COMPOSITION FOR PREVENTING, RELIEVING OR TREATING CLIMACTERIC DISORDERS COMPRISING LACTIC ACID BACTERIA AND PREBIOTICS

20210204583 ยท 2021-07-08

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to a composition for preventing, relieving or treating climacteric symptoms, the composition comprising lactic acid bacteria and prebiotic composition. The lactic acid bacteria of the present disclosure have -glucosidase activity and a very excellent ability to convert isoflavones into equol compounds, and thus may exhibit estrogenic activity through synergism with the gut microbiota. Therefore, the lactic acid bacteria of the present disclosure may be effectively used for the prevention, relief or treatment of women's climacteric or menopausal symptoms.

    Claims

    1. A food composition for preventing or alleviating climacteric or menopausal symptoms, the food composition comprising: (i) one or more lactic acid bacteria selected from the group consisting of lactic acid bacteria of the genus Bifidobacterium, lactic acid bacteria of the genus Lactobacillus, and lactic acid bacteria of the genus Lactococcus; and (ii) a prebiotic composition comprising isoflavone and a soybean germ extract.

    2. The food composition of claim 1, wherein the lactic acid bacteria of the genus Bifidobacterium are one or more lactic acid bacteria selected from the group consisting of Bifidobacterium lactis, Bifidobacterium breve, Bifidobacterium longum, and Bifidobacterium infantis; the lactic acid bacteria of the genus Lactobacillus are one or more lactic acid bacteria selected from the group consisting of Lactobacillus rhamnosus, Lactobacillus gasseri, and Lactobacillus helveticus; and the lactic acid bacteria of the genus Lactococcus are Lactococcus lactis.

    3. The food composition of claim 1, wherein the lactic acid bacteria are one or more lactic acid bacteria selected from the group consisting of Bifidobacterium lactis, Bifidobacterium infantis, Lactobacillus gasseri, and Lactobacillus helveticus.

    4. The food composition of claim 1, wherein the isoflavone is comprised in an amount of 1 to 50 wt % based on the weight of the prebiotic composition.

    5. The food composition of claim 1, wherein the climacteric or menopausal symptoms are hot flashes, night sweat, irregular menstrual cycles, loss of sexual desire, vaginal dryness, fatigue, hair loss, sleep disorder, attention difficulties memory loss, dizziness, weight gain, incontinence, abdominal bloating, allergies, brittle nails, changes in body odor, irregular heartbeats, depression, anxiety, restlessness, panic disorder symptoms, osteoporosis, osteopenia, hyperlipidemia, or dyslipidemia.

    6. A pharmaceutical composition for preventing or treating climacteric or menopausal symptoms, the pharmaceutical composition comprising: (i) one or more lactic acid bacteria selected from the group consisting of lactic acid bacteria of the genus Bifidobacterium, lactic acid bacteria of the genus Lactobacillus, and lactic acid bacteria of the genus Lactococcus; (ii) a prebiotic composition comprising isoflavone and a soybean germ extract; and (iii) a pharmaceutically acceptable carrier.

    7. The pharmaceutical composition of claim 6, wherein the lactic acid bacteria of the genus Bifidobacterium are one or more lactic acid bacteria selected from the group consisting of Bifidobacterium lactis, Bifidobacterium breve, Bifidobacterium longum, and Bifidobacterium infantis; the lactic acid bacteria of the genus Lactobacillus are one or more lactic acid bacteria selected from the group consisting of Lactobacillus rhamnosus, Lactobacillus gasseri, and Lactobacillus helveticus; and the lactic acid bacteria of the genus Lactococcus are Lactococcus lactis.

    8. The pharmaceutical composition of claim 6, wherein the lactic acid bacteria are one or more lactic acid bacteria selected from the group consisting of Bifidobacterium lactis, Bifidobacterium infantis, Lactobacillus gasseri, and Lactobacillus helveticus.

    9. The pharmaceutical composition of claim 6, wherein the isoflavone is comprised in an amount of 1 to 50 wt % based on the weight of the prebiotic composition.

    10. The pharmaceutical composition of claim 6, wherein the climacteric or menopausal symptoms are hot flashes, night sweat, irregular menstrual cycles, loss of sexual desire, vaginal dryness, fatigue, hair loss, sleep disorder, attention difficulties memory loss, dizziness, weight gain, incontinence, abdominal bloating, allergies, brittle nails, changes in body odor, irregular heartbeats, depression, anxiety, restlessness, panic disorder symptoms, osteoporosis, osteopenia, hyperlipidemia, or dyslipidemia.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0044] FIGS. 1a and 1b show the results of measuring the equol productivities of probiotic lactic acid bacteria in a soybean germ extract.

    [0045] FIGS. 2a and 2b show the results of measuring the -glucosidase activities of probiotic lactic acid bacteria in a soybean germ extract.

    [0046] FIG. 3a shows the results of measuring the effect of treatment of MCF-7 cells either with S30 or with a culture obtained by culturing each of probiotic lactic acid bacteria strains (B. lactis, B. infantis, L. gasseri, and L. helveticus) in S30 on the mRNA expression levels of estrogen-related genes (ESR1, ESR2 and pS2).

    [0047] FIG. 3b shows the results of measuring the effect of treatment of MG-63 cells either with S30 ort with a culture obtained by culturing each of probiotic lactic acid bacteria strains (B. lactis, B. infantis, L. gasseri, and L. helveticus) in S30 on the mRNA expression levels of ESR1, ESR2, osteocalcin and osteoprotegerin.

    [0048] FIG. 3c shows the results of measuring the effect of treatment of MG-63 cells either with S30 or with a culture obtained by culturing each of probiotic lactic acid bacteria strains (B. lactis, B. infantis, L. gasseri, and L. helveticus) in S30 on the mRNA expression levels of alkaline phosphatase, COL1A1, BMP-2 and BMP-4.

    [0049] FIG. 4 shows the results of measuring the serum concentrations of 17-estradiol and equol of each of experimental groups (Sham, OVX, OVX+E2, OVX+PRO, OVX+S30, and OVX+S30+PRO) in ovariectomized (OVX) rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0050] FIG. 5 shows the results of measuring changes in the body weight of each of experimental groups (Sham, OVX, OVX+E2, OVX+PRO, OVX+S30, and OVX+S30+PRO) in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0051] FIGS. 6a and 6b show the results of measuring the abdominal fat volume depending on the body weight of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0052] FIGS. 7a and 7b show the results of measuring the hematological parameters of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0053] FIG. 8a shows the results of measuring the vaginal epithelial height of each experimental group in OVX rats.

    [0054] FIG. 8b shows the results of measuring the uterus weight of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j p<0.01, compared to OVX+S30 group.

    [0055] FIGS. 9a to 9c show the results of measuring the bone parameters of each experimental group in OVX rats.

    [0056] FIG. 10 shows the results of measuring the serum serotonine and norepinephrine concentrations of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0057] FIG. 11a shows the results of measuring the serum concentrations of bone formation markers (osteocalcin and B-ALP) of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0058] FIG. 11b shows the results of measuring the serum levels of bone resorption markers (deoxypyridinoline, pyridinoline, and type 1 collagen cross-linked telopeptide (NTX, CTX)) of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0059] FIG. 12 shows the results of measuring the vascular homeostasis markers (endothelin-1, nitric oxide (NO) and endothelial nitric oxide synthase (eNOS)) of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f p<0.01, compared to OVX+E2 group. g: p<0.05. h p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    [0060] FIG. 13 shows the results of measuring the serum concentrations of follicle stimulating hormone (FSH) and luteinizing hormone (LH) of each experimental group in OVX rats. The measured values are expressed as meanSD. a: p<0.05. b: p<0.01, compared to Sham group. c: p<0.05. d: p<0.01, compared to OVX group. e: p<0.05. f: p<0.01, compared to OVX+E2 group. g: p<0.05. h: p<0.01, compared to OVX+PRO group. i: p<0.05. j: p<0.01, compared to OVX+S30 group.

    DESCRIPTION OF SPECIFIC EMBODIMENTS

    [0061] The specific embodiments described herein are representative of preferred embodiments or examples of the present disclosure, and thus the scope of the present disclosure is not limited thereto. It will be apparent to those skilled in the art that modifications and other uses of the present disclosure do not depart from the scope of the present disclosure as defined in the appended claims.

    EXAMPLES

    Experimental Methods

    Experimental Example 1: Selection of Probiotics Having Ability to Convert Isoflavone into Equol

    [0062] A probiotic strain having the ability to produce equol from a soybean germ extract (S30) containing 30 wt % of isoflavone was selected.

    [0063] First, a soybean germ extract was prepared using 40 g/L of a soybean germ extract (S30, prepared by Seorim Bio) containing 30 wt % of isoflavone and sterile water. The pH of the soybean germ extract was adjusted to 6.7 using 5M NaOH. The entire soybean germ extract was sterilized by autoclaving at 121 C. for 15 minutes. Microorganisms were activated in rehydrated MRS (Mann Rogosa Sharpe) broth (De Mann et al. 1960) at 37 C. for 20 hours three times, followed by fourth activation in the sterile soybean germ extract at an inoculum level of 5% (v/v). 40 to 400 mL of the sterile soybean germ extract was inoculated with the active culture (5% v/v), and incubated at 37 C. for 24 hours to hydrolyze isoflavone glycosides. The strain activated in the soybean germ extract was used.

    [0064] In the initial screening step, incubation in the soybean germ extract was performed up to 48 hours, and whether equol was produced from the soybean germ extract was examined. In addition, samples were taken at regular time intervals in a time-dependent manner and measured for -glucosidase activity. The measurement of -glucosidase activity was performed using the p-nitrophenyl--D-glucopyranoside (pNPG) method. The sequence of the above screening steps was determined flexibly. That is, strains producing equol were first screened, and then -glucosidase activity was measured, or strains having high -glucosidase activity were first screened, and then whether the strains produced equol was examined. Screening was performed by measuring equol productivity and -glucosidase activity in single strains or a combination of strains.

    Experimental Example 2: In Vitro Cell Assay

    [0065] Through an in vitro cell experiment, the estrogen-related efficacy of equol produced by probiotics and the expression levels of estrogen-related markers were examined. The expression levels of estrogen-related markers in MG-63 cells (Homo sapiens bone osteosarcoma, osteoblasts) and MCF-7 cells (human breast adenocarcinoma, breast cancer cells) were examined. Each of the cell lines was treated with the soybean germ extract culture of each probiotic strain selected based on equol formation and -glucosidase activity, and the mRNA expression levels of biomarkers in the cell line were analyzed by real-time PCR (Table 1).

    TABLE-US-00001 TABLE1 Gene Organism Primersequence ER Human Forward AATTCAGATAATCGACGCCAG(SEQIDNO:1) Reverse GTGTTTCAACATTCTCCCTCCTC(SEQIDNO:2) ER Human Forward TAGTGGTCCATCGCCAGTTAT(SEQIDNO:3) Reverse GGGAGCCAACACTTCACCAT(SEQIDNO:4) pS2 Human Forward CATGGAGAACAAGGTGATCTG(SEQIDNO:5) Reverse CAGAAGCGTGTCTGAGGTGTC(SEQIDNO:6) Osteocalcin Human Forward ACACTCCTCGCCCTATTG(SEQIDNO:7) Reverse GATGTGGTCAGCCAACTC(SEQIDNO:8) Alkaline Human Forward AAACCGAGATACAAGCACTCCCAC(SEQIDNO:9) phosphatase Reverse TCCGTCACGTTGTTCCTGTTCAG(SEQIDNO:10) Collagen,typeI, Human Forward GCGGCTCCCCATTTTTATACC(SEQIDNO:11) alpha1(COL1A1) Reverse GCTCTCCTCCCATGTTAAATAGCA(SEQIDNO:12) BMP2 Human Forward GCGTGAAAAGAGAGACTGC(SEQIDNO:13) Reverse CCATTGAAAGAGCGTCCAC(SEQIDNO:14) BMP4 Human Forward ACGGTGGGAAACTTTTGATGTG(SEQIDNO:15) Reverse CGAGTCTGATGGAGGTGAGTC(SEQIDNO:16) Osteoprotegerin Human Forward GGAACCCCAGAGCGAAATACA(SEQIDNO:17) Reverse CCTGAAGAATGCCTCCTCACA(SEQIDNO:18) -actin Human Forward CATTGCCGACAGGATGCA(SEQIDNO:19) Reverse CATCTGCTGGAAGGTGGACAG(SEQIDNO:20)

    [0066] 2-1. Measurement of Estrogen Receptor (ER)-, Activation and Protein Expression Level

    [0067] A cell experiment was performed using MCF-7 cells (breast cancer cells), Ishikawa cells (endometrial cancer cells) and SaOS-2 cells (ostesarcoma cells), which are established cell lines of tissues in which estrogen receptors are largely distributed. These cells were treated with each test substance, and whether the test substance activated the receptor was examined, thereby evaluating the gene transcription activity. In addition, the protein expression levels of ER (ESR1) and ER (ESR2) were measured by a cell assay or a Western blotting assay in an animal model, and the mRNA expression levels of ER (ESR1) and ER (ESR2) were measured by RT-PCR (reverse transcription polymerase chain reaction).

    [0068] 2-2. Measurement of mRNA Expression Levels of ESR1 and pS2

    [0069] ESR1 and pS2 are estrogen-responsive genes whose expression is increased by estrogen receptors. MCF-7 cells (breast cancer cells) were treated with each test substance, and whether the test substance exhibited estrogenic activity was evaluated by analyzing changes in the mRNA expression levels of the genes.

    [0070] 2-3. Measurement of Expression Levels of Bone Density Markers in Osteoblasts

    [0071] The expression levels of OPG (osteoprotegerin), BMP-2 (bone morphogenetic protein 2), BMP-4 (bone morphogenetic protein 4), osteocalcin, alkaline phosphatase and the like as bone formation markers were measured. BMP4 (bone morphogenetic protein 4) is a bone morphogenetic protein known to have high osteoinduction capacity, and BMP2 (bone morphogenetic protein 2) is a gene that promotes bone formation, and increased expression of BMP2 indicates promoted bone formation. COL1A1 (collagen type I 1) is a major component of connective tissue, cartilage or the like, and activates the production of type 1 collagen. In addition, OPG is a protein produced in bone-forming osteoblasts and inhibits the action of osteoclasts.

    Experimental Example 3: Animal Experimental Test

    [0072] For the finally selected probiotic strains, the climacteric symptom inhibitory activity of each strain in climacteric model experimental animals was evaluated.

    [0073] 3-1. Experimental Design

    [0074] As experimental animals, female Sprague-Dawley rats (initial body weight: 150 to 180 g/rat) were used (6 rats/group). The experiment was performed for 10 weeks (1 week: acclimation period; 1 week: recovery period after ovariectomization (OVX); and 8 weeks: test substance administration period). Estrogen (17-estradiol, E2), the soybean germ extract (30% isoflavone, S30), probiotics (BL+BT+LGA+LH, Pro), and feed (AIN-93G, obtained by replacing soybean oil with corn oil) were administered. Estrogen (17-estradiol, E2) was administered at a dose of 10 g/kg three times a week, S30 was administered at a dose of 10 mg/kg every day, and probiotics were administered at a dose of 110.sup.7 CFU/head every day. Table 2 below shows the animal experimental schedule.

    TABLE-US-00002 TABLE 2 Group Week 1-0 Week 0-1 Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Sham Acclimation AIN-93G OVX Ovariectomization AIN-93G OVX + E2 (week 0) & 8-week administration of AIN-93G + E2 OVX + Pro acclimation 8-week administration of AIN-93G + Pro 8 OVX + S30 8-week administration of AIN-93G + S30 OVX + Pro + S30 8-week administration of AIN-93G + E2 + S30

    [0075] 3-2. Experiment for Measurement

    [0076] The body weight of each experimental group was measured every week. After 8 weeks of administration, the contents of serum estrogen and equol in the blood of each experimental group were measured. After 8 weeks of administration, fat distribution measurement and quantitative measurement of each rat's abdominal tissue were performed through micro-CT imaging.

    [0077] The thickness of vaginal epithelial cells was measured through H & E staining of the vaginal epithelial cells. Through measurement of the uterus weight, it was confirmed that the uterus weight was reduced due to OVX and the menopausal model was well induced. In addition, whether the administered substance also affected the endothelium of the uterus was examined.

    [0078] For hematological analysis, serum lipid levels were analyzed by measuring triglyceride, total cholesterol, LDL cholesterol, HDL cholesterol and free fatty acid levels. In addition, vasodilation was measured. It is known that estrogen acts to promote vasodilation and reduce blood lipid, and that an increase in the prevalence of cardiovascular diseases in climacteric women is associated with decreased estrogen levels. Accordingly, as parameters for measuring the cardiovascular health of climacteric women, serum total cholesterol, HDL-cholesterol, VLDL-cholesterol, LDL-cholesterol and triglyceride levels were measured, and markers of vasoconstriction and vasodilation were measured, such as endothelin-1, nitric oxide (NO) and endothelial nitric oxide synthase (eNOS).

    [0079] BMD (bone mineral density) and BMC (bone mineral concentration) were measured. Whether the lowering of bone density due to estrogen deficiency can be mediated by administration of the test substance was evaluated by measuring the bone density in the climacteric animal model (OVX). The expression levels of bone density markers in osteoblasts were measured. In climacteric women, the expression levels of bone resorption markers are generally higher than those of bone formation markers. Bone resorption markers are markers that are released when osteoclasts gnaw at bone, and include deoxypyridinoline, pyridinoline, and type 1 collagen cross-linked telopeptide (NTX, CTX). As bone formation markers, osteocalcin, alkaline phosphatase and the like were measured. The efficacy-related markers in climacteric women are shown in Table 3 below.

    TABLE-US-00003 TABLE 3 Biomarker Product Neurotransmitters Serotonin Rat 5-hydroxy tryptamine (5-ht) ELISA Kit Norepinephrine Rat Norepinephrine (NE) ELISA Kit Bone formation Osteocalcin Rat Osteocalcin (OC) ELISA Kit markers Alkaline phosphatase Rat bone alkaline phosphatase, BALP ELISA Kit Bone resorption Deoxypyridinoline Rat deoxypyridinoline (DPD) ELISA Kit markers Pyridinoline Rat Pyridinoline (PYD) ELISA Kit NTX Rat cross linked N-telopeptide of type I collagen, NTX ELISA Kit CTX Rat cross Linked C-telopeptide of type I collagen (CTX-I) ELISA Kit Cardiovascular Endothelin-1 Rat Endothelin 1 ELISA Kit markers Nitric oxide Rat nitric oxide (NO) ELISA Kit eNOS Rat Endothelial Nitric Oxide Synthase ELISA Kit Follicle-stimulating Follicle-stimulating Rat Follicle Stimulating Hormone (FSH) ELISA Kit Hormone hormone Luteinizing hormone Luteinizing hormone Rat Luteinizing hormone ELISA Kit Estradiol Estradiol, E2 Rat Estradiol (E2) ELISA Kit Equol Equol Equol ELISA Kit

    Experimental Results

    Example 1: Measurement of Concentration of Equol Produced by Probiotics

    [0080] Each of the strains (19 CBT strains) held by Cell Biotech Co., Ltd. was inoculated into a 30% isoflavone-containing soybean germ extract (S30) and cultured at 37 C. for 48 hours, and then whether equol in the supernatant was produced and the concentration of equol were measured. As a result, it was confirmed that, in the culture supernatants of the eight strains (Bifidobacterium lactis, Bifidobacterium breve, Bifidobacterium longum, Bifidobacterium infantis, Lactobacillus rhamnosus, Lactobacillus gasseri, Lactobacillus helveticus, and Lactococcus lactis) measured, equol was produced and the significant concentration thereof was measured. In particular, in the strains of the genus Bifidobacterium, a large amount of equol was produced (FIG. 1a). In addition, a combination of four probiotic strains (B. lactis, B. infantis, L. gasseri, and L. helveticus), which has shown high equol productivity, showed higher equol productivity than each single strain (FIG. 1b).

    Example 2: Measurement of -Glucosidase Activity of Probiotics

    [0081] Isoflavones exist in the form of glycoside conjugates (sugar-bound glycosides). To form equol, glycosides bound to isoflavones should first be degraded into aglycones. This reaction is performed by the -glycosidase of the gut microbiota. Among the eight equol-producing strains, strains having high efficiency were screened by measuring the -glucosidase activity under the same conditions. In the initial reaction time period (1 hour to 2 hours), strains having relatively high -glucosidase activity were B. lactis, B. infantis, L. gasseri and L. helveticus, and also maintained higher -glucosidase activity than other strains for a total of 48 hours of the reaction (FIG. 2a). In addition, the combination of four strains (B. lactis, B. infantis, L. gasseri and L. helveticus) maintained higher -glucosidase activity than other single strains (FIG. 2b). Four probiotics (B. lactis, B. infantis, L. gasseri and L. helveticus) were selected, which produced high concentrations of equol by reaction with the soybean germ extract (S30) in the gut after administration and exhibited high -glucosidase activity, and these selected probiotics were used in an in vivo test.

    Example 3: Measurement of Estrogen-Related Gene Expression in Breast Cancer Cells and Osteoblasts

    [0082] Each of MCF-7 cells (human breast adenocarcinoma, breast cancer cells) and MG-63 cells (Homo sapiens bone osteosarcoma, osteoblasts) was treated either with S30 or with the culture filtrate obtained by culturing each of the probiotic strains (B. lactis, B. infantis, L. gasseri and L. helveticus) in S30, and the expression levels of estrogen-related genes in the cells were measured. As a result of the measurement, it was confirmed that the expression levels of the genes in the cells treated with S30 alone did not significantly differ from those in the control group, but the expression levels of the genes in the cells treated with the culture filtrate obtained by culturing each probiotic strain in S30 did significantly differ from those in the control group, and the overall expression levels of the estrogen-related genes in these cells were significantly higher than those in the control group and the S30-treated group (FIGS. 3a to 3c).

    Example 4: Measurement of Serum Concentrations of 17-Estradiol and Equol in OVX Rats

    [0083] 17-estradiol (E2) was measured in the serum of each experimental group, and as a result, it was confirmed that the serum concentration of 17-estradiol was significantly low in the OVX group, but the serum concentration of 17-estradiol in the OVX+E2 group to which 17-estradiol was administered was similar to that in the Sham group. When each of probiotics, S30 and S30+probiotics was administered to the OVX rats, the serum concentration of 17-estradiol did not significantly increase. Meanwhile, equol was measured in the serum of each experimental group, it was confirmed that the serum level of equol did not significantly differ between the Sham, OVX, OVX+E2, and OVX+probiotics groups, but administration of S30 or S30+probiotics significantly increased the serum concentration of equol. The increase in the serum level of equol in the OVX+S30 group was believed to be because equol was produced by the gut microbiota of the rats. Administration of S30+proiotics showed a significant increase in the serum level of equol, suggesting that administration of the probiotics to the gut microbiota of the rats exhibited a synergistic effect on the production of equol from S30 (FIG. 4).

    Example 5: Measurement of Changes in Body Weight in OVX Rats

    [0084] Since a somewhat amount of estrogen is required even after menopause, estrogen precursors in the adipocytes and myocytes mainly in abdominal adipose tissue are converted into estrogen after menopause, and the adipocytes are activated in the process of compensating for the rapid decrease in estrogen caused by menopause, thus causing obesity. The body weights of the rats were measured over 8 weeks after ovariectomization (OVX). Before administration (0 week), the body weight values were similar without significant difference between the experimental groups. From 1 week after administration, a significant difference in the body weight between the experimental groups started to appear. The body weight gain caused by OVX compared to the Sham group started to appear, and particularly, the body weight gain significantly decreased in the S30+probiotics group. In addition, the effect of probiotic administration also appeared. From 3 weeks after the start of administration, a significant difference in the body weight of the S30+probiotics group from that of the Sham group started to not appear, and at 4 weeks after the start of administration, the body weight gain of the S30+probiotics group decreased compared to that of the E2 (17-estradiol, estrogen)-administered group. At 8 weeks of administration (end of administration), it was confirmed that the body weight gain of the S30+probiotics group did not significantly differ from those of the Sham group and the probiotics-administered group, but significantly decreased compared to those of the OVX, E2 and S30 groups. In addition, it was confirmed that the body weights of the rats increased over 8 weeks after OVX, and that the administration of E2 significantly decreased the body weight gain of the rats. This effect was also observed upon administration of probiotics or S30+probiotics, but did not appear upon administration of S30 alone (FIG. 5).

    Example 6: Measurement of Abdominal Fat Volume in OVX Rats

    [0085] The abdominal fat volume depending on the body weight of each experimental group in the OVX rats was measured and compared (FIGS. 6a and 6b).

    [0086] The results of measurement of the total abdominal volume indicated that OVX and administration of S30 alone more significantly increased the abdominal volume than Sham. Administration of E2 or probiotics showed no significant difference in the abdominal volume from OVX, but administration of S30+probiotics exhibited the effect of significantly decreasing the total abdominal volume compared to OVX.

    [0087] In addition, the total abdominal fat volume (abdominal visceral fat volume+abdominal subcutaneous fat volume) was measured, and as a result, the results with the same tendency as in the measurement of the total abdominal volume were obtained. In addition, the abdominal visceral fat volume was measured, and as a result, it was confirmed that OVX and administration of S30 alone more significantly increased the abdominal visceral fat volume than Sham. Administration of E2 or probiotics more significantly decreased the abdominal visceral fat volume than OVX. Administration of S30+probiotics exhibited the effect of significantly decreasing the abdominal visceral fat volume compared to OVX and administration of S30.

    [0088] The abdominal subcutaneous fat volume was measured, and as a result, it was confirmed that OVX significantly increased the abdominal subcutaneous fat volume compared to Sham. The abdominal subcutaneous fat volumes of other experimental groups did not significantly differ from that of the OVX group, but administration of S30+probiotics exhibited the effect of significantly decreasing the abdominal subcutaneous fat volume compared to OVX.

    [0089] The total abdominal fat ratio (%) (total abdominal fat volume/total abdominal volume) significantly increased in OVX and administration of S30 alone compared to Sham. Administration of S30+probiotics showed no significant difference in the total abdominal fat ratio from Sham, and exhibited the effect of significantly decreasing the total abdominal fat ratio compared to administration of each of E2, probiotics and S30.

    [0090] The results of measurement of the abdominal visceral fat ratio (%) (abdominal visceral fat volume/total abdominal fat volume) indicated that there was no significant difference in the abdominal visceral fat ratio between the experimental groups.

    [0091] The results of measurement of the abdominal subcutaneous fat ratio (%) (abdominal subcutaneous fat volume/total abdominal fat volume (%) indicated that there was no significant difference in the abdominal subcutaneous fat ratio between the experimental groups.

    Example 7: Measurement of Hematological Parameters in OVX Rats

    [0092] The hematological parameters of each experimental group in the OVX rats were measured and compared (FIGS. 7a and 7b).

    [0093] Albumin acts as a carrier for several hormones, and binds to and transports electrolytes, such as Ca, P and sulfur (S), and thyroid hormones. When the concentration of albumin is lowered, various functions decrease. The concentration of albumin decreased due to OVX, but increased significantly due to administration of probiotics or S30+probiotics.

    [0094] Changes in the blood concentration of calcium are affected by calcium present in the bone, and the increase in bone resorption by ovariectomization causes a decrease in bone quality, resulting in an increase in the blood concentration of calcium. Thus, changes in the concentration of calcium are associated with bone resorption. The blood concentration of calcium was increased due to OVX, but decreased due to administration of E2. In addition, administration of each of S30, probiotics and S30+probiotics significantly decreased the concentration of calcium compared to administration of each of Sham and E2.

    [0095] When the secretion of estrogen decreases, the function of inhibiting the activation of lipoprotein lipase is lowered, resulting in excessive accumulation of fat, and hyperlipidemia appears. OVX significantly increased the concentrations of cholesterol, triglycerides, and LDL compared to Sham, and significantly decreased the concentration of HDL. Administration of each of S30, probiotics and S30+probiotics generally exhibited the effect of significantly alleviating hyperlipidemia, and particularly, administration of S30+probiotics exhibited higher effects on a decrease in the blood concentration of LDL and an increase in the blood concentration of HDL than administration of the other test substances.

    [0096] OVX significantly increased the hepatic AST (aspartate transaminase) and ALT (alanine transaminase) concentrations compared to the Sham group. Administration of probiotics alone exhibited the effect of significantly decreasing the AST and ALT concentrations, but administration of S30+probiotics exhibited a better effect than administration of S30 alone.

    Example 8: Measurement of Vaginal Endometrial Thickness in OVX Rats

    [0097] 8-1. Measurement of Vaginal Epithelial Height in Each Experimental Group

    [0098] The blood estrogen concentration that decreases after climacterium and menopause also affects the urogenital organs, causing redness of the vaginal mucosa, loss of elasticity, loss of wrinkles, changes in cell composition, and urogenital atrophy that results in an increase in vaginal acidity. As the thickness of vaginal epithelium and vaginal blood flow decrease, the vagina becomes dry, thinner, and pale, and the maturity of the vaginal epithelium decreases, resulting in increased immature cells. OVX significantly decreased the vaginal epithelial height compared to Sham, and administration of E2 more significantly increased the vaginal epithelial height than OVX. Administration of probiotics or S30 alone significantly decreased the vaginal epithelial height compared to Sham and administration of E2, and showed no significant difference from OVX. However, administration of S30+probiotics showed no significant difference in the vaginal epithelial height from the Sham and E2 groups, and more significantly increased the vaginal epithelial height than the OVX, probiotics or S30 group. This result is believed to be because administration of S30+probiotics exhibited a significant improvement effect against the change in vaginal tissue caused by a decrease in estrogen (FIG. 8a).

    [0099] 8-2. Measurement of Uterus Weight in Each Experimental Group

    [0100] Ovariectomization (OVX) decreases the weight of the uterus by decreasing estrogen that causes the endometrium to grow. OVX significantly decreased the uterus weight compared to Sham, and administration of E2 more significantly increased the uterus weight than OVX. Administration of probiotics or S30 alone significantly decreased the uterus weight compared to Sham and administration of E2, and showed no significant difference in the uterus weight from OVX. However, administration of S30+probiotics significantly decreased the uterus weight compared to Sham and administration of E2, but significantly increased the uterus weight compared to that OVX or administration of probiotics or S30. These results suggest that administration of S30+probiotics exhibited a significant improvement effect against the change in uterus tissue caused by a decrease in estrogen (the uterus weight per 100 g body weight showed the same significance) (FIG. 8b).

    Example 9: Measurement of Bone Parameters in OVX Rats

    [0101] The bone parameters of each experimental group in the OVX rats were measured and compared (FIGS. 9a to 9c). BMD (bone material density) was significantly decreased by OVX. Administration of probiotics or S30 showed no significant difference in BMD from OVX, but administration of E2 or S30+probiotics significantly increased BMD. In particular, administration of S30+probiotics significantly increased BMD compared to administration of probiotics or S30. TV (total volume) was similar between all the experimental groups, and was not changed by OVX. OVX significantly decreased BV (bone volume), BV/TV, and BS (bone surface). Administration of probiotics or S30 showed no significant difference in BV, BV/TV and BS from OVX, but administration of E2 or S30+probiotics significantly increased BV, BV/TV and BS. BS/BV and Tb. Th (trabecular thickness) were significantly decreased by OVX and significantly increased by administration of each of E2 and S30+probiotics. Tb. N (trabecular number) and Tb. Sp (trabecular separation) significantly increased in all the experimental groups subjected to OVX, but did not significantly differ between the experimental groups.

    Example 10: Measurement of Serum Concentrations of Serotonin and Norepinephrine in OVX Rats

    [0102] Serotonin is a neurotransmitter contained in the brain, visceral tissues, platelets, mast cells, etc., and peripheral serotonin that is produced in the visceral tissue under the influence of the microbiome inhibits differentiation of osteoblasts. Estrogen is known to increase the concentration of norepinephrine and receptors for neurotransmitters, and a decrease in norepinephrine may be induced in the climacteric period when estrogen decreases. The serum concentration of serotonin was measured, and as a result, it was confirmed that the serum concentration of serotonin was significantly increased by OVX compared to Sham, but was significantly decreased by administration of E2, probiotics or S30+probiotics. No significant difference between the S30 group and the S30+probiotics group appeared. The serum concentration of norepinephrine was measured, and as a result, it was confirmed that the serum concentration of norepinephrine was more significantly decreased by OVX than by Sham, but was significantly increased by administration of each of E2, probiotics, S30 and S30+probiotics. In particular, administration of S30+probiotics showed the highest significant increase in the serum concentration of norepinephrine (FIG. 10).

    Example 11: Measurement of Serum Concentrations of Bone Formation Markers and Bone Resorption Markers in OVX Rats

    [0103] Estrogen acts to inhibit bone resorption, and bone loss increases as estrogen secretion decreases in the climacteric period. In climacteric women, bone resorption markers generally significantly increase compared to bone formation markers. As bone resorption markers that are produced when osteoclasts degrade bone, deoxypyridinoline, pyridinoline, and type 1 collagen cross-linked telopeptide (NTX, CTX) were measured, and as bone formation markers, osteocalcin, bone alkaline phosphatase (B-ALP), etc. were measured. The results of measurement of the bone formation markers indicated that osteocalcin and B-ALP were significantly decreased by OVX, but were more significantly increased by administration of E2, probiotics or S30 than by OVX, and particularly, osteocalcin and B-ALP were more significantly increased by administration of S30+probiotics than by administration of E2, probiotics or S30 (FIG. 11a). The results of measurement of the bone resorption markers indicated that deoxypyridinoline, pyridinoline, NTX and CTX were generally increased by OVX, and were more significantly decreased by administration of E2, probiotics or S30 than by OVX, and particularly, these markers were significantly decreased by administration of S30+probiotics to levels achieved by administration of E2 (FIG. 11b).

    Example 12: Measurement of Vascular Homeostasis Markers

    [0104] It is known that estrogen induces vasodilation and that an increase in the prevalence of cardiovascular diseases in climacteric women is associated with a decrease in estrogen levels. Accordingly, as markers for measuring the cardiovascular health of climacteric women, endothelin-1, which is a vasoconstriction marker, and nitric oxide (NO) and endothelial nitric oxide synthase (eNOS) which are vasodilation markers, were measured. The results of measurement of endothelin-1 indicated that endothelin-1 was significantly increased by OVX, but was more significantly decreased by administration of E2, probiotics or S30+probiotics than by OVX. In particular, the decrease in endothelin-1 by administration of S30+probiotics was similar to that shown by Sham, and endothelin-1 was more significantly decreased by administration of S30+probiotics than by administration of S30. NO (nitric oxide) was significantly decreased by OVX, but was more significantly increased by administration of E2 or S30+probiotics than by OVX, and administration of probiotics or S30 showed no significant difference in nitric oxide from OVX. Although there no significant difference in eNOS (endothelial nitric oxide synthase) between Sham and OVX, eNOS was significantly increased by administration of E2, and was more significantly increased by administration of S30+probiotics than by OVX. Administration of probiotics or S30 showed no significant difference in eNOS from Sham or OVX (FIG. 12).

    Example 13: Measurement of Serum Levels of FSH and LH

    [0105] In the climacteric period, the secretion of estrogen is decreased due to the depletion of follicles in the ovary, and for this reason, the secretion of follicle stimulating hormone (FSH) and luteinizing hormone (LH) is increased by the negative feedback mechanism of the hypothalamus-pituitary axis. FSH (follicle stimulating hormone) was significantly increased by OVX. FSH was more significantly decreased by administration of E2 or S30+probiotics than by OVX. In particular, the level of FSH by administration of S30+probiotics was similar to that shown by Sham or administration of E2, and was significantly decreased compared to that shown by administration of probiotics or S30. LH (luteinizing hormone) showed a similar tendency to FSH, and administration of S30+probiotics exhibited a similar effect to administration of E2 (FIG. 13)

    [0106] As described in detail above, the lactic acid bacteria of the present disclosure have -glucosidase activity and a very excellent ability to convert isoflavones into equol compounds, and thus may exhibit estrogenic activity through synergism with the gut microbiota. Therefore, the lactic acid bacteria of the present disclosure may be effectively used for the prevention, relief or treatment of women's climacteric or menopausal symptoms.

    [0107] Although the present disclosure has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present disclosure. Thus, the substantial scope of the present disclosure will be defined by the appended claims and equivalents thereto.