Plant-produced chimaeric Orbivirus VLPs
11053509 · 2021-07-06
Assignee
- Csir (Pretoria, ZA)
- University Of Cape Town (Cape town, ZA)
- ONDERSTEPOORT BIOLOGICAL PRODUCTS SOC LTD (Pretoria, ZA)
Inventors
- Albertha René VAN ZYL (Wynberg, ZA)
- Ann Elizabeth Meyers (Plumstead, ZA)
- Daria Anna RUTKOWSKA (Centurion, ZA)
- Edward Peter Rybicki (Cape Town, ZA)
- Hester Catharina STARK (Irene, ZA)
- Martha Magaretha O'KENNEDY (Pretoria, ZA)
- Nobalanda Betty MOKOENA (Montana, ZA)
Cpc classification
C12N15/8258
CHEMISTRY; METALLURGY
C12N2720/12134
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
This invention relates to a second generation, plant-produced synthetic Orbivirus candidate vaccine. The vaccine comprises a plant produced chimaeric Orbivirus virus like particle (VLP) comprising at least one structural protein from one Orbivirus serotype and at least one structural protein selected from another serotype of the Orbivirus, wherein both structural capsid proteins are from the same Orbivirus species. In particular the invention relates to a vaccine against an Orbivirus, a method of producing chimaeric Orbivirus virus-like particles (VLPs) for use in a method of prevention and/or treatment of an Orbivirus infection, the use of the chimaeric Orbivirus VLPs in the manufacture of a vaccine for an Orbivirus, and a method of preventing and/or treating an Orbivirus infection.
Claims
1. A method of producing a chimaeric African Horse Sickness Virus (AHSV) VLP in a plant cell, the method comprising: (i) providing codon-optimised nucleotide sequences encoding AHSV VP2, VP3, VP5 and VP7 structural proteins, wherein at least one of the VP2, VP3, VP5 and VP7 structural proteins is selected from a first AHSV serotype and at least one of the VP2, VP3, VP5 and VP7 structural proteins is selected from a second AHSV serotype of the same AHSV species; (ii) cloning the codon-optimised nucleotide sequences into at least one expression vector adapted to express the structural proteins in a plant cell; (iii) transforming or infiltrating the plant cell with the at least one expression vector of step (ii); (iv) co-expressing the VP2, VP3, VP5 and VP7 structural proteins in the plant cell, such that the expressed structural proteins assemble to form the chimaeric AHSV VLP; and (v) recovering the chimaeric AHSV VLP from the plant cell.
2. The method of claim 1, wherein in step (i) at least one of the VP2, VP3, VP5 and VP7 structural proteins is selected from a third AHSV serotype.
3. The method of claim 2, wherein at least one of the VP2, VP3, VP5 and VP7 structural proteins is selected from a fourth AHSV serotype.
4. The method of claim 1, wherein the structural proteins are transiently expressed in the plant cell.
5. The method of claim 1, wherein the at least one expression vector includes a promoter and/or other regulatory sequences, operably linked to each nucleotide sequence encoding each structural protein.
6. The method of claim 1, wherein in step (iii) the at least one expression vector is transformed into the plant cell in a ratio of 1:1:1:1 or a ratio of 1:1:2:1 or a ratio of 2:1:2:1 of the nucleotide sequences encoding VP2:VP3:VP5:VP7.
7. The method of claim 1, wherein the plant cell is a Nicotiana benthamiana cell.
8. The method of claim 1, wherein the plant cell is a mutant N. benthamiana dXT/FT tobacco cell, which facilitates mammalian-like or human-like glycosylation of polypeptides.
9. The method of claim 1, wherein the expression of the AHSV VP2, VP3, VP5 and VP7 structural proteins in the plant cell is mediated by Agrobacterium AGL-1, LBA4404 or GV3101 pMP90.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) Non-limiting embodiments of the invention will now be described by way of example only and with reference to the following figures:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
DETAILED DESCRIPTION OF THE INVENTION
(36) The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the invention are shown.
(37) The invention as described should not be limited to the specific embodiments disclosed and modifications and other embodiments are intended to be included within the scope of the invention. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
(38) As used throughout this specification and in the claims which follow, the singular forms a, an and the include the plural form, unless the context clearly indicates otherwise.
(39) The terminology and phraseology used herein is for the purpose of description and should not be regarded as limiting. The use of the terms comprising, containing, having and including and variations thereof used herein, are meant to encompass the items listed thereafter and equivalents thereof as well as additional items.
(40) By bluetongue or BT is meant a virus belonging to a group of approximately 26 related but genetically distinct serotypes. The virus may also be referred to herein as bluetongue virus or BTV.
(41) BTV is a double stranded ribonucleic acid (dsRNA) virus that causes an insect-borne, infectious non-contagious disease of both domesticated and wild ruminants; it is the type species of the genus Orbivirus that is classified into the family Reoviridae. Reoviridae is one of the largest families of viruses and includes major human pathogens, such as rotavirus, as well as pathogens of insects, reptiles, fish, plants and fungi. Orbiviruses differ from other members of the Reoviridae family in that they can multiply in both arthropod and vertebrate cells, causing severe disease and high mortality. BTV is transmitted between its hosts by Culicoides spp., causing disease in ruminants worldwide.
(42) Virus protein (VP) 2 is the most variable of the BTV capsid proteins and contains the epitopes involved in virus neutralisation and serotype determination (DeMaula at al., 2000, Huismans and Erasmus, 1981). Twenty six distinct serotypes of BTV have been identified based on neutralisation activity of VP2 as well as with BTV specific real time reverse transcriptase polymerase chain reaction (RT-PCR). Each serotype shows variation that is associated with the geographical origins of the virus from around the world. Molecular studies on BTV isolates from different geographic regions have further divided BTV into two major topotypes, namely the eastern and western lineages.
(43) The BTV genome is a double-stranded circular dsRNA surrounded by a protein capsid. BTV can replicate in both wild and domestic ruminants as well as some species of deer. Replication takes place in both the host and the Culicoides insect vector. BTV virions are complex three-layered icosahedral structures that are 80 nanometer (nm) in diameter. The virions are composed of a core of ten segments of dsRNA encapsulated by seven structural proteins (four major and three minor proteins) that are arranged into three distinct layers (
(44) The three minor proteins (viral protein (VP) 1, VP4 and VP6) are enclosed by the subcore that is made up of VP3. The core-surface layer consists of VP7. The outer capsid is composed of major proteins VP2 and VP5 which are laid onto the foundation provided by the core. The minor proteins together with the genomic RNA form the virus replication complex, whereas the four major proteins make up the capsid of the virus. In addition to the structural proteins BTV has four non-structural (NS) proteins (NS1, NS2, NS3/3a and NS4) which are involved in virus replication and assembly in BTV-infected cells.
(45) The chimaeric VLPs and compositions according to the invention may be used to treat or prevent BTV infection or conditions associated with BTV infection. By condition associated with BTV infection is meant any condition, disease or disorder that has been correlated with the presence of an existing BTV infection, includes secondary effects, such as reductions in milk production, weight gain, wool break and temporary infertility.
(46) BTV can infect all known species of domestic and wild ruminants. Severe disease usually occurs in the fine-wool and mutton breeds of sheep as well as some species of deer. BTV infection of cattle, goats and wild ruminant species is mostly asymptomatic or subclinical. In BTV endemic areas BTV-infected sheep develop only mild or no obvious disease. The bluetongue after which the disease is named is seen only in serious clinical cases.
(47) Onset of the disease in sheep is typically characterised by high fever lasting 5-7 days. Clinical signs of disease can include fever, depression, excessive salivation, nasal discharge, facial oedema, hyperaemia and ulceration of the oral mucosa, coronitis, lameness and death. Abortion can occur in pregnant animals as well as teratogenic defects in calves. The severity of clinical disease and mortality rate is influenced by the breed and age of the animal as well as the virus strain that causes the infection. In acute cases of BT, clinical signs in sheep are mainly associated with damage to microvascular endothelial cells.
(48) After recovery from BT animals may suffer from a number of long-lasting secondary effects, such as reductions in milk production, weight gain, wool brake and temporary infertility.
(49) Pathogenesis of BTV infection is similar in sheep and cattle as well as other species of ruminants. After an animal gets infected with BTV, through the bite of a Culicoides vector, the virus will travel to the regional lymph node where initial replication takes place. The virus then spreads throughout the body to a variety of tissues, where replication occurs mainly in mononuclear phagocytic and endothelial cells.
(50) Viraemia is cell associated and can be prolonged in domestic ruminants.
(51) During viraemia BTV is associated with all blood cells, but late in the course of infection the virus is mostly associated with the erythrocytes. The longer lifespan of erythrocytes facilitates prolonged infection of ruminants, as well as the infection of the haematophagous insect vectors that feed on viraemic ruminants. Infectious virus can co-circulate for several weeks with high neutralising antibody titres, the maximum period of viraemia in sheep is about 50 days and in cattle about 100 days.
(52) By African horse sickness or AHS is meant the disease itself. The virus is referred to herein as African horse sickness virus or AHSV belongs to a group of approximately 9 related but genetically distinct serotypes.
(53) AHSV is a double stranded ribonucleic acid (dsRNA) virus that causes an infectious, non-contagious disease of equids. It is classified as an Orbivirus in the family Reoviridae. The virus is transmitted by biting midges of the Culicoides species.
(54) The AHS virion is an icosahedral, non-enveloped particle, composed of three concentric layers surrounding the segmented double-stranded RNA genome. The AHS virion has been reported to be between 70 nm-87 nm in diameter. The subcore, composed of structural protein VP3, encloses 10 linear genome segments and enzymatic minor proteins VP1, VP3 and VP6. The subcore is covered by a layer of VP7 trimers forming the core particle. The core is surrounded by the outermost layer composed of structural proteins VP5 and VP2, with VP2 being the neutralizing antigen and serotype determinant. There are nine known serotypes of AHSV and all are present within South Africa and most parts of sub-Saharan Africa.
(55) The chimaeric VLPs and compositions according to the invention may be used to treat or prevent AHSV infection or conditions associated with AHSV infection. By condition associated with AHSV infection is meant any condition, disease or disorder that has been correlated with the presence of an existing AHSV infection and includes secondary effects.
(56) AHSV infects equid species, such as horses, donkeys, mules and zebra, amongst others. The mortality rate in horses, the most susceptible species, can be up to 95% while donkeys and mules generally develop milder disease. Zebras are considered the natural vertebrate host of AHSV and rarely exhibit clinical signs of infection. Respiratory and circulatory functions are impaired in diseased animals and result in oedema of subcutaneous and intermuscular tissues, of lungs and haemorrahages of serosal surfaces. These animals also exhibit pyrexia and loss of appetite.
(57) A compound according to the invention includes, without limitation, a single chimaeric Orbivirus VLP including a core comprising capsid proteins VP3, VP5 and VP7 from one serotype of an Orbivirus species and an outer layer comprising a VP2 selected from any one of the other serotypes of the same Orbivirus species. In an alternative embodiment a compound of the invention includes, without limitation, a double chimaeric Orbivirus VLP including a core comprising capsid proteins VP3 and VP7 from one serotype of an Orbivirus species and an outer layer comprising the VP2 and VP5 capsid proteins selected from any one of the other serotypes of the same Orbivirus species.
(58) When the Orbivirus species is BTV, a compound according to the invention includes, without limitation, a single chimaeric VLP including a core comprising, for instance, BTV-8 capsid proteins VP3, VP5 and VP7 and an outer layer comprising a BTV VP2 selected from any one of the 26 BTV serotypes, with the exception of BTV-8. In an alternative embodiment a compound of the invention includes, without limitation, a double chimaeric VLP including a core comprising, for instance, BTV-8 VP3 and VP7 capsid proteins and an outer layer comprising BTV VP2 and VP5 capsid proteins selected from any one of the 26 BTV serotypes, with the exception of BTV-8
(59) Similarly, when the Orbivirus species is AHSV, a compound according to the invention includes, without limitation, a single chimaeric VLP including a core comprising, for instance, AHSV-1 capsid proteins VP3, VP5 and VP7 and an outer layer comprising AHS VP2 selected from any one of the 8 remaining AHSV serotypes. In an alternative embodiment a compound of the invention includes, without limitation, a double chimaeric VLP including a core comprising, for instance, AHSV-1 VP3 and VP7 capsid proteins and an outer layer comprising AHSV VP2 and VP5 capsid proteins selected from any one of the remaining 8 AHSV serotypes.
(60) It will be appreciated by those of skill in the art that the Orbivirus species could be an Orbivirus selected from the group consisting of Lebombo virus (LEBV), Pata virus (PATAV), African horse sickness virus (AHSV), Bluetongue virus (BTV), Altamira virus (ALTV), Almeirim virus (AMRV), Caninde virus (CANV), Changuinola virus (CGLV), Irituia virus (IRIV), Jamanxi virus (JAMV), Jari virus (JARIV), Gurupi virus (GURV), Monte Dourado virus (MDOV), Ourem virus (OURV), Purus virus (PURV), Saraca virus (SRAV), Acado virus (ACDV), Corriparta virus (CORV), Eubenangee virus (EUBV), Ngoupe virus (NGOV), Tilligerry virus (TILV), Epizootic hemorrhagic disease virus (EHDV), Kawanabe virus, Equine encephalosis virus (EEV), Great Island virus, Kemerovo virus (KEMV), Essaouira virus (ESSV), Kala iris virus (KIRV), Mill Door/79 virus (MILDV), Rabbit syncytium virus (RSV), Tribe virus (TRBV), Broadhaven virus (BRDV), Orungo virus (ORUV), Abadina virus (ABAV), Apies River virus, Bunyip Creek virus (BCV), Chuzan (Kasba) virus (SBV), CSIRO Village virus (CVGV), D'Aguilar virus (DAGV), Marrakai virus (MARV), Petevo virus (PETV), Vellore virus (VELV), Llano Seco virus (LLSV), Minnal virus (MINV), Netivot virus (NETV), Umatilla virus (UMAV), Wallal virus (WALV) and Mitchell River virus (MRV).
(61) A protein, peptide or polypeptide is any chain of two or more amino acids, including naturally occurring or non-naturally occurring amino acids or amino acid analogues, irrespective of post-translational modification (e.g., glycosylation or phosphorylation).
(62) The terms nucleic acid or nucleic acid molecule encompass both ribonucleotides (RNA) and deoxyribonucleotides (DNA), including cDNA, genomic DNA, and synthetic DNA. The nucleic acid may be double-stranded or single-stranded. Where the nucleic acid is single-stranded, the nucleic acid may be the sense strand or the antisense strand. A nucleic acid molecule may be any chain of two or more covalently bonded nucleotides, including naturally occurring or non-naturally occurring nucleotides, or nucleotide analogs or derivatives. By RNA is meant a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides. The term DNA refers to a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides.
(63) The term complementary refers to two nucleic acids molecules, e.g., DNA or RNA, which are capable of forming Watson-Crick base pairs to produce a region of double-strandedness between the two nucleic acid molecules. It will be appreciated by those of skill in the art that each nucleotide in a nucleic acid molecule need not form a matched Watson-Crick base pair with a nucleotide in an opposing complementary strand to form a duplex. One nucleic acid molecule is thus complementary to a second nucleic acid molecule if it hybridizes, under conditions of high stringency, with the second nucleic acid molecule. A nucleic acid molecule according to the invention includes both complementary molecules.
(64) In some embodiments, a chimaeric VLP of the invention may include, without limitation, BTV-8 VP3 (SEQ ID NO: 1 or 2), VP5 (SEQ ID NO: 3 or 4) and VP7 (SEQ ID NO: 5 or 6) polypeptides or derivatives thereof and/or a VP2 polypeptide selected from the group consisting of SEQ ID NOs 7 to 11, or derivatives thereof. Another embodiment of the invention includes, without limitation, nucleic acid molecules encoding the aforementioned amino acid sequences. It will however be appreciated by those of skill in the art that the VP3, VP5 and VP7 polypeptides may be polypeptides from any of the BTV serotypes, for example BTV-3 VP5 (SEQ ID NO:12), BTV-4 VP5 (SEQ ID NO:13) and BTV-4 VP7 (SEQ ID NO:14).
(65) In other embodiments, a chimaeric VLP of the invention may include, without limitation, AHSV-1 VP3, VP5 and VP7 polypeptides having an amino acid sequence of SEQ ID NOs: 15, 16 and 17, respectively or derivatives thereof and/or a VP2 polypeptide of SEQ ID NO:18 or 19, or derivatives thereof. Another embodiment of the invention includes, without limitation, nucleic acid molecules encoding the aforementioned amino acid sequences. It will however also be appreciated by those of skill in the art that the VP3, VP5 and VP7 polypeptides may be polypeptides from any of the AHSV serotypes, for example AHSV-7 VP5 (SEQ ID NO:20).
(66) As used herein a substantially identical sequence is an amino acid or nucleotide sequence that differs from a reference sequence only by one or more conservative substitutions, or by one or more non-conservative substitutions, deletions, or insertions located at positions of the sequence that do not destroy or substantially reduce the antigenicity of one or more of the expressed polypeptides or of the polypeptides encoded by the nucleic acid molecules. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the knowledge of those with skill in the art. These include using, for instance, computer software such as ALIGN, Megalign (DNASTAR), CLUSTALW or BLAST software. Those skilled in the art can readily determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In one embodiment of the invention there is provided for a polypeptide or polynucleotide sequence that has at least about 80% sequence identity, at least about 90% sequence identity, or even greater sequence identity, such as about 95%, about 96%, about 97%, about 98% or about 99% sequence identity to the sequences described herein.
(67) Alternatively, or additionally, two nucleic acid sequences may be substantially identical if they hybridize under high stringency conditions. The stringency of a hybridisation reaction is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation which depends upon probe length, washing temperature, and salt concentration. In general, longer probes required higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridisation generally depends on the ability of denatured DNA to re-anneal when complementary strands are present in an environment below their melting temperature. A typical example of such stringent hybridisation conditions would be hybridisation carried out for 18 hours at 65 C. with gentle shaking, a first wash for 12 min at 65 C. in Wash Buffer A (0.5% SDS; 2SSC), and a second wash for 10 min at 65 C. in Wash Buffer B (0.1% SDS; 0.5% SSC).
(68) In an alternative embodiment of the invention, the chimaeric VLPs may be prepared by, for instance, inserting, deleting or replacing amino acid residues at any position of the BTV VP2, VP3, VP5 or VP7 polypeptide sequences and/or, for instance inserting, deleting or replacing nucleic acids at any position of the nucleic acid molecule encoding the BTV VP2, VP3, VP5 or VP7 polypeptides.
(69) In an alternative embodiment of the invention, the chimaeric VLPs may be prepared by, for instance, inserting, deleting or replacing amino acid residues at any position of the AHSV VP2, VP3, VP5 or VP7 polypeptide sequences and/or, for instance inserting, deleting or replacing nucleic acids at any position of the nucleic acid molecule encoding the AHSV VP2, VP3, VP5 or VP7 polypeptides.
(70) Those skilled in the art will appreciate that polypeptides, peptides or peptide analogues can be synthesised using standard chemical techniques, for instance, by automated synthesis using solution or solid phase synthesis methodology. Automated peptide synthesisers are commercially available and use techniques known in the art. Polypeptides, peptides and peptide analogues can also be prepared from their corresponding nucleic acid molecules using recombinant DNA technology.
(71) In some embodiments, the nucleic acid molecules of the invention may be operably linked to other sequences. By operably linked is meant that the nucleic acid molecules encoding the VP2, VP3, VP5 and/or VP7 polypeptides of the invention and regulatory sequences are connected in such a way as to permit expression of the proteins when the appropriate molecules are bound to the regulatory sequences. Such operably linked sequences may be contained in vectors or expression constructs which can be transformed or transfected into host cells for expression. It will be appreciated that any vector or vectors can be used for the purposes of expressing the VP2, VP3, VP5 and/or VP7 of the invention.
(72) The term recombinant means that something has been recombined. When used with reference to a nucleic acid construct the term refers to a molecule that comprises nucleic acid sequences that are joined together or produced by means of molecular biological techniques. The term recombinant when used in reference to a protein or a polypeptide refers to a protein or polypeptide molecule which is expressed from a recombinant nucleic acid construct created by means of molecular biological techniques. Recombinant nucleic acid constructs may include a nucleotide sequence which is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature. Accordingly, a recombinant nucleic acid construct indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e. by human intervention. Recombinant nucleic acid constructs may be introduced into a host cell by transformation. Such recombinant nucleic acid constructs may include sequences derived from the same host cell species or from different host cell species.
(73) The term vector refers to a means by which polynucleotides or gene sequences can be introduced into a cell. There are various types of vectors known in the art including plasmids, viruses, bacteriophages and cosmids. Generally polynucleotides or gene sequences are introduced into a vector by means of a cassette. The term cassette refers to a polynucleotide or gene sequence that is expressed from a vector, for example, the polynucleotide or gene sequences encoding the VP2, VP3, VP5 and/or VP7 polypeptides of the invention. A cassette generally comprises a gene sequence inserted into a vector, which in some embodiments, provides regulatory sequences for expressing the polynucleotide or gene sequences. In other embodiments, the vector provides the regulatory sequences for the expression of the VP2, VP3, VP5 and/or VP7 polypeptides. In further embodiments, the vector provides some regulatory sequences and the nucleotide or gene sequence provides other regulatory sequences. Regulatory sequences include but are not limited to promoters, transcription termination sequences, enhancers, splice acceptors, donor sequences, introns, ribosome binding sequences, poly(A) addition sequences, and/or origins of replication.
(74) The chimaeric VLPs or compositions of the invention can be provided either alone or in combination with other compounds (for example, nucleic acid molecules, small molecules, peptides, or peptide analogues), in the presence of an adjuvant, or any carrier, such as a pharmaceutically acceptable carrier and in a form suitable for administration to mammals, for example, humans, cattle, sheep, etc.
(75) As used herein a pharmaceutically acceptable carrier or excipient includes any and all antibacterial and antifungal agents, coatings, dispersion media, solvents, isotonic and absorption delaying agents, and the like that are physiologically compatible. A pharmaceutically acceptable carrier may include a solid or liquid filler, diluent or encapsulating substance which may be safely used for the administration of the chimaeric. VLPs or vaccine composition to a subject. The pharmaceutically acceptable carrier can be suitable for intramuscular, intraperitoneal, intravenous, subcutaneous, oral or sublingual administration. Pharmaceutically acceptable carriers include sterile aqueous solutions, dispersions and sterile powders for the preparation of sterile solutions. The use of media and agents for the preparation of pharmaceutically active substances is well known in the art. Where any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is not contemplated. Supplementary active compounds can also be incorporated into the compositions.
(76) Suitable formulations or compositions to administer the chimaeric VLPs and compositions to subjects who are to be prophylactically treated for an Orbivirus infection, who are suffering from an Orbivirus infection or subjects which are presymptomatic for a condition associated with Orbivirus infection fall within the scope of the invention. Any appropriate route of administration may be employed, such as, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, intracistemal, intraperitoneal, intranasal, aerosol, topical, or oral administration.
(77) As used herein the term subject includes wild and domestic ruminants, equids or any specified target animal
(78) For vaccine formulations, an effective amount of the chimaeric VLPs or compositions of the invention can be provided, either alone or in combination with other compounds, with immunological adjuvants, for example, aluminium hydroxide dimethyldioctadecylammonium hydroxide or Freund's incomplete adjuvant. The chimaeric VLPs or compositions of the invention may also be linked with suitable carriers and/or other molecules, such as bovine serum albumin or keyhole limpet hemocyanin in order to enhance immunogenicity.
(79) In some embodiments, the chimaeric VLPs or compositions according to the invention may be provided in a kit, optionally with a carrier and/or an adjuvant, together with instructions for use.
(80) An effective amount of a compound according to the invention includes a therapeutically effective amount, immunologically effective amount, or a prophylactically effective amount. A therapeutically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as treatment of an Orbivirus infection or a condition associated with such infection. The outcome of the treatment may for example be measured by a decrease in viremia, inhibition of viral gene expression, delay in development of a pathology associated with the Orbivirus infection, stimulation of the immune system, or any other method of determining a therapeutic benefit. A therapeutically effective amount of a compound may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the compound to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the compound are outweighed by the therapeutically beneficial effects.
(81) The dosage of any of the chimaeric VLPs or compositions of the present invention will vary depending on the symptoms, age and body weight of the subject, the nature and severity of the disorder to be treated or prevented, the route of administration, the Orbivirus infection being treated and the form of the composition. Any of the compositions of the invention may be administered in a single dose or in multiple doses. The dosages of the compositions of the invention may be readily determined by techniques known to those of skill in the art or as taught herein.
(82) By immunogenically effective amount is meant an amount effective, at dosages and for periods of time necessary, to achieve a desired immune response. The desired immune response may include stimulation or elicitation of an immune response, for instance a T or B cell response.
(83) A prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired prophylactic result, such as prevention of onset of a condition associated with an Orbivirus infection. Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of disease, so that a prophylactically effective amount may be less than a therapeutically effective amount.
(84) Dosage values may vary with the severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the judgment of the person administering or supervising the administration of the chimaeric VLPs or compositions of the invention. Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected. The amount of active compound(s) in the composition may vary according to factors such as the disease state, age, sex, and weight of the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single dose may be administered, or multiple doses may be administered over time. It may be advantageous to formulate the compositions in dosage unit forms for ease of administration and uniformity of dosage.
(85) The term preventing, when used in relation to an infectious disease, or other medical disease or condition, is well understood in the art, and includes administration of a composition which reduces the frequency of or delays the onset of symptoms of a condition in a subject relative to a subject which does not receive the composition. Prevention of a disease includes, for example, reducing the number of diagnoses of the infection in a treated population versus an untreated control population, and/or delaying the onset of symptoms of the infection in a treated population versus an untreated control population.
(86) The term prophylactic or therapeutic treatment is well known to those of skill in the art and includes administration to a subject of one or more of the compositions of the invention. If the composition is administered prior to clinical manifestation of the unwanted condition (e.g., disease or other unwanted state of the subject) then the treatment is prophylactic, i.e., it protects the host against developing the unwanted condition, whereas if it is administered after manifestation of the unwanted condition, the treatment is therapeutic (i.e., it is intended to diminish, ameliorate, or stabilize the existing unwanted condition or side effects thereof).
(87) Toxicity and therapeutic efficacy of compositions of the invention may be determined by standard pharmaceutical procedures in cell culture or using experimental animals, such as by determining the LD.sub.50 and the ED.sub.50. Data obtained from the cell cultures and/or animal studies may be used to formulating a dosage range for use in a subject. The dosage of any composition of the invention lies preferably within a range of circulating concentrations that include the ED.sub.50 but which has little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For compositions of the present invention, the therapeutically effective dose may be estimated initially from cell culture assays.
(88) Provided herein are methods for producing a chimaeric BTV VLP in a plant cell, which comprises a core comprising BTV-8 capsid proteins VP3, VP5 and VP7 and an outer layer comprising BTV VP2 proteins selected from any one of the 26 BTV serotypes and methods for producing a chimaeric BTV VLP in a plant cell, which comprises a core comprising BTV-8 VP3 and VP7 capsid proteins and an outer layer comprising BTV VP2 and VP5 capsid proteins selected from any one of the 26 BTV serotypes.
(89) Similarly, methods for producing a chimaeric AHSV VLP in a plant cell, which comprises a core comprising AHSV-1 capsid proteins VP3, VP5 and VP7 and an outer layer comprising VP2 protein selected from any one of the 8 remaining AHSV serotypes and methods for producing a chimaeric AHSV VLP in a plant cell, which comprises a core comprising AHSV-1 VP3 and VP7 capsid proteins and an outer layer comprising AHSV VP2 and VP5 capsid proteins selected from any one of the remaining 8 AHSV serotypes.
(90) A VLP or virus-like particle refers to the capsid-like structure which results from the assembly of Orbivirus VP2, VP3, VP5 and VP7 polypeptides. These particles are antigenically and morphologically similar to native Orbivirus virus virions but do not include viral genetic material; accordingly, these particles are not replicating nor infectious.
(91) The invention also relates in part to a method of eliciting an immune response in a subject comprising administering to a subject in need thereof a prophylactically effective amount of the chimaeric VLPs or compositions of the present invention.
(92) The following examples are offered by way of illustration and not by way of limitation.
Example 1
(93) Nicotiana sp. codon-optimised BTV-8 VP2 (SEQ ID NO:27), VP3 (SEQ ID NO:21), VP5 (SEQ ID NO:23) and VP7 (SEQ ID NO:25) were synthesised (Geneart, Germany). The plant codon optimised nucleotide sequences encode the following proteins: BTV-8 VP2 (SEQ ID NO:7), VP3 (SEQ ID NO:1), VP5 (SEQ ID NO:3) and VP7 (SEQ ID NO:5). Primers were designed to add restriction enzyme sites (AgeI and XhoI) on the 5 and 3 termini, respectively (Table 1) such that they could be cloned into the pEAQ-HT expression vector using these sites.
(94) TABLE-US-00001 TABLE1 BTVgenespecificprimers Protein PrimerName Sequence SEQIDNO. BTV-8VP2 pEAQ-HTVP2F 5 GCACCGGTATGGAAGAACTCGCTATCCCAA3 (SEQIDNO:41) cVP2coR 5 GCCTCGAGTCAAACGTTGAGGAGCTTAGTAAG3 (SEQIDNO:42) BTV-8VP3 pEAQ-HTVP3F 5 GCACCGGTATGGCTGCTCAAAATGAGCAAAG3 (SEQIDNO:43) cVP3coR 5 GCCTCGAGTTAAACAGTTGGAGCAGCAAGC3 (SEQIDNO:44) BTV-8VP5 pEAQ-HTVP5F 5 GCACCGGTATGGGAAAGATTATTAAGTCCCTCTC3 (SEQIDNO:45) cVP5coR 5 GCCTCGAGTCAAGCGTTCCTAAGGAAGAG3 (SEQIDNO:46) BTV-8VP7 pEAQ-HTVP7F 5 GCACCGGTATGGATACAATTGCTGCTAGGG3 (SEQIDNO:47) cVP7coR 5 GCCTCGAGTCACACATAAGCAGCCCTAG3 (SEQIDNO:48)
(95) Resulting constructs were named pEAQ-HT-VP2, pEAQ-HT-VP3, pEAQ-HT-VP5 and pEAQ-HT-VP7. These constructs were sequenced and transformed into A. tumefaciens LBA4404.
(96) Ten ml cultures of all four recombinant constructs were grown up in LB containing magnesium sulphate (2 mM), rifampicin (50 g/ml) and kanamycin (30 g/ml) at 27 C. overnight with agitation at 200 rpm. A 10th of the volume was transferred to induction medium (LB, 10 mM MES, pH 5.6) containing the same concentration of antibiotics as well as 20 M acetosyringone. These were incubated overnight at 27 C. with agitation at 200 rpm and then centrifuged at 4000 rpm to pellet the cells. The cell pellets were resuspended in 5 ml of infiltration medium (10 mM MES, 10 mM MgCl.sub.2, 3% sucrose, pH 5.6) supplemented with 200 M acetosyringone and incubated at room temperature for 2 h. The OD.sub.600 of each culture was measured and the cultures diluted to an OD of 1.8 in infiltration medium. They were then combined in a ratio of 1:1:2:1 (VP2:VP3:VP5:VP7) and syringe-infiltrated into the abaxial surfaces of six-week-old N. benthamiana plants.
(97) At 9 days post infiltration (dpi) the leaves were ground up and immediately cut up into fine pieces and homogenized in three volumes of ice cold bicine buffer (50 mM bicine (pH 8.4), 20 mM sodium chloride (NaCl), and 1 Complete Mini, EDTA-free protease inhibitor cocktail (Roche)) lacking NLS and DTT. The homogenate was clarified by centrifugation at 1000g for 10 min after which the supernatant was filtered through four layers of Miracloth (Merck). The crude plant sap was overlayed onto 5 ml of a 40% iodixanol (Optiprep, Sigma-Aldrich) cushion prepared in 50 mM Tris-HCl, pH 8.4 and 20 mM NaCl after which it was centrifuged for 2 h at 79 000g in a SW 32 Ti rotor (Beckman). The 40% iodixanol cushion was collected after centrifugation from the bottom of the tube and overlayed onto 5 ml of a 20% to 60% step gradient (1 ml of each gradient in 10% incrementing steps) and centrifuged as above. Fractions of 0.5 ml were collected from the bottom of the tubes and analyzed by western blotting and TEM.
(98) For western blot analysis, the iodixanol fractions were incubated at 90 C. for 10 min in loading buffer. The proteins were separated on 8% SDS polyacrylamide gels where equal amounts of total protein were loaded in each lane. After electrophoresis the proteins were transferred onto nitrocellulose membranes using a Trans-Blot SD semi-dry transfer cell (Bio-Rad). Membranes were probed with a 1:2000 dilution of BTV-8 sheep serum (Thuenemann et al., 2013) and subsequently with a 1:10000 dilution of anti-goat/sheep alkaline phosphatase-conjugated secondary antibody (Sigma-Aldrich). Detection was performed with 5-bromo-4-chloro-3-indoxyl-phosphate (BCIP) and nitroblue tetrazolium (NBT) phosphatase substrate (BCIP/NBT 1-component, KPL). Western blot analysis of the first 8 fractions collected from the iodixanol gradient after centrifugation showed the presence of all four bands constituting the BTV-8 VLPs in fractions 4 (approximately 40%-50% iodixanol) up until fraction 8 (20%-30% iodixanol) (
(99) For TEM, copper grids (mesh size 200) were floated for 2 min on a 1:200 dilution of BTV-8 sheep serum and washed twice with sterile water. Thereafter the grids were floated on a 1:10 dilution of crude plant extract for 5 min and washed three times with sterile water. The samples were negatively stained for 1 min with 2% uranyl acetate. Fractionated samples from the density gradients were treated similarly except they were not captured onto the grids with anti-BTV-8 sheep serum. All grids were viewed using a Technai G2 TEM. TEM of fraction 4 from the density gradient showed a mixed population of both CLPs and VLPs based on diameter measurements (
(100) TEM on samples from leaves co-infiltrated with BTV VP constructs was also carried out. The BTV-8 pEAQ-HT-VP2, pEAQ-HT-VP3, pEAQ-HT-VP5 and pEAQ-HT-VP7 constructs were cultured and combined (as described previously) in a ratio of 1:1:2:1 (VP2:VP3:VP5:VP7) and syringe-infiltrated into the abaxial surfaces of six-week-old N. benthamiana plants.
(101) At 9 dpi a whole leaf was picked from the infiltrated plant and a 3 cm3 cm piece was cut out with a scalpel blade in the presence of 2.5% gluteraldehyde (25% gluteraldehyde diluted in 0.1 M phosphate buffer (pH 7.4)). The leaf sample was soaked in 2.5% gluteraldehyde for 6 hours after which it was cut into 1 mm3 mm fragments, also in the presence of 2.5% gluteraldehyde. The leaf fragments were left in 2.5% gluteraldehyde overnight at 4 C. The following morning the leaf fragments were washed 3 times, 5 minutes for each wash, in 0.1 M phosphate buffer (pH 7.4). The leaf fragments were fixed for one hour in one part 2% osmium tetroxide and one part 0.2 M phosphate buffer (pH 7.4) after which it was washed twice for 5 minutes each with 0.1 M phosphate buffer (pH 7.4) followed with two washes of 5 min each with water.
(102) After washing the leaf fragments were sequentially dehydrated. The leaf fragments were incubated for 5 minutes each in 30%, 50%, 70%, 80%, 90% and 95% ethanol. The fragments were incubated for 10 minutes in 100% ethanol; this step was repeated twice. After the ethanol dehydrations series the leaf fragments were further dehydrated by 10 minute incubation in 100% acetone, repeated twice. The leaf fragments were mixed overnight in 1:1 acetone:Spurr's resin.
(103) The following day half of the 1:1 acetone:Spurr's resin mixture was removed (after centrifugation) and replaced with 100% Spurr's resin to yield a 1:3 acetone:Spurr's resin mixture. The sample was mixed for four hours at room temperature, after which the acetone/resin mixture was removed and replaced with 100% Spun's resin. The leaf fragments were incubated in 100% Spurr's resin for three days at 4 C. The 100% Spurr's resin was replaced with fresh resin and incubated for four hours at room temperature after which the resin was replaced again and incubated overnight at room temperature. The following morning the samples were embedded and incubated for 24 hours at 60 C.
(104) The embedded leaf samples were cut into ultrathin sections with a diamond knife and collected onto copper grids. The copper grids were stained with uranyl acetate for 10 minutes after which they were washed five times, 15 seconds each, with water. The grids were blotted dry and transferred to lead citrate for 10 minutes after which the grids were washed with water and blotted dry. Grids were viewed using the Technai G2 transmission electron microscope.
(105)
Example 2
(106) In Example 1 the present inventors investigated the transient production of BTV VLPs in plants as an alternative cheaper source of safe and effective vaccine. The inventors have successfully shown that co-expression of Bluetongue virus (BTV) serotype 8 VP2, VP3, VP5 and VP7 capsid encoding genes by Agrobacterium-mediated infiltration of N. benthamiana results in the efficient assembly of virus-like particles (VLPs), and that these VLPs are highly immunogenic and are protective in sheep (
(107) The present example was performed to demonstrate that it is possible to produce BTV VLPs covering a wide range of serotypes by using the pre-existing BTV 8 VP3, 5 and 7 proteins as a common scaffold or core on which different serotype-specific VP2s could be presented representing other BTV serotypes thus producing a multivalent antigen.
(108) To prove this concept, we tested the production of VLPs in plants with a different BTV VP2 serotype i.e. a BTV-2 VP2. The VP2 gene was codon-optimised for N. benthamiana (SEQ ID NO:28) and synthesised by GenScript, cloned into the plant expression vector pEAQ-HT (Sainsbury et al., 2009) and electroporated into Agrobacterium tumefaciens LBA4404. This recombinant strain as well as those encoding BTV serotype 8 VP3, 5 and 7 genes (made previously) which are required for VLP assembly were co-infiltrated into N. benthamiana and the leaves were screened for the presence of all 4 proteins by western blotting after 8 days. A preliminary western blot was carried out on the samples to determine the presence of BTV VP proteins. VP3, 5 and 7 proteins were detected but VP2 was not (data not shown). The antiserum used for this western blot is polyclonal serum from sheep which have been injected with plant-produced BTV-8 VLPs. It is possible that the VP2 is not detected by this antiserum in this western blot because it is serotype 8-specific.
(109) We continued with scaling up of BTV VP production so that sufficient material could be obtained for purification and TEM analysis. Thirty plants were co-infiltrated with cultures of the 4 different recombinant strains and harvested after 8 days.
(110) The leaf material was homogenised, centrifuged to get rid of particulate matter, and the supernatant filtered through Miracloth. The filtrate was then loaded on top of a 30% Optiprep cushion made up in bicine buffer. The tubes were centrifuged at 22 000 rpm for 2 hours in a SW32Ti rotor and the interface between the cushion and supernatant aspirated. This was loaded on top of a 20 to 60% Optiprep gradient (made up in bicine buffer) and centrifuged at 22 000 rpm for 2 h in a SW32Ti rotor. The tube was fractionated into 101 ml fractions and some of the fractions were analysed on a western blot using the same polyclonal sheep antiserum used above to detect BTV VP protein.
(111)
(112) Fraction 5 of the gradient was analysed by transmission electron microscopy (TEM).
(113) We have shown that the co-infiltration of only BTV-8 VP3- and VP7-encoding constructs results in the formation of core-like particles (
(114) In previous work on BTV-8 VLPs only it was shown that an infiltration ratio of 1:1:2:1 of VP2:VP3:VP5:VP7 yielded the best VLPs and this was tested in this chimaeric constructs to try and skew production from more CLPs to more VLPs.
(115) This example proves that it is possible to make chimaeric BTV VLPs although the infiltration process needs to be optimised in order to direct the preferential assembly of VLPs rather than CLPs.
(116) Although BTV-8 VP3, VP5 and VP7 proteins are detectable by western blot and BTV-2 VP2 proteins are not, chimaeric BTV VLPs comprising of BTV-8 VP3, VP5 and VP7 and BTV-2 VP2 can be produced in plants although it seems there are significantly more core-like particles (CLPs) and sub-core-like particles (sCLPs) made than VLPs.
Example 3
(117) The following plant codon optimised nucleotide sequences were synthesised by Bio Basic Int.: BTV-3 VP2 (SEQ ID NO:29), BTV-3 VP5 (SEQ ID NO:32), BTV-4 VP2 (SEQ ID NO:30), BTV-4 VP5 (SEQ ID NO:33), BTV-4 VP7 (SEQ ID NO:34), BTV-8 VP2 (SEQ ID NO:31), BTV-8 VP3 (SEQ ID NO:22), BTV-8 VP5 (SEQ ID NO:24) and BTV-8 VP7 (SEQ ID NO:26). The plant codon optimised nucleotide sequences encode the following proteins: BTV-3 VP2 (SEQ ID NO:9), BTV-3 VP5 (SEQ ID NO:12), BTV-4 VP2 (SEQ ID NO:10), BTV-4 VP5 (SEQ ID NO:13), BTV-4 VP7 (SEQ ID NO:14), BTV-8 VP2 (SEQ ID NO:11), BTV-8 VP3 (SEQ ID NO:2), BTV-8 VP5 (SEQ ID NO:4) and BTV-8 VP7 (SEQ ID NO:6).
(118) Using the protocols described herein the nucleotide sequences where cloned into the pEAQ-HT expression vector and the vectors were subsequently electroporated into Agrobacterium tumefaciens LBA4404 (1.44 kV, 200 and 25 F). Similarly pEAQ-HT void of an insert were also electroporated into Agrobacterium and served as negative controls. A pEAQ-HT-gfp vector containing the green fluorescent protein gene (gfp) served as positive control. The product was resuspended in Luria broth medium, and placed on a rotor shaker at 28 C. for three hours to recover before plated on selective medium (50 mg/l streptomycin, 25 mg/l kanamycin and 20 mg/l Rifamycin). A single colony of each Insert was PCR validated using pEAQ-HT Fw (SEQ ID NO:49) and pEAQ-HT Rv (SEQ ID NO:50) primers. These primers are specific for the pEAQ-HT vector.
(119) TABLE-US-00002 TABLE2 pEAQ-HTplasmidspecificprimers. PrimerName Sequence SEQIDNO. pEAQ-HTFw 5 ACTTGTTACGATTCTGCTGACTTTCGGCGG3 (SEQIDNO:49) pEAQ-HTRv 5 CGACCTGCTAAACAGGAGCTCACAAAGA3 (SEQIDNO:50)
(120) Transient expression efficiency of the pEAQ series of vectors was investigated by agroinfiltration of Nicotiana benthamiana. The assembly of VLPs was also validated in N. benthamiana which facilitates mammalian-like or human-like glycosylation RNAi mutant N. benthamiana dXT/FT (Strasser et al., 2008). The pEAQ-HT constructs containing genes encoding individual capsid proteins of BTV serotypes 3, 4 and 8 were individually transformed into Agrobacterium. Prior to plant infiltration Agrobacterium tumefaciens strain (LBA4404) transformed with pEAQ-HT vector containing individual VP2, VP3, VP5 and VP7 of selected serotypes were streaked on YMB agar plates and incubated at 28 C. for 48 hrs. The growing bacterium was scraped off from the plate and inoculated into YMB broth with the relevant antibiotics and grown overnight. Cells were pelleted and resuspended in MMA buffer (100 mM MES, 10 mM MgCl.sub.2 and 100 mM acetosyringone; pH 5.6). Each of the four Agrobacterium cultures were adjusted to OD.sub.600 of approximately 0.5-0.7 with the same buffer. The formation of VLPs was validated by mixing and infiltrating the four constructs encoding the four individual capsid proteins at a ratio of 1:1:1:1 and used for plant infiltrations (20-25 plants; 15-20 cm in height). The Agrobacterium transformed with pEAQ-HT-gfp was used as the positive control and negative was A. tumefecians transformed with an empty pEAQ-HT vector. The construct pEAQ-HT-VP3 was sometimes substituted with pEAQ-VP3 wt, to suppress the expression of capsid protein VP3 and to shift the stoichiometry from core-like particles (CLPs) to VLPs as previously described (Theunemann, et al., 2013).
(121) The leaf material was harvested four to eight days after infiltration using a Matstone Multipurpose juice extractor in VLP extraction buffer (50 mM bicine, pH 8.4; 20 mM sodium chloride [NaCl], 0.1% (w/v) N-lauroylsarcosine (NLS) sodium salt, 1 mM dithiothreitol (DTT)) in a ratio 1:3 with complete protease inhibitor cocktail (P2714, Sigma Life Sciences) or complete EDTA-free tablets (Roche) added to the VLP extraction buffer immediately before the extraction started. In a particular experiment, 0.5 mM CaCl.sub.2 was added to the extraction medium to potentially stabilize the formed VLPs. Crude extracts were centrifuged twice for 10 minutes at 4,200g, 10 C. to remove cell debris in a JA14 rotor using a Beckman Coulter Avanti J-26 XPI centrifuge.
(122) Particles were purified by density gradient centrifugation using ultra-high quality sucrose (Sigma Life Sciences) step gradients (30%-70%) prepared dissolved in VLP dilution buffer (50 mM Tris-HCl, pH 8.4, 20 mM NaCl). Step gradients of 1 ml with 10% incrementing steps were prepared and then overlaid with 8 ml of clarified leaf extract. The gradients were centrifuged at 85,800g, at 10 C. for 3 hours in a SW-41Ti rotor (Beckman Coulter). Fractions of 500 l were collected and aliquots (26 l) from all fractions were analysed on 4-12% Bis-Tris Bolt (Life Technologies) protein gels or 10% Stain Free SDS-PAGE (Bio-Rad). The sucrose-gradient purified product was dialysed overnight against bicine buffer containing only the bicine (pH 8.4) and sodium chloride in preparation for animal trials.
(123) The sucrose gradient fractions were adsorbed onto holey carbon-coated copper grids as follows. The grids were floated on the 1/10 dilution protein sample for 30 seconds and excess sample drained off the grid via blotting on filter paper. Subsequently the grid was floated on 2% sodium phosphotungstate, pH 7.0 for 30 seconds (0.22 m filter sterilized before staining) and drained as described above. The air dried grid was imaged in a JEM-2100 Transmission electron microscope (JEOL) at the University of Pretoria, Laboratory for Microscopy and Microanalysis.
(124) Protein bands of interest were in-gel trypsin digested as per the protocol described in (Shevchenko et al., 2007). In short, gel bands were destained using 50 mM NH.sub.4HCO.sub.3/50% MeOH followed by in-gel protein reduction (50 mM DTT in 25 mM NH.sub.4HCO.sub.3) and alkylation (55 mM iodoacetamide in 25 mM NH.sub.4HCO.sub.3). Proteins were digested over night at 37 C. using 5-50 l, 10 ng/l trypsin depending on the gel piece size. Digests were resuspended in 20 l, 2% acetonitrile/0.2% formic acid and analysed using a Dionex Ultimate 3000 RSLC system coupled to an AB Sciex 6600 TipleTOF mass spectrometer. Peptides were first de-salted on an Acclaim PepMap C18 trap column (100 m2 cm) for 2 min at 15 l/min using 2% acetonitrile/0.2% formic acid, than separated on Acclain PepMap C18 RSLC column (300 m15 cm, 2 m particle size). Peptide elution was achieved using a flow-rate of 8 l/min with a gradient: 4-60% B in 15 min (A: 0.1% formic acid; B: 80% acetonitrile per 0.1% formic acid). An electrospray voltage of 5.5 kV was applied to the emitter. The 6600 TipleTOF mass spectrometer was operated in Data Dependant Acquisition mode. Precursor scans were acquired from m/z 400-1500 using an accumulation time of 250 ms followed by 30 product scans, acquired from m/z 100-1800 at 100 ms each, for a total scan time of 3.3 sec. Multiply charge ions (2+-5+, 400-1500 m/z) were automatically fragmented in Q2 collision cells using nitrogen as the collision gas. Collision energies were chosen automatically as function of m/z and charge.
(125) Protein pilot v5 using Paragon search engine (AB Sciex) was used for comparison of the obtained MS/MS spectra with Uniprot Swissprot protein database. Proteins with threshold above 99.9% confidence were reported.
(126) Assembly of BTV serotype 3, 4 and 8 VLPs were investigated by infiltrating N. benthamiana mammalian-like mutant dXT/FT or unmodified N. benthamiana plants with the relevant constructs. The Agrobacterium strain LBA4404 harboring pEAQ-HT constructs encoding for the four capsid proteins individually for BTV serotypes 3, 4 and 8 were successfully infiltrated into N. benthamiana leaves. Production of VLPs in plant leaf tissue was determined by mixing the four constructs encoding the four individual capsid proteins VP2:VP3:VP5:VP7 at a ratio of 1:1:1:1. Leaf tissue was harvested eight days after infiltration, extracted and purified as described.
(127) The production of all four capsid proteins was determined by SDS-PAGE and immuno blot analysis where appropriate serum was available. The crude leaf extract was subjected to sucrose gradient purification and distinct protein bands were identified on Coomassie stained SDS-PAGE gels. The protein bands at 111 kDa, 100 kDa, 59 kDa and 38 kDa were confirmed to be the capsid proteins VP2, VP3, VP5 and VP7, respectively, by mass spectrophotometry. The assembly of VLPs (70 nm) was confirmed by transmission electron microscopy (TEM) for all three serotypes 3, 4 and 8.
(128) The following combinations of capsid proteins, extraction buffer composition and protease inhibitors were tested for assembling and purification of chimaeric CLPs and chimaeric VLPs.
(129) BTV-3 Double Chimaeric
(130) Genes encoding BTV-8 VP3 and BTV-8 VP7 forming CLPs combined with BTV-8 VP5 and BTV-3 VP2 (BTV-3 single chimaeric) or BTV-8 VP3, BTV-8 VP7 combined with BTV-3 VP2, BTV-3 VP5 (BTV-3 double chimaeric) for the outer capsids were combined as described and infiltrated into N. benthamiana leaves. Alternatively, BTV-8 VP3 cloned into pEAQ wild type (wt) was used instead of BTV-8 VP3 cloned into pEAQ-HT to form the core and in an attempt to improve the stoichiometry towards VLPs as described before (Theunemann et al., 2013). Although VP3 is dearly reduced when using BTV-8 VP3 wt in forming the cores (
(131) VLPs were extracted in standard bicine buffer containing protease inhibitor (Sigma P2714-1BTL) and purified using a sucrose gradient (30-70%) and fractions (45-55%) were analyzed using Bolt gels. The presence of the core capsid proteins VP3 and VP7 as well as one of the outer capsid proteins VP5 were consistently detected at 100 kDa, 38 kDa and 59 kDa, respectively and therefore not repeatedly subjected to mass spectrometry. The detection of VP2 with mass spectrometry and TEM analysis were considered sufficient to confirm the formation of VLPs for all future experiments.
(132) Creation of Chimaeric VLPs Comprising BTV-8 VP3 and BTV-4 VP2, VP5 and VP7 in Mammalian-Like Tobacco dXT/FT
(133) Genes encoding BTV-8 VP3 and BTV-8 VP7 were used to assemble and form CLPs in mutant N. benthamiana dXT/FT tobacco (
(134) Creation of Double Chimaeric BTV-3 VLPs
(135) BTV-8 VP3 and VP7 inner capsid proteins were assembled with BTV-3 VP2 and VP5 outer capsid proteins. VLPs were extracted in bicine buffer containing protease inhibitor (Sigma P2714-1BTL) and purified using a sucrose gradient (30-70%) and fractions (45-40%) were analyzed using Bolt gels as described (
(136) Chimaeric BTV-4 and BTV-3 VLPs in Humanized Tobacco
(137) Previously, BTV VLPs were assembled with BTV-8 VP3 and BTV-4 VP2, VP5 and VP7. In this experiment double chimaeric BTV VLPs were assembled with BTV-8 VP3 and VP7 cores and BTV-4 VP5 and VP2 outer capsids, alternatively double chimaeric BTV VLPs were assembled with BTV-8 VP3 and VP7 cores and BTV-3 VP5 and VP2 outer capsids. Double chimaerics with BTV-8 VP3 and VP7 forming the core and the outer capsid proteins being from a second serotype (3 or 4) seem to be more stable than single chimaeric BTV VLPs. The double chimaeric VLPs will be used for sheep trials. The BTV VLPs were extracted in bicine buffer supplemented with Roche EDTA-free protease inhibitor. Mass spectrometry confirmed the presence of BTV-3 VP2 and BTV-4 VP2. Although the peptides detected were indicated as BTV-10, the inventors point out that identical sequences appear in BTV-4 (
(138) Purifying Double Chimaeric BTV VLPs in Buffer Containing CaCl.sub.2 and with Different Protease Inhibitors
(139) Two independent protease inhibitors and the addition or omission of CaCl.sub.2 were compared to identify which method best preserved the formed VLPs during extraction. Chimaeric BTV VLPs were assembled with BTV-8 VP3 and VP7 cores and BTV-4 VP5 and VP2 outer capsids. The expression and assembly of capsid proteins was conducted in N. benthamiana dXT/FT. Selected sucrose gradient fractions were separated using the Bolt 4-12% SDS PAGE gels and fragments at 100-120 kDa were subjected to mass spectrometry (
Example 4
(140) Plant Expressed AHS Single, Double and Triple Chimaeric VLPs
(141) Gene sequences, encoding the VP2, VP5, VP3 and VP7 proteins of AHSV serotype 1 (Genbank accession numbers AM883165, FJ183369, FJ183366, AM883171, respectively), the VP2 (Genbank accession number AY163330) and VP5 (Genbank accession number JQ742011) proteins of AHSV serotype 7, the VP5 protein of AHSV serotype 3 (Genbank accession number DQ868777 and the VP2 protein of AHSV serotype 6 (Genbank accession number DQ868774.1) were codon optimised for optimal expression in Nicotiana benthamiana plant cells and synthesized with unique AgeI and XhoI sites at the 5 and 3 termini, respectively.
(142) The following plant codon optimised nucleotide sequences were synthesised by BioBasic Inc, Canada: AHSV-1 VP2 (SEQ ID NO:38), AHSV-1 VP3 (SEQ ID NO:35), AHSV-1 VP5 (SEQ ID NO:36), AHSV-1 VP7 (SEQ ID NO:37), AHSV-7 VP2 (SEQ ID NO:39), AHSV-7 VP5 (SEQ ID NO:40), AHSV-3 VP5 (SEQ ID NO:65) and AHSV-6 VP2 (SEQ ID NO:67). These plant codon optimised nucleotide sequences encode the following proteins: AHSV-1 VP2 (SEQ ID NO:18), AHSV-1 VP3 (SEQ ID NO:15), AHSV-1 VP5 (SEQ ID NO:16), AHSV-1 VP7 (SEQ ID NO:17), AHSV-7 VP2 (SEQ ID NO:19), AHSV-7 VP5 (SEQ ID NO:20), AHSV-3 VP5 (SEQ ID NO:66) and AHSV-6 VP2 (SEQ ID NO:68).
(143) The VP2, VP5, VP3 and VP7 nucleotide sequences were subsequently cloned into the pEAQ expression vectors (Sainsbury et al., 2009, Plant Bioscience Limited, UK). More, specifically sequences encoding the AHSV-1 VP5, VP3 and VP7 proteins were firstly cloned into the intermediate pEAQ vectors FSC5 or FSC6 via directional AgeI/XhoI restriction enzyme-based cloning. The restriction enzymes in this study were supplied by ThermoScientific and the Fast-link DNA ligase enzyme by EpiCentre. Cloning of the AHSV-1 VP2-encoding sequence into the intermediate FSC5 vector was performed using the In-Fusion HD cloning kit (Clontech) with the primers depicted in Table 3, according to the manufacturers instructions.
(144) TABLE-US-00003 TABLE3 In-FusionAHSVspecificprimers. PrimerName Sequence SEQIDNO. In-FusionAHSVP2-F 5 CAAATTCGCGACCGGTCCATGGCTAGTGAATTC3 (SEQIDNO:51) In-FusionAHSVP2-R 5 AGTTAAAGGCCTCGAGTTATTCTATCTTTGAAAGC3 (SEQIDNO:52) In-FusionHS5VP2-F 5 CAAATTCGCGACCGGTCCATGGTTCAGAATTCGGTG3 (SEQIDNO:69) In-FusionHS5VP2-R 5 AGTTAAAGGCCTCGAGTCATTTCTCGGTTTTGGCC3 (SEQIDNO:70) In-FusionHS6VP2-F 5 CAAATTCGCGACCGGTCCATGGCTTCTGAATTCGGT3 (SEQIDNO:71) In-FusionHS6VP2-R 5 AGTTAAAGGCCTCGAGTCACTCGGCTTTGGCCAT3 (SEQIDNO:72)
(145) The VP5-encoding expression cassette was subsequently cloned from the recombinant FSC6-VP5 plasmid into the pEAQ express vector via directional AscI/SbfI restriction enzyme-based cloning. Cloning of the VP7-encoding expression cassette from FSC6-VP7 into the pEAQ express vector followed a similar process except that the recombinant plasmid was digested with both enzymes AscI and AlwI prior to digestion with SbfI to ensure different sizes of insert and vector backbone DNA fragments. Cloning of the VP2 and VP3 encoding sequences into the linearized pEAQ-HT vector required that the respective FSC5-VP2 and FSC-5-VP3 recombinant plasmids be digested with the AgeI and XhoI prior to ligation. The AHSV-7 VP2 and AHSV-7 VP5 encoding sequences were cloned individually into the pEAQ-HT vector via directional AgeI/XhoI restriction enzyme-based cloning. Cloning of the sequences encoding the AHSV-3 VP5 and AHSV-6 VP2 proteins individually into the pEAQ-HT vector was performed using the In-Fusion HD@ cloning kit (Clontech) with the primers depicted in Table 3, according to the manufacturers instructions.
(146) In order to generate the dual recombinant plasmid pEAQ-express-AHSV-1VP3-AHSV1-VP7, the AHSV-1 VP7 encoding sequence was firstly cloned from pEAQ-express-AHSV-1VP7 plasmid into the pEAQ-HT vector via directional AgeI/XhoI restriction enzyme-based cloning. The VP7-encoding expression cassette was subsequently excised from pEAQ-HT-AHSV-1VP7 using the AscI/PacI enzymes and cloned into the compatible MluI/AsiSI sites of the pEAQ-express vector. The VP3-encoding expression cassette was transferred from the pEAQ-HT-AHSV1VP3 plasmid into the newly generated pEAQ-express-AHSV1VP7 plasmid via AscI/PacI mediated restriction enzyme based cloning. Following transformation into electrocompetent DH10B bacterial cells, the presence of recombinant plasmid in candidate bacterial clones was verified via colony PCR with the primers depicted in Table 4. The presence of the AHSV-1 L2 (VP2), L3 (VP3), M6 (VP5) and S7 (VP7) PCR products can be visualised in
(147) TABLE-US-00004 TABLE4 PrimersusedforcolonyPCR. Protein PrimerName Sequence SEQIDNO. AHSV-1VP2 QAHSVP2-F 5 CGTACCGGTCCATGGCTAGTGAATTCGGT3 (SEQIDNO:53) QAHSVP2-R 5 GCAGCTCGAGTTATTCTATCTTTGAAAGC3 (SEQIDNO:54) AHSV-1VP3 QAHSVP3-F 5 GGTACCGGTATGCAAGGTAACGAACGT3 (SEQIDNO:55) QAHSVP3-R 5 CAGCTCGAGTTAAATTGTTGGCCTTGC3 (SEQIDNO:56) AHSV-1VP5 QAHSVP5-F 5 CGTACCGGTCCATGGGAAAATTTACTTC3 (SEQIDNO:57) QAHSVP5-R 5 CAGCTCGAGTTAGCTAATCTTCACGCC3 (SEQIDNO:58) AHSV-1VP7 QAHSVP7-F 5 GCTACCGGTCCATGGATGCAATAGCAGC3 (SEQIDNO:59) QAHSVP7-R 5 CAGCTCGAGTTAATGATAAGCTGCAAG3 (SEQIDNO:60) AHSV-7VP2 AHSV7VP2F 5 CCATGGCATCAGAGTTTGGTATC3 (SEQIDNO:61) AHSV7VP2R 5 CCTCATTCTGCCTTTGATAACAGC3 (SEQIDNO:62) AHSV-7VP5 AHSV7VP5-F 5 ACCGGTATGGGAAAGTTC3 (SEQIDNO:63) AHSV7VP5-R 5 CTCGAGGGCAATACGAAC3 (SEQIDNO:64) AHSV-5VP2 FSC5F 5 GGTTTTCGAACTTGGAGAAA3 (SEQIDNO:73) FSC5R 5 AGAAAACCGCTCACCAAACATAGA3 (SEQIDNO:74) AHSV-6VP2 FSC5F 5 GGTTTTCGAACTTGGAGAAA3 (SEQIDNO:75) FSC5R 5 AGAAAACCGCTCACCAAACATAGA3 (SEQIDNO:76)
(148) The PCR reactions contained a final concentration of 0.3 M forward/reverse primer and the KAPA 2G Fast DNA polymerase enzyme (KAPA Biosystems) and were set up according to the manufacturer's instructions. The cycling conditions were as follows: 1 cycle of 95C for 2 min, followed by 25 cycles of 95C for 20 sec, 59 C. (47 C. for AHSV-7 VP2 and AHSV-7 VP5) for 15 sec and 72 C. for 3 min 30 sec followed by 1 cycle of 72 C. for 7 min. The capsid protein encoding sequences were verified via dideoxy Sanger DNA sequencing (Inqaba Biotechnical Industries (Pty) Ltd). Some of the recombinant plasmids constructed are depicted in
(149) Transient expression of the AHSV capsid proteins was accomplished via Agrobacterium-mediated infiltration of Nicotiana benthamiana or Nicotiana benthamiana dXT-FT plant leaves with the recombinant pEAQ expression plasmids. One hundred nanograms of the recombinant pEAQ plasmid was transformed into 60 l electrocompetent LBA4404 Agrobacterium cells (1.44 kV, 200 and 25 F) using a Gene Pulsar (Bio-Rad). The transformed bacterial cells were resuspended in 500 l SOC medium and placed on a rotational shaker (175 rpm) at 30 C. for 3 hours to recover prior to 250 l being plated out onto two selective medium plates (50 g/ml Kanamycin, 50 g/ml Rifampicin and 50 g/ml Streptomycin). The plates were inverted and incubated at 28 C. for 96 hours. All reagents were molecular biology grade and obtained from Sigma Life Science unless otherwise indicated. Recombinant LBA4404 bacterial clones, verified via colony PCR, were inoculated into 5 ml YMB medium (0.1% yeast extract, 1% Mannitol, 1.7 mM NaCl, 0.8 mM MgSO.sub.4.H.sub.2O, 2.2 mM K.sub.2HPO.sub.4), with the appropriate antibiotics (50 g/ml Kanamycin, 50 g/ml Rifampicin and 50 g/ml Streptomycin), and incubated with rotational shaking (175 rpm) for 24 hours at 28 C. Cryopreserved LBA4404 Agrobacterium cells, containing the pEAQ-HT vector or the pEAQ-HT-GFP plasmid, were also inoculated into 5 ml YMB media to serve as negative and positive controls, respectively. The Agrobacteria starter cultures were subsequently used to inoculate 50 ml YMB media with the appropriate antibiotics and these cultures were incubated overnight at 28 C. with rotational shaking (175 rpm). The bacterial cells were harvested from the overnight cultures via centrifugation at 8000 rpm for 7 min at 20 C. The cell pellets were each resuspended in 40 ml freshly prepared MMA infiltration buffer (10 mM MES hydrate; pH 5.6, 10 mM MgCl.sub.2, 100 M 3,5-dimethoxy-4-hydroxy-acetophenone). In order to assess the assembly of CLPs, N. benthamiana leaves were agroinfiltrated with the VP7 and VP3-encoding genes, whilst agroinfiltration with all four capsid protein encoding sequences enabled assessment of VLP assembly. The agrobacterial suspensions were combined in a 1:1:1 ratio (for VLPs) and 1:1 (for CLPs) and subsequently diluted with the MMA buffer such that the final OD.sub.600 was 0.45-0.5. The leaves of four week old N. benthamiana plants were syringe-infiltrated with these Agrobacteria combinations or the pEAQ-HT/pEAQ-HT-GFP Agrobacteria suspension. The plants were incubated at 27 C. for 8 days post-infiltration (dpi).
(150) Preliminary evidence of foreign protein expression was obtained by illuminating the pEAQ-HT-gfp-infiltrated leaf with UV light 8 dpi (
(151) Agrobacterium infiltrated N. benthamiana leaves were photographed and harvested 8 days post-infiltration. The leaf tissue was extracted immediately in 3 volumes of VLP extraction buffer (20 mM sodium chloride (NaCl), 50 mM Bicine, pH 8.4, 0.1% (w/v) sodium lauroyl sarcosine (NLS), 1 mM dithiothreitol (DTT) (ThermoScientific), 0.2% protease inhibitor cocktail P2714 (Sigma Life Science)/cOmplete EDTA-free protease inhibitor cocktail (Sigma-Aldrich) or CLP extraction buffer (as VLP extraction buffer but containing 140 mM NaCl) in a multipurpose juice extractor (MATSONE). The DTT and protease inhibitor cocktails were freshly prepared according to the manufacturers' instructions and added to the extraction buffer just prior to use. Large cell debris was removed by filtering the cell lysate through two layers of miracloth and the extract further clarified via centrifugation (4200g; 30 min; 10 C.).
(152) Virus-like particles (VLPs) or Core-like particles (CLPs) were purified using sucrose density gradient centrifugation. Sucrose solutions (30%-70%) were prepared by dissolving ultra-high quality sucrose (Sigma Life Science) in VLP dilution buffer (20 mM NaCl, 50 mM bicine, pH 8.4) or CLP dilution buffer (140 mM NaCl, 50 mM Bicine, pH 8.4) and layered into gradients of 1 ml 10% incrementing steps. The clarified cell lysates were layered on top of the sucrose gradients and centrifuged in a SW-41Ti rotor (Beckman Coulter) at 85,800g for 3 hours; 10 C. The 55%-35% sucrose layers were harvested in 500 l fractions using a Minipuls2 peristaltic pump (Gilson). Ten microlitres of each fraction was subsequently analysed for protein content by denaturing SDS-PAGE and immunoblotting procedures.
(153) Ten microliter of each sucrose fraction was mixed with an equal volume of 2 Laemmli protein sample buffer (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue and 0.125 M Tris HCl, pH approx. 6.8), the protein samples denatured at 95 C. for 5 min and analysed on denaturing SDS 10% polyacrylamide gels (BioRad TGX Stain Free Fast Cast), prepared according to the manufacturer's instructions. The Precision Plus Protein WesternC standard (Bio-Rad) was used as a size marker. Electrophoresis was performed in 1TGS buffer (25 mM Tris-HCl; pH 8.3, 200 mM glycine, 0.1% SDS) using the Mini-PROTEAN Tetra system (Bio-Rad) by applying a current of 50 V for 20 min and thereafter a current of 130 V for approximately 1.5 hours. The polyacrylamide gels were then subjected to an immunoblot protocol with an AHSV-7 specific polyclonal antiserum to confirm the identity and position of the AHSV capsid proteins on the gels.
(154) The protein samples were immunoblotted onto a PVDF membrane within the Trans-Blot Turbo Transfer Pack (Bio-Rad) using the Trans-BlotTurbo Transfer system (Bio-Rad) mixed MW application (1.3 A; 25 V; 7 min). The membrane was incubated in 3% blocking solution (3% bovine serum albumin (Roche) in 1 Tris buffered saline (150 mM NaCl, 20 mM Tris pH 7.5; 0.1% Tween-20 (Merck)) at room temperature with gentle agitation for 3 hours. Prior to incubation with the membrane, the primary antibody, an anti-AHSV-7 guinea pig polyclonal antiserum (GPAHSV-7), was pre-treated with N. benthamiana plant extract in order to remove plant protein-specific antibodies from the serum. This was done by crushing a single uninfiltrated N. benthamiana leaf in a mortar and pestle with 1TBS buffer in a ratio of 1:3, adding the primary antibody to this leaf extract and incubating this mixture at 37 C. for 1 hour with slight agitation. This plant extract/primary antibody mixture was then added to 3% blocking solution (1:300 dilution) and incubated overnight at 4 C. with gentle agitation to allow binding of the antibodies to immobilised protein.
(155) The membrane was subsequently washed five times with wash buffer (0.1% Tween 20 (Merck) in 1TBS), 5 min for each wash. A secondary antibody, a combination of the horseradish peroxidase-conjugated Rabbit anti-Guinea Pig IgG H&L (HRP) conjugate (abcam ab6771) (1:5000 dilution) and Precision Protein StrepTactin-HRP Conjugate (Bio-Rad) (1:10000 dilution) was then added. After incubation at room temperature for 1 hour with gentle agitation, the membrane was washed five times in wash buffer (0.1% Tween 20 (Merck) in 1TBS), 5 min each wash. The membrane was then subjected to the detection procedure by adding the Clarity Western ECL chemiluminescent substrate (Bio-Rad), according to the manufacturer's instruction, and placing the membrane immediately into the ChemiDoc MP Imager (Bio-Rad). By using the Chemi Hi Resolution application, photographs of the chemiluminescence signals were taken approximately every second with the accumulating exposure starting at 1 second and ending at 15 seconds.
(156) Sucrose fractions containing putative AHSV capsid proteins were electrophorized on precast denaturing 4-12% Bolt Bis-Tris Plus polyacrylamide Gels (Thermo Fischer Scientific), according to the manufacturers' instructions. SeeBlue Plus2 Prestained Protein Standard (Invitrogen) was used as the size marker. Electrophoresis was performed in the Bolt MES or MOPS SDS running buffer using the mini gel tank (Thermo Fischer Scientific) by applying a current of 200 V for approximately 35 min. The gels were then stained in Coomassie Brilliant Blue G250 staining solution (50% methanol (Minema), 10% acetic acid (Minema), 0.1% Coomassie Brilliant Blue G250 (Merck)) for 20 min and destained in destaining solution (10% methanol, 10% acetic acid) overnight. Candidate protein bands of approximately the correct size were excised from the gel and sent for Mass spectrometry (MS) analysis (Dr Stoyan Stoychev, CSIR Biosciences).
(157) Expression of the AHSV-1 VP3, VP7, VP5 and AHSV-7 VP2 capsid proteins in the Nicotiana benthamiana leaves, harvested at 8 dpi, was confirmed via sucrose density centrifugation and immunoblot analysis with guinea pig AHSV-7 serum (
(158) It was hypothesized that a double chimaeric VLP particle, where the VP2 and VP5 outer capsid proteins originate from one serotype and the core proteins VP7 and VP3 from another serotype of AHSV, may be more stable than the single chimaeric VLP where only the outer capsid protein VP2 is exchanged. N. benthamiana leaves were hence infiltrated with combinations of recombinant Agrobacterium tumefaciens bacteria containing the AHSV-1 VP3, AHSV-1 VP7, AHSV-1 VP5 or AHSV-7 VP5 and AHSV-7 VP2 constructs and harvested 8 dpi. Sucrose gradient centrifugation of the leaf extracts and immunoblotting of the resulting sucrose fractions with guinea pig AHSV-7 serum indicated a greater quantity of the AHSV-7 VP2 and VP5 proteins in fractions 55-50% (
(159) In order to investigate whether it may be possible to assemble a triple chimaeric AHSV VLP particle in plants, where the origin of the capsid proteins is from three different AHSV serotypes, constructs encoding the AHSV-1 VP7/AHSV-1 VP3, AHSV-3 VP5 and AHSV-6 VP2 proteins were infiltrated into Nicotiana benthamiana dXT-FT plant leaves. The leaves were harvested 8 days post-infiltration and the cell extracts centrifuged through 70-30% sucrose gradient. Sucrose fractions were electrophorized on precast denaturing 4-12% Bolt Bis-Tris Plus polyacrylamide Gels (Thermo Fischer Scientific), as described above, and candidate protein bands excised from the gel and sent for Mass spectrometry (MS) analysis (Table 5). The large number of AHSV-6 VP2-specific peptides confirm the assembly of the triple chimaeric AHSV-1/AHSV-3/AHSV-6 VLPs in N. benthamiana dXT-FT plant cells.
(160) TABLE-US-00005 TABLE 5 Mass Spectrometry (MS) results of triple chimaeric AHSV-1/AHSV-3/AHSV-6 combination in plants Protein % Cov Peptides Band (95) Name (95%) 1 18.95 AHSV-6 VP2 plant 18 codon optimised 2 32.86 AHSV-6 VP2 plant 35 codon optimised
(161) VLPs and/or CLPs were visualised by adsorbing samples from 55% sucrose fractions onto carbon-coated holey copper grids as follows: The grids were floated on the protein sample for 30 seconds, the excess sample drained off the grid via blotting on filter paper and the grid then floated on 2% sodium phosphotungstate, pH 7 for 30 sec. The excess stain was drained off by blotting the grid onto filter paper. The grid was air dried and subsequently imaged in a JEM-2100 Transmission electron microscope (JEOL). The diameters of the particles visualised on the grid were measured using the measure tool on the Gatan Digital Micrograph software. Thirty five particles of each type were measured and the mean diameter calculated.
(162) Transmission electron microscope (TEM) viewing of the particles present in the 55% sucrose gradient fractions of the gradients depicted above, as well as a gradient of the AHSV-1VP7-AHSV-1VP3 plant cell lysate, indicated the presence of core-like particles (CLPs) and virus-like particles (VLPs) (
(163) In the present Example the inventors have successfully produced the first documented African horse sickness virus-like particles in Nicotiana benthamiana or Nicotiana benthamiana dXT-FT plants. These VLPs, based on AHSV-1, will be used as a component of a multivalent vaccine against the nine African horse sickness serotypes. In addition, the inventors have also succeeded in generating single and double chimaeric AHSV-1/AHSV-7 VLPs, as well as triple chimaeric AHSV-1/AHSV-3/AHSV-6 VLPs in plants. In this case, particles, formed from the AHSV-1 VP3 and VP7 capsid proteins, function as a scaffold for the presentation of the entire VP2 and/or VP5 antigen of other AHSV serotypes to the immune system. An alternative scaffold, created from the capsid proteins of any one or more of the remaining eight AHSV serotypes, is not excluded. The AHSV VLP-based presentation system is in the process of being developed by the inventors for the presentation of all nine AHSV neutralization VP2 antigens to serve as an efficacious, multivalent vaccine against African horsesickness. An initial target animal trial, described in Example 8, has been conducted and preliminary data indicate that plant-expressed, double chimaeric AHSV-1/AHSV-7 VLPs are immunogenic in horses. A second target animal immunogenicity trial with a triple chimaeric AHSV-1/AHSV-3/AHSV-6 VLP particle is currently underway to confirm these results.
Example 5
(164) Plant codon optimised nucleotide sequences were synthesised by Bio Basic Int. Both the nucleotide sequences and the proteins that they encode are described in Example 3. Using the protocols described herein the nucleotide sequences were cloned into the pEAQ-HT expression vectors. In this experiment Agrobacterium harbouring the pEAQ-HT with inserts were taken from a seed cell bank. The aim of this experiment was to compare the stable assembly of double and single chimaeric VLPs of serotypes BTV-4 and BTV-3 using BTV-8 core proteins; and also the most appropriate combinations to result in stable chimaeric VLPs.
(165) Transient expression efficiency of the pEAQ series of vectors was investigated by agroinfiltration of Nicotiana benthamiana which facilitates mammalian-like or human-like glycosylation RNAi mutant dXT/FT. The pEAQ-HT constructs containing genes encoding individual capsid proteins of BTV serotypes 3, 4 and 8 were stored as seed cell banks. Prior to plant infiltration Agrobacterium tumefaciens strain (LBA4404) transformed with pEAQ-HT vector containing individual VP2, VP3, VP5 and VP7 of selected serotypes were streaked on YMB agar plates and incubated at 28 C. for 48 hrs. The growing bacterium was scraped off from the plate and inoculated into YMB broth with the relevant antibiotics and grown overnight. Cells were pelleted and resuspended in MMA buffer (100 mM MES, 10 mM MgCl.sub.2 and 100 mM acetosyringone; pH 5.6). Each of the four Agrobacterium cultures was adjusted to OD.sub.600 of approximately 0.5 with the same buffer. The formation of VLPs was validated by mixing and infiltrating the four constructs encoding the four individual capsid proteins at a ratio of 1:1:1:1 and used for plant infiltrations (5 plants per construct combination; 15-20 cm in height).
(166) The leaf material was harvested eight days after infiltration using a Matstone Multipurpose juice extractor in VLP extraction buffer (50 mM bicine, pH 8.4; 20 mM sodium chloride [NaCl], 0.1% (w/v) N-lauroylsarcosine (NLS) sodium salt; 1 mM dithiothreitol (DTT)) in a ratio 1:3 with complete protease inhibitor cocktail (P2714, Sigma Life Sciences) added to the VLP extraction buffer immediately before the extraction started. Crude extracts were centrifuged twice for 10 minutes at 4,200g, 10 C. to remove cell debris in a JA14 rotor using a Beckman Coulter Avanti J-26 XPI centrifuge.
(167) Particles were purified by density gradient centrifugation using ultra-high quality sucrose (Sigma Life Sciences) step gradients (30%-70%) prepared dissolved in VLP dilution buffer (50 mM Bicine, pH 8.4, 20 mM NaCl). Step gradients of 1 ml with 10% incrementing steps were prepared and then overlaid with 8 ml of clarified leaf extract. The gradients were centrifuged at 85,800g, at 10 C. for 3 hours in a SW-41Ti rotor (Beckman Coulter). Sucrose gradient fractions (45%-50%) were collected and aliquots (26 l) were analysed on a 4-12% Bis-Tris Bolt (Life Technologies) protein gel. Distinct protein bands were identified on Coomassie stained gels. The protein bands at 111 kDa, 100 kDa, 59 kDa and 38 kDa were confirmed to be the capsid proteins VP2, VP3, VP5 and VP7, respectively, by mass spectrophotometry. The assembly of VLPs (70 nm) was confirmed by transmission electron microscopy (TEM) for all three serotypes 3, 4 and 8 (
(168) The sucrose gradient fractions were adsorbed onto holey carbon-coated copper grids as follows. The grids were floated on the 1/10 dilution protein sample for 30 seconds and excess sample drained off the grid via blotting on filter paper. Subsequently the grid was floated on 2% sodium phosphotungstate, pH 7.0 for 30 seconds (0.22 m filter sterilized before staining) and drained as described above (
(169) Protein bands of interest were in-gel trypsin digested as per the protocol described in Example 3. Protein pilot v5 using Paragon search engine (AB Sciex) was used for comparison of the obtained MS/MS spectra with Uniprot Swissprot protein database. Proteins with threshold above 99.9% confidence were reported (Table 6).
(170) TABLE-US-00006 TABLE 6 Combinations of capsid proteins and peptides identified by Mass Spectrometry. Bluetongue virus BTV-4, BTV-3 & BTV-8 seed cell bank Sample # Protein Size Peptides 95% coverage BTV-8 homogenous VLPs VP2 111 kDa 150 67.6% BTV-3 single chimaeric (BTV-8 VP3, VP2 111 kDa 22 31.0% VP5 & VP7, BTV-3 VP2) BTV-3 double chimaeric (BTV-8 VP3 & VP2 111 kDa 81 62.8% VP7, BTV-3 VP2 & VP5 BTV-4 single chimaeric (BTV-8 VP3, VP2 111 kDa 18 29.3% VP5 & VP7, BTV-4 VP2 BTV-4 double chimaeric (BTV-8 VP3 & VP2 111 kDa 48 54.0% VP7, BTV-4 VP2 & VP5) BTV-4 single chimaeric (BTV-8 VP3, VP2 111 kDa 42 50.4% BTV-4 VP2, VP5 & VP7)
(171) Since all the Agrobacterium cultures were prepared from the same seed cell bank, infiltrated in the same batch of plants, extracted with the same extraction buffer, subjected to ultracentrifugation in the same run and equal amounts were loaded on the same SDS PAGE 4-12% Bolt precast gel, we confidently make the assumption that double chimaerics have more VP2 protein assembled. The results indicate that the assembly of double chimaeric (both outer capsid proteins) VLPs is superior to the assembly of single chimaeric (only VP2 outer capsid substituted) VLPs. Almost four times more peptides of VP2 were detected when the VLPs of BTV-3 was assembled via double chimaeric versus single chimaeric combinations, 81 versus 22 peptides, respectively. Similarly, almost three times more VP2 peptides were detected when the VLPs of BTV-4 was assembled via double chimaeric versus single chimaeric combinations, 48 versus 18 peptides, respectively. For both scenarios above, single chimaeric indicates that BTV-8 core (VP3, VP7 and VP5) was combined with VP2 from a second serotype. When BTV-8 VP3 was combined with the remaining capsid proteins VP2, VP7 and VP5 of serotype 4, 42 peptides were detected, 6 peptides less than BTV-4 double chimaeric VLP combination. Nevertheless, all animals trials were conducted with BTV-4 and BTV-3 double chimaeric VLP vaccines. Homogenous BTV-8 VLPs resulted in 150 VP2 peptides.
(172) Combinations of BTV-3 Single and Double Chimaeric VLPs
(173) BTV-3 single chimaerics was assembled by proteins BTV-8 VP3 and BTV-8 VP7 forming CLPs combined with BTV-8 VP5 and BTV-3 VP2. BTV-3 double chimaerics was assembled by proteins BTV-8 VP3, BTV-8 VP7 combined with BTV-3 VP2, BTV-3 VP5.
(174) Combinations of BTV-4 Single and Double Chimaeric VLPs
(175) BTV-4 single chimaerics was assembled by proteins either of 1). BTV-8 VP3 and BTV-8 VP7 forming CLPs combined with BTV-8 VP5 and BTV-4 VP2 (only VP2 of serotype 4) or 2). BTV-8 VP3 combined with BTV-4 VP7, VP5 and VP2 (only VP3 of serotype 8). BTV-4 double chimaerics was assembled by proteins BTV-8 VP3, BTV-8 VP7 combined with BTV-4 VP2, BTV-4 VP5.
Example 6
(176) BTV-4 Double Chimaeric VLP Extraction and Purification for Sheep Trial
(177) A large scale VLP purification system was established for biomass BTV4 VLP production for the purpose of subsequent target animal (sheep) immunogenicity studies. Hand infiltration of Agrobacterium harbouring BTV serotype 8 and 4 genes encoding the four capsid proteins (BTV-8 VP3 and VP7; BTV-4 VP2 and VP5) was conducted as described in Example 3. Thirty to forty plants were infiltrated with the Agrobacterium culture. Once more the leaf material was harvested eight days after infiltration in Bicine buffer. Remaining plant debris was removed by filtering the cell lysate through two layers of miracloth before two successive centrifugations steps (4200g for 10 minutes each at 10 C.). The plant extract was then filtered through a Sartoclean GF sterile midicap (3 M+8 M) using a Masterflex Console Drive peristaltic pump (Cole-Parmer Instrument Company). To further purify, the lysate was filtered through a 300K Minimate Tangential Flow Filtration (TFF) Capsule (Pall Life Sciences) with the pressure not exceeding 2 Bar. The latter removes all proteins smaller than 300K. The NLS detergent, DTT and protease inhibitor was removed from the VLP containing extract through two subsequent wash steps (1 in 10 dilution each) with sterile VLP dilution buffer. D-(+)-Trehalose dihydrate (Sigma Life Science) (5% m/v) was added to the extract (50 ml) to stabilise the VLP extract. The extract was filter sterilised through a 0.45 M+0.2 M Sartobran 300 sterile capsule (Sartorius Stedim biotech GmbH) using a peristaltic pump.
(178) In addition to TFF purification, a fraction of the crude plant lysate was also purified with sucrose gradient centrifugation. The lysate (23 ml) was layered on top of sucrose density gradients (70-30%; 3 ml each) and centrifuged at 85,800g, at 10 C. for 3 hours in a SW-32Ti rotor (Beckman Coulter) in 38.6 ml volume ultra-clear Beckman tubes. The first 6 ml was discarded (60-70% fractions) and the following 6 ml (50-40%) containing the VLPs, was collected. The sucrose-gradient purified product was dialysed overnight against Bicine buffer containing only the Bicine (pH 8.4) and sodium chloride before filter sterilization in preparation for animal trials. The TFF and sucrose fractions used for the animal trial was mixed (1:1) with Alhydrogel and transported to Onderstepoort Biological Products (OBP) on ice. The vaccine was administered on the day of delivery at OBP.
(179) The sheep trial was conducted according to the procedures and schedule detailed in the target animal ethics application submitted to the Animal Ethics Committee OBP. Approval was subsequently obtained from CSIR Research Ethics Committee. In short, sheep were stabled and handled according to standard operating procedures outlined by the Experimental unit. Vaccination and bleeding of animals was according to standard practices. Animals were bled on days 0, 7, 14, 21, 28, 35, 42, 49 and 56. The primary vaccine was administered on day 0 and 21 with 500 l sterile purified BTV-4 VLPs and 500 l Alhydrogel. Sheep 554 and 513 were vaccinated with TFF purified VLPs, sheep 521, 566 and 656 with sucrose gradient purified VLPs, sheep 551 with live attenuated BTV-4 antigens (positive control) and sheep 634 with Bicine buffer alone to serve as negative control.
(180) Serum neutralizing tests (SNTs) were conducted to determine antibody titers and used to demonstrate seroconversion (Table 7). A titer of 1:4 will demonstrate seroconversion. Seroconversion was shown for the control sheep, three sucrose gradient and one TFF vaccinated animals. Sheep 554 was inadvertently pre-exposed to BTV.
(181) TABLE-US-00007 TABLE 7 Serum neutralizing test (SNT) results of the sheep trial. Sheep # Innoculum Day 0 D 7 D 14 D 21 D 28 D 35 D 42 D 49 D 56 554 TFF* 0 0 0 0 0 0 0 0 0 513 TFF 0 0 1:4 0 0 0 1:8 0 0 521 Sucrose 0 0 1:4 1:128 1:128 1:256 1:256 1:256 1:256 566 Sucrose 0 0 0 1:8 1:32 1:256 1:256 1:256 1:256 656 Sucrose 0 0 0 0 1:2 1:32 1:32 1:32 1:64 551 OBP live attenuated BTV- 0 0 0 1:16 1:128 1:128 1:256 1:256 1:256 4 virus (Positive control) 634 Bicine buffer (Negative 0 0 0 0 0 0 0 0 0 control)
Example 7
(182) BTV-3 VLP Extraction and Purification for Sheep Trial
(183) A large scale VLP purification system was established for biomass BTV-3 VLP production for the purpose of subsequent target animal (sheep) immunogenicity studies. Hand infiltration of Agrobacterium harbouring BTV serotype 8 and 3 genes encoding the four capsid proteins (BTV-8 VP3 and VP7; BTV-3 VP2 and VP5) was conducted as described in Example 3. Thirty to forty plants were infiltrated with the LBA4404 Agrobacterium culture harbouring the pEAQ-HT vector and genes encoding the capsid proteins described above. Once more the leaf material was harvested eight days after infiltration in Bicine buffer. Remaining plant debris was removed by filtering the cell lysate through two layers of miracloth before two successive centrifugations steps (4200g for 10 minutes each at 10 C.). The plant extract was then filtered through a Sartoclean GF sterile midicap (3 M+8 M) using a Masterflex Console Drive peristaltic pump (Cole-Parmer Instrument Company). To further purify, the lysate was filtered through a 300K Minimate Tangential Flow Filtration (TFF) Capsule (Pall Life Sciences) with the pressure not exceeding 2 Bar. The latter removes all proteins smaller than 300K. The NLS detergent, DTT and protease inhibitor was removed from the VLP containing extract through two subsequent wash steps (1 in 10 dilution each) with sterile VLP dilution buffer. D-(+)-Trehalose dihydrate (Sigma Life Science) (5% m/v) was added to the extract (50 ml) to stabilise the VLP extract. The extract was filter sterilised through a 0.45 M+0.2 M Sartobran 300 sterile capsule (Sartorius Stedim biotech GmbH) using a peristaltic pump.
(184) In addition to TFF purification, a fraction of the crude plant lysate was also purified with sucrose gradient centrifugation. The lysate (23 ml) was layered on top of sucrose density gradients (70-30%; 3 ml each) and centrifuged at 85,800g, at 10 C. for 2 hours in a SW-32Ti rotor (Beckman Coulter) in 38.6 ml volume ultra-clear Beckman tubes. The first 6.5 ml was discarded (60-70% fractions) and the following 3 ml (50-40%) containing the VLPs, was collected. The sucrose-gradient purified product was dialysed overnight against phosphate buffer (pH 7.4) before filter sterilization in preparation for animal trials. The TFF and sucrose fractions used for the animal trial was mixed (1:1) with Montanide ISA 201 VG and transported to Onderstepoort Biological Products (OBP) on ice. The vaccine was administered on the day of delivery at OBP.
(185) Sheep were stabled and handled according to standard operating procedures outlined by the Experimental unit at OBP. Vaccination and bleeding of animals was according to standard practices. Animals were bled on days 0, 7, 14, 21, 28, 35 and 42. The primary vaccine was administered on day 0 and 21 with 500 l sterile purified BTV-3 VLPs and 500 l Montanide ISA 201 VG. Sheep 1646, 1639 and 1655 were vaccinated with TFF purified VLPs, sheep 1657, 1605 and 1613 with sucrose gradient purified VLPs, sheep 1632, 1647 and 1609 with sucrose gradient omitting the adjuvant; sheep 1608 and 1614 with live attenuated BTV-3 antigens (positive control) and sheep 1649 with Bicine buffer alone and sheep 1629 nave, untouched to serve as negative control.
(186) Serum neutralizing tests (SNTs) were conducted to determine antibody titers and used to demonstrate seroconversion. A titer of 1:4 will demonstrate seroconversion. Seroconversion was shown for all three TFF vaccinated animals identical to live BTV-3 monovalent vaccinations (Table 8).
(187) TABLE-US-00008 TABLE 8 Serum neutralising test (SNT) results of the sheep trial. Pre-bleed Day 0 D 7 D 14 D 21 D 28 D 35 D 42 D 49 D 56 TFF (ISA 201) 1646 2 256 256 256 256 256 1639 2 256 256 256 256 256 1655 4 256 256 256 256 256 Sucrose (ISA 201) 1657 2 16 16 1605 2 16 2 1613 Sucrose (no adjuvant) 1632 8 8 1647 2 2 4 1609 4 8 Live monovalent 1608 128 256 256 256 256 256 256 256 1614 128 256 256 256 256 256 Controls Bicine buffer 1649 Nave, untouched 1629
Example 8
(188) VLP Purification and Immunogenicity Trial of Double Chimaeric AHSV VLPs in Horses
(189) Following agroinfiltration of Nicotiana benthamiana dXT-FT plants with the appropriate recombinant pEAQ vectors, the double chimaeric AHSV-1/AHSV-7 VLPs were purified by means of both tangential flow filtration (TFF) and sucrose density gradient centrifugation prior to being injected into horses. More specifically, LBA 4404 agrobacterial cells, containing the recombinant plasmids pEAQ-express-AHSV-1VP7/AHSV-1VP3, pEAQ-HT-AHSV-7VP5 and pEAQ-HT-AHSV-7VP2 were defrosted and streaked out onto selective LB plates (50 g/ml Kanamycin, 50 g/ml Rifampicin and 50 g/ml Streptomycin). Following incubation at 28 C. for 48 hours, the cultures were subsequently inoculated into 50 ml YMB medium containing the appropriate antibiotics and incubated overnight at 28 C. with rotational shaking (175 rpm). The overnight cultures were harvested at 8000 rpm for 7 min at 20 C. and each cell pellet resuspended in 40 ml MMA buffer (10 mM MES hydrate; pH 5.6, 10 mM MgCl.sub.2, 100 M 3,5-Dimethoxy-4-hydroxy-acetophenone) and the OD.sub.600 measured. The agrobacterial suspensions were combined in a 1:1:1 ratio and the final OD.sub.600 of each combination was 0.4-0.5. Four week-old N. benthamiana dXT-FT plants were infiltrated with the agrobacterial combination via syringe-mediated infiltration.
(190) The infiltrated leaves were harvested 8 days post infiltration (d.p.i), weighed and immediately processed through a juice extractor (MATSTONE 6 in 1 multipurpose juice extractor) with 3 volumes of VLP extraction buffer (20 mM NaCl, 50 mM Bicine, pH 8.4, 0.1% (w/v) Sodium lauroyl sarcosine (NLS), 1 mM Dithiothreitol (DTT) (ThermoScientific), cOmplete, EDTA-free Protease inhibitor cocktail (Sigma-Aldrich)). The DTT and cOmplete, EDTA-free Protease inhibitor cocktail tablets were freshly prepared according to the manufacturers' instructions and added to the extraction buffer just prior to use. Large plant debris was removed by filtering the cell lysate through 2 layers of miracloth and the cell extract clarified via low speed centrifugation (4200g; 30 min; 10 C.). Using a Masterfiex Consol Drive peristaltic pump (Cole-Parmer Instrument Company), the cell extract was filtered through a Sartoclean GF sterile midicap (3+0.8 M) depth filter (Sartorius).
(191) A portion of the filtrate was layered on top of 70-30% sucrose gradients and centrifuged in a SW-38Ti rotor (Beckman Coulter) at 85,800g for 3 hours; 10 C. Sucrose solutions (30%-70%) were prepared by dissolving ultra-high quality sucrose (Sigma Life Science) in VLP dilution buffer (20 mM NaCl, 50 mM Bicine, pH 8.4) and layered into gradients of 3 ml 10% incrementing steps. Following centrifugation the 55%-45% sucrose layers were harvested in 1 ml fractions via a Minipuls2 peristaltic pump (Gilson). Fractions containing the VLPs (55%-45%) were added together and dialysed against sterile VLP dilution buffer (20 mM NaCl, 50 mM Bicine, pH 8.4) overnight, with gentle stirring, in SnakeSkin dialysis tubing (Thermo Fisher Scientific).This was followed by a second dialysis step of 2 hours against new VLP dilution buffer at 4C. The dialysed sample was harvested and D-(+)-Trehalose dihydrate (Sigma Life science) added as a stabilizing agent to a final concentration of 5%.
(192) The remainder of the Depth filtered plant cell extract was further filtered through a 300K Minimate Tangential Flow filtration (TFF) Capsule (Pall Life Sciences) with the pressure not exceeding 2 Bar. This was done to remove all proteins smaller than 300K. Two subsequent wash steps (1 in 10 dilution each) with sterile VLP dilution buffer ensured the removal of the NLS detergent, DTT and Protease inhibitor from the plant extract. The plant cell lysate was concentrated to of its original volume and D-(+)-Trehalose dihydrate (Sigma Life science) added as a stabilizing agent to a final concentration of 5%.
(193) The sucrose and TFF purified samples were subsequently filter-sterilized through a 0.45 M+0.2 M Sartobran 300 Sterile capsule (Sartorius Stedim biotech GmbH) utilizing a peristaltic pump with the pressure not exceeding 2 Bar. They were also tested for sterility by streaking out 100 l of the sample on Luria agar plates containing no antibiotics and incubating those plate overnight at 37 C. Samples, taken throughout the course of the purification procedure, were analysed for protein content by denaturing SDS-PAGE and immunoblotting procedures with AHSV-7 specific antiserum, kindly donated by OBP. The protein content of the filter sterilized samples was quantified by using the Micro BCA Protein Assay kit (Thermo Fisher Scientific) while the VLPs in these same samples was visualised via TEM.
(194) The immunogenicity of the plant-produced double chimaeric AHSV-1/AHSV-7 VLPs was investigated in the target species, horses. The horse trial was conducted according to the procedures and schedule detailed in the approved target animal ethics applications (CSIR REC registration number 151/2015, OBP registration number 2015/003). Seven AHS-nave foals (6 months old) were stabled in closed stables at OBP and handled according to standard operating procedures outlined by the Experimental Unit. Vaccination and bleeding of animals was according to standard operating protocols and conducted by OBP. Three foals were each injected subcutaneously into the inner thigh with the TFF-purified VLP/Alydrogel sample (final volume of 2 ml containing 3490 g of total protein). Two foals were each injected subcutaneously into the inner thigh with the sucrose gradient-purified VLP/Alydrogel sample (final volume of 2 ml containing 101 g of total protein). One foal was inoculated with sterile bicine buffer/Alydrogel sample as a negative control whilst another was inoculated with monovalent AHSV-7 live attenuated vaccine (OBP) as a positive control. The animals were inoculated with the booster sample on day 28 of the immunization schedule. The 2 ml TFF-purified VLP/Alydrogel booster sample contained 3825 g of total protein while the 2 ml sucrose gradient-purified VLP/Alydrogel sample contained 184 g of total protein. The two control animals received sterile bicine buffer/Alydrogel and monovalent AHSV-7 live attenuated vaccine (OBP), respectively, during the boost inoculation. Serum samples were taken on days 0, 7, 14, 21, 28, 35, 42, 49 and 56. Serum neutralization testing was performed on the blood samples by OBP according to the RDV-ME-014 method whilst the VP7-specific ELISA tests were performed by ARC Onderstepoort Veterinary Institute (OVI).
(195) The results of this horse trial are as follows: One horse (#31), inoculated with the TFF-purified AHSV-1/AHSV-7 VLP sample, elicited -AHSV-7 neutralizing antibodies with a titre of 1:16 two weeks after the boost inoculation (day 42) (Table 9 & 10). This indicates that the AHSV-7 VP2 protein was presented on the surface of the double chimaeric VLPs in a conformation capable of eliciting an AHSV neutralizing humoral immune response in the horse. However, this immune response was not detected in the following two weeks (days 49 and 56). No neutralizing antibodies were detected in the sera of any of the other animals during the trial, not even the animals injected with the monovalent live attenuated AHSV-7 virus used as a positive control (Animal #32). The lack of a response in the positive control group indicates that this trial will have to be repeated. Horses #29 and #30, both inoculated with the TFF-purified AHSV-1/AHSV-7 VIPs, as well as horse #35, inoculated with sucrose gradient purified AHSV-1/AHSV-7 VLPs, elicited antibodies against the VP7 protein on day 35, a week after the booster inoculation. This indicates the presence of CLPs. As expected, the animal inoculated with bicine buffer, #43, did not elicit any neutralizing or VP7-specific antibodies during the course of the trial.
(196) TABLE-US-00009 TABLE 9 Serum neutralizing test (SNT) results of the horse trial. Horse # Innoculum Day 0 D 7 D 14 D 21 D 28 D 35 D 42 D 49 D 56 23 TFF-purified AHSV-1/7 0 0 0 0 0 0 0 0 0 VLPs 30 TFF-purified AHSV-1/7 0 0 0 0 0 0 0 0 0 VLPs 31 TFF-purified AHSV-1/7 0 0 0 0 0 0 1:16 0 0 VLPs 35 Sucrose gradient purified 0 0 0 0 0 0 0 0 0 AHSV-1/7 VLPs 41 Sucrose gradient purified 0 0 0 0 0 0 0 0 0 AHSV-1/7 VLPs 32 Monovalent live 0 0 0 0 0 0 0 0 0 attenuated AHSV-7 OBP (Positive control) 43 Bicine buffer (Negative 0 0 0 0 0 0 0 0 0 control)
(197) TABLE-US-00010 TABLE 10 ELISA results of the horse trial. Horse # Innoculum D 14 D 21 D 28 D 35 23 TFF-purified AHSV-1/7 Neg Neg Neg 9 VLPs 30 TFF-purified AHSV-1/7 Neg Neg Neg 14 VLPs 31 TFF-purified AHSV-1/7 Neg Neg Neg Neg VLPs 35 Sucrose gradient purified Neg Neg Neg 22 AHSV-1/7 VLPs 41 Sucrose gradient purified Neg Neg Neg Neg AHSV-1/7 VLPs 32 Monovalent live Neg Neg Neg Neg attenuated AHSV-7 OBP (Positive control) 43 Bicine buffer Neg Neg Neg Neg (Negative control)
Example 9
(198) Immunogenicity of Plant Produced African Horse Sickness Virus-Like Particles
(199) A consensus gene sequence for each of the AHSV-5 viral capsid proteins VP2, VP3, VP5 and VP7 was obtained by aligning all the known sequences for these genes listed in GenBank, using CLC Mainbench bioinformatics software (Qiagen Bioinformatics, Aarhus, Denmark). Consensus sequences were codon optimized for expression in N. benthamiana and synthesized by GenScript Biotech Corporation (China) with flanking AgeI and XhoI restriction enzyme sites. The codon-optimized VP7 consensus sequence, modified as described by S. Bekker (2015) to include 7 amino acid substitutions near the 3 end, (Pro276His, Arg328Ala, Val333Asn, Ala334Pro, Pro335Met, Val336Pro and Gln338Pro) was also synthesized. Restriction enzyme cloning was used to insert the genes into the pEAQ-HT expression vector obtained from George Lomonossoff, John Innes Centre, UK (Sainsbury et al., 2009) to produce pEAQ-AHS5-VP2, pEAQ-AHS5-VP3, pEAQ-AHS5-VP5, pEAQ-AHS5-VP7 and pEAQ-AHS5-VP7mu. The AHSV-5 plasmid constructs were electroporated into Agrobacterium radiobacter AGL1-ATCC BAA-101 as described previously (Maclean et al., 2007) and recombinant clones were selected at 27 C. on Luria Bertani (LB) media plates containing 25 g/mL carbenicillin and 50 g/mL kanamycin.
(200) Transient Expression in Plants
(201) Expression of the AHSV-5 capsid proteins was achieved by agroinfiltration of 5-6-week-old N. benthamiana plants. Agrobacterium transformants each carrying one of the AHSV-5 capsid protein genes, were subcultured and grown overnight with agitation at 27 C. in Luria Bertani Broth (LBB) base supplemented with 50 g/mL kanamycin, 20 M acetosyringone and 2 mM MgSO.sub.4. The cultures were diluted in resuspension solution (10 mM MES, pH 5.6, 10 mM MgCl.sub.2, 100 M acetosyringone) to the desired optical density and incubated for 1 h at 22 C. to allow for expression of the vir genes. For single infiltrations, each AHSV-5 Agrobacterium recombinant suspension was diluted to OD.sub.600=0.5 or 1.0, while co-infiltration suspensions contained all four AHSV-5 recombinants in a ratio VP2:VP3:VP5:VP7 of 1:1:1:1 or 1:1:2:1. Plants were grown at 22-25 C. under 16 h/8 h light/dark cycles. Agrobacterium suspensions were infiltrated into the leaf inter-cellular spaces using either a blunt-ended syringe or by means of a vacuum infiltrator, applying a vacuum of 100 kPa. For optimization of the expression, 3 leaf discs were obtained from each plant, clipped with the lid of a micro-centrifuge tube on 3, 5 and 7 days post infiltration (dpi) and homogenized in 3 volumes of PI buffer (phosphate buffered saline (PBS), pH 7.4 containing 1 Complete protease inhibitor cocktail (Roche, Basel, Switzerland)) using a micro-pestle. The homogenate was incubated on ice for 30 min and then clarified by centrifugation at 13 000 rpm for 15 min in a benchtop microfuge. For large scale expression, leaf tissue was harvested 7 dpi, as this time span was shown to be optimal for expression of all four capsid proteins. Harvested leaves were immediately homogenized in 3 volumes PI buffer using a Moulinex juice extractor. The homogenized leaves were re-incubated with the extracted juice and incubated at 40 C for 1 h with gentle shaking. Crude plant extracts were filtered through four layers of Miracloth (Merck, Darmstadt, Germany) and the filtrate was clarified by centrifugation at 13 000 rpm for 15 min at 4 C.
(202) AHSV-5 Capsid Proteins Transiently Expressed in N. benthamiana Leaves Self-Assemble into VLPs
(203) A consensus sequence of each gene was obtained by aligning all the known sequences listed in GenBank and these were codon-optimized for Nicotiana spp. translation and synthesized with flanking AgeI and XhoI restriction enzyme sites by GenScript Biotech Corporation, China. The genes were cloned into the multiple cloning site of the pEAQ-HT vector (Sainsbury et al. 2009, obtained from G. Lomonossoff, John Innes Centre, UK) to yield four different constructs, pEAQ-AHS5-VP2, pEAQ-AHS5-VP3, pEAQ-AHS5-VP5 and pEAQ-AHS5-VP7 (
(204) Purification and Western Blot Analysis
(205) AHSV-5 VLPs were purified by iodixanol density gradient ultracentrifugation. Iodixanol (Optiprep, Sigma-Aldrich, Missouri, USA) solutions (20-60%), prepared in PBS, were used to create a 12 ml step gradient (2-3 mL of each gradient in 10% incrementing steps) under 27 ml clarified plant extract and centrifuged at 32 000 rpm for 2 h at 4 C. in an SW 32 Ti rotor (Beckman, Calif., USA). Fractions of 1 ml were collected from the bottom of the tube and 30 l from fractions representing the 30-40% region of the gradient were electrophoresed on a 10% SDS-polyacrylamide gel, followed by Coomassie blue staining. Particle quantification was achieved by visual comparison of the four capsid protein bands to known amounts of bovine serum albumin (BSA) run in separate lanes on the same SDS-PAGE gel. To further purify and concentrate VLP samples for use in animal studies, VLP-containing fractions were diluted with PBS to 20% iodixanol and subjected to a second round of ultracentrifugation per the same protocol described above. Both crude plant extracts and gradient-purified VLPs were analyzed by western blot: heat-denatured samples were separated on 10% polyacrylamide gels and then transferred onto HyBond C Extra nitrocellulose membranes (AEC-Amersham, Gauteng, South Africa) using a Trans-Blot SD semi-dry transfer cell (Bio-Rad, California, USA). Membranes were first probed with a 1:1000 dilution of AHSV-5 specific horse serum (received from Deltamune, Pretoria, South Africa), washed four times with PBS containing 0.05% Tween 20 (Sigma-Aldrich, Missouri, USA) (PBS-T) and then probed with 1:5000 dilution of anti-horse alkaline phosphatase-conjugated secondary antibody (Sigma-Aldrich, Missouri, USA). After washing again, proteins were detected with 5-bromo-4-chloro-3-indoxyl-phosphate (BCIP) and nitroblue tetrazolium (NBT) phosphatase substrate (BCIP/NBT 1-component, KPL, SeraCare, Mass., USA).
(206) Density Gradient Ultracentrifugation of Plant-Produced AHSV-5 VLPs
(207) To produce an AHS VLP preparation of sufficient purity and concentration for immunization of guinea pigs, several modifications were made. Firstly, the process was scaled up to infiltrate 24 plants with the recombinant constructs at the optimal OD.sub.600 of 0.5 each and optimal ratio of 1:1:1:1. Secondly, AHSV VP7 is known to form trimers which aggregate into crystalline structures in the cytoplasm of infected cells and there is evidence to suggest that these crystals impede VLP formation by sequestering available soluble VP7 trimers and preventing them from incorporating into the core particle. Therefore, a mutated version of the VP7 gene containing 7 amino acid substitutions near the 3 end was also synthesized (SEQ ID NO:77) and cloned into pEAQ-HT to yield pEAQ-AHS5-VP7mu. The protein encoded by the mutated version of the VP7 gene has the sequence set forth in SEQ ID NO:78. Co-infiltration with Agrobacterium strains carrying the VP2, VP3 and VP5 recombinants together with this construct as opposed to the wild-type VP7 construct, yielded an increased concentration of VLPs. Therefore, the mutated VP7 construct was used in all further experiments. Thirdly, a vacuum infiltrator was used to introduce the Agrobacterium suspension into the leaf intercellular spaces as this was much less labour intensive than syringe infiltration and resulted in more uniform infiltration of plant leaves.
(208) Lastly, clarified leaf extracts were purified by iodixanol density gradient ultracentrifugation. Green leaf impurities settled in the upper 30% region of the gradient, while a single iridescent band was observed at a higher density, near the 30-40% interface (
(209) Transmission Electron Microscopy
(210) Glow-discharged copper grids (mesh size 200) were floated on 20 l crude plant extract or 20 l density gradient fractions for 3 min and then washed successively by floating on 5 drops of sterile water. Particles were negatively stained for 30 sec with 2% uranyl acetate and then imaged using a Technai G2 transmission electron microscope (TEM).
(211) Immunization of Guinea Pigs
(212) Approval for the immunization experiments was obtained from the Faculty of Health Sciences Animal Ethics Committee, University of Cape Town (FHS AEC ref No.: 016/019). Prior to the study, 100 l of blood was drawn from each of 8 female guinea pigs (Hartley strain). Guinea pigs (n=4) were injected subcutaneously with purified AHSV-5 VLPs or 30% iodixanol in PBS, both formulated in 5% Montanide PET Gel A adjuvant (Seppic, Paris, France). Animals were boosted on day 13 and on day 41, they were euthanized by anaesthesia with ketamine/xylazine and exsanguinated. Serum was tested for antibodies by indirect enzyme-linked immunosorbent assay (ELISA) and western blot. Briefly, 96-well Maxisorp microtiter plates (Thermo Fisher Scientific, Massachusetts, USA) were coated overnight at 4 C. with 60 ng/well of AHSV-5 VLPs originally used for the inoculations. Plates were washed four times with PBS-T and blocked with 5% fat-free milk powder diluted in PBS-T for 1 h at 37 C. Guinea pig antisera were serially diluted in PBS-T/5% milk, added to the plates and allowed to incubate for 1 h at 37 C. Plates were washed four times, and an alkaline phosphatase-conjugated goat anti-guinea pig IgG (Sigma-Aldrich, Missouri, USA) was diluted (1:5000) in blocking buffer and added to plates. Plates were again incubated for 1 h at 37 C. and washed four times. After addition of 100 l p-Nitrophenyl phosphate substrate (SIGMAFAST, Sigma-Aldrich, Missouri, USA), the plates were incubated in the dark for 30 min to allow a colorimetric reaction to develop. Optical densities at a wavelength of 450 nm were read by a Bio-Tek Powerwave XS spectrophotometer. For western blot analysis, guinea pig antisera were used at a dilution of 1:10 000 as per the protocol described above.
(213) Neutralization Assays
(214) The serum neutralizing antibody titres of individual guinea pig sera were assayed against three different AHSV serotypes, namely serotypes 4, 5 and 8 using a serum neutralization test (SNT).
(215) Plant-Produced AHSV-5 VLPs Induce a Strong Immunogenic Response in Guinea Pigs
(216) Guinea pigs were used as a small animal model to test the ability of the plant-produced AHSV 5 VLPs to induce an immune response. On day 0, four guinea pigs (V2-V5) were each vaccinated with 16.5 g AHSV VLPs, while four control animals (C2-C5) were immunized with PBS. Prior to the boost inoculation, a further purification yielded sufficient AHS VLPs to increase the amount of the next inoculum. Animals were thus boosted on day 13 with 50 g VLPs or PBS and sera from all animals was collected on day 41. Sera from guinea pigs immunized with VLPs tested positive for AHSV 5 antibodies in indirect ELISA, 1:40 000 being the lowest dilution at which an absorbance value could be read. Sera from guinea pigs vaccinated with PBS, tested negatively (
(217) To test the ability of the sera to neutralize live virus, serum samples from all guinea pigs were sent to the Equine Research Centre at Onderstepoort, University of Pretoria for serum neutralization tests. Sera were assayed against AHSV-5 and AHSV-8 as serological cross-protection has been shown in vitro between serotypes 5 and 8, and AHSV-4 for which no cross protection has been shown. All vaccinated guinea pig sera showed a high level of neutralization capability against AHSV-5 and neutralized AHSV-8 to a lesser extent, but to a similar degree compared to the AHS positive control (Table 11). The sera did not neutralize AHSV-4 and control guinea pig sera did not neutralize any of the AHSV serotypes. These results indicate that plant-produced AHSV-5 VLPs stimulate a highly protective immune response in guinea pigs.
(218) TABLE-US-00011 TABLE 11 Virus neutralizing antibody titers of serum samples from vaccinated (V) and control (C) guinea pigs. The guinea pig sera were assayed for neutralization capability against AHSV-5, AHSV-4 and AHSV-8, as serological cross-protection has been shown in vitro between serotypes 5 and 8, but not between serotypes 5 and 4. Horse serum from animals vaccinated with the AHSV live-attenuated vaccine produced by Onderstepoort Biological Products (OBP) was used as a positive control. Group Guinea Pig AHSV-4 AHSV-5 AHSV-8 Vaccine V2 Negative 1:5120 1:160 V3 Negative 1:640 1:80 V4 Negative 1:1280 1:56 V5 Negative 1:2560 1:80 Control C2 Negative Negative Negative C3 Negative Negative Negative C4 Negative Negative Negative C5 Negative Negative Negative OBP vaccine 1:112 1:112 1:112
Example 10
(219) Production of BT VLPs Harnessing Various Agrobacterium Strains
(220) LBA4404, AGL-1 and GV3101 pMP90 Agrobacterium strains were compared as vehicle to deliver the expression vector pEAQ-HT, harbouring the selected genes, to the plant cells. BTV-8 (VP3, VP7, VP5 and VP2) and BTV-3 (VP5 and VP2) were individually electroporated into these Agrobacterium strains. The goal was to determine the Agrobacterium strain most suitable and resulting in the highest number of intact double chimaeric BTV-3 (BTV-8 VP3 and VP7 core combined with BTV-3 VP2 and VP5 outer capsids) and homogenous BTV-8 VLPs (BTV-8 VP3, VP5, VP2 and VP7) for commercial production. Assembly of BTV serotypes 3 and 8 VLPs were created using stocks from the LBA4404 seed cell bank, or the recently prepared Agrobacterium AGL-1 and GV3101 pMP90 collection. N. benthamiana dXT/FT plants were infiltrated with the relevant Agrobacterium and construct combinations. The Agrobacterium strains harboring pEAQ-HT constructs encoding for the four capsid proteins individually for BTV serotypes 3 and 8 were successfully infiltrated into N. benthamiana leaves. Production of VLPs in plant leaf tissue was determined by mixing the four constructs encoding the four individual capsid proteins VP3:VP7:VP5:VP2 at a ratio of 1:1:1:1 (OD.sub.600=2). Leaf tissue was harvested seven days after infiltration, extracted and Iodixanol density gradient purified as described above. The Iodixanol purified BT VLPs proteins were quantified using a sensitive colorimetric protein assay, the Micro BCA Protein Assay Kit (ThermoScientific) using Bovine Gamma Globulin (Bio-Rad) protein standards. Eight micrograms of protein were loaded in each lane (
(221) The Iodixanol samples were stained as follows: grids were floated on the undiluted protein sample for 5 minutes were washed five times in 5 l distilled water, drained via blotting on filter paper each time before staining. Subsequently the grids were floated on 2% uranyl acetate (30 seconds, drained and stained for another 10 seconds) and drained as described above. The air dried grid was imaged in a CM10 Transmission electron microscope (Philips) at the University of Pretoria (UP) Onderstepoort, Laboratory for Microscopy and Microanalysis (
(222) In this Example, Agrobacterium strains LBA4404, GV3101 pMP90 and AGL-1 were compared to mediate homogenous BTV-8 and double chimaeric BTV-3 in N. benthamiana facilitating mammalian glycosylation (dXT/FT, Strasser et al., 2008) by exclusively subjecting VP2 to mass spectrometry. Assembly of homogenous BTV-8 and double chimaeric BTV-3 as visualized by TEM images is comparable when mediated by the three independent Agrobacterium strains. Mass spectrometry analysis of homogenous BTV-8 VLPs (duplicate technical replicates) indicated that either LBA4404 (42-46 peptides) or GV3101 pMP90 (36-41 peptides) or AGL-1 (49-52 peptides) are suitable to mediate abundant VLP assembly with strain AGL-1 slightly superior. Mass spectrometry analysis of double chimaeric BTV-3 (triple technical replicates) however indicated that LBA4404 (32-39 peptides) is superior to both GV3101 pMP90 (7 peptides in only one sample) and AGL-1 (14-17 peptides).
(223) TABLE-US-00012 TABLE 12 Mass spectrometry results of the production of BT VLPs harnessing various Agrobacterium strains Duplicates or triplicates of VP2 Viral 95% Sample # detected protein Note Peptides coverage BTV VP2 serotypes BTV-8 LBA4404 1 BTV-8 VP2 111 kDa 46 48.0% BTV8_VP2_AGJ83482_1 Homogenous 2 BTV-8 VP2 111 kDa 42 40.0% BTV8_VP2_AGJ83482_1 BTV-8 GV3101 pMP90 1 BTV-8 VP2 111 kDa 41 43.0% BTV8_VP2_AGJ83482_1 Homogenous 2 BTV-8 VP2 111 kDa 36 37.0% BTV8_VP2_AGJ83482_1 BTV-8 AGL-1 1 BTV-8 VP2 111 kDa 49 51.0% BTV8_VP2_AGJ83482_1 Homogenous 2 BTV-8 VP2 111 kDa 52 47.0% BTV8_VP2_AGJ83482_1 BTV-3 LBA4404 1 BTV-3 VP2 111 kDa 32 0.35% BTV3_VP2_CAE51090_1 Double chimaeric 2 BTV-3 VP2 111 kDa 39 0.4% BTV3_VP2_CAE51090_1 3 BTV-3 VP2 111 kDa 26 0.28% BTV3_VP2_CAE51090_1 BTV-3 GV3101 pMP90 1 BTV-3 VP2 111 kDa 7 0.06% BTV3_VP2_CAE51090_1 Double chimaeric 2 BTV-3 VP2 111 kDa Not detected BTV3_VP2_CAE51090_1 3 BTV-3 VP2 111 kDa Not detected BTV3_VP2_CAE51090_1 BTV-3 AGL-1 1 BTV-3 VP2 111 kDa 17 0.21% BTV3_VP2_CAE51090_1 Double chimaeric 2 BTV-3 VP2 111 kDa 14 0.14% BTV3_VP2_CAE51090_1 3 BTV-3 VP2 111 kDa Not detected BTV3_VP2_CAE51090_1
REFERENCES
(224) COETZER, J. A. W. & GUTHRIE, A. J. (2004) African horse sickness. In: Infectious Diseases of Livestock 2nd ed. Oxford University Press Southern Africa, Cape Town, 1231-1246. DEMAULA, C. D., BONNEAU, K. R. & MACLACHLAN, N. J. 2000. Changes in the outer capsid proteins of bluetongue virus serotype ten that abrogate neutralization by monoclonal antibodies. Virus Res, 67, 59-66. HUISMANS, H. & ERASMUS, B. 1981. Identification of the serotype-specific and group-specific antigens of bluetongue virus. Onderstepoort J Vet Res, 48, 51-58. MERTENS, P. P., DIPROSE, J., MAAN, S., SINGH, K. P., ATTOUI, H. & SAMUEL, A. R. 2004. Bluetongue virus replication, molecular and structural biology. Vet Ital, 40, 426-37. PEARSON, L. D. & ROY, P. 1993. Genetically engineered multi-component virus-like particles as veterinary vaccines. Immunology and Cell Biology 71: 381-389. SAINSBURY, F., THUENEMANN, E. C. & LOMONOSSOFF, G. P. 2009. pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol., 7, 682-693. SHEVCHENKO, A., TOMAS, H., HAVLI, J., OLSEN V. J. & MANN, M. (2007) In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols. 1, 2856-2860. STRASSER R, STADLMANN J, SCHHS M, STIEGLER G, QUENDLER H, MACH L, GLSSL J, WETERINGS K, PABST M & STEINKELLER H, 2008. Generation of glycol-engineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogenous human N-like N-glycan structure. Plant Biotechnology Journal 6: 392-402. THUENEMANN, E. C., MEYERS, A. E., VERWEY, J., RYBICKI, E. P. & LOMONOSSOFF, G. P. 2013. A method for rapid production of heteromultimeric protein complexes in plants: assembly of protective bluetongue virus-like particles. Plant Biotechnology Journal, n/a-n/a.