APTAMER OF NATTOKINASE AND METHOD FOR SCREENING THE APTAMER
20210207128 ยท 2021-07-08
Inventors
- Yun FA (Qingdao, CN)
- Haijie ZHAO (Qingdao, CN)
- Mingyang GUAN (Qingdao, CN)
- QI WANG (QINGDAO, CN)
- Huizhou LIU (Qingdao, CN)
Cpc classification
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
Abstract
An aptamer of nattokinase and method for screening the aptamer are provided, which relate to technical fields of biotechnology. A set of nattokinase nucleic acid aptamers screened by capillary electrophoresis separation technology is: SEQ ID NO:1SEQ ID NO:17. The dissociation constants of the seven aptamers were detected by surface plasmon resonance technology, and the affinity of the seven aptamers was strong, with affinities between 8.7-87 nM. The nucleic acid aptamer of the present disclosure has precise specificity, high affinity, and is convenient for chemical modification, and can be used as an effective molecular recognition tool for the high-sensitive analysis of proteins. it. The recognition technology based on nucleic acid aptamers provides a basis for the development of NK determination and efficient separation and purification.
Claims
1. A method for screening nattokinase nucleic acid aptamer, comprising following steps: designing and constructing a random oligonucleotide library with fixed sequences at both ends; mixing and incubating the random oligonucleotide library with nattokinase, performing capillary electrophoresis separation, and collecting bound complexes; using the bound complexes as a template for asymmetric PCR amplification and preparing a secondary library; conducting multiple rounds of screening of secondary libraries, using complexes obtained in last round of screening for PCR amplification to obtain a nucleotide library that binds to nattokinase; purifying the nucleotide library, sequencing the nucleotide library to obtain candidate aptamers; and testing structure, affinity and specificity of candidate aptamers to obtain high affinity and high specificity nattokinase nucleic acid aptamers.
2. The method for screening nattokinase nucleic acid aptamer according to claim 1, wherein a condition of the capillary electrophoresis separation is as following: capillary temperature is 25 C., 0.5 psi, 20 s injection, separation voltage is 25 kV, a running buffer of capillary electrophoresis is 50 mmol/L boric acid-borax buffer with pH 7.8, a detection wavelength is 280 nm.
3. The method for screening nattokinase nucleic acid aptamer according to claim 2, wherein in the capillary electrophoresis separation process, nattokinase peaking at 3.3 min, ssDNA peaking at 9.9 min, and a peak of NK-ssDNA complex appearing at 15.2 min, and a collection time is 18.76 min-24.56 min.
4. The method for screening nattokinase nucleic acid aptamer according to claim 1, wherein combining a 69 nt random sequence library with nattokinase, the 69 nt random sequence is 5-TTGAGCCTACGAGCGATACC-29N-GATGTCAGGTGTCTCGTCGT-3, where 29N means that there are 29 random sequences of T, G, A or C.
5. The method for screening nattokinase nucleic acid aptamer according to claim 1, wherein a pair of primer sequences involved in asymmetric PCR are shown in SEQ ID NO: 18 and SEQ ID NO: 19, respectively, wherein a concentration of downstream primer is 0.5 mol/L, and a ratio of upstream and downstream primers is 30:1.
6. The method for screening nattokinase nucleic acid aptamer according to claim 1, wherein a pair of primer sequences involved in PCR amplification of a complex obtained in the last round of screening are shown in SEQ ID NO:23 and SEQ ID NO:24.
7. The method for screening nattokinase nucleic acid aptamer according to claim 1, wherein a nucleic acid purification method comprises magnetic bead purification.
8. An aptamer of nattokinase, a nucleotide sequence of aptamer is any one of SEQ ID NO:1 to SEQ ID NO:17.
9. The aptamer of nattokinase according to claim 8, the aptamer of nattokinase is obtained by the method for screening nattokinase nucleic acid aptamer of claim 1.
10. A kit for molecular recognition of nattokinase protein, comprising the aptamer of nattokinase of claim 8.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0047] In order to make objects, technical solutions and advantages of the present disclosure clearer, the present disclosure is further described in detail with examples. The devices and reagents used in the examples are commercially available unless otherwise noted. The examples are only for explaining the present disclosure, not for limiting the present disclosure, since various modifications and substitutions can be made without departing from the present disclosure.
[0048] The genes, proteins or fragments thereof involved in the present disclosure may be natural purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (for example, bacteria, yeasts, plants) through recombinant technology.
[0049] The nucleic acid aptamer specifically binding to the nattokinase target screened in the present disclosure is a new aptamer. Capillary electrophoresis technology is used to screen aptamers in the present disclosure. The screening efficiency of aptamers has been significantly improved, and the problems of cumbersome, time-consuming, low-efficiency and poor repeatability of traditional screening methods have been solved. The interaction of candidate aptamer with target is explored through surface plasmon resonance technology and capillary electrophoresis technology. The dynamics and thermodynamics of molecular interactions are studied. These provide a key basis for the establishment of the aptamer evaluation system. The research in this application is helpful to develop the unique advantages of nucleic acid aptamers, and can promote the research progress in the fields of NK active sites, catalytic mechanism, separation and purification.
[0050] The aptamer of nattokinase and method for screening the aptamer are described in the following examples.
Example 1 Establishment of Experimental Conditions
[0051] Experimental conditions in the screening process were explored, such as the type of running buffer, the best detection wavelength, etc. Finally, 50 mmol/L boric acid-borax buffer (pH 7.8) was selected as the running buffer for capillary electrophoresis and the solvent for the nattokinase sample, and 280 nm was selected as the detection wavelength. The experimental process is as follows:
[0052] 1. Establishment of Capillary Electrophoresis Analysis Method Suitable for Screening Nattokinase Aptamers
[0053] Analysis conditions of capillary electrophoresis: Column temperature was 25 C., 0.5 psi, 20 s injection, separation under 25 kV voltage.
[0054] Activation of the capillary: before the capillary is first used, it is washed with methanol, 0.1 mol/L hydrochloric acid solution, regenerating solution (0.1 mol/L NaOH solution) and buffer in sequence. The washing conditions are: 20 psi, 3.5 min. When changing different solutions, ultrapure water is required. Flush for 2.0 min at 20 psi.
[0055] Cleaning of capillary: before each injection, the capillary is washed with ultrapure water and running buffer in sequence. Flushing conditions: 15 psi, 3.0 min. The capillary must be reactivated after being loaded several times. After ultrasonic treatment of the test reagent, it needs to be filtered with a 0.22 m pore filter membrane before it can be used.
[0056] 2. Confirmation Experiment of NK Wavelength
[0057] Detect and compare the response values of samples with a concentration of 1.00 mg/mL at three wavelengths of 214, 254 and 280 nm to obtain the best detection wavelength. 50 mmol/L boric acid-borax buffer (pH 7.8) was used as the running buffer.
[0058]
[0059] 3. Separation Experiment of NK, NK-ssDNA and ssDNA
[0060] Nattokinase and ssDNA (the 69 nt random sequence library below) were dissolved in 50 mmol/L boric acid-borax buffer (pH 7.8). The concentration of NK was 2.0 mg/mL and the concentration of ssDNA was 5 mol/L. Capillary electrophoresis analysis was performed under the same conditions. The analysis conditions were the aforementioned optimized conditions.
[0061]
[0062] A mixed solution of 0.005 mg/mL NK and 100 mol/L ssDNA was prepared for capillary electrophoresis analysis, and the experiment was performed three times.
[0063] 4. Optimization of PCR Conditions
[0064] Experiments under optimal amplification conditions: 55 C., 57 C., 59 C., 61 C., 63 C., 65 C. were used as annealing temperature, random sequence was used as template for PCR. After the range of 61-63 C. was selected as the optimal annealing temperature, 61 C., 62 C., and 63 C. were used as the annealing temperature for experiments. When the annealing temperature was 61 C., the dissolution curve had a peak at 62 C. and a peak at 82 C., but the peak was very small (
[0065] 5. Optimization of Conditions for Preparing Secondary Libraries by Asymmetric PCR
[0066] Under the best PCR conditions, the primer concentration and the ratio of the two primers are constantly changing (primer sequence is shown in Table 1). The experimental results show that the concentration of primer P2 is 0.5 mol/L, and the primer ratio is 30:1. There are many asymmetric PCR products under this experimental condition. Although there were non-specific amplification products under this condition, specific amplification products can be well separated from non-specific products in gel electrophoresis, and can be used for gel recovery to prepare single-stranded secondary libraries.
[0067]
[0068] 6. Screening of NK Aptamers
[0069] The first round of screening is described as follows.
[0070] Before screening, the easily soluble random oligonucleotide library was denatured at 95 C. for no less than 10 minutes, and then slowly cooled to room temperature. After the random oligonucleotide library solution was cooled to room temperature, it was mixed with nattokinase. The concentration of nattokinase in the solution was about 0.0025 mg/mL (1.0 mol/L). The mixture was incubated at 30 C. for no less than 30 minutes, and slowly mixed up and down every 20 minutes. The amount of nattokinase was sufficient to fully bind to the oligonucleotide chain that can bind to nattokinase in the random oligonucleotide library. After being placed at room temperature for 10 minutes, the sample was separated.
[0071] The materials in collection window 1 and collection window 2 in
[0072] It can be seen from the figure that as the concentration of the random oligo ssDNA library increases, the baseline between the target nattokinase and the free nucleic acid library peaks tends to drift upward. This may be caused by the continuous dissociation of the ssDNA-NK complex during the electrophoresis process to produce a capillary coating. In the experiment, the baseline drift part and the peak position of the NK-ssDNA complex were collected at the same time.
[0073] The second round of screening are described as follows.
[0074] The NK-ssDNA complex collected in the first round of screening was used to replace the random nucleic acid library for the second round of nattokinase aptamer screening. The experimental conditions were consistent with the first round of screening. In the subsequent rounds of screening, the NK-ssDNA complexes collected in the previous round of screening were used to replace the random library. Aptamers with sufficient affinity for nattokinase were obtained through repeated screening.
[0075] In the second round of aptamer screening test, the collection of the first round was incubated with nattokinase. The solution was collected in sections after injection and analysis. The electrophoresis pattern collected by the aptamer was shown in
[0076] The third round of screening are described as follows.
[0077] The NK-ssDNA complex collected in the second round of screening was used as a template for PCR amplification. The PCR system and procedures were shown in Table 2 and Table 3. 69 nt-ssDNA (sequence shown in Table 1) and ultrapure water were used as templates for control experiments. The results of PCR gel electrophoresis were shown in
[0078] It can be seen from the figure that the bands of the products amplified with 69 nt-ssDNA library as template are basically the same as the bands of the collected NK-ssDNA complex samples. No scattering bands are produced, and these bands are located near the 100 bp mark. No product was formed in the blank control with ultrapure water as the template. This shows that the PCR amplification is successful, the collection contains NK-ssDNA complex, and the concentration is not higher than 1.0 nmol/Lol/mL. The ssDNA in the collected NK-ssDNA complex was successfully amplified. The third round of NK-ssDNA collection experiment was effective.
Example 2 Screening of Nattokinase Nucleic Acid Aptamer
[0079] The purchased nattokinase was purified by chromatography and identified. Aptamers were screened by using purified protein and experimental conditions determined in Example 1. The screening method is as follows.
[0080] 1. Design of Nucleic Acid Library and Primers
[0081] The sequence required for the experiment was designed by the nucleic acid primer design software Primer, and the secondary structure of the designed nucleic acid strand was evaluated by the NUPACK software and The Mfold Web Server.
[0082] 2. Nattokinase, Nucleic Acid and Complex were Separated by Capillary Electrophoresis
[0083] The concentration of the immobilized fluorescently labeled oligonucleotide library was 0.5 mol/L, and the concentration of nattokinase was 0.125 mol/L. After these two solutions were mixed, they were incubated at 30 C. under dark conditions. It was taken out every 10 minutes and shaken gently, and the sample was separated after 30 minutes. Separation conditions: capillary temperature was 25 C., 0.5 psi, 20 s injection, separation voltage 25 kV; before each injection, methanol, ultrapure water, 0.1 mol/L hydrochloric acid solution, ultrapure water, regenerant A (0.1 mol/L NaOH solution), ultrapure water, and running buffer were sequentially used for washing. Flushing conditions: 20 psi, 5.0 min; ultrapure water and running buffer were used for flushing between two injections. Flushing conditions: 15 psi, 3.0 min.
[0084] Nattokinase peaked at 3.3 min, and 69 nt-ssDNA peaked at 9.9 min. The baseline drift part was collected in the time range of 3.96 min to 11.88 min. The peak of NK-ssDNA complex appeared at 15.2 min. The complex was collected in the time range of 18.76 min to 24.56 min.
[0085] 3. After the Random Library was Combined with NK, the Secondary Library was Prepared by Asymmetric PCR.
[0086] The nucleic acid sequences of the primers and templates used in the PCR system were shown in Table 1.
TABLE-US-00001 TABLE1 SequenceandlengthusedinPCRsystem Length name Sequence(5-3) (nt) Upstream 5-ACGACGAGACACCTGACATC-3 20 primer(P.sub.1) SEQIDNO:18 downstream 5-TTGAGCCTACGAGCGATACC-3 20 primer(P.sub.2) SEQIDNO:19 Fixedsequence 5-TTGAGCCTACGAGCGATACCGAG 78 (gdDNA) TGACAATCGACACATATTAGTATCTT CAACCCGTAGATGTCAGGTGTCTCGT CGT-3SEQIDNO:20 80ntRandom 5-TTGAGCCTACGAGCGATACC- 80 sequence 40N-GATGTCAGGTGTCTCGTCGT-3 (80nt-ssDNA) SEQIDNO:21,40Nisa randomsequenceof40T,G, A,C. 69ntRandom 5-TTGAGCCTACGAGCGATACC- 69 sequence 29N-GATGTCAGGTGTCTCGTCGT-3 (69nt-ssDNA) SEQIDNO:22,29Nisa randomsequenceof29T,G, A,C
[0087] The various substances used in the PCR system and their concentrations were shown in Table 2.
TABLE-US-00002 TABLE 2 PCR reaction system The initial volume Reagent concentration (L) ddH.sub.2O Pure water 4.5 P.sub.1 2.0 mol/L 7.5 P.sub.2 2.0 mol/L 7.5 Target 1.0 nmol/Lol/L 3.0 PCR Master Mix 25 Eva Green 2.5 Total volume 50 L
[0088] The basic reaction procedures of the PCR system were shown in Table 3.
TABLE-US-00003 TABLE 3 Basic PCR reaction procedures Number of cycles transsexual annealing extend 1 94 C., 1 min 2-30 94 C., 30 s 61 C., 20 s 72 C., 10 s 31 72 C., 5 min
[0089] Asymmetric PCR system and procedures were shown in Table 4 and Table 5.
TABLE-US-00004 TABLE 4 Asymmetric PCR reaction system The initial volume Reagent concentration (L) ddH.sub.2O 12.25 P.sub.1 5 mol/L 7.5 P.sub.2 0.5 mol/L 2.25 Target 1.0 nmol/L 3.0 PCR Master Mix 25 Total volume 50 L
TABLE-US-00005 TABLE 5 Asymmetric PCR program Number of cycles transsexual annealing extend 1 94 C., 1 min 2-25 94 C., 30 s 61 C., 20 s 72 C., 10 s 26 72 C., 5 min
[0090] 4. The complex or secondary library (the secondary library can also be screened for multiple rounds according to the optimized conditions) obtained in the previous screening was used for PCR amplification, so that the pure nucleic acid combined with nattokinase was obtained. In this embodiment, the secondary library obtained by asymmetric PCR was used as a template for amplification. Specific operations: Genomic DNA was accurately quantified using Qubit 2.0 DNA detection kit, and the amount of DNA that should be added to the PCR reaction was determined. Illumina bridge PCR compatible primers were introduced into the primers used in PCR.
TABLE-US-00006 190294-F: SEQIDNO:23 AGCAGCACAGAGGTCAGATG,. 190294-R: SEQIDNO:24 TTCACGGTAGCACGCATAGG,.
[0091] PCR system was as follows.
TABLE-US-00007 Reagent volume 2 Taq master Mix 15 L Bar-PCR primer F (10 uM) 1 L Primer R (10 uM) 1 L PCR products (Last round) 10-20 ng H.sub.2O add to 30 L
[0092] PCR program was as follows.
[0093] Asymmetric PCR Program
TABLE-US-00008 Number of cycles transsexual annealing extend 1 94 C., 1 min 2-25 94 C., 30 s 61 C., 20 s 72 C., 10 s 26 72 C., 5 min
[0094] Table 1. Sequence and length used in PCR system
[0095] 5. Purify the Amplified Nucleic Acid
[0096] The specific operation was as follows.
[0097] 1) Magnetic beads were added to 40 L PCR product at a dose of 0.6-0.8 times (refer to Bioengineering Magnetic Bead Method Sequencing Product Purification Kit). The magnetic beads were adsorbed on the magnetic stand for 5 minutes after shaking and fully suspended, the supernatant was sucked out with a pipette.
[0098] 2) Magnetic beads were added to the remaining solution at a dose of 0.6-0.8 times. The magnetic beads were adsorbed on the magnetic stand for 5 minutes after shaking and fully suspended, the supernatant was sucked out with a pipette.
[0099] 3) 90 L WashBuffer (or 70% ethanol) was added to the remaining solution, the PCR tube was placed on the magnetic stand in the reverse direction, the magnetic beads were adsorbed to the other side of the PCR tube, and the supernatant was sucked out after sufficient adsorption.
[0100] 4) The PCR tube or 8-strip tube was placed in a 55 C. oven for 5 minutes to completely volatilize the alcohol inside.
[0101] 5) 30 L Elution Buffer was added for elution.
[0102] 6) The PCR tube was placed on the adsorption rack for 5 minutes. After fully adsorption, the supernatant was transferred to a clean 1.5 mL centrifuge tube for quantitative use.
[0103] 7) The purified nucleic acid was accurately quantified using Qubit2.0 DNA detection kit to facilitate sequencing after mixing in an equal amount of 1:1. The amount of DNA of each sample was 10 ng and the same amount is mixed, and the final sequencing concentration on the computer was 20 pmol.
[0104] 8) Finally, 17 candidate nucleic acid aptamers were obtained, the sequence was as follows.
TABLE-US-00009 NK-APT-01 SEQIDNO:1 CGCCTGAGGGATGACCTGTTCATGTAGGG. NK-APT-02 SEQIDNO:2 GACTACCGCGGAGATCTCCAATCGGGATG. NK-APT-03 SEQIDNO:3 AAATGAGGACCTCATTATCTTAGGAAGGT. NK-APT-04 SEQIDNO:4 GCCTTAAAAACGTCCTTAGTGACGTTTAC. NK-APT-05 SEQIDNO:5 GCTCACGTAGATTAAACTATGCTAAGAGC. NK-APT-06 SEQIDNO:6 CATTGCAATGTAACTGTCTAGCTTGACTG. NK-APT-07 SEQIDNO:7 CCGGTCGCCATGGGGGAGCTGCGTACCGC. NK-APT-08 SEQIDNO:8 CCATTCCAACTCGCTTTAAACATAAATCG. NK-APT-09 SEQIDNO:9 CTGTGAACCAAGGATTCATGCCGGTAAAC. NK-APT-10 SEQIDNO:10 GGGTTACGATCAGTCTCATGGAAACGACC. NK-APT-11 SEQIDNO:11 GTTGCAAGGAAAGCTATGCCTATGCCCCA. NK-APT-12 SEQIDNO:12 CTCGTGTAAAACGATGGTAGCTGTACTTG. NK-APT-13 SEQIDNO:13 AAAGGCGCTGTGCACAGTGTCCCCGCGGG. NK-APT-14 SEQIDNO:14 CCGAGGGGAATTCACCACGAATCGCCTCT. NK-APT-15 SEQIDNO:15 TCGATAGTTGTACTGGAGTGAATCACTGA. NK-APT-16 SEQIDNO:16 AAGACTCCAGTCGCGGCCTCTATCCGGGA. NK-APT-17 SEQIDNO:17 ACCCAAGTAGGCGAGTTCAGAACTGTGTG.
[0105] 6. The secondary structure of the obtained sequence was analyzed by Mfold software at 25 C. and Na.sup.+ of 50 mmol/L. The results showed that the obtained sequence generally had a neck loop structure. The affinity of the seven candidate aptamers with higher affinity was initially identified using CE-fluorescence detection technology.
[0106] First, the nucleic acid library without nattokinase was subjected to CE analysis. After adding nattokinase, perform CE electrophoresis analysis before and after incubation. The affinity was expressed by the percentage change in peak area S=(A.sub.0A.sub.1)/A.sub.0, where A.sub.0 was the peak area of the nucleic acid library, and A.sub.1 was the peak area of the nucleic acid library that was not bound to the target after incubation with the target nattokinase. The larger the ratio, the greater the affinity between nattokinase and the nucleic acid library.
[0107] The specific operation was as follows. Nucleic acid aptamers with representative secondary structures were synthesized by 56-FAM (FITC) fluorescent labeling. The aptamer was diluted to 0.5 mol/L with 50 mmol/L pH7.8 boric acid buffer. The easily soluble random oligonucleotide library was denatured and placed at 95 C. for no less than 10 min, and then slowly cooled to room temperature. 50 L of nucleic acid aptamer solution was added to 10 L of nattokinase solution with a concentration of 0.05 mg/mL, and the solution was made up to 100 L with 50 mM pH7.8 boric acid buffer to obtain an aptamer concentration of 0.25 mol/L and NK concentration of 0.005 mg/mL mixture. Incubate the mixture at 30 C. for 30 min and load the sample for analysis.
[0108]
[0109] 7. The identification of the affinity of the candidate aptamer and nattokinase was as follows.
[0110] Measurement conditions of steady-state affinity: Temperature: 4 C., flow rate: 30 l/min, binding time: 100 s, dissociation time: 100 s. 0-220 nmol purified NK was flowed through the chip in sequence, and an obvious steady-state response graph of SPR was obtained. The response value obtained in the equilibrium state was used for nonlinear fitting of different protein concentrations. The affinity KC of the protein-aptamer on the chip was 5.4 nmol/Lol/L.
[0111] NK with a concentration of 2KC was prepared and mixed with ten competing aptamers of different concentrations. Different SPR response values were obtained on the same chip, and nonlinear fitting was performed to obtain the KS of the other nine aptamers in solution. The concentration gradient of competing aptamers ranges from 0-200 nmol/L.
TABLE-US-00010 TABLE 6 The affinity constant KS of the ten aptamers screened name K.sub.S (nmol/L) R.sup.2 NK-APT-01 NK-APT-02 16 0.99 NK-APT-03 87 0.99 NK-APT-04 15 0.99 NK-APT-06 NK-APT-12 8.7 0.99 NK-APT-13 35 0.97 NK-APT-14 28 0.97 NK-APT-15 21 0.98 NK-APT-17
[0112] 7. Specific Determination of NK Nucleic Acid Aptamer
[0113] Different concentrations of bovine serum protein and trypsin were passed through the chip, and the response values obtained under the same conditions are shown in
[0114] The results showed that as the protein concentration increased, the SPR response value did not increase accordingly. It can be inferred that this aptamer did not bind to bovine serum protein and trypsin or had a weak binding force.
[0115] It is understood that the examples described herein are for illustrative purposes only, not for limiting the present disclosure. The various modifications, equivalent replacements and improvements made without departing the spirit and principle of the present disclosure should be all encompassed in the protection scope of the present disclosure. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.