecules/Cl.sup. ions 1050/4/4 Mean B factors: protein/water/NAD.sup.+/Cl.sup./overall (.sup.2) 17.9/30.2/14.4/20.9/18.4 PDB accession code 6F9Q .sup.aFigures in parentheses indicate values for the outer resolution shell. .sup.bR.sub.merge = .sub.hkl .sub.i |I.sub.i(hkl) I(hkl)
|/.sub.hkl.sub.iI.sub.i(hkl). .sup.cR.sub.meas = .sub.hkl[N/(N 1)].sup.1/2 .sub.i|I.sub.i(hkl)
I(hkl)
|/.sub.hkl.sub.iI.sub.i(hkl), where I.sub.i(hkl) is the ith observation of reflection hkl,
I(hkl)
is the weighted average intensoty for all observations i of reflection hkl and N is the number of observations of reflection hkl. .sup.dCC.sub.1/2 is the correlation coefficient between intensities taken from random halves of the dataset. .sup.eThe data set was split into working and free sets consisting of 95 and 5% of the data, respectively. The free set was not used for refinement. .sup.fThe R-factors R.sub.work and R.sub.free are calculated as follows: R = (|F.sub.obs F.sub.calc|)/|F.sub.obs|, where F.sub.obs and F.sub.calc are the observed and calculated structure factor amplitudes, respectively. .sup.gAs calculated using MolProbity.sup.4
TABLE-US-00004 TABLE4 PrimersusedinmutationinvestigationintoNEPS1andNEPS3. Enzyme Mutation ForwardMutationPrimer ReverseMutationPrimer NEPS1 V110A TGGGCTGGACATGATGTTCTCCAATGCGGGG ATTGGAGAACATCATGTCCA ATCATGAGCAAGTC GCCCA (SEQIDNO:15) (SEQIDNO:39) NEPS1 N125A GGAATTCGATAAAGTGATGCGCGTGGCCGCG CACGCGCATCACTTTATCGAA CGCGGGATGGCTGC TTCC (SEQIDNO:16) (SEQIDNO:40) NEPS1 T152N AGGAACGAGAGGCACTATTATCTGCAATACC GCAGATAATAGTGCCTCTCGT ACCCCGCTATCGTC TCCT (SEQIDNO:17) (SEQIDNO:41) NEPS1 T153A AACGAGAGGCACTATTATCTGCACGGCCACCC CGTGCAGATAATAGTGCCTCT CGCTATCGTCGAG CGTTCC (SEQIDNO:18) (SEQIDNO:42) NEPS1 T154G CGAGAGGCACTATTATCTGCACGACCGGCCC GGTCGTGCAGATAATAGTGC GCTATCGTCGAGG CTCTCG (SEQIDNO:19) (SEQIDNO:43) NEPS1 P155S AGGCACTATTATCTGCACGACCACCTCGCTAT GGTGGTCGTGCAGATAATAG CGTCGAGGGGCGGGCA TGCCT (SEQIDNO:20) (SEQIDNO:44) NEPS1 L156S CACTATTATCTGCACGACCACCCCGTCATCGTC CGGGGTGGTCGTGCAGATAA GAGGGGCGGGCA TAGTG (SEQIDNO:21) (SEQIDNO:45) NEPS1 Y167F GAGGGGCGGGCAAAGCATGACGGACTTTGC GTCCGTCATGCTTTGCCCGCC GATGTCGAAGCACG CCTC (SEQIDNO:22) (SEQIDNO:46) NEPS1 K171M AAGCATGACGGACTATGCGATGTCGATGCAC CGACATCGCATAGTCCGTCAT GCAGTGATGGG GCT (SEQIDNO:23) (SEQIDNO:47) NEPS1 S198M GATTAGGGTTAACTGCGTGACGCCGATGGTG CGGCGTCACGCAGTTAACCC GTGCTCACGCCGCT TAATCC (SEQIDNO:24) (SEQIDNO:48) NEPS1 V199A TAGGGTTAACTGCGTGACGCCGTCGGCGGTG CGACGGCGTCACGCAGTTAA CTCACGCCGCTCG CCCT (SEQIDNO:25) (SEQIDNO:49) NEPS1 T202A CTGCGTGACGCCGTCGGTGGTGCTCGCGCCG GAGCACCACCGACGGCGTCA CTCGCCCAACGGATG CGCAG SEQIDNO:26) (SEQIDNO:50) NEPS1 TT152NA AGGAACGAGAGGCACTATTATCTGCAATGCC GCAGATAATAGTGCCTCTCGT ACCCCGCTATCGTC TCCT (SEQIDNO:27) (SEQIDNO:51) NEPS1 TTT152 AGGAACGAGAGGCACTATTATCTGCAACGCC GCAGATAATAGTGCCTCTCGT NAG GGCCCGCTATCGTC TCCT (SEQIDNO:28) (SEQIDNO:52) NEPS1 TTTP152 AGGAACGAGAGGCACTATTATCTGCAACGCC GCAGATAATAGTGCCTCTCGT NAGS GGTAGCCTATCGTCGAGG TCCT (SEQIDNO:29) (SEQIDNO:53) NEPS1 TTTPL152 AGGAACGAGAGGCACTATTATCTGCAACGCC GCAGATAATAGTGCCTCTCGT NAGSS GGTAGCTCATCGTCGAGG TCCT (SEQIDNO:30) (SEQIDNO:54) NEPS3 N150T GGGAAGGGGAGGGTCCATCATATGCACCGCC GCATATGATGGACCCTCCCCT GGCTCGTCGGCGGT TCC (SEQIDNO:31) (SEQIDNO:55) NEPS3 A151T AAGGGGAGGGTCCATCATATGCAACACCGGC GTTGCATATGATGGACCCTCC TCGTCGGCGGTGAG CCTT (SEQIDNO:32) (SEQIDNO:56) NEPS3 G152T GGGAGGGTCCATCATATGCAACGCCACCTCG GGCGTTGCATATGATGGACC TCGGCGGTGAGG CTCC (SEQIDNO:33) (SEQIDNO:57) NEPS3 S153P AGGGTCCATCATATGCAACGCCGGCCCGTCG GCCGGCGTTGCATATGATGG GCGGTGAGGGGCGCGCA ACCCT (SEQIDNO:34) (SEQIDNO:58) NEPS3 S154L GTCCATCATATGCAACGCCGGCTCGCTGGCCG CGAGCCGGCGTTGCATATGA GTGAGGGGCGCGCA TGGAC (SEQIDNO:35) (SEQIDNO:59) NEPS3 Y165F GAGGGGCGCGCATGGCGTGACGGACTTCGTG GTCCGTCACGCCATGCGCGC ATGTCGAAGCATGC CCCTC (SEQIDNO:36) (SEQIDNO:60) NEPS3 K169M TGGCGTGACGGACTACGTGATGTCGAUGCAT CGACATCACGTAGTCCGTCAC GCGGTGATAGGGCTGGTG GCCA (SEQIDNO:37) (SEQIDNO:61) NEPS3 M196S TATTAGGGTTAACAGCGTGTCGCCGAGTGCC CGGCGACACGCTGTTAACCC GTGGCGACGCCGCT TAATACTG (SEQIDNO:38) (SEQIDNO:62)