EMBRYONIC ZEBRAFISH MODELS USING DNAZYME MEDIATED KNOCKDOWN

Abstract

The present invention provides DNAzymes for reduction in the expression of the target gene implicated in disease. The present invention also provides a platform technology for the use of DNAzymes to create a reduction in gene expression in zebrafish embryos. More particularly, the present invention describes DNAzyme mediated knockdown of Fmr1 mRNA, gcdh mRNA and gba1mRNA in zebrafish embryos. The present invention also provides a method of creating a model of Fragile X syndrome in Zebrafish embryos.

Claims

1. A method of developing a model of Fragile X syndrome in zebrafish embryos comprising delivering one or more DNAzyme sequence into the zebrafish embryo at 0 hpf (hours post fertilization) to 7 dpf (days post fertilization) to knockdown FMR1 mRNA expression.

2.-3. (canceled)

4. The method of claim 1 wherein the DNAzyme sequence is selected from a group consisting of SEQ ID NO. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, and targeting any sequence that is part of the Fmr1 mRNA sequence of Genbank Accession number NM 152963.

5.-7. (canceled)

8. A method of developing a model of Glutaric Aciduria Type 1 (GA1) in zebrafish embryos comprising delivering one or more DNAzyme sequence into the zebrafish embryo at 0 hpf (hours post fertilization) to 7 dpf (days post fertilization) to knockdown gcdh mRNA expression.

9.-10. (canceled)

11. The method of claim 8, wherein the DNAzyme sequence is selected from a group consisting of SEQ ID NO. 13, 14, 15, 16, 17, 18. or 19 and targeting any sequence that is part of the gcdh mRNA Ensmbl Gene ID ENSDARG00000109610.

12.-14. (canceled)

15. A method of developing a model for Gaucher's Disease in zebrafish embryos comprising delivering one or more DNAzymes sequence into the zebrafish embryo at 0 hpf (hours post fertilization) to 7 dpf (days post fertilization) to knockdown gba1 mRNA expression.

16.-17. (canceled)

18. The method of claim 15 wherein the DNAzyme sequence is selected from a group consisting of SEQ ID NO. 20, 21, 22, 23, 24, or 25 and targeting a sequence that is part of the gba1 mRNA of Ensmbl gene ID ENSDARG00000076058.

19.-21. (canceled)

22. A method to reduce the expression level of a target mRNA in zebrafish embryos, wherein the said method comprises administering a DNAzyme sequence comprising the core nucleotide sequence of SEQ ID NO. 1 (GGCTAGCTACAACGA) to a zebrafish embryo.

23. A method of developing a model of monogenic diseases in zebrafish embryos comprising delivering a DNAzyme sequence targeting the causal gene, into the zebrafish embryo between 0 hpf (hours post fertilization) to 7 dpf (days post fertilization) resulting in knocking down of the causal gene.

24. (canceled)

25. The method of claim 23, wherein the DNAzyme sequence targets a mRNA that is specific to a disease condition.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1: Strategy for DNAzyme mediated knockdown of target mRNA for model creation in zebrafish.

[0021] FIG. 2: A. Sequence of Zebrafish Fmr1 mRNA and DNAzyme target positions; B. In vitro mRNA cleavage assay for DNAzymes; C. Measurement of DNAzyme cleavage efficiency using RT-qPCR; D: Dose and time curves of DNAzyme cleavage of RNA in vitro.

[0022] FIG. 3: A. Survival of electroporated zebrafish embryos to show non toxicity of DNAzymes; B. DNAzyme uptake into electroporated zebrafish embryos and their stability in vivo.

[0023] FIG. 4: A. Fmr1 mRNA level in DNAzyme treated zebrafish embryos; B. FMRP protein level in DNAzyme treated zebrafish embryos; C. Structural phenotypes observed in DNAzyme treated zebrafish embryos, resembling human FXS phenotypes; D. Behavioral phenotypes observed in DNAzyme treated 7 dpf larvae; E. mGluR5 protein levels in DNAzyme treated zebrafish.

[0024] FIG. 5: DNAzymes that cleave the gcdh mRNA identified on the basis of an in-vitro cleavage assay. A. Sequence corresponding to a fragment of the gcdh mRNA, highlighting the target sites for the selected DNAzymes. B. Transcript corresponding to GCDH_test RNA was synthesized in vitro, and incubated with various DNAzymes to measure in vitro cleavage activity. The uncut and cut fragments are indicated. C-D: The amount of gcdh mRNA was quantified by RT-PCR from control and DNAzyme treated embryos at 24, 48 and 72 hpf. The numbers under each lane indicate the fraction of gcdh mRNA remaining at that time point.

[0025] FIG. 6: DNAzymes that cleave the gba1 mRNA identified on the basis of an in-vitro cleavage assay. A. Sequence corresponding to a fragment of the gba1 mRNA, highlighting the target sites for the selected DNAzymes. B. Transcript corresponding to a fragment of gba1 mRNA was synthesized in vitro, and incubated with various DNAzymes to measure in vitro cleavage activity. The uncut and cut fragments are indicated.

DESCRIPTION OF THE INVENTION

[0026] The present invention provides catalytic DNAs (DNAzymes) to knock down the expression of specific genes(s) in the zebrafish embryo, mimicking a natural genetic mutation or deletion found in a disease to create the zebrafish model of that disease (strategy outlined in FIG. 1). Such a model can be used as an inexpensive initial screen to identify drug candidates for repurposing.

[0027] A catalytic DNA/DNAzyme is an oligonucleotide that has a catalytic core capable of cleaving a (RNA) phosphodiester bond, flanked by two arms that are complementary to the target RNA of interest. This oligonucleotide on its own is able to cleave the complementary RNA in vitro as well as in vivo. Thus in the present invention, a catalytic DNA is used to knock down the level of an mRNA in a zebrafish embryo, to mimic the diseased state caused due to the loss of function of the corresponding protein.

[0028] Therefore in one aspect the present invention provides a specific DNAzyme for reducing the expression of target gene in zebrafish embryos, comprising the following sequence between nucleotide positions 8/9-22/23:

TABLE-US-00001 SEQIDNO.1: GGCTAGCTACAACGA

[0029] This DNAzyme at positions 1-8 and 22-31 consists of sequences complimentary to any target mRNA. It also has a 3 inverted dT or other such modifications such as PEG at the 3 end. A nucleotide, peptide or chemical linker, or fluorescent tag may be attached to the 3 or 5 end of the afore-mentioned DNAzyme.

[0030] A person skilled in the art will appreciate that the invention provides a method to reduce the expression level of any target mRNA using a specific DNAzyme with the core described in SEQ ID NO. 1, in zebrafish embryos.

[0031] More particularly, the present invention provides a DNAzyme mediated knockdown of the zebrafish Fmr1 mRNA of Genbank Accession number NM_152963 comprising a structure selected from the group consisting of:

TABLE-US-00002 SEQIDNO.2cdFMRA1: CTATTTCAGGCTAGCTACAACGAGCAGCGGT SEQIDNO.3cdFMRA2: GCTTTCTAGGCTAGCTACAACGATTCACGCA SEQIDNO.4cdFMRB1: GCCAGTAAGGCTAGCTACAACGATTAATACA SEQIDNO.5cdFMRB2: GTCCATGAGGCTAGCTACAACGAGCCAGTAA SEQIDNO.6cdFMRB3: CTCGTCCAGGCTAGCTACAACGAGACGCCAG SEQIDNO.7cdFMRB6: TCCTCGCAGGCTAGCTACAACGATTCCACC SEQIDNO.8cdFMRB7: AAGCTCCAGGCTAGCTACAACGATCGCTCC SEQIDNO.9cdFMRC3: TGACAGTAGGCTAGCTACAACGATCTCATG SEQIDNO.10cdFMRC4: AAAGGCCAGGCTAGCTACAACGATGTGACA SEQIDNO.11cdFMRD2: TCTGAAAAGGCTAGCTACAACGACGGTTGG SEQIDNO.12cdFMRE1: CCACTTCAGGCTAGCTACAACGACGCTCTC

[0032] The DNAzyme targets a sequence that is part of the Fmr1 mRNA sequence Genbank Accession number NM_152963. In another embodiment, the present invention also provides a method of reducing Fmr1 expression in a target cell comprising administering one or more DNAzymes.

[0033] In yet another embodiment, the present invention provides a strategy for DNAzyme mediated knockdown of the zebrafish gcdh mRNA Ensmbl Gene ID ENSDARG00000109610 comprising a structure selected from the group consisting of:

TABLE-US-00003 SEQIDNO.13cdgcd1: GTGAGTTCAGGCTAGCTACAACGACAGCAGAC SEQIDNO.14cdgcd2: TTTGTCATAGGCTAGCTACAACGAGCAGCAG SEQIDNO.15cdgcd3: ATCTCCCGAGGCTAGCTACAACGAGGAAATGT SEQIDNO.16cdgcd4: CGCTGTCGAGGCTAGCTACAACGACCTCTCCA SEQIDNO.17cdgcd5: GATCATGAGGCTAGCTACAACGACTCCTCCT SEQIDNO.18cdgcd6: CGTACGCCAGGCTAGCTACAACGAATAACTA SEQIDNO.19cdgcd7: GGCATTGAAGGCTAGCTACAACGAGGGGTGCA

[0034] The present invention also provides a strategy for DNAzyme mediated knockdown of the zebrafish gba1 mRNA of Ensmbl gene ID ENSDARG00000076058 comprising a structure selected from the group consisting of:

TABLE-US-00004 SEQIDNO.20cdGb1: CCGTCTTTAGGCTAGCTACAACGATGTCAGCT SEQIDNO.21cdGb2: GAGCCATGAGGCTAGCTACAACGACGAAATTC SEQIDNO.22cdGb3: TATGTCGCAGGCTAGCTACAACGATGCACACA SEQIDNO.23cdGb4: TATTGCTGAGGCTAGCTACAACGAATATGATA SEQIDNO.24cdGb5: TCAGAGTGAGGCTAGCTACAACGATCTGAGAG SEQIDNO.25cdGb6: GTGCTGGAAGGCTAGCTACAACGATTCTGACT

[0035] The present invention also provides a method of creating a model of Fragile X syndrome and other diseases further exemplified by Gaucher's disease and Glutaric Aciduria Type I in Zebrafish embryos comprising delivering the afore-mentioned DNAzyme(s) into the Zebrafish embryo between 0 hpf (hours post fertilization) to 7 dpf (days post fertilization) to create the knockdown. The DNAzyme is delivered into the Zebrafish embryo by microinjection or electroporation among other methods. A transient reduction in the expression of the target gene is created by introducing sufficient DNAzyme into hundreds of embryos at a time, in order to achieve a significant knockdown without otherwise perturbing the development and maturation of the embryo. As an example, a model for Fragile X syndrome is created using DNAzyme mediated knockdown of Fmr1 mRNA. This leads to the reduction in the protein level of FMR protein (FMRP) and increase in level of mGluR5 protein, characteristic of FXS. The FXS fish display all the molecular and behavioral phenotypes characteristic of FXS patients, and show rescue with drugs prescribed to FXS patients, thus validating the model. It will be appreciated by a person skilled in the art that such a method of creating a model using Zebrafish embryo can be extended to any disease condition not limited by this disclosure.

[0036] Thus this platform technology can be extended to make models in zebrafish for a number of monogenetic disorders, pediatric and rare diseases. Data supporting this claim, has been established herein by using the examples of GA1 and Gaucher's disease models.

Advantages of the Invention

[0037] As provided in the present invention, the DNAzyme based models create a transient knockdown of the target mRNA, using a simple oligonucleotide alone, without dependence on any other reagents or the cellular machinery. Therefore, the knockdown is reproducible and robust, and the methodology is quick and inexpensive as compared to the other existing methods. Since the DNAzyme targets the mRNA, there is a direct and immediate effect on the protein level in the embryo, after DNAzyme treatment. However, because of the transient nature of the knockdown, the phenotypes can only be studied in the embryonic and early larval stages (0-7 dpf), which is the window of interest for the study of monogenic rare disease models, and this window is very accessible for study and manipulation in zebrafish.

[0038] The present invention provides a robust, inexpensive, quick, high-throughput and simple-to-create models of certain genetic diseases using a DNAzyme based knockdown strategy in Zebrafish. The platform technology can be used to create disease models in Zebrafish, for any disease where a monogenic loss of functionality is the underlying cause. Such a model can be used as an inexpensive initial screen to identify drug candidates for repurposing. The motivation behind the creation of this platform is the unavailability and unaffordability of models, specifically for rare diseases, which was an impediment for drug discovery efforts.

Examples

[0039] 1. Several Catalytic DNA Sequences Cleave FMR1 Test RNA Efficiently In Vitro:

[0040] DNA sequence was cloned corresponding to the first 400 nucleotides of the FMR1 mRNA under a T7 promoter in the plasmid pUC57. Using this template, the inventors synthesized the FMR1_400 test RNA by in vitro transcription using the T7 RNA polymerase. Several designed DNAzymes were used in an in vitro cleavage assay using the FMR1_400 test RNA to identify the candidates with the best efficiency. Several DNAzymes such as B3, B2, A2, C3 and B7 were able to cleave the FMR1_400 test RNA efficiently in vitro (FIG. 2). B3 was able to cleave >80% of the full length RNA, within the first five minutes of incubation and was able to do so even at a 1:1 molar ratio (FIG. 2D).

[0041] 2. Several Catalytic DNA Sequences Cleave GCDH Test RNA Efficiently In Vitro:

[0042] DNA sequence corresponding to the first 553 nucleotides of the gcdh mRNA (isoform a) was obtained by reverse transcription-PCR (RT-PCR) from zebrafish total RNA using the primers

TABLE-US-00005 (Fwd) SEQIDNO.26 GTAATACGACTCACTATAGGGAACAGCTTTGTCTCGTCTG (rev) SEQIDNO.27 TCCGTGGTTTGGTTCTGTTAG

[0043] A test RNA fragment (GCDH_test RNA) was obtained from this DNA by in vitro transcription using T7 RNA polymerase, and was used as a substrate to test in vitro cleavage activity of the DNAzymes.

[0044] Using an in-silico design approach, the inventors designed seven DNAzyme sequences that target the Zebrafish gcdh mRNA. Target sites were chosen based on the secondary structure of the RNA fragment (as predicted by RNAfold), at regions which were accessible such as part of a bulge, loop or single stranded region (FIG. 5 A). Several designed DNAzymes were used in an in vitro cleavage assay using the GCDH_500 test RNA to identify the candidates with the best efficiency. Several DNAzymes such as Gcd 2, 3, 5 and 6 GCDH_test RNA efficiently in vitro (FIG. 5B). DNAzyme sequences used in the in vitro catalytic activity assay are provided as SEQ ID NO. 13-17 (internal identifiers: gcd1 to gcd7).

[0045] 3. Several Catalytic DNA Sequences Cleave Gba1 Test RNA Efficiently In Vitro:

[0046] DNA sequence was cloned corresponding to the first 500 nucleotides of the gba1 mRNA under a T7 promoter in the plasmid pUC57. Using this template, the inventors synthesized the Gba1_500 test RNA by in vitro transcription using the T7 RNA polymerase.

[0047] Using an in-silico design approach, the inventors designed six DNAzyme sequences that target the Zebrafish gba1mRNA. Target sites were chosen based on the secondary structure of the RNA fragment (as predicted by RNAfold), at regions which were accessible such as part of a bulge, loop or single stranded region (FIG. 6A). Several designed DNAzymes were used in an in vitro cleavage assay using the Gba1_500 test RNA to identify the candidates with the best efficiency. Several DNAzymes such as Gb3, Gb4 and Gb6 were able to cleave the Gba1_500 test RNA efficiently in vitro (FIG. 6B).

[0048] DNAzyme sequences used in the in vitro catalytic activity assay are provided as SEQ ID NO. 18-23 (internal identifiers: gb1 to gb6).

[0049] 4. DNAzymes is Introduced into Zebrafish Embryos by Electroporation:

[0050] Electroporation was used to efficiently deliver DNAzymes into 0-1 hpf zebrafish embryos. During electroporation, various conditions such as voltage (25-200V), pulse number (2-16), duration (100-200 sec), DNAzyme concentration (0.1-0.5 g/l) and embryo density (25-100 embryos/400p1) were varied to arrive at the optimal set of parameters (50V, 200 sec, 16 pulses, 0.2 g/l DNAzyme, 100 embryos/400 l) which led to maximal survival of the embryos (FIG. 3A). The amount of catDNA present in the embryo at 24 and 48 hours post treatment was quantified by PCR analysis and found to be comparable to the standard technique of microinjection, with over 80% of input oligonucleotide being delivered into the embryo (FIG. 3B).

[0051] 5. DNAzymes Result in Significant Knockdown of FMR1 mRNA:

[0052] DNAzymes B3, B7 etc. cleave the FMR1_400 test RNA efficiently in vitro, and is expected to do the same with the FMR1 mRNA in vivo. In order to test this, FMR1 mRNA level was measured by using semi-quantitative RT-PCR assay, from DNAzyme treated and control embryos (which were treated with an oligo that has a scrambled sequence), at various timepoints. Briefly different sets of zebrafish embryos were electroporated in the presence of DNAzyme B3/B7 at the 1-2 cell stage. At 24 hrs, 48 hrs or 72 hours post treatment, embryos were collected, pooled in batches of 5 and total RNA was extracted by standard methods. From this RNA, the level of FMR1 mRNA was measured and quantified and found to be significantly reduced in the DNAzyme treated embryos relative to control. The FMR1 level was normalized to an internal control (act1 mRNA) and is presented as a chart, in treated embryos relative to control (FIG. 4A).

[0053] 6. DNAzymes Result in Significant Knockdown of Gcdh mRNA:

[0054] DNAzymes Gcd2,3 and 5 cleave the GCDH_test RNA efficiently in vitro, and are expected to do the same with the gcdh mRNA in vivo. In order to test this, DNAzymes were introduced by electroporation as described previously for the FMR1 DNAzymes. Subsequently, gcdh mRNA level was measured by using semi-quantitative RT-PCR assay, from DNAzyme treated and control embryos at various timepoints. Briefly different sets of zebrafish embryos were electroporated in the presence of DNAzyme oligo at the 1-2 cell stage. At 24 hrs, 48 hrs or 72 hours post treatment, embryos were collected, pooled in batches of 50 and total RNA was extracted by standard methods. From this RNA, the level of gcdh mRNA was measured by RT-PCR, electrophoresed on native PAGE and quantified using ImageJ. The gcdhmRNA level was normalized to an internal control (act1 mRNA) for each sample, and then normalized to control embryos. The fraction of gcdh mRNA remaining, in treated embryos relative to control, is indicated below the corresponding lane in FIG. 5C, D. The level of gcdh mRNA was found to be significantly reduced in the DNAzyme treated embryos relative to control, for both gcd3 and gcd5 at 24 hpf, and for as long as 72 hpf in the case of gcd5.

[0055] 7. DNAzymes Result in Significant Knockdown of FMR Protein and the Consequent Molecular and Behavioral Phenotypes:

[0056] Similarly, FMRP levels were measured in untreated and treated embryos by using whole-embryo Western analysis. A similar experimental protocol was followed for DNAzyme treatment, embryos were collected at various time points post treatment, pooled in batches of 5, and total protein was extracted. FMRP level was measured by standard SDS-PAGE followed by Western Blotting using a zebrafish FMRP antibody (FIG. 4B), and found to be significantly reduced. Anatomical phenotypes such as craniofacial elongation, bent notochord and tail deformities were observed in the DNAzyme treated zebrafish at the 48-72 hpf stages (FIG. 4C).

[0057] Behavioral assays were carried out at the 7 dpf stage to measure anxiety (open-field test), fear cognition (red-bar test) and irritability (circling behavior). VPA, an agent known to induce symptoms of Autism spectrum disorders in mice models (Wagner et al. 2006), was used as a positive control in these assays. The DNAzyme treated FXS fish show increased anxiety, decreased fear cognition and increased irritability (like VPA) compared to control zebrafish larvae (FIG. 4D).

[0058] In the DNAzyme model of FXS, the knock down of FMRP using DNAzyme technology, results in lasting changes in downstream targets (mGluR5) and is presented in the Western blot shown in FIG. 4E. This indicates that the behavioral phenotypes observed in these DNAzyme treated larvae at 7 dpf are due to the DNAzyme mediated FMRP knockdown and the consequent increase in mGluR5 among other changes.