MODIFIED ONCOLYTIC ADENOVIRUSES
20210017501 · 2021-01-21
Assignee
Inventors
- Tuuli Ranki (Helsinki, FI)
- Sari Pesonen (Helsinki, FI)
- Petri Priha (Helsinki, FI)
- Erkko Ylösmäki (Helsinki, FI)
- Vincenzo Cerullo (Helsinki, FI)
- Beatriz Martins (Helsinki, FI)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
C12N2710/10332
CHEMISTRY; METALLURGY
C07K14/70575
CHEMISTRY; METALLURGY
C12N2710/10321
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
Abstract
The invention concerns a modified replication competent, oncolytic adenovirus; a pharmaceutical composition comprising same; and a method of treating cancer using same.
Claims
1. A modified replicating adenovirus (Ad) of serotype 5 having lytic activity in target cancer cells comprising: a) a E1A gene deletion wherein the deletion is of nucleotides encoding base pairs 923-946; b) a 5/3 chimeric substitution of a knob of an adenoviral fiber protein wherein the knob of serotype 5 Ad is replaced by the knob of a serotype 3 Ad; c) a 14.7k gene deletion wherein the deletion is of base pairs 30448-30834 with respect to the wild type adenovirus and wherein the sequence GGA GGA GAT GAC TGA (SEQ ID NO: 1) is substituted for GGA GGA GAC GAC TGA (SEQ ID NO: 2); and d) a gp19k gene deletion and a 7.1k gene deletion wherein the deletions are of base pairs 28541-29211 with respect to the wild type adenovirus.
2. The modified adenovirus according to claim 1 wherein said adenovirus is further modified by the insertion of a molecule encoding OX40L.
3. The modified adenovirus according to claim 2 wherein said OX40L is human OX40L.
4. The modified adenovirus according to claim 2 wherein said OX40L is inserted in the E3B region, replacing the gene 14.7K deletion.
5. (canceled)
6. The modified adenovirus according to claim 1 wherein said adenovirus is modified by the insertion of a molecule encoding CD40L.
7. The modified adenovirus according to claim 6 wherein said CD40L is human CD40L.
8. The modified adenovirus according to claim 6 wherein said CD40L molecule is inserted immediately downstream from OX40L using a 2A processing site.
9. The modified adenovirus according to claim 8 wherein the 2A processing site is inserted between the two transgenes and the 2A processing site is preceded by a cleavage site and a SGSG-linker (SEQ ID NO: 28) to ensure effective cleavage of the transgenes.
10. The modified adenovirus according to claim 8 wherein said 2A processing site is a foot-and-mouth disease virus 2A processing site (F2A) or a porcine teschovirus-1 2A processing site.
11. The modified adenovirus according to claim 6 wherein said CD40L molecule is inserted in the late region of the virus, specifically in the late region 3 (L3).
12. The modified adenovirus according to claim 11 wherein said CD40L molecule is inserted downstream from the 23K gene preceding its polyadenylation site.
13. The modified adenovirus according to claim 11 wherein a splice acceptor site and/or a Kozak sequence is provided or inserted upstream of the CD40L molecule.
14. The modified adenovirus according to claim 2 wherein a molecule encoding the whole cDNA of at least one or each of OX40L and CD40L is inserted into said adenovirus.
15. A pharmaceutical composition comprising at least one modified replication-competent and target cell lytic adenovirus according to claim 1 and a suitable carrier.
16. The pharmaceutical composition according to claim 15 wherein said composition is formulated for intratumoral, intramuscular, intra-arterial, intravenous, intrapleural, intravesicular, intradermal, intracavitary or peritoneal injection, or an oral administration.
17-18. (canceled)
19. A method of treating cancer in a patient comprising administering to a patient an effective amount of a composition comprising at least one modified replication-competent and target cell lytic adenovirus according to claim 1.
20. The method of treating cancer according to claim 19 wherein the at least one modified replication-competent and target cell lytic is administered with a cell checkpoint modulator.
21. The method of treating cancer according to claim 20 wherein the checkpoint modulator is an anti-PD1 molecule, an anti-PD-L1 molecule or an anti-CTLA-4 molecule.
22. The method according to claim 19 wherein said cancer is selected form the list comprising or consisting of: nasopharyngeal cancer, synovial cancer, hepatocellular cancer, renal cancer, cancer of connective tissues, melanoma, lung cancer, bowel cancer, colon cancer, rectal cancer, colorectal cancer, brain cancer, throat cancer, oral cancer, liver cancer, bone cancer, pancreatic cancer, choriocarcinoma, gastrinoma, pheochromocytoma, prolactinoma, T-cell leukemia/lymphoma, neuroma, von Hippel-Lindau disease, Zollinger-Ellison syndrome, adrenal cancer, anal cancer, bile duct cancer, bladder cancer, ureter cancer, oligodendroglioma, neuroblastoma, meningioma, spinal cord tumor, osteochondroma, chondrosarcoma, Ewing's sarcoma, cancer of unknown primary site, carcinoid, carcinoid of gastrointestinal tract, fibrosarcoma, breast cancer, Paget's disease, cervical cancer, esophagus cancer, gall bladder cancer, head cancer, eye cancer, neck cancer, kidney cancer, Wilms' tumor, liver cancer, Kaposi's sarcoma, prostate cancer, testicular cancer, Hodgkin's disease, non-Hodgkin's lymphoma, skin cancer, mesothelioma, multiple myeloma, ovarian cancer, endocrine pancreatic cancer, glucagonoma, parathyroid cancer, penis cancer, pituitary cancer, soft tissue sarcoma, retinoblastoma, small intestine cancer, stomach cancer, thymus cancer, thyroid cancer, trophoblastic cancer, hydatidiform mole, uterine cancer, endometrial cancer, vagina cancer, vulva cancer, acoustic neuroma, mycosis fungoides, insulinoma, carcinoid syndrome, somatostatinoma, gum cancer, heart cancer, lip cancer, meninges cancer, mouth cancer, nerve cancer, palate cancer, parotid gland cancer, peritoneum cancer, pharynx cancer, pleural cancer, salivary gland cancer, tongue cancer and tonsil cancer.
Description
[0054] An embodiment of the present invention will now be described by way of example only with reference to the following wherein:
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
SPECIFIC DESCRIPTION
Materials and Methods:
Creation of an Oncolytic Adenovirus Having a E1A Gene Deletion of Nucleotides Encoding Amino Acids 923-946
[0065] The 24 base pair deletion was introduced into the Ad5 backbone sequence by using a shuttle plasmid targeting the E1A region, the cloning method described in Kanerva et al, the deletion first described in Fueyo et al.
Creation of an Oncolytic Adenovirus Having a 5/3 Chimeric Substitution of an Adenoviral Fiber Protein
[0066] The serotype 5 knob was replaced with the serotype 3 knob by using a shuttle plasmid with a modified fiber region to introduce the sequence via homologous recombination into the virus backbone. The specific cloning methods are described in Kanerva et al.
[0067] Creation of an Oncolytic Adenovirus Having a 14.7k Gene Deletion of Base Pairs 30448-30834 with Respect to the Wild Type Adenovirus and Wherein the Sequence GGA GGA GAT GAC TGA (SEQ ID NO: 1) is Substituted for GGA GGA GAC GAC TGA (SEQ ID NO: 2) and the Creation of an Oncolytic Adenovirus Having a gp19k Gene Deletion and a 7.1k Gene Deletion of Base Pairs 28541-29211 with Respect to the Wild Type Adenovirus.
[0068] The 14.7K deletion and the substitution of GGA GGA GAT GAC TGA (SEQ ID NO: 1) for GGA GGA GAC GAC TGA (SEQ ID NO: 2) (with the insertion of the transgene OX40L in the place of 14.7K) and the deletion of gp19k/7.1 k genes were introduced into a shuttle plasmid (pShuttle-OX40L) by chemical synthesis. Based on a virtual sequence designed in Vector NTI program, overlapping oligo nucleotides were designed at GeneArt (Thermo Fisher Scientific), that together comprised the whole sequence. Oligo synthesis was achieved by a solid phase synthesis applying controlled pore glass as the solid material. Oligos were then released to a liquid phase and assembled by using PCR on a fully automated assembly station. The synthetically cloned sequence was introduced into a pMX cloning vector, and verified by sequencing.
Cloning of OX40L and CD40L into pAD5/3-D24 for Obtaining pAd5/3-D24-OX40L/F2A/CD40L and pAd5/3-D24-OX40L/P2A/CD40L
[0069] To create viruses containing both OX40L and CD40L genes and either one of the foot-and-mouth disease virus 2A processing site (F2A) or Porcine teschovirus-1 2A processing site (P2A) inserted between the transgenes for co-translational processing, 3 fragments for each construct where amplified by PCR.
[0070] For F2A containing constructs, fragment 1 containing OX40L sequence and a part of the F2A processing site was amplified from pShuttle-OX40L using primers Gibson OX40L and F2A reverse OX40L (see list of all primers used in table 1), fragment 2 containing a part of the F2A processing site and the complete sequence of CD40L was amplified from pShuttle-CD40L using primers F2A forward CD40L and F2A reverse CD40L.
[0071] For P2A containing constructs, fragment 1 containing OX40L sequence and a part of the P2A processing site was amplified from pShuttle-OX40L using primers Gibson OX40L and P2A reverse OX40L (see list of all primers used in table 1), fragment 2 containing a part of the P2A processing site and the complete sequence of CD40L was amplified from pShuttle-CD40L using primers P2A forward CD40L and P2A reverse CD40L.
[0072] For both F2A and P2A constructs, fragment 3 containing adenovirus genomic sequence flanking the 3end of CD40L was amplified from pShuttle-OX40L using primers F2A forward Adeno end w/o insertion and Gibson OX40L REV. All PCR reactions were performed with Phusion High-Fidelity DNA Polymerase (Thermo Fisher, F530) according to manufacturer's instructions followed by DpnI treatment (NEB, R0176). The reactions were purified with NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, 740609.50). The purified fragments were then assembled together creating fragments GA-OX40L/F2A/CD40L and GA-OX40L/P2A/CD40L using Gibson assembly master mix (NEB, E2611) followed by PCR amplification of the assembled fragment using primers Gibson OX40L FW and Gibson OX40L REV (see
[0073] To assemble GA-OX40L/F2A/CD40L or GA-OX40L/P2A/CD40L into the viral backbone, pAd5/3-D24 was digested with SrfI (NEB, R0629L) and BarI (SibEnzyme, E548) followed by ethanol precipitation. The digested viral backbone pAd5/3-D24 was assembled with GA-OX40L/F2A/CD40L or GA-OX40L/P2A/CD40L fragments using Gibson assembly master mix (NEB, E2611) according to the manufacturer's instructions to generate pAd5/3-D24-OX40L/F2A/CD40L and pAd5/3-D24-OX40L/P2A/CD40L. The Gibson assembly reactions were transformed into NEB 5-alpha Competent E. coli (NEB, C2987H) according to manufacturer's instructions. Positive colonies were screened by PCR and the correct recombination events were further confirmed by sequencing the constructs.
Cloning of CD40L and OX40L into pAD53-D24 for Obtaining pAd5/3-D24-CD40L-OX40L
[0074] To create a fragment including CD40L (CD40L-GA) to be cloned into the viral backbone pAd5/3-D24 by specific homologous recombination reaction (brand name Gibson Assembly, New England Biolabs), three PCR products were first assembled together with Gibson assembly recombination reaction. The fragments fused together contained the following sequences: Fragment A corresponds to nucleotides 21376 to 22114 of pAd5/3-D24 plasmid. Fragment B corresponds to nucleotides 999 to 2623 of pShuttle-CD40L plasmid. Fragment C corresponds to nucleotides 22820-27107 of pAd5/3-D24 plasmid (see table 1b-3b for list of primers and primer sequences used). PCR reactions were performed with Phusion High-Fidelity DNA Polymerase (Thermo Fisher, F530) according to manufacturer's instructions and the reactions were purified with NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, 740609.50). Next, to create CD40L-GA, the purified PCR fragments were assembled together by the Gibson Assembly recombination reaction according to manufacturer's instructions (Gibson assembly master mix, NEB E2611). After the homologous recombination, the newly created CD40L-GA fragment was further amplified by PCR using the primers AA and DD (for the primer sequences, please see tables 1b and 3b) using Phusion High-Fidelity DNA Polymerase according to manufacturer's instructions. The PCR amplified CD40L-GA was gel purified using NucleoSpin Gel and PCR Clean-up kit. To clone CD40L-GA into the viral backbone, pAd5/3-D24 was digested with SpeI (NEB, R0133S) and AsiSI (NEB,R0630S) followed by ethanol precipitation. The digested viral backbone pAd5/3-D24 was assembled with CD40L-GA fragment using Gibson assembly master mix (NEB, E2611) according to the manufacturer's instructions to generate pAd5/3-D24-CD40L. The Gibson assembly reaction was transformed into NEB 5-alpha Competent E. coli (NEB, C2987H) according to manufacturer's instructions. Positive colonies were screened by PCR and the correct recombination was further confirmed by sequencing the constructs. In order to create the final construct, i.e. virus containing both CD40L and OX40L genes, a fragment including OX40L (OX40L-GA) was amplified using the following primers: Gibson OX40L FW and Gibson OX40L REV (amplifying the region in pShuttle-OX40L corresponding to nucleotides 11 to 3287), please see table 4b for primer sequences. PCR reaction was performed with Phusion High-Fidelity DNA Polymerase (Thermo Fisher, F530) according to manufacturer's instructions and the reactions was purified with NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, 740609.50). To clone OX40L-GA into the viral backbone, pAd5/3-D24-CD40L was digested with SrfI (NEB, R0629L) and BarI (SibEnzyme, E548) followed by ethanol precipitation. The digested viral backbone pAd5/3-D24-CD40L was assembled with OX40L-GA fragment using Gibson assembly master mix (NEB, E2611) according to the manufacturer's instructions to generate pAd5/3-D24-CD40L-OX40L. The Gibson assembly reaction was transformed into NEB 5-alpha Competent E. coli (NEB, C2987H) according to manufacturer's instructions. Positive colonies were screened by PCR and the correct recombination was further confirmed by sequencing the constructs.
Methods for the In Vitro Testing of the Modified Adenovirus with One Transgene or Two Transgenes
Flow Cytometric Analysis to Determine OX40L/OX40 Interaction
[0075] A flow cytometric analysis was performed to verify that the OX40L expressed from the viruses is able to bind its native receptor OX40 (
[0076] 72 hours after the infection, the cells were collected and counted, and 310.sup.5 cells were plated per well on a 96-well-plate in duplicates. The plate was centrifuged at 400 g for 5 minutes and re-suspended in PBS. This step was repeated twice, and the cells were then suspended into a mixture of OX40 receptor antibody and goat anti-rabbit Alexa fluor 488 antibody, incubated for 30 minutes, washed 3 times and then ran in BD Accuri flow cytometer to detect the geometric mean of the OX40L/OX40 complex cells. The data was analyzed with the FlowJo software.
Sandwich ELISA to Verify the OX40L/OX40 Interaction
[0077] To further verify that the OX40L expressed from the viruses is able to bind its native receptor, OX40, a functional sandwich ELISA was performed (
[0078] The wells were incubated for 1 hour with a mouse anti-human OX40L antibody (1:1000 dilution in PBS), washed 3 times, and incubated with an anti-mouse-HRP conjugate (1:1000 dilution in PBS) for 1 hour. After washing the plates 3 times, 90 l of TMB substrate was added and the plate was incubated in the dark at room temperature for 10 minutes. The HRP conjugated to the anti-mouse antibody reacts with the substrate TMB calorimetrically, and the intensity of the color was measured at 450 nm spectrophotometrically.
Functionality Assay with OX40/NF-kBHEK293 Recombinant Cell Line
[0079] To verify that the OX40L produced by the viruses (either the single transgene viruses or the double transgene viruses) is functional and able to activate the downstream signals when binding its receptor, OX40, a functionality assay using human embryonic kidney cell line 293 (HEK-293) constitutively expressing OX40 was performed (
[0080] OX40L product is produced in the culture medium of an A549 cell culture infected with a virus expressing OX40L gene. The medium is collected and added to a culture of OX40/NF-B ReporterHEK293 cells constitutively expressing the OX40 receptor. The binding of OX40L to OX40 receptor triggers an intracellular signaling pathway that, via NF-B activation, leads to the expression of firefly Luciferase reporter gene. The luciferase activity is measured using the ONE-step luciferase assay system and a luminometer to determine the relative bioluminescence of a known concentration of OX40L standard. The OX40L concentration of the virus sample can then be analyzed based on the luminescence readings and the standard curve. Before the OX40L concentration can be determined, a standard curve for OX40L has to be defined using known concentrations of recombinant human OX40L.
[0081] Briefly, 1.510.sup.4A549 cells were plated on a 96-well-plate in 10% DMEM. On the following day A549 cells were infected with a multiplicity of infection of 10 i.e. 10 viruses per cell, with either the single transgene virus (Ad5/3-D24-OX40L, termed as OX40L-virus in the figures), the double transgene viruses (Ad5/3-D24-OX40L-CD40L.C1 and Ad5/3-D24-OX40L-CD40L.C3, termed as OX40L/CD40L.C1 and OX40L/CD40L.C3) or a virus without a transgene (Ad5/3-D24, termed as ctrl-virus) in 2% DMEM.
[0082] Some wells were left uninfected to be used as a negative control. 72 hours after the infection, the cells were centrifuged at 500 g for 5 minutes, the media was disposed and 210.sup.5 OX40/NF-kB-HEK293 cells in 100 ul of 10% MEM was added on top of the A549 cells. After centrifuging with 400 g for 1 minute the cells were incubated at 37 C. for 6 hours before lysing with a lysis buffer and adding 20 ul of each lysate on a transparent 96-well-plate wells. After adding 100 ul of the luciferase reagent as a substrate, the luminescence was immediately read on a luminometer.
Functionality Assay for the CD40L Transgene Product
[0083] To verify that the CD40L protein expressed from the double-transgene viruses is able to bind its native receptor CD40 and activate downstream signals on the CD40 expressing cells, a Ramos Blue cell-based functionality assay was performed (
[0084] Ramos Blue is a B lymphocyte cell line that stably expresses an NF-B-inducible SEAP (secreted embryonic alkaline phosphatase) reporter gene. The CD40L product is produced in the culture medium of a cell culture infected with a PeptiCRAd virus expressing CD40L gene. The medium is collected and added to a culture of Ramos Blue cells constitutively expressing the CD40 receptor. The binding of CD40L to CD40 triggers an intracellular signaling pathway that leads to the secretion of SEAP which turns a substrate blue, and that can be measured spectrophotometrically at 620-655 nm. The relative concentration of the functional CD40L is determined by using a standard curve for recombinant human CD40L.
[0085] Briefly, human A549 cells were plated on a 6-well-plate and infected with the double transgene viruses (OX40L/CD40L.C1 or OX40L/CD40L.C3), the virus with only OX40L (OX40L-virus) as a transgene or a virus with no transgenes (Ctrl-virus) with a multiplicity of infection of 10. Supernatant was collected 72 hours later and any cells and cell debris was removed by centrifugation at 500 g for 5 minutes. A 2-fold dilution series were prepared from the supernatants and of the recombinant CD40L protein with a starting concentration of 100 ug/ml. A 100 l of each supernatant was added to 410.sup.5 Ramos Blue cells in 96 well plate (plated in 100 l) and the plate was incubated at 37 C. for 18 hours. After incubation, the cells were pelleted by centrifuging at 400 g for 5 minutes, and 40 l of the supernatant was added to a new 96-well plate. 160 l of the QUANTI-Blue substrate was added, the plate was incubated for 1 hour and the SEAP level was determined spectrophotometrically.
Methods for the In Vivo Testing of the Modified Adenovirus with and without Peptide Antigen Coating
[0086] NOD/Shi-scid/IL-2Rnull immunodeficient mice were humanized using hematopoietic stem cells (CD34+, HLA-B35+) isolated from human cord blood. A375 human melanoma tumors were implanted subcutaneously (210.sup.6 cells per 100 ul) and the animals were randomized into groups based on the humanization rate and the tumor size. The animals were treated oncolytic virus without peptide coating (VALO-C1) or nclolytic virus with peptide antigen coating (PeptiCRAd) (virus dose 110.sup.8 for both groups; a suboptimal dose of 110.sup.7 was also tested for PeptiCRAd). Peptide vaccines (0.12 or 30 ug) were given intradermally with Poly-IC as an adjuvant.
[0087] The treatments started 25 days after randomization (D0) by a bolus dose of cyclophosphamide (1 mg/mouse i.v.). Treatments were given intratumorally (mock, virus and PeptiCRAd) or intradermally (peptide control) on days 1, 2, 3 and 12. Secondary tumors were implanted into the contralateral flank two days after the third treatment (day 5). No treatments for secondary tumors were given.
[0088] Peripheral blood mononuclear cells (PBMCs) and tumor infiltrating CD8+ lymphocytes (TILs) were analyzed for peptide antigen NY-ESO-1 and MAGE-specific CD8+ T-cells by flow cytometry with dextramer analysis. Different immune cell subsets among PBMCs and TILs were assessed. The flow cytometric analysis were performed on Attune NxT Flow Cytometer (Life Technologies).
PBMC Mouse Model Immunization
[0089] 35 eight-week old NOD-Prkdcem26Cd52/IL-2R em26Cd22/NjuCrl immunodeficient mice (NCG) were engrafted with 2.Math.10.sup.6 SKMEL-2 tumor cells (HLA-B35+) on the right flank (Day 0). On day 13, 510.sup.6 HLA-B35+ human peripheral blood mononuclear cells (PBMC) from two different donors were injected intravenously. Intratumoral treatments with NYESO-1 and MAGE-A3-complexed 5/3 capsid and containing OX40L-expressing virus (OX40L PeptiCRAd) or a NYESO-1 and MAGE-A3-complexed 5/3 capsid containing OX40L- and CD40L-expressing virus (PeptiCRAd)were initiated on Day 16 with a virus dose of 110.sup.9 VP complexed with each peptide. Concomitantly with the first PeptiCRAd treatment, 50000 autologous plasmacytoid and myeloid dendritic cells were injected intratumorally. On days 17, 18 (prime with the first treatment) and 25 (boost), the tumors were treated with intratumoral PeptiCRAd injections without addition of dendritic cells. The treatment schema is presented in
Results
[0090] Functionality of the OX40L Expressed from the Viruses
[0091] The flow cytometric analysis as well as the sandwich ELISA indicate that the OX40L transgene product expressed from the viruses onto the cell surface of the infected cell, as well as shed to some extent from the cell surface, is able to bind its receptor OX40 (
Functionality of the CD40L Expressed from the OX40L/CD40L-Expressing Viruses
[0092] A clear downstream gene activation was seen when analyzing the CD40L functionality utilizing Ramos Blue cells stably expressing CD40 receptor (
Modified Oncolytic Virus with and without Peptide Surface Antigen Elicits Peptide Specific Immune Response in a Humanized Mouse Model
[0093] All active treatments (peptide alone, virus without peptide [VALO-C1], and virus with peptide [PeptiCRAd]) increased the number of immune cells in primary tumors in comparison to mock treated animals. Both VALO-C1 and PeptiCRAd-1 treated animals showed more T-cells (CD3, CD4, CD8) in primary tumors in comparison to peptide vaccine or mock treated animals post treatment, while the number of overall infiltrating immune cells (CD45) was similar in all groups (
[0094] Furthermore, the number of T regulatory cells (CD3+/CD4+/FoxP3+) was smaller in VALO-C1 and PeptiCRAd-1 treated primary tumors in comparison to primary tumors from peptide vaccine or mock treated animals (
[0095] Oncolytic adenovirus with (PeptiCRAd) or without peptide antigen (VALO-C1) is superior to standard peptide vaccination in triggering systemic tumor-targeted CD8+ T-cell responses and infiltration of CD8+ TILs into untreated distant tumors. The data suggest that PeptiCRAd improves the tumor targeting specificity of a standard oncolytic virus.
PeptiCRAd Elicits Peptide-Specific Immune Response in a PBMC Mouse Model
[0096] Treatments with NY-ESO-1- and MAGE-A3-complexed PeptiCRAd resulted in tumor growth arrest in humanized mouse melanoma model even when the treatment was started for large, well established tumors (
REFERENCES
[0097] Kanerva et al 2003 Mol Ther 12:449-458. [0098] Fueyo et al 2000. Oncogene 19:2-12.
TABLE-US-00002 TABLE1 PrimersusedforthecloningofpAd5/3-D24-CD40L-OX40L. Primername Primersequence P2ArevOX40L 5CGCCGGCCTGCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCGCTCCTCCTCTTCCTAAGGACACAGAATTC ACCAGG3(SEQIDNO:4) P2AfwdCD40L 5AGCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCATGA TCGAAACATACAACCAAAC3(SEQIDNO:5) F2AfwdAdenoend 5ACTCAAACTCTGATAAAAAAAAATAATAAAGCATCACTTACTTAAAATCAGTTAGCAAATTTCTGTCC3 withoutinsertion (SEQIDNO:6) F2ArevOX40L 5TCGAAGTTCAGGGTCTGCTTCACGGGGGCCACGATCTTCTGCTTGTGCCTGGCCTCGCCGCTGCCGCTCC TCCTCTTCCTAAGGACACAGAATTCACCAGG3(SEQIDNO:7) F2AfwdCD40L 5AGAAGATCGTGGCCCCCGTGAAGCAGACCCTGAACTTCGACCTGCTGAAGCTGGCCGGCGA CGTGGAGAGCAACCCCGGCCCCATGATCGAAACATACAACCAAAC3(SEQIDNO:8) F2ArevCD40L 5-TAAGTGATGCTTTATTATTTTTTTTTATCAGAGTTTGAGTAAGCCAAAGGACGTGAAGCCAG3 (SEQIDNO:9) GibsonOX40LFW 5GCCGAAGTTCAGATGACTAACTCAG3(SEQIDNO:10) GibsonOX40LREV 5ATAGTGGGTGCGGATGGACAG3(SEQIDNO:11)
TABLE-US-00003 TABLE1b PrimerstoPCRfragmentAwithpAd5/3D24astemplate. Positionat Name Sensesequence Primer5-3 Tm pAd5/3D24 PrimerAA ACCGCAGTTGACAGCATTACC ACCGCAGTTGACAGCATTACC 57.9 21376-21396 (SEQIDNO:12) (SEQIDNO:13) PrimerBB TCCACGCCTTTGCCAACTGG CAGTTGGCAAAGGCGTGG 57.5 22097-22114 (SEQIDNO:14) (SEQIDNO:15)
TABLE-US-00004 TABLE2b PrimerstoPCRfragmentBwithpShuttle-CD40Lastemplate. Positionat pShuttle- Name Sensesequence Primer5-3 Tm CD40L PrimerCC GCCTGTGGACTATTCTGCTGC GCCTGTGGACTATTCTGCTGC 58.3 999-1019 (SEQIDNO:16) (SEQIDNO:17) PrimerB GTCTGGGCGTTAGGATACAGC GCTGTATCCTAACGCCCAGAC 57.5 2603-2623 (SEQIDNO:18) (SEQIDNO:19)
TABLE-US-00005 TABLE3b PrimerstoPCRfragmentCwithpAd5/3-D24astemplate. Positionat Name Sensesequence Primer5-3 Tm pAd5/3D24 PrimerC GCACCGTAGTGGCATCAAAAGG GCACCGTAGTGGCATCAAAAGG 58.3 22820-22841 (SEQIDNO:20) (SEQIDNO:21) PrimerDD CTACGTCATCTCCAGCGGC GCCGCTGGAGATGACGTAG 57.9 27089-27107 (SEQIDNO:22) (SEQIDNO:23)
TABLE-US-00006 TABLE4b PrimerstoPCROX40LinsertwithpShuttle-CX40Lastemplate. Position Primersequence Tm atOX40L Name Sensesequence (5.fwdarw.3) (C.) Block Gibson GCCGAAGTTCAGATGACTAACTCAG GCCGAAGTTCAGATGACTAACTCAG 62 11-37 OX40L (SEQIDNO:24) (SEQIDNO:25) FW Gibson CTGTCCATCCGCACCCACTAT ATAGTGGGTGCGGATGGACAG 62 3167-3187 OX40L (SEQIDNO:26) (SEQIDNO:27) REV