AMYLASE MUTANT HAVING HIGH SPECIFIC ACTIVITY AND THERMAL STABILITY, GENE OF MUTANT, AND APPLICATIONS THEREOF
20210024908 ยท 2021-01-28
Assignee
Inventors
- Bin YAO (Beijing, CN)
- Huiying Luo (Beijing, CN)
- Jin Qiu (Beijing, CN)
- Tao Tu (Beijing, CN)
- Huoqing Huang (Beijing, CN)
- Yuan Wang (Beijing, CN)
- Yaru Wang (Beijing, CN)
- Yingguo Bai (Beijing, CN)
- Xiaoyun Su (Beijing, CN)
- Kun Meng (Beijing, CN)
Cpc classification
International classification
Abstract
The present invention relates to the field of agriculture biotechnology, specially relates to an amylase mutant having high specific activity and thermal stability, gene and use thereof. Said amylase mutant is obtained by performing substitution of S33A/S34E/V35H, and deletion of amino acids at the sites of 178 and 179 of the wild type amylase having amino acid sequence of SEQ ID NO:1, and having improved enzymatic activity and thermal stability than the wild type amylase.
Claims
1. An amylase mutant, (1) being obtained by substituting S33A/S34E/V35H, and deleting the amino acids at the sites of 178 and 179 of the wild type amylase having amino acid sequence of SEQ ID NO:1, and having improved enzymatic activity and thermal stability than those of the wild type amylase, or having 99% sequence identity to the polypeptide obtained by substituting S33A/S34E/V35H, and deleting the amino acids at the sites of 178 and 179 of the wild type amylase having amino acid sequence of SEQ ID NO:1; and (2) having the 2.5-3.5 times enzymatic activity of the wild type, retaining more than 99% and 30%35% of the enzymatic activity after being treated at 70 C. and 80 C. respectively.
2. The amylase mutant according to claim 1, wherein said amylase mutant retains more than 99% of enzymatic active after being treated at 70 C. for 3 to 10 min.
3. The amylase mutant according to claim 1, wherein said amylase mutant retains 32% of enzymatic active after being treated at 80 C. for 3 to 10 min.
4. A gene encoding the amylase mutant of claim 1.
5. A recombinant vector of comprising the gene of claim 4.
6. A recombinant cell comprising the gene of claim 4.
7. A method of preparing amylase having high enzymatic activity and thermal stability, comprising the steps of (1) constructing a recombinant vector comprising the gene of claim 2; (2) transforming the host cell with the recombinant vector obtained by the step (1); and (3) culturing said host cell and isolating said amylase.
8. A use of the amylase mutant of claim 1.
9. A use of the amylase mutant of claim 1 to feed, medicine, food or textile fields.
10. A use of the gene of claim 4.
11. A use of the gene of claim 4 to feed, medicine, food or textile fields.
Description
BRIEF DESCRIPTIONS OF THE DRAWINGS
[0027]
[0028]
[0029]
EMBODIMENT
[0030] The present invention is further illustrated with reference to the following examples and the appended drawings, which should by no means be construed as limitations of the present invention.
[0031] Test Materials and Reagents
[0032] 1. Strains and vectors: host: Bacillus subtilis SCK6; and vector pHYP16-BKAMY
[0033] 2. Enzymes and other biochemical reagents: restriction endonucleases (Fermentas); and ligase (Promaga).
[0034] 3. Medium: LB medium; starch medium
[0035] Suitable biology laboratory methods not particularly mentioned in the examples as below can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other kit laboratory manuals.
Example 1 Site Directed Mutagenesis of the Gene Encoding the Amylase
[0036] The optimized mutation site wasS33A/S34E/V35H/R178/ G179. The mutation site was introduced with the primers of table 1 by Site-directed Mutagenesis Kit followed by sequencing to obtain the mutant gene.
TABLE-US-00003 TABLE1 Primers SEQ Length IDNO. Primers Sequence(5.fwdarw.3).sup.a (bp) 3 Bkamy-F ttacaaaaacatcagccgtaggatccg 50 ccgcaacgaacggaacaatgatg 4 Bkamy-R gggacgtcgacttagtggtggtggtgg 54 tggtgctgctgaacccacactgagacg 5 pHYP16-F gggttcagcagcaccaccaccaccacc 51 actaagtcgacgtccccggggcag 6 pHYP16-R attgttccgttcgttgcggcggatcct 50 acggctgatgtttttgtaatcgg
[0037] Sequencing results showed that the nucleotide sequence amplified by mutation had 1458 bp, comprising the encoding area of 1455 bp encoding the amino acid sequence of SEQ ID No: 2 having 485 amino acid residues. The protein with the amino acid sequence of SEQ ID No: 2 was named as amylase mutant BKAMYA.
Example 2 Preparation of Amylase Mutant BKAMYA
[0038] 1. Preparation of Recombinant Plasmid pHYP16-BKAYA
[0039] Firstly, the vector and the target fragment were amplified by POE-PCR followed by being recovered and mixed in a proper proportion, and then added into the PCR system to construct the recombinant plasmid containing the said amylase gene. Mutation of nucleotides was introduced by Site Mutation kit using the wild type plasmid as the temple. Then, the obtained recombinant plasmid was sequenced to test the validity of purpose sequence. The recombinant plasmid inserting the exogenous gene was named aspHYP16-BKAMYA.
[0040] 2. Preparation of the Recombinant Strain SCK6/BKAMYA
[0041] The above recombinant plasmid pHYP16-BKAMYA was transformed into Bacillus spk6 cells to obtain the recombinant strain SCK6/BKAMYA.
[0042] 3. Preparation of the Amylase Mutant
[0043] The above recombinant strainSCK6/BKAMYA was inoculated into 50 mL of medium in 100 mL of flask and cultured on a shaker operating at 220 rpm at 37 C. and for 24 h. Then, the cultured medium was transferred to 200 mL medium in a 1 L of flask to culture at 37 C. and 220 RPM again. The supernatant was collected by centrifugation to purify the amylase mutant BKAMYA by affinity chromatography for analyzing activity.
Example 3 Analysis and Comparison of the Amylase Mutant BKAMYA and Wild Type Amylase
[0044] 1. Analysis and Comparison of the Enzymatic Activity
[0045] The enzymatic activity of amylase was determined with UV spectrophotometer by the steps of performing the enzymatic reaction at the certain temperature and pH for 20 min, wherein 1 mL of said enzymatic reaction system included 100 L of appropriate diluted enzyme solution and 900 L of substrate, measuring the absorbance at 540 nm and calculating the enzymatic activity. A unit of enzymatic activity (U) is defined as the amount of enzyme to produce 1 mol glucose per unit time under given conditions.
[0046] The purified amylase mutant prepared in example 2 and the wild type amylase were performing the enzymatic reaction at pH 7.0 and 55 C. to determine their enzymatic activity.
[0047] As showed in
[0048] 2. Analysis and Comparison of Thermal Stability
[0049] The thermal stability of both the purified amylase mutant prepared in example 2 and the wild type was determined by treating at 60 C. for 10 min, 30 min and 60 min respectively or 70 C. for 2 min, 5 min, and 10 min respectively, in 0.1 mol/L of citric acid-disodium hydrogen phosphate buffer (pH 7.0), and their retained enzymatic activity at 55 C. was determined.
[0050] As showed in