CCL24 as a Diagnostic and Therapeutic Target for Breast Cancer
20210208161 ยท 2021-07-08
Assignee
Inventors
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
G01N33/6863
PHYSICS
C07K16/24
CHEMISTRY; METALLURGY
International classification
C07K16/24
CHEMISTRY; METALLURGY
Abstract
Using expression of CC chemokine ligand (CCL24) to serve as an identification of a potential deriver of metastatic cancers and methods of detecting the presence of CCL24 to serve as a breast cancer diagnosis tool.
Claims
1. A breast cancer detection method comprising: analyzing a subject for a tumor microenvironment; analyzing immune suppression events in the tumor microenvironment; and determining the amount of at least one chemokine in the tumor microenvironment;
2. The method of claim 1, wherein the chemokine comprises CCL24 of Sequence 1.
3. The method of claim 1, further comprising analyzing basal-like breast cancer cells.
4. The method of claim 1, further comprising analyzing for polarization of at least one tumor associated microphage.
5. The method of claim 1, further comprising analyzing the tumor microenvironment for immune suppressor cells.
6. The method of claim 5, wherein the immune suppressor cells comprise CCR3 expressing immune suppressor cells.
7. The method of claim 1, further comprising analyzing for defecting of effector function for cytotoxic immune cells.
8. A method for cancer detection comprising: analyzing a subject for a tumor microenvironment; analyzing immune suppression events in the tumor microenvironment; and determining the presence of a serum-based biomarker.
9. The method of claim 8, wherein the serum based biomarker comprises a chemokine.
10. The method of claim 9, wherein the chemokine comprises CCL24 of Sequence 1.
11. The method of claim 8, wherein the cancer being detected comprises breast cancer.
12. The method of claim 8, further comprising analyzing for polarization of at least one tumor associated microphage.
13. The method of claim 8, further comprising analyzing the tumor microenvironment for immune suppressor cells.
14. The method of claim 13, wherein the immune suppressor cells comprise CCR3 expressing immune suppressor cells.
15. The method of claim 8, further comprising analyzing for defecting of effector function for cytotoxic immune cells.
16. A method of inhibiting modulation of immunosuppressor cells in a tumor microenvironment comprising: inhibiting migration and metastasis of breast cancer cells via inhibition of CCL24 formation through knockdown.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] An understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure may be utilized, and the accompanying drawings of which:
[0012]
[0013]
[0014]
[0015]
[0016]
[0017] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
[0018] It will be understood by those skilled in the art that one or more aspects of this invention can meet certain objectives, while one or more other aspects can meet certain other objectives. Each objective may not apply equally, in all its respects, to every aspect of this invention. As such, the preceding objects can be viewed in the alternative with respect to any one aspect of this invention. These and other objects and features of the invention will become more fully apparent when the following detailed description is read in conjunction with the accompanying figures and examples. However, it is to be understood that both the foregoing summary of the invention and the following detailed description are of a preferred embodiment and not restrictive of the invention or other alternate embodiments of the invention. In particular, while the invention is described herein with reference to a number of specific embodiments, it will be appreciated that the description is illustrative of the invention and is not constructed as limiting of the invention. Various modifications and applications may occur to those who are skilled in the art, without departing from the spirit and the scope of the invention, as described by the appended claims Likewise, other objects, features, benefits and advantages of the present invention will be apparent from this summary and certain embodiments described below, and will be readily apparent to those skilled in the art. Such objects, features, benefits and advantages will be apparent from the above in conjunction with the accompanying examples, data, figures and all reasonable inferences to be drawn therefrom, alone or with consideration of the references incorporated herein.
DETAILED DESCRIPTION OF A PREFERRED EMBODIMENT
[0019] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0020] Unless specifically stated, terms and phrases used in this document, and variations thereof, unless otherwise expressly stated, should be construed as open ended as opposed to limiting. Likewise, a group of items linked with the conjunction and should not be read as requiring that each and every one of those items be present in the grouping, but rather should be read as and/or unless expressly stated otherwise. Similarly, a group of items linked with the conjunction or should not be read as requiring mutual exclusivity among that group, but rather should also be read as and/or unless expressly stated otherwise.
[0021] Furthermore, although items, elements or components of the disclosure may be described or claimed in the singular, the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated. The presence of broadening words and phrases such as one or more, at least, but not limited to or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent.
[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.
[0023] All publications and patents cited in this specification are cited to disclose and describe the methods and/or materials in connection with which the publications are cited. All such publications and patents are herein incorporated by references as if each individual publication or patent were specifically and individually indicated to be incorporated by reference. Such incorporation by reference is expressly limited to the methods and/or materials described in the cited publications and patents and does not extend to any lexicographical definitions from the cited publications and patents. Any lexicographical definition in the publications and patents cited that is not also expressly repeated in the instant application should not be treated as such and should not be read as defining any terms appearing in the accompanying claims. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.
[0024] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.
[0025] Where a range is expressed, a further embodiment includes from the one particular value and/or to the other particular value. The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase x to y includes the range from x to y as well as the range greater than x and less than y. The range can also be expressed as an upper limit, e.g. about x, y, z, or less and should be interpreted to include the specific ranges of about x, about y, and about z as well as the ranges of less than x, less than y, and less than z. Likewise, the phrase about x, y, z, or greater should be interpreted to include the specific ranges of about x, about y, and about z as well as the ranges of greater than x, greater than y, and greater than z. In addition, the phrase about x to y, where x and y are numerical values, includes about x to about y.
[0026] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as about that particular value in addition to the value itself. For example, if the value 10 is disclosed, then about 10 is also disclosed. Ranges can be expressed herein as from about one particular value, and/or to about another particular value. Similarly, when values are expressed as approximations, by use of the antecedent about, it will be understood that the particular value forms a further aspect. For example, if the value about 10 is disclosed, then 10 is also disclosed.
[0027] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of about 0.1% to 5% should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the sub-ranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.
[0028] As used herein, the singular forms a, an, and the include both singular and plural referents unless the context clearly dictates otherwise.
[0029] As used herein, about, approximately, substantially, and the like, when used in connection with a measurable variable such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value including those within experimental error (which can be determined by e.g. given data set, art accepted standard, and/or with e.g. a given confidence interval (e.g. 90%, 95%, or more confidence interval from the mean), such as variations of +/10% or less, +/5% or less, +/1% or less, and +/0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosure. As used herein, the terms about, approximate, at or about, and substantially can mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and/or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In general, an amount, size, formulation, parameter or other quantity or characteristic is about, approximate, or at or about whether or not expressly stated to be such. It is understood that where about, approximate, or at or about is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0030] As used herein, the singular forms a, an, and the include both singular and plural referents unless the context clearly dictates otherwise.
[0031] As used herein, about, approximately, substantially, and the like, when used in connection with a measurable variable such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value including those within experimental error (which can be determined by e.g. given data set, art accepted standard, and/or with e.g. a given confidence interval (e.g. 90%, 95%, or more confidence interval from the mean), such as variations of +/10% or less, +/5% or less, +/1% or less, and +/0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosure. As used herein, the terms about, approximate, at or about, and substantially can mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and/or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In general, an amount, size, formulation, parameter or other quantity or characteristic is about, approximate, or at or about whether or not expressly stated to be such. It is understood that where about, approximate, or at or about is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0032] The terms subject, individual, and patient are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed by the term subject.
[0033] As used interchangeably herein, the terms sufficient and effective, can refer to an amount (e.g. mass, volume, dosage, concentration, and/or time period) needed to achieve one or more desired and/or stated result(s). For example, a therapeutically effective amount refers to an amount needed to achieve one or more therapeutic effects.
[0034] As used herein, therapeutic can refer to treating, healing, and/or ameliorating a disease, disorder, condition, or side effect, or to decreasing in the rate of advancement of a disease, disorder, condition, or side effect. A therapeutically effective amount can therefore refer to an amount of a compound that can yield a therapeutic effect.
[0035] As used herein, the terms treating and treatment can refer generally to obtaining a desired pharmacological and/or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof, such as cancer and/or indirect radiation damage. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease, disorder, or condition. The term treatment as used herein covers any treatment of cancer and/or indirect radiation damage, in a subject, particularly a human and/or companion animal, and can include any one or more of the following: (a) preventing the disease or damage from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and/or its symptoms or conditions. The term treatment as used herein can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and/or those in which the disorder is to be prevented. As used herein, the term treating, can include inhibiting the disease, disorder or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and/or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.
[0036] As used herein, the terms weight percent, wt %, and wt. %, which can be used interchangeably, indicate the percent by weight of a given component based on the total weight of a composition of which it is a component, unless otherwise specified. That is, unless otherwise specified, all wt % values are based on the total weight of the composition. It should be understood that the sum of wt % values for all components in a disclosed composition or formulation are equal to 100. Alternatively, if the wt % value is based on the total weight of a subset of components in a composition, it should be understood that the sum of wt % values the specified components in the disclosed composition or formulation are equal to 100.
[0037] As used herein, water-soluble, generally means at least about 10 g of a substance is soluble in 1 L of water, i.e., at neutral pH, at 25 C.
[0038] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to one embodiment, an embodiment, an example embodiment, means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, appearances of the phrases in one embodiment, in an embodiment, or an example embodiment in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the disclosure. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
[0039] All patents, patent applications, published applications, and publications, databases, websites and other published materials cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.
[0040] Tumor microenvironment (TME) is considered a prime factor for homing, nurturing, and driving the development and progression of cancer. TME is complex and constitutes multiple cell types including immune cells. There is a group of proteins called chemokines, which facilitates lymphocyte trafficking under specific conditions and angiogenesis inducing inflammation supporting tumorigenesis and metastasis of cancer. The current disclosure identifies a novel molecule associated with the TME at the interplay of oncology and immunology. The current disclosure has observed a significantly higher level of CCL24 in basal like breast cancer cells. Therefore, the current disclosure posits that the chemokine CCL24 drives the progression of aggressive breast cancer leading to metastasis and detection of same can lead to early diagnosis of breast cancer.
[0041] The current disclosure seeks to determine the molecular function of chemokine ligand CCL24 in breast cancer, and to investigate if CCL24 serves as a potential deriver of metastatic breast cancer, addressing the overarching challenges of identifying novel determinants of breast cancer, and its potential as a therapeutic target in reducing/eliminating mortality due to breast cancer.
[0042] CCL24 also known as myeloid progenitor inhibitory factor 2 (MPIF-2) or eosinophil chemotactic protein 2 (eotaxin-2) is a protein that in humans is encoded by the CCL24 gene. Chemokines are small, cell secreted proteins that primarily regulate leukocyte trafficking in homeostatic conditions and during specific immune responses. Chemokines guide the migration and adhesion of leukocytes and influence diverse physiological functions including cell proliferation, angiogenesis, inflammation, tumorigenesis and metastasis. Chemokines are associated with the establishment of pro-tumor microenvironment stimulating tumor cell progression and metastasis.
[0043] In fact, chemokines constitute a large family with almost 50 members and approximately 20 chemokine receptors. Chemokines bind to its cell surface cognate receptors modulating biological activities and activating intracellular signaling pathways. The normal breast expresses a number of chemokines but at a very low level.
[0044] Among multiple chemokines, CXCL8, CCL2, CCL4, CCL5, and CCL18 are well-studied in breast cancer. The CXC family chemokine CXCL8 is primarily associated with cell cycle regulation as well as in angiogenesis. CXCL12-CXCR4 axis is one of the most studied ligand-receptor pairs in metastasis, where CXCR4 expression is higher in breast tumors. CXCR4 controls chemotaxis towards CXCL12, highly expressed in lung, liver, bone, and lymph nodes, which are the preferential metastatic sites of breast cancer cells. CCL2 is highly expressed in both tumor and tumor microenvironment cells, exerting its pro-tumor effects indirectly by promoting angiogenesis and enriching leukocytes infiltration. Chemokine CCL5 is involved in T helper cell recruitment, showed higher expression in multiple cell types of TME as compared to healthy tissue. CCL5 is linked to macrophage infiltration in breast cancer animal models. However, in human breast xenografts, its expression negatively correlates with macrophage recruitment implicating an indirect role of CCL5. Similarly, CCL18 promotes malignant behavior and correlates with metastasis of human breast cancer, however, a major source of CCL18 is tumor associated macrophages. CCL18 is induced by IL-4, IL-10, and IL-13, therefore, a constituent of M2-like polarized macrophages. Overall, the chemokines have been proposed as possible therapeutic targets for metastatic breast cancer. However, previous studies suggest that most of the studied chemokines are acting indirectly in breast pathogenicity.
[0045] The innovative concept of the current disclosure is the identification of CC chemokine ligand (CCL24) in association with breast cancer progression. As described above, previous studies have described the role of different chemokines in breast cancer. For example, CCL18 is secreted by the tumor associated macrophages and promotes breast cancer metastasis; CXCL12 attracts CXCR4 expressing breast cancer cells to lung, liver, bone and lymph node metastatic sites; high levels of CCL2 in breast cancer is expressed by tumor cells and correlates with macrophage infiltration.
[0046] However, humanized CCL2 neutralizing antibody is ineffective in suppressing CCL2 serum level or tumor progression due to a feedback mechanism that increases CCL2 production. Hence, there is an unmet need to develop alternate strategies. There is no study in the literature addressing any connotation, including expression and function, of CCL24 in breast cancer. It is innovative to determine the clinical significance of CCL24 as a potential biomarker of aggressive breast cancer (such as triple negative breast cancer) and its role in breast cancer development and metastasis. Successful completion of this will open a new direction to further establishing the clinical significance of CCL24 chemokine as a biomarker of aggressive breast cancer, and a novel therapeutic target in breast cancer progression and metastasis.
[0047] The current disclosure offers that the CCL24 molecule is at the interface of oncology and immunology, highly expressed in aggressive breast cancer cells and is associated with tumor promoting activities by increasing immune suppressive events in the tumor microenvironment. Therefore, the current disclosure postulates that the chemokine CCL24 drives the progression of aggressive breast cancer leading to metastasis. The rationale for this hypothesis is based on observations that the expression of CCL24 specific to basal-like breast cancer cells may serve as a selected variant evading immune system and promoting breast cancer metastasis.
[0048] High levels of chemokine ligand CCL24 is specifically expressed by aggressive breast cancer cells, and therefore, may function as a driving factor of breast cancer metastasis. CCL24 is linked with the polarization of tumor associated macrophage and promoting immune suppressor cells. Therefore, identification and characterization of a novel CCL24 chemokine associated with breast cancer progression and metastasis, directing immunosuppressive events at the tumor site will have a significant clinical impact on the development of CCL24-specific targeted therapy. If successful, potential oncogenic function of CCL24 may help to revolutionize treatment regimens eliminating mortality associated with metastatic breast cancer, and accelerate the progressive vision toward ending breast cancer.
[0049] The CCL24 molecule is unique in that: 1) it is associated with inflammation, which plays a significant role in cancer development and progression; 2) CCL24 is a chemoattractant, which attracts various immune cells types in the developing bed of neoplastic cells, supporting tumor promotion; and 3) CCL24 is highly expressed in triple negative breast cancer cells and, therefore, may promote the migration and metastasis of breast cancer.
[0050] So far, chemokine ligands studies are associated indirectly in breast cancer progression and metastasis. For example, CCL18 is secreted by the tumor associated macrophages and promotes breast cancer metastasis; CXCL12 attracts CXCR4 expressing breast cancer cells to lung, liver, bone and lymph node metastatic sites; high level of CCL2 in breast cancer is expressed by tumor cells and correlates with macrophage infiltration. However, humanized CCL2 neutralizing antibody is ineffective in suppressing CCL2 serum level or tumor progression due to feedback mechanism that increases CCL2 production. For the first time, the current disclosure proposes to determine the oncogenic function of the chemokine ligand CCL24 in breast cancer.
[0051] CCL24 in breast TME induces tumor promoting environment due to increased trafficking of CCR3 expressing immune suppressor cells. Literature suggests there are 9 known ligands (CCL5, CCL7, CCL11, CCL13, CCL15, CCL18, CCL24, CCL26, and CCL28) for CCR3 expressing immune suppressor cells. Using KM Plotter data analysis similar to CCL24, the current disclosure found that the hazard ratio (HR) of 1.87 was significantly higher for CCL24 (p=0.0053) as compared to CCL13 (p=0.14; HR=1.38), CCL26 (p=0.13; HR=1.55), and CCL28 (p=0.36; HR 1.30). The rest of the chemokine ligands (CCL5, CCL7, CCL11, CCL15, and CCL18) showed either no effect or better prognosis in breast cancer patients with increased level of expression. Additionally, multivariate analysis using KM-plotter data sets, showed a significantly poor prognosis (p=009; HR=1.85) with increased level of CCL24 after multivariable adjustment for other clinical and histopathological markers (Ki67, ESR1, and Her2) suggesting a selective association between high CCL24 and poor prognosis of breast cancer. These observations strongly support a key involvement of CCL24 specific to poor prognosis of breast cancer by inducing accumulation of immune suppressor cells promoting breast cancer metastasis.
[0052] Based on the current disclosure's preliminary studies with respect to CCL24, there are two critical observations: 1) CCL24 is highly expressed by the aggressive triple negative breast cancer cells, and therefore, may be a driving factor of breast cancer metastasis; and 2) CCL24 may function within breast cancer tumor microenvironment by polarizing tumor associated macrophages, promoting immune suppressor cells, or defecting the effector function of cytotoxic immune cells. Thus, functional characterization of a novel, breast cancer specific CCL24 chemokine modulating immunosuppressive events at the tumor site will have a significant clinical impact on the development of CCL24-specific targeted therapy in the near future.
[0053] The development and progression of tumor cells is driven by the molecular changes accumulated within the cells. These developing tumor cells are in continuous equilibrium with the immunologic targets within the tumor microenvironment, eventually evading the immune system. The current disclosure postulates that the chemokine CCL24 drives the progression of aggressive breast cancer leading to metastasis. The rationale for this hypothesis is based on strong preliminary observations that the expression of CCL24 specific to basal-like breast cancer cells may serve as a selected variant evading immune system and promoting breast cancer metastasis.
[0054] The current disclosure utilizes two specific aims to understand the oncogenic function of CCL24 in breast cancer. Aim 1: to determine the clinical significance of CCL24 in breast cancer. In this aim, the current disclosure will determine the clinical significance of a novel chemokine CCL24 protein in clinical samples using archival specimens of breast cancer tissues. The rationale for this aim is based on higher CCL24 protein/mRNA expression in triple negative cancer cells (MDA-MB231, HCC1143, MDA-MB157 and HCC70) as compared to normal or less aggressive cell lines (MCF-10A, T47D, and MCF7). Aim 2: determine the oncogenic function and therapeutic targeting of CCL24 in breast cancer cell growth and metastasis. The current disclosure will determine the oncogenic function of CCL24 in breast cancer using in vitro and in vivo methods. The current disclosure developed CCL24-knockout and CCL24-overexpressing breast cancer cell lines for in vitro studies, and their tumorigenic potential regulating immune suppressor cells of myeloid progenitors in vivo mouse models.
[0055] Chemokine CCL24 in Cancer: Studies on the role of chemokine CCL24 in cancer remain completely uncharacterized. A previous study reports an association of CCL24 with primary and metastatic tumors of colorectal origin. However, recently it is shown that CCL24 expression decreased in glandular cells with tumor progression. There is no study in the literature addressing any connotation (including expression and function) of CCL24 in breast cancer.
[0056] Because of the inventor's prior research focus in prostate cancer, and recent interest in understanding the tumor immunology of breast and cervical cancers, the current disclosure initiated the CCL24 expression screening in a panel of human prostate, cervical, and breast cancer cell lines. In prostate cancer cell lines, it was observed a dysregulated expression of CCL24 mRNA, while no detectable mRNA was observed in cervical cancer cell lines, see
[0057] However, CCL24 mRNA expression was very strong and consistent in TNBC cells (MDA-MB231, HCC1143, MDA-MB157 and HCC70) as compared to normal or less tumorigenic (MCF-10A, T47D, and MCF7) breast cancer cells (see
[0058] As part of the current disclosure's research to propose CCL24 as serum-based novel biomarker due to its specificity to aggressive breast cancer, CCL24 chemokine levels in serum samples from human breast cancer patients were analyzed. Observations show a higher level of CCL24 mRNA and protein in TNBC cell lines of African American (AA) ethnicity (MDA-MB157 and HCC70) as compared to Caucasians (MDA-MB231 and HCC1143:
[0059] These results could be due to 1) very small sample size; 2) the tested serum samples are from the primary breast cancer patients; and 3) it could be possible that the CCL24 released by the tumor cells may not be found in free-state in the circulation. Nonetheless, preliminary observations strongly support a direct role of CC chemokine ligand (CCL24) in breast cancer progression and metastasis. Therefore, the current disclosure addresses the question that CCL24 may serve as an oncogenic driver in breast cancer cells and at the same time increasing lymphocytes trafficking at the tumor site establishing pro-tumor environment stimulating breast cancer metastasis. Successful completion of this study will open a new direction in establishing the clinical significance of CCL24 as a molecular marker and a therapeutic target including immunotherapy intervening the progression and development of aggressive/metastatic breast cancer.
[0060] Understanding the molecular basis of breast cancer is important in identifying novel molecule(s) associated with the development and progression of this disease. In this aim, the current disclosure will determine the clinical significance of a novel chemokine CCL24 in breast cancer progression. Based on strong preliminary observations, the current disclosure will determine the expression of CCL24 protein in clinical samples using archival specimens of breast tumor tissues. The rationale for this study is that the CCL24 is significantly higher in TNBC (MDA-MB231, HCC1143, MDA-MB157 and HCC70) than the normal or less aggressive cell lines (MCF-10A, T47D, and MCF7).
[0061] (1.1) Collection of breast tissue samples. The current disclosure will obtain archival breast tissue samples and utilize the Core facility at Medical College of Wisconsin. The current disclosure will analyze CCL24 protein expression by quantitative immunohistochemistry (IHC) in a material of 2,000 primary invasive breast cancer specimens assembled into tissue microarrays that have been collected by Dr. Rui (Study collaborator). There is extensive clinical follow-up data on these specimens (median follow-up of 8.8 years), including histopathological variables and treatment. These data will allow us to adjust clinical outcome correlation of CCL24 in multivariable analysis to determine whether tumor expression of CCL24 is an independent predictor of clinical outcome. Dr. Rui also has a breast cancer progression tissue microarray of 40 normal, 40 DCIS, 60 invasive breast cancers (grades 1-3), and 40 lymph node metastases. This progression array will allow the examination of CCL24 expression in tumors across different phases of progression. All these human breast tissue specimens are archival materials and will be received in a blinded fashion (de-identified) and the PI does not have any access to patient's personal information, and therefore exempt from full IRB review.
[0062] (1.2) Pathological analysis of the breast tissue specimens. This is the first time the CCL24 protein will be analyzed for its clinical implications in breast cancer. IHC staining will be performed by a dedicated facility at the Clinical Pathology Core at the Medical College of Wisconsin. We have established sensitive IHC of CCL24 in formalin-fixed, paraffin-embedded tissue using a robotic Agilent/Dako Omnis autostainer. For increased sensitivity and the opportunity to measure CCL24 in both the cancer cell compartment and the stromal cell compartment of tumors, multiplexed immunofluorescence will be used. CCL24 will be detected using Cy5 channel, pan-cytokeratin staining will help identify the cancer cell compartment and distinguish it from the stromal compartment, and DAPI will stain cell nuclei blue. Stained slides will be digitized into images on the Panoramic Flash 250 scanner (3DHistech). CCL24 will be objectively quantified in cancer cells and in stromal cells using the advanced Tissue Studio platform. Correlation to clinical outcome will be performed using Kaplan-Meier analyses with log-rank statistics, followed by Cox regression for multivariable adjustment for clinic-pathological and treatment variables.
[0063] (1.3) Sample size calculation and analysis plan. The clinical outcome cohort will be randomly divided into a training and validation set. Based on preliminary analysis, we expect that in the validation cohort of 1,000 patients, 10-year progression-free survival (PFS) is 82% and the time from the surgery varies uniformly from 10 to 20 years. It is assumed that high-risk patients identified by the optimal cutoff for a biomarker will have 10-year PFS of 70% or less and at least 20% of the 600 patients are high-risk. Then, the sample size of 120 patients in the high-risk group and 480 patients in the low risk group provides 80% power to detect the hazard ratio of 1.74 using the two-sided log-rank test with alpha=0.05. If the proportion of high-risk patients is higher than 20% or 10-year PFS is lower than 70%, then the power is higher. The sample size will also effectively allow multivariable adjustment for key clinicopathological variable, including, age, race, tumor size, histological grade, lymph node status, metastasis status, hormone receptor status, and treatment. The Fisher's z-test for correlation (based Pearson's correlation coefficient) will have greater than 95% power to detect a linear association of 0.3 or greater at the 5% level of significance. Means and 95% confidence intervals will be reported for continuous variables; medians and interquartile ranges will be substituted when skewness cannot be remedied. The comparative expression of CCL24 in paired tissue samples (benign and malignant) will be done using McNemars test. Kaplan-Meier curves will be drawn to illustrate the significance of CCL24 expression with patient prognosis.
[0064] This aim is designed to examine the clinical significance of chemokine CCL24 in the development and progression of breast cancer. The study is expected to define the pattern and extent of CCL24 protein expression providing a novel insight to predict the outcome of breast cancer. Because CCL24 is a chemokine and plays a critical role in trafficking of lymphocytes, it is expected that the expression level of CCL24 protein will have clinical significance with tumor grade and stage in human breast tissue specimens. If so, this will be the very first study providing evidence to establish the clinical significance of CCL24 in the growth and development of breast cancer.
[0065] Aim 2: To determine the oncogenic function and therapeutic targeting of CCL24 in breast cancer. Preliminary studies indicate strong expression of CCL24 mRNA and protein in highly aggressive TNBC cells (MDA-MB231, HCC1143, MDA-MB157 and HCC70) in contrast to normal (MCF-10A), ER+ (T47D), and ERPR+ (MCF7) breast cancer cells. Further extension of CCL24 mRNA expression in a panel of prostate cancer cell lines showed very low to non-detectable, while in cervical cancer cell lines CCL24 mRNA was not detectable. This observation suggest a critical role of CCL24 specific to breast cancer cell growth and metastasis. Therefore, in this study, the current disclosure proposes to determine the oncogenic function of CCL24 in breast cancer using in vitro and in vivo assays.
[0066] (2.1). In vitro functional analysis of CCL24 in breast cancer. (2.1a) Establishment of a CCL24 knockout (KO)/over-expressed breast cancer cell lines: CCL24 mRNA is highly expressed in TNBC cell lines, while low to non-detectable in MCF-10A, T47D, and MCF-7 cell lines. Since the functional significance of CCL24 in breast cancer remains uncharacterized, the current disclosure will determine the gene function of the chemokine CCL24 by generating CCL24-KO cell lines of MDA-MB-231 and MDA-MB-157 using short hairpin RNA (shRNA), and over-expression of CCL24 in MCF-10A and T47D cells using CCL24 DNA plasmid. The selection of MCF-10A and T47D for over-expression or MDA-MB-231 and MDA-MB-157 for silencing of CCL24 is based on expression analysis of CCL24 as in
[0067] (2.1b) Effect of cell proliferation. The human breast cancer cell lines MCF-10A and T47D over expressing CCL24, and MDA-MB-231 and MDA-MB-157 silenced for CCL24, with their respective control cell lines, will be compared in cell proliferation assays determining the molecular function of CCL24 gene. These cell lines will be seeded into 96 well plates. A MTT assay will be performed at 24, 48, 72, and 96 hours to examine the function of CCL24 in breast cancer cell proliferation. The current disclosure will also perform cell growth kinetics of these selected clones in comparison with their parental cells at 24, 48, 72, and 96 hours by seeding 110.sup.6 cells into 100 mm tissue culture petri-dish. All experiments will be conducted in triplicate, and will be repeated at least three times. Quantitative data will be collected and statistically analyzed.
[0068] (2.1c) Cell invasion assay. A Boyden chamber invasion assay with matrigel will be performed to test the oncogenic function of CCL24 in motility of the established cells. MCF-10A and T47D over expressing CCL24, and MDA-MB-231 and MDA-MB-157 silenced for CCL24 along with their respective parental cells will be seeded (110.sup.4) with 0.5 ml of the cell culture medium into inserts pre-coated with matrigel. The lower chamber of the well will be filled with complete culture medium. Following 24 and 48 hours of incubation, cells on the bottom of the membrane will be counted by staining with crystal violet. Additionally, the current disclosure will use a secondary assay, Oris Cell Migration Assay (Platyplus Technologies LLC, Madison, Wis.) to evaluate the function of CCL24 in cell migration. All experiments will be conducted in triplicate and will be repeated at least three times. Quantitative data will be collected and statistically analyzed.
[0069] (2.2). In vivo functional study of CCL24 in breast cancer. (2.2a) In vivo tumor growth study analyzing oncogenic function of CCL24 in breast cancer: To evaluate the oncogenic function of CCL24 gene on breast tumor cell growth, most effective clones of TNBC cells (MDA-MB-231 and MDA-MB-157) silenced for CCL24 or CCL24 over-expressing (MCF-10A and T47D) cells will be used. To establish tumors, CCL24-KO or over-expressing cells (510.sup.5) will be inoculated for subcutaneous xenograft in female nude mice (10 mice per group), which are ideal to study the gene function in tumor biology. The parental cells transfected with a scrambled shRNA or empty vector will serve as control. Tumor volume will be measured using a Vernier caliper as demonstrated in our previous studies. At the end of the experiment, tumors will be harvested and weighed. Liver and lungs will be checked for metastatic lesions. Tumors will be snap frozen, and paraffin-embedded tissue sections will be stained with hematoxylin and eosin to determine tissue histology including the extent of necrosis or apoptosis. The cell proliferation index and angiogenesis markers (Ki-67; PCNA; BrdU and VEGF) will be assessed using (IHC).
[0070] (2.2b) Analysis of immune suppressor cells polarization in the tumor microenvironment. Unarguably, tumor cells induce immune defects including mobilization of immune suppressor cells (T-regulatory cells; myeloid-derived suppressor cells: MDSCs; and polarization of macrophages) conducive to tumor promoting environment. Currently, T-regs and MDSCs are therapeutic targets to augment anticancer activities. Since, the events at the tumor site dictate the destruction or promotion of tumor cells; CCL24 deletion will inhibit the polarization of tumor associated macrophages (TAM) and infiltration of immune suppressor cells in the tumor microenvironment. To determine the polarization and infiltration of macrophages and MDSCs due to chemokine CCL24 in breast cancer cells, 4-6 week old female NOD-SCID mice will be injected by intraperitoneal route with human PBMCs (110.sup.7 PBMCs in 100 l of PBS) from healthy donor. At the same time, 5105 breast tumor cells (CCL24-KO or overexpressed along with respective control cell lines in 100 ul of volume) will be injected subcutaneously on back flank of NOD-SCID (10 mice per group). Tumor growth will be monitored as in Aim 2.2. At the end of the experiment, mice will be sacrificed to harvest the spleen and tumor to measure the amount of immune suppressor cells (T-regs; MDSCs; and TAM) using phenotypic markers CD4+ FoxP3+, and CD11b+ Gr1+). Liver and lungs will be checked for metastatic lesions. Excised tumors will be weighed, and divided into two parts. One part will be frozen fixed and paraffin embedded for the analysis of gross morphological changes in tumor cells. The second part of the tumor will be digested with the enzyme solution to prepare a single cell suspension. The lymphocytes will be gated using anti-CD45 antibody to analyze the level of T-regs and MDSCs and the polarization of TAM (from M1 to M2 using macrophage-specific phenotypic markers).
[0071] (2.2c) Immune suppressive cytokines analysis in tumor lysate. From the experimental settings as in Aim 2.3, tumor cell lysate will be prepared using protease and phosphatase inhibitors in PBS with subsequent vortexing and sonication. Following the protein estimation using Bradford reagent, equal amounts of protein from CCL24 KO or over-expressed cells and control tumor cell lysates will be used to perform ELISA assay for IL-10, TGF-, TNF-, and GMCSF.
[0072] (2.2d) Therapeutic targeting of CCL24 by antibody neutralization. Testing of the therapeutic efficacy of CCL24 targeting uses syngeneic mouse models. Mice will be inoculated subcutaneously with 4T1 or E0771 breast tumor cells respectively in Balb/c or C57BL/6 mice. For the in vivo blocking of CCL24, neutralizing antibodies diluted in PBS (CCL24 antibodies (CCL24/Eotaxin-2 MAb and CCL24/Eotaxin-2 Affinity Purified Polyclonal Ab, R&D systems) will be mixed and used at 50 g/dose (monoclonal) and 10 g/dose (polyclonal). Isotype controls rat IgG2A and normal goat IgG (R&D systems) will be mixed and used at a similar dose. The mice will be treated with the neutralizing antibodies 1 day before tumor cell inoculation with 4T1 or E0771 cells and then every other day post tumor inoculation for two weeks. The mice will be culled on day 21 for tumor and spleen harvesting and analyzing immune suppressor cells as above. Immune suppressor cells express CCR3, a receptor for CCL24. As proposed in this invention, higher expression of CCL24 in breast tumors will increase the accumulation of CCR3 immune suppressor cells at the tumor site promoting metastasis of breast cancer. Therefore, the proposed innovation is that targeted inhibition of CCL24-CCR3 axis will inhibit breast cancer cell growth and metastasis.
[0073] (2.2e) Statistical analysis. Mice will be randomly assigned to one of two groups (CCL24-KO or control, with injection of different tumor cell lines). Ten mice per group results in an overall sample size of 40 mice per experimental set (2 cell lines with their respective controls). One goal is to measure tumor growth and metastasis. Since the current disclosure postulates that the mice with silenced CCL24 function will either show similar (H0) or significantly less (H1) tumor growth than control mice, a one-sided two-sample t-test will be used to make inferences about differences in mean tumor weight and volume. With 10 mice per group, the t-test will have greater than 95% power to detect a difference equivalent to 2.0 standard deviations in the two groups at the 5% level of significance. Ten mice per group will also ensure detection of a difference as small as 1.2 standard deviations with sufficient (83%) power. Should the data not meet the assumptions of the t-test; appropriate transformations will first be attempted. If one cannot be found, the nonparametric Wilcoxon (Mann-Whitney) Rank-Sum test will be used instead; and this should result in no greater than a 5% loss of power for the test of our primary outcome.
[0074] Expected outcomes and alternative strategies. By completing the proposed experiments in this Aim, the current disclosure expects to determine the novel function of CCL24 in breast tumor cell growth, and that the inhibition of CCL24 significantly suppresses invasion and migration of breast cancer cells metastasis compare to parental cell lines. It is expected that the knockdown of CCL24 will inhibit the modulation of immunosuppressor cells (infiltration in the tumor and macrophage polarization) in breast tumor microenvironment, thereby inhibiting migration and metastasis of breast cancer cells supporting our proposed hypothesis. The current disclosure proposes that diminished immunosuppressive activity following therapeutic targeting of CCL24 will apply breaks on the evolution of metastatic behavior of breast tumor cells providing a novel opportunity for an improved management/treatment of breast cancer. Since immune suppressor cells (T-regs, MDSCs and macrophages) express CCL24 receptor CCR3, neutralization of CCL24 is expected to inhibit immune suppressor cells trafficking in to TME.
TABLE-US-00001 SEQUENCELISTING <110>UniversityofSouthCarolina <120>CCL24asaDiagnosticandTherapeuticTargetforBreastCancer <130>2033101.0000139 <140>Unknown <141>2020Nov.25 <150>U.S.ProvisionalApplicationNo.62/940,396 <151>2019Nov.26 <160>2 <170>PatentIn <210>1 <211>1441 <212>DNA <213>Homosapiens <221>CDS <222>111...470 <400>1 ATCATTTCTGCTCTGCACTTGGCACCAAGGCTGTCACCCTGTTACCTCCGGGTCCTTTCC60 TCCTGCACGTCAGCTTTGAGCCCCGAGCTGGTGCTTCTGCTCTCTGAGACATGGCAGGCC120 TGATGACCATAGTAACCAGCCTTCTGTTCCTTGGTGTCTGTGCCCACCACATCATCCCTA180 CGGGCTCTGTGGTCATCCCCTCTCCCTGCTGCATGTTCTTTGTTTCCAAGAGAATTCCTG240 AGAACCGAGTGGTCAGCTACCAGCTGTCCAGCAGGAGCACATGCCTCAAGGCAGGAGTGA300 TCTTCACCACCAAGAAGGGCCAGCAGTTCTGTGGCGACCCCAAGCAGGAGTGGGTCCAGA360 GGTACATGAAGAACCTGGACGCCAAGCAGAAGAAGGCTTCCCCTAGGGCCAGGGCAGTGG420 CTGTCAAGGGCCCTGTCCAGAGATATCCTGGCAACCAAACCACCTGCTAATCCCCGCCCA480 GCCCTCCAGCCCTGAGTTTGGGCCTGAGCTGCTTGGCGGGCTACTCGGGGCCTGGAGAAG540 CCACAGTGATGGGGGGAAGAGCTAATTTTCCTGTTTCTTAGCAACACTCTCCAGGGATGT600 GTCTCTTCTATGAAAAACCCGAGGGAGCAGGTGATGTGGTTCCCGGGGGCTGAGCAATGG660 CTCCAAGCATCCAAGGCCCCTTGCCTTTCTGGAGCTGGGTGAGAAGATCCCAGAAGGAGA720 GCAGTGGCAACTCTTTGCCTTCTCCTCCTGACCTGGTTCTGATGCTTTTTCTTTTTTTTT780 TTTTTCTGAGACGGAGTCTCGCTCTGTCACCCAGGCTGGAGTGCAGTGGCACAATCTCGG840 TTCACTGCAACCTCCGCCTCCTGGGTTCAAGTGATTCTCGTGCCTCAGCCTCCCGAGTAC900 CTGGGACTACAGGTGTGTACCACCACACCCAACTAACTTTTGTATTTTTAGTAGAGATGA960 GGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGGCCTCAAGTGATCTACCTGCCT1020 CGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACACCCAGCCTACTCAAACTT1080 TTATGTTGAAAAAAAAAAATCATAATTTTTTTTTTTTTAAAGGAAATGAACGTGGAGGAC1140 TGGGGTGAAGGGCCAGCCTGGGTAGTTTAATCTTTTTGGGAAGACATGACTTTAAGGAGA1200 TTCCCTGCTTTGTGACAGGTTGCTCCATGCTGTCTTGGGGACAAGGGCCTGTACTGCCTT1260 CAAATCTGGGCTCACCCCACATTTTGGTGAGGGGAAGATAGGGTGGGGGGATTAGGGGGA1320 GAAAAGACTCTAGCTTTTTTTTTCTATGCATGATATACTGTGTGGGTTTATCAAGAGTGT1380 AGACACAGTTGCTGTTCTCAAATAATAGGCCAAATAAAATGCGATTCTTTTTTTCTTTGA1440 A <210>2 <211>119 <212>PRT <213>Homosapiens <400>2 MetAlaGlyLeuMetThrIleValThrSerLeuLeuPheLeuGlyVal 51015 CysAlaHisHisIleIleProThrGlySerValValIleProSerPro 202530 CysCysMetPhePheValSerLysArgIleProGluAsnArgValVal 354045 SerTyrGlnLeuSerSerArgSerThrCysLeuLysAlaGlyValIle 505560 PheThrThrLysLysGlyGlnGlnPheCysGlyAspProLysGlnGlu 65707580 TrpValGlnArgTyrMetLysAsnLeuAspAlaLysGlnLysLysAla 859095 SerProArgAlaArgAlaValAlaValLysGlyProValGlnArgTyr 100105110 ProGlyAsnGlnThrThrCyc 115
[0075] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the disclosure as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure that are obvious to those skilled in the art are intended to be within the scope of the disclosure. This application is intended to cover any variations, uses, or adaptations of the disclosure following, in general, the principles of the disclosure and including such departures from the present disclosure come within known customary practice within the art to which the disclosure pertains and may be applied to the essential features herein before set forth.