METHOD FOR DETERMINATION OF CELLULAR MRNA
20210017585 ยท 2021-01-21
Inventors
Cpc classification
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
B01L2400/086
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/0487
PERFORMING OPERATIONS; TRANSPORTING
C12Q2523/303
CHEMISTRY; METALLURGY
C12Q2523/303
CHEMISTRY; METALLURGY
C12Q2563/155
CHEMISTRY; METALLURGY
B01L2200/0668
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0864
PERFORMING OPERATIONS; TRANSPORTING
C12Q2563/155
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
B01L2300/0816
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502761
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502746
PERFORMING OPERATIONS; TRANSPORTING
International classification
Abstract
Methods and systems for mRNA analysis and quantification of mRNA expression in cells are provided. An example method includes introducing a first capture probe and a second capture probe into the cells, the first capture probe and the second capture probe each configured to be complementary to a respective section of target mRNA within the cells, wherein binding of the first and second capture probes to the respective sections of the target mRNA results in tagging of the cells and causes the first and second capture probes to form clusters with each other. The first capture probe and the second capture probe are each bound to magnetic nanoparticles (MNPs) that, when trapped within the tagged cells, cause the tagged cells to be susceptible to magnetic forces. The method and system further include introducing the cells into a device configured to magnetically capture tagged cells.
Claims
1. A method for mRNA analysis in cells, the method comprising: introducing a first capture probe and a second capture probe into the cells, the first capture probe and the second capture probe each configured to be complementary to a respective section of target mRNA within the cells, wherein binding of the first and second capture probes to the respective sections of the target mRNA results in tagging of the cells and causes the first and second capture probes to form clusters with each other; wherein the first capture probe and the second capture probe are each bound to magnetic nanoparticles (MNPs) that, when trapped within the tagged cells, cause the tagged cells to be susceptible to magnetic forces; and introducing the cells into a device configured to magnetically capture tagged cells.
2. The method of claim 1 wherein the target mRNA is at least one of survivin, TMPRSS2/ERG, AR, AR-V7, PD1, PDL1, and PARP mRNA.
3. The method of claim 1 wherein the first capture probe has a first sequence and the second capture probe has a second sequence, and wherein: the first sequence of the first capture probe is 5 CAG TTC TTG AAT GTA GAG AT 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 GCA GGC GCA GCC CTC CAA GA 3; the first sequence of the first capture probe is 5 GAT AAG GCT TCC TGC CGC GC 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 CAA CGA CTG GTC CTC ACT CA 3; the first sequence of the first capture probe is 5 TGC TTT CAT GCA CAG GAA TT 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 CTG GAA TAA TGC TGA AGA GT 3; or the first sequence of the first capture probe is 5 CTG ATG AAG AGA AGC ATG TG 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 TGG GAG AAG AAT GAG AGG CT 3.
4. The method of claim 1 wherein the cells are cancer cells.
5. The method of claim 4 wherein the cancer cells are prostate cancer cells.
6. The method of claim 1 wherein the device is a microfluidic device.
7. A system for analyzing mRNA in cells comprising: a first capture probe and a second capture probe, the first capture probe and the second capture probe each configured to be complementary to a respective section of target mRNA within the cells, wherein binding of the first and second capture probes to the respective sections of the target mRNA results in tagging of the cells and causes the first and second capture probes to form clusters with each other; wherein the first capture probe and the second capture probe are each bound to magnetic nanoparticles (MNPs) that, when trapped within the tagged cells, cause the tagged cells to be susceptible to magnetic forces; and a device configured to magnetically capture tagged cells.
8. The system of claim 7 wherein the device is a microfluidic device.
9. The system of claim 8 wherein the microfluidic device further comprises a plurality of sorting portions defined in the microfluidic device, each sorting portion including a respective plurality of flow rate-reducing structures, wherein each sorting portion promotes capture of respective different cells exhibiting respective different amounts of susceptibility to magnetic attraction force.
10. The system of claim 9 wherein the microfluidic device comprises at least six sorting portions.
11. The system of claim 7 wherein the target mRNA is at least one of survivin, TMPRSS2/ERG, AR, AR-V7, PD1, PDL1, and PARP mRNA.
12. The system of claim 7 wherein the first capture probe has a first sequence and the second capture probe has a second sequence, and wherein: the first sequence of the first capture probe is 5 CAG TTC TTG AAT GTA GAG AT 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 GCA GGC GCA GCC CTC CAA GA 3; the first sequence of the first capture probe is 5 GAT AAG GCT TCC TGC CGC GC 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 CAA CGA CTG GTC CTC ACT CA 3; the first sequence of the first capture probe is 5 TGC TTT CAT GCA CAG GAA TT 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 CTG GAA TAA TGC TGA AGA GT 3; or the first sequence of the first capture probe is 5 CTG ATG AAG AGA AGC ATG TG 3-Biotin-(TEG) and the second sequence of the second capture probe is Biotin-(TEG) -5 TGG GAG AAG AAT GAG AGG CT 3.
13. The system of claim 7 wherein the cells are cancer cells.
14. The system of claim 13 wherein the cancer cells are prostate cancer cells.
15. A method for quantifying expression of target mRNA in cells of a sample, the method comprising: determining an mRNA capture fraction of cells expressing the target mRNA in the sample; and calculating an expression index (EI) for expression of the target mRNA in the sample by dividing the mRNA capture fraction by an average zone parameter, the average zone parameter representing a zone in which cells having an average expression of the target mRNA is captured by a multi-zoned capture device; wherein determining the mRNA capture fraction includes: magnetically capturing cells that have been tagged with a targeted capture probe bound to a magnetic nanoparticle (MNP), the capture probe being configured to be complementary to a section of the target mRNA.
16. The method of claim 15, wherein determining the mRNA capture fraction further comprises: determining a number of cells (N.sub.CP) captured in the sample using the targeted capture probe; determining a number of cells (N.sub.NSP) captured in the sample by a nonspecific probe; determining a total number of cells (N.sub.Ab) in the sample; and wherein the mRNA capture fraction is defined by an equation: mRNA capture fraction=(N.sub.CPN.sub.NSP)/N.sub.Ab.
17. The method of claim 16, wherein determining N.sub.Ab comprises determining a number of cells captured in the sample by anti-EpCAM.
18. The method of claim 16 further wherein calculating EI comprises calculating an equation:
EI=(mRNA capture fraction)/Zone.sub.Ave*10 wherein Zone.sub.Ave is an index of an average capture zone in which cells having an average expression of the target mRNA are captured by the capture device.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Reference will now be made, by way of example, to the accompanying drawings which show example embodiments of the present application, and in which:
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051] Similar reference numerals may have been used in different figures to denote similar components.
DESCRIPTION OF EXAMPLE EMBODIMENTS
[0052] Cell-to-cell variation in gene expression creates a need for techniques that characterize expression at the level of individual cells. This is particularly true for rare circulating tumor cells (CTCs), in which subtyping and drug resistance are of particular interest. In blood, these heterogeneous cells are outnumbered one-billion-fold by normal cells. As a step towards this end, the present disclosure provides examples of an amplification-free molecular approach for mRNA analysis in cancer cells.
[0053] Reference is first made to
[0054] Cells 4 are permeabilized to deliver probes with attached magnetic nanoparticles 3. In the presence of the target mRNA, the probes 14, 15 form clusters 2 which are too large to exit the cell 4. The probes 14, 15 are thus trapped within the cells 4 when clustering 2 occurs in the presence of the target mRNA. This traps the MNPs 3 of the probes 14, 15 within the cells 4, which increases the magnetic susceptibility of the cells 4. A microfluidic device 6 (discussed further below) may then be used to magnetically capture the tagged cells 4. Although a microfluidic device 6 is described as an example for magnetically capturing the tagged cells 4, it should be understood that any suitable device (e.g., using a microfluidic approach or non-microfluidic approach) may be used for magnetic capture of the tagged cells 4. For example, simply applying an appropriate magnetic force to attract the tagged cells 4 (e.g., by placing a simple magnet against the side of a container containing the tagged cells 4) and then washing away non-attracted particles may be sufficient.
[0055] In an embodiment, clustering 2 occurs when target mRNA is present. Dual Probe-mRNA hybridization 16 triggers the aggregation of MNPs to form clusters 2 that become trapped within the cells 4, as shown schematically in
[0056] In one example, in the absence of the target mRNA, no clusters 2 are formed and the probes can exit the cells 4. In this example, even when some unclustered probes 14, 15 remain in the cell 4, they cause only a small increase in the magnetic susceptibility (compared to magnetic clusters 2). Thus, non-target cells 4 do not exhibit enhanced magnetic susceptibility and are not magnetically captured when introduced to the microfluidic device 6.
[0057] In the example illustrated, cells 4 are fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.3% Triton X-100 (TX-100). The cells 4 are incubated with two magnetic nanoparticles (MNPs)-tagged DNA probes 14 and 15 complementary to different sections of the target mRNA. Other methods for introducing the probes 14 and 15 into the cells 4 may also be suitable.
[0058] The tagged cells 4 are loaded into a microfluidic device 6 with a flow inlet 18 for receiving a sample, as shown in
[0059] An example of the microfluidic device 6 is further described in United States patent application publication no. 2016/0061811, which is hereby incorporated by reference.
[0060] Generally, cell capture occurs when the magnetic force acting on the cell counterbalances the drag force caused by the flow. The magnetic force acting on cells tagged with magnetic nano-beads can be calculated according to the following formula:
[0061] Where N.sub.b is the number of beads per cell, V.sub.m is the bead volume, X.sub.bead [unitless] represents the difference between the magnetic susceptibility of the bead and the medium, po [H/m] is the permeability of free space (4n10.sup.7 H/m), and B [T] is the applied magnetic field. In some examples described below, magnetic beads with diameter of 100 nm were used.
[0062] Stokes' law can be used to determine the transverse drag force acting on a cell, neglecting wall effects at low Reynolds numbers, according to the following formula:
{right arrow over (F)}.sub.d=6 {right arrow over ()}
[0063] Where r [m] is the cell radius (10 m), [Pas] is the dynamic viscosity of the medium (0.001 Pas), and v [m/s] is the velocity of the cell.
[0064]
[0065] In one example, the first zone Z1 (that is, the zone Z1 closest to the inlet) may be designed to have a relatively high linear velocity that would only retain particles (e.g., cells) with relatively high susceptibility to attractive forces (in this case, a high magnetic content, meaning, a high number of trapped probes within the cell). The following zones Z2-Z6 may be designed to have velocities that decreased stepwise, for example, by the factors described above. That is, the first zone Z1 closest to inlet 18 has a relatively high average linear velocity of about 500 m/s (indicated as 1), the second zone Z2 has an average linear velocity that is 0.47 of that in the first zone Z1, the third zone Z3 has an average linear velocity that is 0.31x of that in the first zone Z1, the fourth zone Z4 has an average linear velocity that is 0.23 of that in the first zone Z1, the fifth zone Z5 has an average linear velocity that is 0.18 of that in the first zone Z1, and the sixth zone Z6 has an average linear velocity that is 0.15 of that in the first zone Z1.
[0066] The average linear velocity of about 500 pm/s in the first zone Z1 is provided as an example, and higher or lower linear velocities may be selected based on the sample being analyzed, for example. The stepwise decrease of linear velocity is provided as an example, and other changes to linear velocity across the zones including increase or decrease by other factors, may be suitable. Generally, the microfluidic device 6 may be designed such that the average linear velocities decrease from the inlet 18 to the outlet 20.
[0067] With further reference to
[0068] Magnetic and flow field simulations may be used to determine the positions in which cells with variable levels of magnetic content are expected to be captured. The simulations were carried out using COMSOL Multiphysics software (Comsol Inc., US) in order to compare the magnitude of the magnetic force at each zone within the device with the drag force opposing cell capture.
[0069] In order to quantify the capture probability of cells, it may be assumed that cells would be captured when they flow within the capture radius along the device 6, whereas cells flowing away from the capture radius will continue their journey along the device. The percentage of the cells that traversed the device within a given radial distance from the centre of an X-structure may then be determined. Additional flow simulations were carried out using a series of concentric control surfaces for various radial positions from the centre of the X-structures. The positive volume flux crossing the capture zone was determined by integrating the dot product of the velocity vector at the surface with the surface unit normal vector over the capture zone area. The amount of fluid changeover at a given radial position from the center of an X-structure was calculated. The positive volume flux crossing the capture zone of cells having different levels of magnetic content (numbers of magnetic nanoparticles=10.sup.5, 10.sup.4, 10.sup.3, 10.sup.2, and 10) at different zones were calculated to determine the capture probability of cells within the device.
[0070] It is evident from
[0071]
[0072] The linear velocity distribution within the first zone, in an example of the 6-zone microfluidic device 6, is shown in
[0073]
[0074] An example method for fabrication of a microfluidic device is now discussed. The example microfluidic device 6 was fabricated using Poly(dimethoxysilane) (PDMS, Dow Chemical, US) soft-lithography. Masters were fabricated on silicon substrates and patterned in SU-8 3050 (Microchem, US). PDMS replicas were poured on masters and baked at 67 C. for 45 min. After peeling the replicas, holes were pierced to connect the tubing. PDMS replicas were attached to no. 1 glass cover slips using a 30 second plasma treatment and left to bond overnight. This step allows for enhancing the bonding and making it irreversible by oxidizing both the replica and the cover in plasma discharge. Afterward, the silicon tubing was attached to the inlet 18 and outlet 20 of the device. Prior to use, devices were conditioned with 1% Pluronic F68 (Sigma-Aldrich, US) in phosphate-buffered saline (PBS) for 1 h, to reduce the nonspecific adsorption. Each device was sandwiched between two arrays of N52 Nd FeB magnets (K&J Magnetics, US, 1.5 mm by 8 mm) with alternating polarity. A syringe pump (Chemyx, US) was used for the duration of the cell capture process. Other methods for fabricating the microfluidic device may be suitable, for example as discussed in United States patent application publication no. 2016/0061811.
[0075] An example method for cell culture is now discussed. VCaP cells (ATCC CRL-2876) were cultured in Dulbecco's Modified Eagle's Medium (DMEM, ATCC 30-2002). PC3 cells were cultured in F-12K Medium (ATCC 30-2004). LNCaP cells were cultured in RPMI-1640 medium (ATCC 30-2001). All media were supplemented with 10% FBS and 1% penicillin-streptomycin and cells were cultured at 37 C. and 5% CO.sub.2 in T75 flasks. Cells were harvested when they reached more than 70-80% confluence. Cell detachment from the culture dishes was performed using 1 mL of 0.25% (w/v) Trypsin-0.53 mM EDTA solution for 3 min at 37 C. The cells were then filtered using a 40 m BD falcon cell strainer (Becton, Dickinson and Company, US).
[0076] An example method for preparation of the magnetic nanoparticles-labeled capture probes is now discussed. Briefly, 100 L of 20 M of the antisense oligonucleotide solution in Dulbecco's phosphate-buffered saline (DPBS, Sigma-Aldrich, US) were heated for 5 min at 60 C. for deaggregation.
[0077] Afterward, the solution was transferred to a microtitre plate and incubated with 1.5 L of 10 mg mL.sup.1 streptavidin-coated magnetic nanoparticles (100 nm, Chemicell, US) for 30 min at room temperature. Subsequently, the magnetic nanoparticles-labeled capture probes (MNPs-CPs) were pelleted using a magnetic-ring stand (Thermofisher Scientific, US) and washed three times with DPBS solution.
[0078] An example method for cellular mRNA analysis is now discussed. Prostate cancer cell lines (200 cells in 100 L DPBS) were fixed with 100 L of 8% paraformaldehyde (PFA, Sigma-Aldrich, US) solution in DPBS containing 1 mM dithiothreitol (DTT, Sigma-Aldrich, US) for 15 min at 37 C. After centrifugation and discarding the supernatant, 100 L of 0.3% Triton X-100 (TX-100, Sigma-Aldrich, US) in DPBS/DTT were added and the suspension was incubated for 10 min at room temperature. Then, 100 L of MNPs-labeled CP1 14 and MNPs-labeled CP2 15 in DPBS/DTT (prepared in the previous step) were added and the suspension was gently shaken for 3 h at room temperature.
[0079] To account for the cells captured as a result of non-specifically internalized MNPs, cells from a second sample of the same size were captured within another fluidic device using two MNPs-tagged nonspecific DNA probes. A control experiment was carried out in which the cells were gently shaken with the MNPs-labeled nonspecific dual probe (NSP) for 3 h at room temp, subsequent to cell fixation and permeabilization.
[0080] To account for the total number of cells analyzed, cells from a third sample of similar size were captured within another device by targeting a specific extracellular marker. The epithelial cell adhesion molecule (EpCAM) was selected as a surface marker commonly expressed in CTCs and subsequently captured using MNPs-tagged anti-EpCAM. Another control experiment was carried out in which the cells were gently shaken with MNPs-anti-EpCAM for 3 h at room temperature. Finally, the cells were loaded into the microfluidic device 6 at a flow rate of 600 L h.sup.1.
[0081] The captured cancer cell subpopulations were then immunostained with antibodies specific to EpCAM and cytokeratin (CK) to identify epithelial cells in blood, and to CD45 to differentiate between WBCs and cancer cells. The cells were also stained with 4,6-diamidino-2-phenylindole (DAPI) to identify nucleated cells. Only EpCAM.sup.+/CK.sup.+/DAPI.sup.+/CD45.sup. are counted as cancer cells.
[0082] The mRNA capture fraction is calculated from the following formula:
[0083] mRNA capture fraction=(N.sub.CPN.sub.NSP)/N.sub.Ab
[0084] N.sub.CP denotes the number of cancer cells captured using the capture probe, NNSP represents the number of cells captured by the nonspecific probe, and N.sub.Ab is the total number of cells in the sample captured by anti-EpCAM. The percentage of cells captured in each zone is multiplied by the mRNA capture fraction to demonstrate the distribution of cell populations bearing different mRNA expression levels and generate a normal distribution fit from which the average capture zone (Zone.sub.Ave) is determined.
[0085] A unique mRNA expression index (EI.sub.mRNA) can then be calculated from the following formula:
EI.sub.mRNA=(mRNA capture fraction)/Zone.sub.Ave*10
[0086] If the EI.sub.mRNA metric is low then there is a corresponding low quantity of the target mRNA present in the cell. Conversely if the metric is high then there is a corresponding large quantity of the target mRNA present in the cell.
[0087] An example method for cell staining and imaging is now discussed. Captured cells were counted using fluorescence microscopy. Prior to staining, captured cells were fixed inside the fluidic device using 100 L of 4% PFA in DPBS/DTT followed by 100 L of 0.2% TX-100 in DPBS/DTT for permeabilization. Captured cells were immunostained with a mixture of 3% allophycocyanin-labeled anti-cytokeratin antibody (APC-CK, GTX80205, Genetex, US), 3% APC-labeled anti-EpCAM antibody (APC-EpCAM, Miltenyi Biotec Inc., US), and 3% alexafluor 488-labeled anti-CD45 antibody (AF488-CD45, MHCD4520, Invitrogen, US) in 100 L PBS containing 1% bovine serum albumin (BSA, Sigma-Aldrich, US) and 0.1% Tween-20 (Sigma-Aldrich, US). Immunostaining was carried out for 60 min at a flow rate of 100 L h.sup.1. After washing with 0.1% Tween-20 in PBS, the cells were stained with 1 drop of 4,6-diamidino-2-phenylindole (DAPI Prolong Gold nuclear stain, Invitrogen, US) in 100 L PBS for 10 min at a flow rate of 600 L h.sup.1. After staining, the cells were washed with 0.1% Tween-20 in PBS, and stored at 4 C. Finally, chips were scanned using a Nikon Ti-E Eclipse microscope with an automated stage controller and a CMOS Camera (Andor Neo). The blue channel was used for DAPI staining, with a typical exposure time of 10-20 ms. The green channel was used for the AF488-CD45 staining, with a typical exposure time of 40-60 ms. The red channel was used for the APC-CK and APC-EpCAM staining, with a typical exposure time of 200-300 ms. The exposure time was set individually for each chip and kept constant in the course of scanning. The imaging was qualitative in nature and hence the variation of exposure time between chips did not affect the results. Cells were counted by overlaying the bright field, red, blue, and green fluorescent images.
[0088] An example method for performing transmission electron microscopy (TEM) is now discussed. PC3 cells (10 000 cells in 100 L) were fixed with 100 L of 8% PFA in DPBS/DTT for 15 min at 37 C. After centrifugation, 200 L of 0.3% TX-100 in DPBS/DTT were added and the suspension was incubated for 10 min at room temperature. The cells were gently shaken with either MNPs-labeled CP1-survivin or MNPs-labeled survivin-CP2 or a combination of MNPs-labeled CP1-survivin and MNPs-labeled survivin-CP2 in DPBS/DTT for 3 h at room temperature. The cells were centrifuged for 5 min at 8000 r.p.m. and the supernatant was discarded. The cells were fixed with a solution of 4% PFA and 1% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) for 1 h at room temperature. After washing three times with the same buffer, the cells were post-stained with 1% osmium tetroxide in 0.1 M phosphate buffer (pH 7.2) for 1 h at room temperature. After washing two times with the same buffer, the cells were dehydrated with 25% ethanol (2 changes in 15 min), 50% ethanol (2 changes in 20 min), 70% ethanol (2 changes in 30 min), 90% ethanol (2 changes in 45 min), and 100% ethanol (3 changes in 60 min). The cells were gently shaken with a mixture of EPON resin and 100% ethanol (1:2) for 2 h, then (2:1) for 3 h, and finally with 100% EPON resin overnight at room temperature. The next day, the resin was removed and the cells were gently shaken with fresh EPON resin for 2 h at room temp then the resin was allowed to polymerize in plastic dishes for 48 h at 40 C. The samples were sliced into 70-90 pm sections with an ultracut microtome then loaded onto carbon-coated copper grids and left to dry at room temperature. TEM (Hitachi H-7000) equipped with XR60 CCD camera was used to examine the morphology of the cells and internalized MNPs.
[0089] An example method for performing transfection of PC3 cells is now discussed. Before transfection, PC3 cells (310.sup.4/well) were grown at a 65% to 75% density overnight in a 6-well plate. After 24 h, the cells were washed with DPBS twice and transfected with 50 M LY2181308.sup.14 in 2 mL serum-free F-12K medium containing 40 L lipofectin reagent (Thermofisher Scientific, US) for 6 h at 37 C. A control experiment was carried out in which the cells were incubated with 2 mL serum-free F-12K medium containing 40 L lipofectin reagent. The medium was removed after 6 h and the cells were incubated with F-12K medium containing 10% FBS for 48 h at 37 C.
[0090] An example method for performing reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is now discussed. Total RNA was isolated from cultured cells by Triazol reagent (Invitrogen, US) and used for RT-qPCR as described previouslyl.sup.5. The isolated RNA was used for cDNA synthesis using the first strand DNA synthesis kit (Invitrogen, US), which contained random hexamer primers and Superscript III reverse transcriptase, according to the manufacturer's protocol. A comparative Ct experiment was performed on ViiA.sup.198 7 real-time PCR (Life Technologies, US). The following TaqMan probes were used: TMP/ERG (TMP-ERG_CDU62RE), BIRC5 or survivin (Hs04194392_s1), AR-FL (AR-FL_CDRWEKJ), AR-V7 (Hs04260217_m1), and TBP (Hs99999910_m1) as a housekeeping gene control. The assay was carried out in triplicates using 10 ng cDNA for each sample in a 96-well plate. The 10 L reaction mix included 5 L 2 TaqMan gene expression master mix (Life Technologies, US), 0.5 L of 20 assay, 3.5 L water and 1 L of 10 ng L.sup.1 cDNA. Cycling conditions for the qPCR were 95 C. for 10 min, followed by 40 cycles of 95 C. for 15 s and 60 C. for 1 min.
[0091] An example method for cellular determination of survivin mRNA in blood spiked with prostate cancer cells is now discussed. Fifteen and fifty PC3 cells were spiked into 1 mL of blood, each-at-a-time. The mononuclear cells were isolated using Ficoll method and were subsequently suspended in 250 L of 2% FBS solution in PBS. Anti-CD15 antibody was modified with MNPs by incubating 100 L of 40 g L.sup.1 biotin-tagged anti-CD15 antibody (Abcam, US) in PBS with 6 L of 10 mg mL.sup.1 streptavidin-coated MNPs for 30 min at room temp. The modified MNPs were pelleted using a magnetic-ring stand and washed three times with PBS. The beads were gently shaken with the cell suspension for 30 min at room temp. The captured leukocytes were pelleted using a magnetic separation rack (Thermofisher Scientific, US) and the supernatant was collected for further analysis. The supernatant was incubated with 250 L of 8% PFA in DPBS/DTT for 15 min at 37 C. After centrifugation, the cells were incubated with 100 L of 0.3% TX-100 in DPBS/DTT for 10 min at room temp. The cells were gently shaken with 100 L of DPBS/DTT containing MNPs-labeled CP1-survivin and MNPs-labeled survivin-CP2 in DPBS/DTT for 3 h at room temp. A control experiment was carried out in which the cells were gently shaken with the MNPs-labeled nonspecific dual probe (NSP) for 3 h at room temp, subsequent to cell fixation and permeabilization. Another control experiment was carried out in which the cells were gently shaken with MNPs-anti-EpCAM for 3 h at room temp. The cells were loaded into the 6-zone microfluidic device at a flow rate of 600 L h.sup.1 and subsequently stained with APC-labeled anti-EpCAM, APC-labeled anti-CK antibodies, AF488-labeled anti-CD45 antibody, and DAPI.
[0092] An example method for cellular TMPRSS2/ERG mRNA determination in CRPC patient's blood is now discussed. Metastatic castration-resistant prostate cancer (CRPC) patients were recruited from the Princess Margaret Hospital according to the University of Toronto Research Ethics Board approval protocol. All patients were enrolled subsequent to informed consent. Sixteen milliliters of peripheral blood samples were collected from CRPC patients in CellSearch tubes containing EDTA. All the samples were analyzed within 24 h after collection. A set of patient samples (n=4) were analyzed to determine whether the approach would be suitable for the analysis of CTCs mRNA. Sixteen milliliters of blood were split into four tubes to be further utilized for the determination of Ncp, NNSP, and N.sub.Ab using the microfluidic approach and for RT-qPCR analysis. The mononuclear cells were isolated using Ficoll method and were subsequently suspended in 250 L of 2% FBS solution in PBS. Anti-CD15 MNPs were gently shaken with the cell suspension for 30 min at room temp. The captured leukocytes were pelleted using a magnetic separation rack and the supernatant was collected for further analysis. In the first tube, the supernatant was incubated with 250 L of 8% PFA in DPBS/DTT for 15 min at 37 C. After centrifugation, 100 L of 0.3% TX-100 in DPBS/DTT were added and the suspension was incubated for 10 min at room temp. The cells were gently shaken with 100 L of DPBS/DTT containing MNPs-labeled CP1-TMP/ERG and MNPs-labeled TMP/ERG-CP2 in DPBS/DTT for 3 h at room temp. In the second tube, a control experiment was carried out in which the cells were gently shaken with the MNPs-labeled nonspecific dual probe (NSP) for 3 h at room temp, subsequent to cell fixation and permeabilization. In the third tube, another control experiment was carried out in which the cells were gently shaken with MNPs-anti-EpCAM (without prior fixation or permeabilization) for 3 h at room temp. The cells were loaded into the 6-zone microfluidic device at a flow rate of 600 L h.sup.1 and subsequently stained with APC-labeled anti-EpCAM, APC-labeled anti-CK antibodies, AF488-labeled anti-CD45 antibody, and DAPI. In the fourth tube, the cells were gently shaken with MNPs-anti-EpCAM (without fixation or permeabilization) for 1 h at room temp. The cells were loaded into a cell-extraction microfluidic device.sup.44 at a flow rate of 8 mL h.sup.1. After washing, the Tygon tubing connecting the zones were cut and the cells were gently pipetted out the device and stored at 80 C. before RT-qPCR analysis.
[0093] An example method for cellular AR-V7 mRNA determination in CRPC patient's blood is now discussed. Metastatic castration-resistant prostate cancer (CRPC) patients were recruited from the Princess Margaret Hospital according to the University of Toronto Research Ethics Board approval protocol. All patients were enrolled subsequent to informed consent. Sixteen milliliters of peripheral blood samples were collected from CRPC patients in CellSearch tubes containing EDTA. All the samples were analyzed within 24 h after collection. A set of patient samples (n=7) were analyzed to determine whether the approach would be suitable for the analysis of CTCs mRNA. Sixteen milliliters of blood were split into four tubes to be further utilized for the determination of Ncp, N.sub.NSP, and N.sub.Ab using the microfluidic approach and for RT-qPCR analysis. The mononuclear cells were isolated using Ficoll method and were subsequently suspended in 250 L of 2% FBS solution in PBS. Anti-CD15 MNPs were gently shaken with the cell suspension for 30 min at room temp. The captured leukocytes were pelleted using a magnetic separation rack and the supernatant was collected for further analysis. In the first tube, the supernatant was incubated with 250 L of 8% PFA in DPBS/DTT for 15 min at 37 C. After centrifugation, 100 L of 0.3% TX-100 in DPBS/DTT were added and the suspension was incubated for 10 min at room temp. The cells were gently shaken with 100 L of DPBS/DTT containing MNPs-labeled CP1-AR-V7 and MNPs-labeled AR-V7-CP2 in DPBS/DTT for 3 h at room temp. In the second tube, a control experiment was carried out in which the cells were gently shaken with the MNPs-labeled nonspecific dual probe (NSP) for 3 h at room temp, subsequent to cell fixation and permeabilization. In the third tube, another control experiment was carried out in which the cells were gently shaken with MNPs-anti-EpCAM (without prior fixation or permeabilization) for 3 h at room temp. The cells were loaded into the 6-zone microfluidic device at a flow rate of 600 L h.sup.1 and subsequently stained with APC-labeled anti-EpCAM, APC-labeled anti-CK antibodies, AF488-labeled anti-CD45 antibody, and DAPI. In the fourth tube, the cells were gently shaken with MNPs-anti-EpCAM (without fixation or permeabilization) for 1 h at room temp. The cells were loaded into a cell-extraction microfluidic device at a flow rate of 8 mL h.sup.1. After washing, the Tygon tubing connecting the zones were cut and the cells were gently pipetted out the device and stored at 80 C. before RT-qPCR analysis.
[0094] An example method for flow cytometric analysis of survivin protein expression in PC3 cells is now discussed. Flow cytometry was used to analyze the level of survivin protein in PC3 cells before and after silencing the survivin gene with LY21813080 siRNA.sup.14. Briefly, PC3 cells (200,000 cells) were incubated with the blocking buffer (1% BSA in PBS) for 30 min at room temp. Afterward, the cells were fixed 4% PFA and permeabilized with 0.2% TX-100. The cells were incubated with 10 L of 100 g mL.sup.1 of DL555-labeled anti-survivin antibody (Novus biologicals, US) for 1 h at room temp. Mouse IgG (Abcam, US) was used as a negative control at the assay conditions. Subsequently, samples were injected into FACSCanto flow cytometer (BD Biosciences, US) and measurements were plotted as histograms. Absorbance values were normalized to unstained control. A total of 10,000 cells were analyzed per cell line.
[0095] An example method for dynamic light scattering (DLS) measurement of the formed clusters of magnetic nanoparticles is now discussed. DLS experiments were carried out using Zeta sizer Nano series (Malvern Instruments, UK), to prove the formation of MNP clusters upon hybridization between MNPs-labeled dual probe and target mRNA. Prior to analysis, MNPs-labeled CP1-TMPRSS2/ERG (15 g) and MNPs-labeled TMPRSS2/ERG-CP2 (15 g) were incubated with 1 M synthetic TMPRSS2/ERG in DPBS/DTT for 3 h at room temp. A control experiment was carried in which the target was incubated with individual capture probes (CP1 or CP2).
Example Experiments
[0096] Reference will now be made to a series of example experiments conducted to investigate possible variations to the disclosed method. These experiments are described for the purpose of illustration only, and are not intended to be limiting or promissory.
[0097] In the following example experiments, a 6-zone microfluidic device 6 was used. However, other variations are possible. For example, a device with fewer than 6 zones or more than 6 zones may be used.
[0098] Further, in the following example experiments the linear velocity profile was 1, 0.47, 0.31, 0.23, 0.18, 0.15 corresponding to zones 1-6 respectively. However, a different linear velocity profile may be used. The decline in flow rate is provided as an example, and other changes to flow rate across the zones including increase or decrease by other factors, may be suitable.
[0099] Dual probes, comprising two capture probes (CP1 and CP2), 14 and 15 were designed for the following example experiments to target BIRC5 (survivin), TMPRSS2/ERG, AR, or AR-V7 mRNA in PC3, LNCaP, or VCaP cells. Sequences of the probes 14 and 15 used in this study are detailed in Table 1.
TABLE-US-00001 TABLE1 Sequenceofthenucleicacidsutilizedintheexample experimentalsetup Nucleicacid Sequence CP1-TMPRSS2/ERG 5GATAAGGCTTCCTGCCGCGC3-Biotin-(TEG) TMPRSS2/ERG-CP2 Biotin-(TEG)-5CAACGACTGGTCCTCACTCA3 TMPRSS2/ERG(synthetic) 5GCGCGGCAGGAAGCCTTATCAGTTGTGAGTGAG GACCAGTCGTTG3 Ctrl-TMPRSS2/ERG 5GTTGCTGACCAGGAGTGAGTGTTGACTATTCCG AAGGACGGCGCG3 AF488-TMPRSS2/ERG-CP1 AF488-5GATAAGGCTTCCTGCCGCGC3-Biotin- (TEG) CP2-TMPRSS2/ERG-AF594 Biotin-(TEG)-5CAACGACTGGTCCTCACTCA3- AF594 CP1-survivin 5CAGTTCTTGAATGTAGAGAT3-Biotin-(TEG) Survivin-CP2 Biotin-(TEG)-5GCAGGCGCAGCCCTCCAAGA3 CP1-AR-FL 5TGCTTTCATGCACAGGAATT3-Biotin-(TEG) AR-FL-CP2 Biotin-(TEG)-5CTGGAATAATGCTGAAGAGT3 CP1-AR-V7 5CTGATGAAGAGAAGCATGTG3-Biotin-(TEG) AR-V7-CP2 Biotin-(TEG)-5TGGGAGAAGAATGAGAGGCT3 LY2181308 5TGTGCTATTCTGTGAATT3 TMPRSS2/ERGForward FAM-5CAGGAGGCGGAGGCGGA3-MGBNFQ primer TMPRSS2/ERGReverse FAM-5GGCGTTGTAGCTGGGGGTGAG3-MGBNFQ primer SurvivinForwardprimer FAM-5CTTTCTCAAGGACCACCGCATCT3-MGB NFQ SurvivinReverseprimer FAM-5GCACTTTCTCCGCAGTTTCCTC3-MGBNFQ AR-FLForwardprimer FAM-5GGAATTCCTGTGCATGAAAGC3-MGBNFQ AR-FLReverseprimer FAM-5CGATCGAGTTCCTTGATGTAGTTC3-MGB NFQ AR-V7Forwardprimer FAM-5CTTGTCGTCTTCGGAAATGTTATG3-MGB NFQ AR-V7Reverseprimer FAM-5CTTTCTTCAGGGTCTGGTCATT3-MGBNFQ TBPForwardprimer FAM-5CGGCTGTTTAACTTCGCTTC3-MGBNFQ TBPReverseprimer FAM-5CACACGCCAAGAAACAGTGA3-MGBNFQ GAPDHForwardprimer FAM-5GAGTCAACGGATTTGGTCGT3-MGBNFQ GAPDHReverseprimer FAM-5GACAAGCTTCCCGTTCTCAG3-MGBNFQ CP1-PDL1 5TGTTCAGAGGTGACTGGATC3-Biotin-(TEG) PDL1-CP2 Biotin-(TEG)-5GCCCTCAGCCTGACATGTCA3 CP1-PD1 5CTCAGGGACACAGGGCACGG3-Biotin-(TEG) PD1-CP2 Biotin-(TEG)-5AGACAATGGTGGCATACTCC3 CP1-PARP 5TCTGTAGCAAGGAGGCTGAA3-Biotin-(TEG) PARP-CP2 Biotin-(TEG)-5CTGCTTCTTCAGGGCTTCTT3
[0100] In the first set of experiments, the use of single nanoparticle-tethered capture probes was not sufficient for high levels of magnetic capture. In proof-of-concept studies monitoring the capture efficiency of a model cell line (PC3 cells), low capture efficiencies were observed when a single capture probe was used. However, when a combination of two capture probes were used, the capture efficiency increased significantly, as shown in
[0101]
[0102] DLS measurements revealed that combining the two capture probes produced large aggregates in the presence of the complementary target strand (
[0103] The results from these exemplary experiments demonstrate that mRNA-triggered aggregation of MNPs-labeled dual probe could enhance the magnetic susceptibility of the cells and facilitate their capture within the device 6.
[0104] Notably, survivin has a gene sequence that has been explored as a potential cancer biomarker. Survivin promotes cell division and suppresses apoptosis in many human cancers. The antiapoptotic effect is related to its ability to inhibit caspases either directly or indirectlyl.sup.16. The transcription of the survivin gene is higher in tumors compared to normal tissues and is often correlated with metastasis and poor prognosis in cancer patients.sup.17. It was found that using the dual probe (CP1+Cp2) has allowed for the highest recoveries of PC3 cells either in the buffer solution (824%) or blood (715%) subsequent to RBCs removal using Ficoll method and WBCs depletion with MNPs-tagged anti-CD15. On the other hand, using a non-specific dual probe (NSP) or CP1 or CP2 individually (at double concentration) has permitted recoveries of 92%, 264%, and 243%, respectively (
[0105]
[0106] As a proof-of-concept, this approach was used to analyze survivin mRNA in PC3, LNCaP, and VCaP cells. The cells were spiked into blood to ensure that heterogeneous samples were compatible with the approach. The number of cells captured using anti-EpCAM was compared to the number captured using the mRNA-directed approach to determine the overall mRNA capture fraction. For each of the cell lines tested, the EpCAM-mediated capture-efficiencies were high (VCaP 924%, LNCaP 953%, PC3 926%), but for the mRNA-targeted trials, the capture levels varied (VCaP 3811%, LNCaP 669%, PC3 798%), reflecting the varied expression of survivin in these cell lines, as shown in
[0107]
[0108]
[0109] The overall mRNA capture fraction for PC3, LNCaP, and VCaP cells, which compares the number of cells captured with mRNA-targeted nanoparticles versus anti-EpCAM targeted nanoparticles, was determined. The overall capture fraction was found in the order of PC3>LNCaP>VCaP (
[0110] For each cell line, the median zone of capture was determined to provide a parameter that could be used to refine the calculation of relative RNA expression for the cell lines. The PC3 and LNCaP cells were primarily captured in the early zones of the device and had average zone values of 1.8 and 1.9, respectively. The VCaP cells, in addition to having a much lower overall capture efficiency, had a much larger average zone value of 4.5. An expression index (EI) for the survivin mRNA was then calculated for each cell line; values are shown in
[0111] Reverse transcription and quantitative PCR were performed using the same cell lines to evaluate the relative expression of survivin mRNA. The TATA-box binding protein, TBP, was used as a standard, and the expression levels of survivin mRNA were compared to TBP for each cell line (
[0112]
[0113]
[0114]
[0115]
[0116] It was noticed that the mRNA expression pattern and index obtained using 10 PC3 cells were comparable to those determined using 500 cells, suggesting that the detection limit of our method is 10 cells in 1 mL of blood. In addition, the purity of the captured cells from blood was also assessed and up to 99.99% of the WBCs (7,000,000 per mL of blood) were depleted from 1, 2, and 4 mL blood, as shown in
[0117] Next, the selectivity of the disclosed approach was demonstrated by analyzing survivin mRNA in PC3 cells before and after silencing the survivin gene with a small interfering RNA (siRNA). PC3 cells were transfected with LY2181308, a previously characterized siRNA directed against survivin.sup.14. It was found that the transfected PC3 cells have exhibited lower EI.sub.survivin compared to control cells (
[0118]
[0119]
[0120] Flow cytometric analysis of the survivin protein revealed that the survivin protein level within the cells was in the order of PC3 >transfected PC3 cells (
[0121] The results corroborated the mRNA expression data obtained using the disclosed approach. In addition, the results were further confirmed with immunostaining in which transfected cells were immunostained with an antibody specific to the survivin protein. Transfected cells have exhibited lower expression of the survivin protein (yellow channel), as shown in example
[0122]
[0123] The disclosed approach was further used to analyze three prostate cancer specific mRNAs, including full-length androgen receptor (AR-FL), AR splice variant 7 (AR-V7), and TMPRSS2/ERG in VCaP, LnCAP, and PC3 cells. Notably, AR mRNA is considered the key oncogenic driver at various stages of prostate cancer development and progression.sup.18. AR-V7 mRNA is the most abundantly expressed variant that drives prostate cancer during androgen deprivation therapyl.sup.19. It was recently identified as a predictive biomarker for the resistance to abiraterone and enzalutamide in metastatic castrate-resistant prostate cancer patients.sup.20. TMPRSS2 (Exon 1)/ERG (Exon 4) is the most frequent gene fusion in prostate cancer, appearing in about 50% of prostate cancer patients and 90% of all prostate cancer gene fusions.sup.21. In addition, TMPRSS2/ERG is absent in healthy cells and was found to correlate with cancer aggression and metastatic potential, the fact that made it more attractive as a diagnostic and prognostic marker than serum PSA.sup.22.
[0124] The expression pattern of AR-FL mRNA (
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132] To assess the results, RT-qPCR was used to analyze the aforementioned mRNAs in the three cell lines and the results are provided in
[0133] Head-to-head comparison of the results revealed a good agreement between both methods and indicated that the disclosed example approach can be used to quantify gene expression levels and generate mRNA expression patterns comparable to those determined by RT-qPCR.
[0134] Fluorescence microscopy was used to gain better insights into TMPRSS2/ERG specific dual probe internalization within three prostate cancer cell lines, including VCaP, LnCaP, and PC3. Fluorescence microscopy images revealed the internalization of AF488-labeled CP1 in VCaP cells. However, no green fluorescence was observed in both LNCaP and PC3 cells (
[0135]
[0136] Transmission electron microscopy (TEM) images supported the previous finding and revealed the formation of clusters of magnetic nanoparticles within PC3 cells after targeting the survivin mRNA with a complementary dual probe (CP1+CP2). No cluster formation was observed when single complementary probes were used (CP1 or CP2), as shown in
[0137]
[0138] To demonstrate the clinical utility of the disclosed approach for mRNA analysis in CTCs, the low-abundance TMPRSS2/ERG and AR-V7 mRNAs in blood samples collected from a small cohort of patients undergoing treatment for metastatic castration-resistant prostate cancer (n=11) were analyzed, as shown in
[0139]
[0140] An average of 12 mL of blood was analyzed per patient and CTCs were identified using immunofluorescence staining techniques. A patient sample was considered positive for TMPRSS2/ERG when the EITMPRSS2/ERG was at least 1.5. It was observed that the ratio of number of CTCs captured by the dual probe to the total number of CTCs determined using the EpCAM beads was higher in TMPRSS2/ERG positive samples compared to samples lacking the gene fusion (
[0141]
[0142] An average of 12 mL of blood was analyzed per patient and CTCs were identified using immunofluorescence staining techniques. A patient sample was considered positive for AR-V7 when the EIAR-V7 was at least 1. It was observed that the ratio of number of CTCs captured by the dual probe to the total number of CTCs determined using the EpCAM beads was higher in AR-V7 positive samples compared to samples lacking the gene fusion (
[0143] A parallel RT-qPCR analysis of TMPRSS2/ERG mRNA corroborated the data (
[0144] A parallel RT-qPCR analysis of the AR-V7 mRNA corroborated the data (
[0145] Representative images of CTCs captured from patient samples versus a white blood cell are shown in
[0146]
[0147] In summary, the disclosed example method provides an amplification-free means to characterize gene expression patterns in intact cancer cells and may be broadly applicable to other cell types, including non-cancer cells.
[0148] The disclosed example method provides capture probes designed to capture cells containing the mRNA transcripts: survivin, TMPRSS2/ERG, AR, or AR-V7. Other capture probes and mRNA transcripts are contemplated. For example, capture probes against the mRNA transcripts: PDL1, PD1, and PARP are listed in Table 1. The disclosed method may also be broadly applicable to cell capture based on polynucleotides other than mRNA, such as microRNA (miRNA) or DNA.
[0149] The disclosed method has the ability to combine cellular mRNA analysis with cellular proteins identification, a critical tool for defining specific cell subsets in heterogeneous populations.
[0150] Additionally, this disclosed approach may be useful for the early detection of cancer by paving the way toward elucidating the molecular profiles of CTCs in-line, without interference from residual blood cells. This can be implemented for better understanding of cancer progression in real-time to improve the clinical outcome.
[0151] The embodiments of the present disclosure described above are intended to be examples only. The present disclosure may be embodied in other specific forms. Alterations, modifications and variations to the disclosure may be made without departing from the intended scope of the present disclosure. While the systems, devices and processes disclosed and shown herein may comprise a specific number of elements/components, the systems, devices and assemblies could be modified to include additional or fewer of such elements/components. For example, while any of the elements/components disclosed may be referenced as being singular, the embodiments disclosed herein could be modified to include a plurality of such elements/components. Selected features from one or more of the above-described embodiments may be combined to create alternative embodiments not explicitly described. All values and sub-ranges within disclosed ranges are also disclosed. The subject matter described herein intends to cover and embrace all suitable changes in technology. All references mentioned are hereby incorporated by reference in their entirety.
REFERENCES
[0152] 1. Elowitz, M. B., Levine, A. J., Siggia, E. D. & Swain, P. S. Stochastic gene expression in a single cell. Science 297, 1183-1186 (2002).
[0153] 2. Bendall, S. C. & Nolan, G. P. From single cells to deep phenotypes in cancer. Nat. Biotechnol. 30, 639-647 (2012).
[0154] 3. Yu, M. et al. Circulating breast tumor cells exhibit dynamic changes in epithelial and mesenchymal composition. Science 339, 580-584 (2013).
[0155] 4. Kalinich, M. et al. An RNA-based signature enables high specificity detection of circulating tumor cells in hepatocellular carcinoma. Proc. Natl. Acad. Sci. U.S.A 114, 1123-1128 (2017).
[0156] 5. Clark, I. C. & Abate, A. R. Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics. Lab Chip 17, 2032-2045 (2017).
[0157] 6. Briley, W. E., Bondy, M. H., Randeria, P. S., Dupper, T. J. & Mirkin, C. A. Quantification and real-time tracking of RNA in live cells using Sticky-flares. Proc. Natl. Acad. Sci. U.S.A 112, 9591-95955 (2015).
[0158] 7. Geiss, G. K. et al. Direct multiplexed measurement of gene expression with color-coded probe pairs. Nat. Biotechnol. 26, 317-325 (2008).
[0159] 8. Deng, Q., Ramskold, D., Reinius, B. & Sandberg, R. Single-cell RNA-seq reveals dynamic, random monoallelic gene expression in mammalian cells. Science 343, 193-196 (2014).
[0160] 9. Livak, K. J. et al. Methods for qPCR gene expression profiling applied to 1440 lymphoblastoid single cells. Methods 59, 71-79 (2013).
[0161] 10. Lyubimova, A. et al. Single-molecule mRNA detection and counting in mammalian tissue. Nat. Protoc. 8, 1743-1758 (2013).
[0162] 11. Itzkovitz, S. & van Oudenaarden, A. Validating transcripts with probes and imaging technology. Nat. Methods 8, S12-19 (2011).
[0163] 12. Halo, T. L. et al. NanoFlares for the detection, isolation, and culture of live tumor cells from human blood. Proc. Natl. Acad. Sci. U.S.A. 111, 17104-17109 (2014).
[0164] 13. Alix-Panabieres, C. & Pantel, K. Challenges in circulating tumour cell research. Nat. Rev. Cancer 14, 623-631 (2014).
[0165] 14. Carrasco, R. A. et al. Antisense inhibition of survivin expression as a cancer therapeutic. Mol. Cancer. Ther. 10, 221-232 (2011).
[0166] 15. Wang, S. et al. Potential clinical significance of a plasma-based KRAS mutation analysis in patients with advanced non-small cell lung cancer. Clin. Cancer Res. 16, 1324-1330 (2010).
[0167] 16. Altieri, D. C. Validating survivin as a cancer therapeutic target. Nat. Rev. Cancer 3, 46-54 (2003).
[0168] 17. Fulda, S. & Vucic, D. Targeting IAP proteins for therapeutic intervention in cancer. Nat. Rev. Drug Discov. 11, 109-124 (2012).
[0169] 18. Watson, P. A., Arora, V. K. & Sawyers, C. L. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer. Nat. Rev. Cancer 15, 701-711 (2015).
[0170] 19. Robinson, D. et al. Integrative clinical genomics of advanced prostate cancer. Cell 161, 1215-1228 (2015).
[0171] 20. Antonarakis, E. S. et al. AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. N. Engl. J. Med. 371, 1028-1038 (2014).
[0172] 21. Tomlins, S. A. et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310, 644-648 (2005).
[0173] 22. Tomlins, S. A. et al. Urine TMPRSS2:ERG fusion transcript stratifies prostate cancer risk in men with elevated serum PSA. Sci. Transl. Med. 3, 94ra72 (2011).