METHOD FOR N-BUTANOL PRODUCTION USING HETEROLOGOUS EXPRESSION OF ANAEROBIC PATHWAYS

20210017550 · 2021-01-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for the production of n-butanol using a transgenic cell with heterologous expression of 2-hydroxyglutarate dehydrogenase, glutaconate-CoA transferase, (R)-2-hydroxyglutaryl-CoA dehydrogenase, glutaryl CoA dehydrogenase, trans-2-enoyl-CoA reductase (NAD+) and bifunctional aldehyde/alcohol dehydrogenase (NAD+).

Claims

1. A method for production of n-butanol, wherein a transgenic cell heterologously expressing each of the following enzymes: a. 2-hydroxyglutarate dehydrogenase hgdH (EC 1.1.99.2.); b. glutaconate-CoA transferase gctAB (EC 2.8.3.12); c. (R)-2-hydroxyglutaryl-CoA dehydratase subunits A, B and C hgdABC (EC 4.2.1.167); d. glutaryl CoA dehydrogenase gcdH (EC 1.3.8.6.); e. trans-2-enoyl-CoA reductase (NAD+) ter (EC 1.3.1.44.); and f. a bifunctional aldehyde/alcohol dehydrogenase (NAD+) selected from adhE1 and adhE2 (EC 1.1.1.11/1.2.1.3.); is grown in a medium comprising a metabolic precursor of 2-oxoglutarate.

2. The method according to claim 1, wherein n-butanol is extracted from said medium.

3. The method according to claim 1, wherein said metabolic precursor of 2-oxoglutarate is selected from glucose, glycerol, glutamate or acetate.

4. The method according to claim 1, wherein the transgenic cell is a bacterium or a yeast cell.

5. The method according to claim 4, wherein the bacterium or the yeast cell is selected from genera Escherichia, Corynebacterium, Ralstonia, Clostridium, Pseudomonas, Lactobacillus, Lactococcus, Acidaminococcus, Fusobacterium, Peptoniphilus, Saccharomyces, Streptomyces Lactobacillus, Pichia, Kluyveromyces, Yarrowia, or Staphylococci, particularly Escherichia coli.

6. The method according to claim 1, wherein a. the protein hgdH is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdH of Acidaminococcus fermentans, more particularly hgdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 1 and has a catalytic activity of at least 75% of the activity of SEQ NO 1 and/or b. the protein gctAB is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said gctAB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to gctAB of Acidaminococcus fermentans, more particularly subunit A of gctAB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 2 and has a catalytic activity of at least 75% of the activity of SEQ NO 2 and/or subunit B of gctAB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 3 and has a catalytic activity of at least 75% of the activity of SEQ NO 3 and/or c. the A subunit of the protein hgd is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdA is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdA of Clostridium symbiosum, more particularly hgdA is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 4 and has a catalytic activity of at least 75% of the activity of SEQ NO 4 and/or d. the B subunit of the protein hgd is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdB of Clostridium symbiosum, more particularly hgdB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 5 and has a catalytic activity of at least 75% of the activity of SEQ NO 5 and/or e. the C subunit of the protein hgd is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdC is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdC of Acidaminococcus fermentans, more particularly hgdC is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 6 and has a catalytic activity of at least 75% of the activity of SEQ NO 6 and/or f. the protein gcdH is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said gcdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to gcdH of Pseudomonas aeruginosa, more particularly gcdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 7 and has a catalytic activity of at least 75% of the activity of SEQ NO 7 and/or g. the protein ter is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said ter is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to ter of Treponema denticola, more particularly ter is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 8 and has a catalytic activity of at least 75% of the activity of SEQ NO 8 and/or h. the protein adhE1 is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said adhE1 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to adhE1 of Clostridium acetobutylicum, more particularly adhE1 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 9 and has a catalytic activity of at least 75% of the activity of SEQ NO 9 and/or i. the protein adhE2 is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said adhE2 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to adhE2 of Clostridium acetobutylicum, more particularly adhE2 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 13 and has a catalytic activity of at least 75% of the activity of SEQ NO 13.

7. The method according to claim 1, wherein said transgenic cell comprises one or more plasmids encoding said heterologously expressed enzymes under control of a promoter sequence operable in said cell, particularly a T7 promoter, a lac promoter, a trp promoter, a tac promoter or a P.sub.L promoter.

8. The method according to claim 1, wherein said fermentation step is performed under anaerobic conditions at 25 to 37 C., particularly at 30 C.

9. The method according to claim 1, wherein the medium comprises 8-12 g.Math.L.sup.1 glucose, 8-10 g.Math.L.sup.1 dibasic sodium phosphate dihydrate, 6-8 g.Math.L.sup.1 monobasic potassium phosphate, 0.5-0.7 g.Math.L.sup.1 sodium chloride, 1.2-1.5 g.Math.L.sup.1 magnesium sulphate, 0.03-0.05 g.Math.L.sup.1 calcium chloride dihydrate, 0.8-1.2 g.Math.L.sup.1 ammonium chloride, and 8-12 mmol.Math.L.sup.1 sodium bicarbonate, 0.1-0.15 g.Math.L.sup.1 selenium, 0.08-0.12 g.Math.L.sup.1 nickel, 0.7-0.9 g.Math.L.sup.1 molybdenum, ampicillin, spectinomycin, and kanamycin and neutral pH, particularly pH 6.8-7.3.

10. The method according to claim 7, wherein said plasmid comprises a. a lac, tac or T7 promoter, and the expression of said heterologous genes is induced by adding IPTG (Isopropyl -D-1-thiogalactopyranosid) to the medium, particularly 0.1-1 mmol.Math.L.sup.1 IPTG, more particularly 0.5 mmol.Math.L.sup.1 IPTG; b. a trp promoter, and the expression of heterologous genes is induced by adding 3-b-indoleacrylic acid to the medium, at concentrations ranging from 10 g.Math.mL.sup.1 to 100 g/m.Math.L.sup.1; c. a P.sub.L promoter, and the expression of heterologous genes is induced by increasing the temperature to 42 C.

11. A transgenic cell, wherein the following enzymes are expressed: a. 2-hydroxyglutarate dehydrogenase hgdH (EC 1.1.99.2.); b. glutaconate-CoA transferase gctAB (EC 2.8.3.12); c. (R)-2-hydroxyglutaryl-CoA dehydratase subunits A, B and C hgdABC (EC 4.2.1.167); d. glutaryl CoA dehydrogenase gcdH (EC 1.3.8.6.); e. trans-2-enoyl-CoA reductase (NAD+) ter (EC 1.3.1.44.); and f. a bifunctional aldehyde/alcohol dehydrogenase (NAD+) selected from adhE1 and adhE2 (EC 1.1.1.11/1.2.1.3.); wherein at least 4 enzymes are expressed heterologously, particularly 5 or 6 enzymes are expressed heterologously.

12. The cell according to claim 11, wherein the cell is selected from genera Escherichia, Corynebacterium, Ralstonia, Clostridium, Pseudomonas, Lactobacillus, Lactococcus, Acidaminococcus, Fusobacterium, Peptoniphilus, Saccharomyces, Streptomyces Lactobacillus, Pichia, Kluyveromyces, Yarrowia, or Staphylococci, particularly Escherichia coli.

13. The cell according to claim 11, wherein a. the protein hgdH is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdH of Acidaminococcus fermentans, more particularly hgdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 1 and has a catalytic activity of at least 75% of the activity of SEQ NO 1 and/or b. the protein gctAB is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said gctAB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to gctAB of Acidaminococcus fermentans, more particularly gctAB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 2 and has a catalytic activity of at least 75% of the activity of SEQ NO 2 and/or subunit B of gctAB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 3 and has a catalytic activity of at least 75% of the activity of SEQ NO 3 and/or c. the A subunit of the protein hgd is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdA is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdA of Clostridium symbiosum, more particularly hgdA is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 4 and has a catalytic activity of at least 75% of the activity of SEQ NO 4 and/or d. the B subunit of the protein hgd is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdB of Clostridium symbiosum, more particularly hgdB is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 5 and has a catalytic activity of at least 75% of the activity of SEQ NO 5 and/or e. the C subunit of the protein hgd is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said hgdC is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to hgdC of Acidaminococcus fermentans, more particularly hgdC is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 6 and has a catalytic activity of at least 75% of the activity of SEQ NO 6 and/or f. the protein gcdH is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said gcdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to gcdH of Pseudomonas aeruginosa, more particularly gcdH is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 7 and has a catalytic activity of at least 75% of the activity of SEQ NO 7 and/or g. the protein ter is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said ter is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to ter of Treponema denticola, more particularly ter is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 8 and has a catalytic activity of at least 75% of the activity of SEQ NO 8 and/or h. the protein adhE1 is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said adhE1 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to adhE1 of Clostridium acetobutylicum, more particularly adhE1 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 9 and has a catalytic activity of at least 75% of the activity of SEQ NO 9 i. the protein adhE2 is encoded by a gene derived from a strictly or facultatively anaerobic bacterium, particularly said adhE2 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical, with respect to its amino acid sequence, to adhE2 of Clostridium acetobutylicum, more particularly adhE2 is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% identical to SEQ NO 13 and has a catalytic activity of at least 75% of the activity of SEQ NO 13.

14. The cell according to claim 11, wherein said cell comprises the sequences for said heterologously expressed enzymes under control of a promoter sequence operable in said cell, particularly a T7 promoter, a lac promoter, a trp promoter, a tac promoter or a P.sub.L promoter.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0161] FIG. 1 The proposed biosynthetic pathway to produce n-butanol from 2-oxoglutarate in E. coli with indication of the reactions catalysed by the enzymes. hgdH2-hydroxyglutarate dehydrogenase; gctABglutaconate-CoA transferase; hgdABC2-hydroxyglutaryl-CoA dehydratase; gcdHglutary-CoA dehydrogenase; tertrans-2-enoyl-CoA reductase, adhE1/adhE2aldehyde dehydrogenase and alcohol dehydrogenase 1 and 2.

[0162] FIG. 2 Construction of the recombinant plasmid pCDFDuet_gctAB_hgdH.

[0163] FIG. 3 Construction of the recombinant plasmid pRSFDuet_gcdH_hgdABC.

[0164] FIG. 4 Construction of the recombinant plasmid pETDuet_adhE1_ter.

[0165] FIG. 5 Construction of the recombinant plasmid pETDuet_adhE2_ter_opt

EXAMPLES

[0166] Materials and Methods:

[0167] Cloning Procedure

[0168] E. coli NEB 5-alpha cells were used for gene cloning and vector propagation. These strains were cultured in LB medium (10 g.Math.L.sup.1 of peptone; 5 g.Math.L.sup.1 yeast extract and 5 g.Math.L.sup.1 of NaCl) with the appropriate antibiotics concentration. The solid version of this medium included 15 g.Math.L.sup.1 agar. All cultivations were performed at 37 C. and, in the case of liquid cultures, under shaking conditions (200 rpm).

[0169] For long-term storage, glycerol was added to a final concentration of 30% to overnight cultures in selective media and kept in a 80 C. freezer.

[0170] The genes used in this study were amplified by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, USA) in a LifeECO Thermal Cycler (Bioer Technology, Zehjiang, China). All primers were purchased from Metabion (Munich, Germany). DNA fragments were purified using DNA Clean and Concentrator DNA Kit (Zymo Research, Irvine, USA).

[0171] Plasmids were extracted using Plasmid Miniprep kit (Zymo Research). All digestions were performed using the appropriate FastDigest restriction endonucleases (Thermo Scientific). Ligations were performed with T4 DNA Ligase (Thermo Scientific) and transformed by heat-shock in chemically competent cells E. coli NEB 5-alpha (New England BioLabs, Massachusetts, USA). The success of ligation was checked through Colony PCR using DreamTaq (Thermo Scientific) and further confirmed by sequencing (StabVida, Lisbon, Portugal). Protocols were performed in accordance with manufacturer's instructions.

[0172] hgdH, gcdH, hgdABC and gctAB genes were codon-optimized through ATGenium for E. coli, synthesized and cloned in vector pHTPO by NZYTech (Lisbon, Portugal). A optimized codon-sequence of adhE2 and ter_opt were synthesized by ATG:biosynthetics (Freiburg, Germany) and cloned in pUC-derivative plasmids.

[0173] Plasmid Construction

[0174] Compatible vectors pETDuet, pCDFDuet and pRSFDuet (Novagen, Darmstadt, Germany) were used to provide individual expression of each protein under the control of the T7lac promoter and a ribosome-binding site (RBS).

[0175] Sources of the cloned genes are shown in table 1.

TABLE-US-00001 TABLE 1 Sources of n-Butanol Pathway Genes and their sequences Name Abbreviation Reference Microorganism Type 2-Hydroxyglutarate hgdH EC 1.1.99.2 Acidaminococcus NS dehydrogenase NCBI GI: fermentans AS >gb|CP001859.1|:1104274- ATCC 25085 NS CO 1105269 NCBI GeneID: Acfer_0977 Glutaconate-CoA gctAB EC 2.8.3.12 Acidaminococcus NS (A) transferase gctA fermentans AS (A) NCBI GI ATCC 25085 NS CO (A) >gi|284047386:2019003- NS (B) 2019965 AS (B) NCBI GeneID: Acfer_1820 NS CO (B) gctB NCBI GI: >gi|284047386:2018200- 2019000 NCBI geneID: Acfer_1819 (R)-2-hydroxyglutaryl- hgdAB EC 4.2.1.- Clostridium NS (A) CoA dehydrogenase NCBI GI: symbiosum AS (A) subunits A and B >AF123384.1:1241-2683 ATCC 14940 NS CO (A) NCBI geneID: AF123384 NS (B) AS (B) NS CO (B) (R)-2-hydroxyglutaryl- hgdC EC 4.2.1.167 Acidaminococcus NS (C) CoA dehydrogenase NCBI GI: fermentans AS (C) Subunit C >gi|284047386:2015608- ATCC 25085 NS CO (C) 2016390 NCBI GeneID: Acfer_0168 Glutaryl-CoA gcdH EC 1.3.8.6 Pseudomonas NS dehydrogenase NCBI GI: >NP_249138.1 aeruginosa AS NCBI PAO1 NS CO GeneID: PANN_05040 trans-2-enoyl-CoA ter EC 1.3.1.44 Treponema NS reductase (NAD.sup.+) NCBI GI: denticola. AS >AE017226.1:636109- ATCC 35405 637302 NCBI GeneID: TDE_0597 Bifunctional Aldehyde/ adhE EC 1.1.1.11/1.2.1.3 Clostridium NS Alcohol NCBI GI: acetobutylicum AS dehydrogenase >CP002661.1:33722- pSMBa- (NAD.sup.+) 36298 DSM 1731 NCBI GeneID: adhE ATCC ID: DSM 1731 Aalpha subunit; Bbeta subunit B; Cgamma subunit C; NSNucleic Acid Sequence; ASAmino acid Sequence; COCodon Optimized

[0176] The plasmid pCDFDuet (Novagen) was used to clone the codon-optimized genes encoding the first two reactions of the proposed pathway (gctAB and hgdH.). hgdH was amplified using the primers hgdH fw and hgdH rev with flanking restriction sites for KpnI and XhoI and cloned into pCDFDuet. The PCR product for gctAB, amplified using primers gctAB_fw and gctAB_rev, was restricted and ligated into BamHI and HindIII restriction sites of the previous construction. Colony PCR with appropriate primers was used to find successful clones and the final plasmid was sent for sequencing to confirm the sequence was correct.

[0177] The plasmid pRSFDuet (Novagen) was used to clone the codon optimized genes hgdABC and gcdH, corresponding to the two intermediate steps of the proposed pathway. gcdH was amplified using the primers gcdH fw and gcdH rev with restriction sites to NdeI and XhoI and cloned in pRSFDuet. Then, hgdABC was inserted in the previous construction. This gene was amplified using primers hgdABC fw and hgdABC rev with restriction sites for SacI and NotI, respectively. Colony PCR with appropriate primers was used to find successful clones and the final plasmid was sent for sequencing to confirm the sequence was correct.

[0178] The plasmid pETDuet (Novagen) was used to clone the genes adhE1 and ter, corresponding to the last two genes of the proposed pathway. The adhE1 gene was amplified from template plasmid pmTA1 (Nielsen, et al. (2009), Metabolic engineering. Elsevier, 11(4-5), pp. 262-73.) using primers adhE1_fw and adhE1_rev with restriction sites for EcoRI and NotI, respectively. The synthetic gene ter (ATG:biosynthetics, Freiburg, Germany) was amplified using primers ter fw and ter rev; restricted and ligated into NdeI and XhoI restriction sites of the previous construction pETDuet_adhe1, resulting in the plasmid pETDuet_adhE1_ter. Colony PCR with appropriate primers was used to find successful clones and the final plasmid was sent for sequencing to confirm the sequence was correct.

[0179] Finally, the plasmid pETDuet (Novagen) was used to clone the genes adhE2 and ter_opt, corresponding to the last two genes of the proposed pathway. The codon-optimized synthetic gene ter_opt (ATG:biosynthetics, Freiburg, Germany) gene was directly digested with NdeI and KpnI and cloned in the respective restriction sites of pETDuet. The codon-optimized synthetic gene adhE2 (ATG:biosynthetics, Freiburg, Germany) was restricted and ligated into SacI and HindIII restriction sites of the previous construction pETDuet_ter, resulting in the plasmid pETDuet_adhE2_teropt.

[0180] In Table 2, the primers used in this study for PCR amplification are shown.

TABLE-US-00002 TABLE2 Sequencesofprimersusedinthecloningprocedures ofthisstudy(*restrictionsitesareunderlined). fwforward;revreverse SEQ Restriction Primer Sequence NO Sites* adhE1_fw CCGAATTCATGAAAGTCACAACAGTAAAGG 17 EcoRI adhE1_rev CCGCGGCCGCTTAAGGTTGTTTTTTAAAACAATT 18 NotI ter_fw CCCATATGATTGTAAAACC 19 NdeI ter_rev CCCTCGAGTTAAATC 20 XhoI hgdABC_fw CCGAGCTCATGAGTATCTATACCCTGGGC 21 SacI hgdABC_rev CCGCGGCCGCTTATTTTTGCATCTCCAAAAC 22 NotI gcdH_fw CCCATATGGCAACCAAAGCAAG 23 NdeI gcdH_rev CCCTCGAGTCAAAAGAACGCTTGAATACC 24 XhoI hgdH_fw CCGGTACCATGAAAGTGCTGTGCTACGG 25 KpnI hgdH_rev CCCTCGAGTTATTTGATTTTGTTCGGGC 26 XhoI gctAB_fw CCGGATCCATGAGCAAAGTCATGACCC 27 BamHI gctAB_rev CCAAGCTTTTATTTGGCTTCAGTTGGAAC 28 HindIII

[0181] The success of the plasmid constructions was confirmed by sequencing the regions of interest with the appropriate primers. In FIG. 2-4 and table 3 the plasmids used or constructed in this study, as well as the respective major features are shown.

TABLE-US-00003 TABLE 3 Plasmids used in this study Plasmid Construct Source pETDuet ColE1(pBR322) ori, lacl, double T7lac, AmpR Novagen pCDFDuet CloDF13 ori, lacl, double T7lac, StrepR Novagen pRSFDuet RSF ori, lacl, double T7lac, KanR Novagen pETDuet_adhE1_ter pETDuet carrying adhE1 from C. acetobutylicum This study and ter from T. denticola pCDFDuet_gctAB_hgdH pCDFDuet carrying codon-optimized gctAB and This study hgdH from A. fermentans pRSFDuet_gcdH_hgdABC pRSFDuet carrying codon-optimized hgdC from This study A. fermentans; hgdAB from Clostridium symbiosum and gcdH from Pseudomonas aeruginosa pETDuet_adhe2_ter_opt pETDuet carrying codon-optimized adhE2 from This study C. acetobutylicum and ter from T. denticola pmTA1 Gmr, lacl, taclac: thil, adhE Nielsen, D. R. et al. (2009) Elsevier, 11(4- 5), pp. 262-73.

[0182] Bacterial Strains

[0183] E. coli K12 MG1655 (DE3) and E. coli BL21 (DE3) were used as hosts for gene expression under control of T7 promoter. BUT_OXG1 and BUT_OXG2 strains were obtained by transforming E. coli BL21 (DE3) and E. coli K12 MG1655 (DE3), respectively, with pCDFDuet_gctAB_hgdH; pRSFDuet_gcdH_hgdABC and pETDuet_adhE1_ter by electroporation. The control strains Control_OXG1 and Control_OXG2 were obtained, by transforming, respectively, E. coli BL21 (DE3) and E. coli K12 MG1655 (DE3) with the plasmids expressing only the last five enzymes of the pathway (pRSFDuet_gcdH_hgdABC and pETDuet_adhE1_ter). Electrocompetent cells were prepared using the protocol developed by (Dower, et al. (1988), Nucleic Acids Research, 16(13), pp. 6127-6145) and transformed using 0.1 cm-gap electroporation cuvettes at a voltage of 1.8 KV. Positive transformants were isolated in LB (containing 10 g.Math.L.sup.1 of peptone; 5 g.Math.L.sup.1 yeast extract and 5 g.Math.L.sup.1 of NaCl) agar (15 g.Math.L.sup.1) plates, containing the appropriate antibiotic concentrations (50 g.Math.mL.sup.1 ampicillin, 50 g.Math.mL.sup.1 spectinomycin and 30 g.Math.mL.sup.1 kanamycin) and incubated at 37 C., overnight. To confirm the success of the transformation, a few transformant colonies were cultivated in LB medium with antibiotics, overnight. After, plasmids were extracted and digested with appropriate restriction enzymes. The correct fragment lengths were confirmed by running the digestion in a 1% (w/v) agarose gel.

[0184] BUT_OXG3 was constructed in the same fashion described above but expressing codon-optimized sequences of ter from Treponoema denticola and adhE2 from Clostridium acetobutylicum.

TABLE-US-00004 TABLE 4 List of strains and genomic DNA used or engineered for this study Strains Relevant genotype Source E. coli K12 MG1655 F--ilvGrfb-50 rph-1 (DE3) Nielsen, et al. (DE3) (2009), Metabolic engineering. Elsevier, 11(4-5), pp. 262-73.) E. coli BL21 (DE3) fhuA2 [lon] ompT gal ( DE3) [dcm] hsdS New England DE3 = sBamHlo EcoRI-B Labs int::(lacl::PlacUV5::T7 gene1) i21 nin5 BUT_OXG1 E. coli BL21 DE3 pETDuet_adhE1_ter; This study pCDFDuet_gctAB_hgdH; pRSFDuet_gcdH_hgdABC BUT_OXG2 E. coli K12 MG1655 DE3 pETDuet_adhE1_ter; This study pCDFDuet_gctAB_hgdH; pRSFDuet_gcdH_hgdABC Control_OXG1 E. coli BL21 DE3 pETDuet_adhE1_ter; This study pRSFDuet_gcdH_hgdABC Control_OXG2 E. coli K12 MG1655 DE3 pETDuet_adhE1_ter; This study pRSFDuet_gcdH_hgdABC BUT_OXG3 E. coli K12 MG1655 DE3 pETDuet_adhE2_ter_opt; This study pCDFDuet_gctAB_hgdH; pRSFDuet_gcdH_hgdABC

[0185] Table 4 summarizes the strains of E. coli used or engineered for this study.

[0186] Enzymatic Assays

[0187] Table 5 lists the enzymatic reactions and table 6 lists the enzymatic assays for the heterologous enzymes in n-butanol production. The stated reactions are the basis for any reactivity quantities stated herein, unless explicitly stated otherwise.

TABLE-US-00005 TABLE 5 Enzymatic reactions. Equation Reaction Enzyme EC No. Code number 2-oxoglutarate + NADH + H.sup.+ = (S)-2- 2-hydroxyglutarate 1.1.99.2 hgdH Eq. i hydroxyglutarate + NAD.sup.+ dehydrogenase (NADH) acetyl-CoA + (S)-2-hydroxyglutarate = acetate + glutaconate CoA- 2.8.3.12 gctAB Eq. ii (R)-2-hydroxyglutaryl-CoA transferase (R)-2-hydroxyglutaryl-CoA = (E)-glutaconyl- (R)-2-hydroxyglutaryl- 4.2.1.167 hgdABC Eq. iii CoA + H.sub.2O CoA dehydratase (E)-glutaconyl-CoA = crotonyl-CoA + CO.sub.2 glutaryl-CoA 1.3.8.6 gcdH Eq. iv dehydrogenase (ETF) crotonyl-CoA + NADH + H.sup.+ = butanoyl-CoA + trans-2-enoyl-CoA 1.3.1.44 ter Eq. v NAD.sup.+ reductase (NAD.sup.+) butanal + NAD.sup.+ + H.sub.2O = butanoyl-CoA + aldehyde 1.2.1.3 adhE Eq. vi NADH + H.sup.+ dehydrogenase (NAD.sup.+) n-butanol + NAD.sup.+ = butanal + NADH + H.sup.+ alcohol 1.1.1.1 adhE Eq. vii dehydrogenase (NAD.sup.+)

[0188] The above named compound are also referred to as the following synonyms:

[0189] 2-oxoglutarate: 2-Oxopentanedioic acid; 2-Ketoglutaric acid; alpha-Ketoglutaric acid; 2-Oxoglutaric acid; Oxoglutaric acid; 2-oxopentanedioate; 4-carboxy-2-oxobutanoate; 2-ketoglutarate; 2-oxopentanedioic acid; -ketoglutarate.

[0190] 2-hydroxyglutarate: 2-hydroxypentanedioate.

[0191] 2-hydroxyglutaryl-CoA: 3-phosphoadenosine 5-{3-[(3R)-4-{[3-({2-[(4-carboxy-2-hydroxybutanoyl)sulfanyl]ethyl}amino)-3-oxopropyl]amino}-3-hydroxy-2,2-dimethyl-4-oxobutyl] dihydrogen diphosphate} 2-hydroxyglutaryl-coenzyme A.

[0192] Glutaconyl-CoA: 5-[2-[3-[[4-[[[5-(6-aminopurin-9-yl)-4-hydroxy-3-phosphonooxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-hydroxyphosphoryl]oxy-2-hydroxy-3,3-dimethylbutanoyl]amino]propanoylamino]ethylsulfanyl]-5-oxopent-3-enoic acid

[0193] Crotonyl-CoA: E)-but-2-enoyl-CoA; Crotonoyl-CoA; trans-But-2-enoyl-CoA; trans-butyr-2-enoyl-CoA.

[0194] Butanoyl-CoA: butyryl-CoA; butanoyl-coenzyme A; Butyryl-coenzyme A.

[0195] Butanal: Butyraldehyde; 1-Butanal; Butaldehyde; Butyl aldehyde; n-Butanal.

[0196] n-Butanol: Butan-1-ol; Butalcohol; Butanol; 1-Butanol; Butyl alcohol; Butyl hydrate; Butylic alcohol; Butyralcohol; Butyric alcohol; Butyryl alcohol; n-Butyl alcohol; 1-Hydroxybutane; n-Propylcarbinol; 1-butyl alcohol.

TABLE-US-00006 TABLE 6 Enzymatic Assays used for individual enzyme activities used in pathway for n-butanol production Enzyme EC No. Assay Reference 2-hydroxyglutarate 1.1.99.2 Kranendijk M. et al., J. Inherit dehydrogenase Metab. Dis. (2009), 32(6):713-19. glutaconate CoA- 2.8.3.12 Charrier C. et al. Microbiology transferase (2006), 152, 179-185. (R)-2-hydroxyglutaryl- 4.2.1.167 Schweiger G. et al. Arch. CoA dehydratase Microbiol. (1984), 137:302-307. glutaryl-CoA 1.3.8.6 Estelmann S. et al. FEBS J. dehydrogenase (ETF) (2014( ), 4:5120-5131. trans-2-enoyl-CoA 1.3.1.44 Bond-Watts B. et al. Nature Chem. reductase (NAD.sup.+) Biol. (2011), 7:22-27. aldehyde dehydrogenase 1.2.1.3 Guro S. et al. Alcohol. (1990), (NAD.sup.+) 7(5):397-401. alcohol dehydrogenase 1.1.1.1 Guro S. et al. Alcohol. (1990), (NAD.sup.+) 7(5):397-401.

[0197] The above named enzymes are also referred to as the following synonyms:

[0198] 2-hydroxyqlutarate dehydrogenase: L-2-hydroxyglutarate dehydrogenase; L-alpha-hydroxyglutarate dehydrogenase; alpha-hydroxyglutarate dehydrogenase; alpha-hydroxyglutarate oxidoreductase; (S)-2-hydroxyglutarate:acceptor 2-oxidoreductase; alpha-ketoglutarate reductase; hydroxyglutaric dehydrogenase; L-2-hydroxyglutaric acid dehydrogenase.

[0199] glutaconate CoA-transferase: (E)-glutaconate CoA-transferase; glutaconate CoA-transferase; Acetyl-CoA:(E)-glutaconate CoA-transferase.

[0200] (R)-2-hydroxyglutaryl-CoA dehydratase: (R)-2-hydroxyglutaryl-CoA hydro-lyase ((E)-glutaconyl-CoA-forming).

[0201] glutaryl-CoA dehydrogenase: glutaryl-coenzyme A dehydrogenase; Glutaryl-CoA dehydrogenase.

[0202] trans-2-enoyl-CoA reductase: mitochondrial 2-trans-enoyl-CoA/ACP reductase; NADPH-dependent trans-2-enoyl-CoA reductase; 2-trans enoyl-ACP(CoA) reductase; trans-2-enoyl-CoA reductase (NADPH); mitochondrial 2-trans-enoyl-thioester reductase.

[0203] bifunctional aldehyde/alcohol dehydrogenase: aldehyde dehydrogenase; aldehyde reductase; aldehyde/alcohol dehydrogenase; aliphatic alcohol dehydrogenase; ethanol dehydrogenase; NAD+-dependent alcohol dehydrogenase; NAD-dependent alcohol dehydrogenase; NAD-specific aromatic alcohol dehydrogenase; NADH-alcohol dehydrogenase; NADH-aldehyde dehydrogenase; NADH-dependent alcohol dehydrogenase.

[0204] Butanol Production Experiments in Complex Medium

[0205] The strains BUT_OXG1 and BUT_OXG2 were cultivated in Terrific Broth (TB) medium supplemented with glucose, glutamate, riboflavin and iron (III) citrate according to composition shown in table 7. The pH of this medium was 7.20.2 at 25 C.

TABLE-US-00007 TABLE 7 Medium composition of Terrific Broth. Component Amount per Liter Unit Tryptone 12 g Yeast extract 24 g Glycerol 4 mL Monobasic potassium phosphate 2.31 g Dibasic potassium phosphate 12.54 g Glutamate 0.468 g Riboflavin 0.07529 g Iron (III) citrate 0.525 g Glucose 10 g

[0206] A single colony was picked from Luria-Bertani (LB) plates and inoculated in 10 mL of LB medium (Table 8).

TABLE-US-00008 TABLE 8 LB medium composition. Component Amount per Liter Unit Tryptone 10 g Yeast extract 5 g Sodium Chloride 10 g

[0207] Cultivation was performed with the addition of suitable antibiotics according to the employed plasmids (50 g.Math.mL.sup.1 ampicillin, 50 g.Math.mL.sup.1 spectinomycin, and 30 g.Math.mL.sup.1 kanamycin). The pre-cultures were grown aerobically on a rotary shaker at 37 C. and 200 rpm, overnight.

[0208] 500 mL shake flasks with 100 mL of TB medium, containing appropriate antibiotics, were inoculated with pre-cultures to obtain an initial optical density OD.sub.600 of 0.1. Cultivation was carried on a rotary shaker at 200 rpm at 37 C. The butanol production genes were induced by the addition of 0.1, 0.5 or 1 mmol.Math.L.sup.1 isopropyl 1-thio--D-galactopyranoside (IPTG) to the culture medium when an optical density OD.sub.600 of 0.4-0.5 was reached.

[0209] To promote butanol production, after induction, the cells were switched to anaerobic conditions by transferring 60 mL of culture to 120 mL sealed serum flasks. The culture was supplemented with 600 L of a 0.01 M stock solution of sodium bicarbonate to achieve a final concentration of 10 mmol.Math.L.sup.1, since it reduces long lag phases in E. coli anaerobic growth (Hornsten (1995), Bioprocess Engineering, 12, pp. 157-162.).

[0210] The cultures were incubated at 30 C. and 180 rpm, for 96 hours. Samples of culture broth were collected at time 0, during induction time and at 96 h. All the experiments were performed in triplicate and the samples were analysed by High-Performance Liquid Chromatography (HPLC) and Gas Chromatography (GC).

[0211] Butanol Production Experiments in Defined Medium

[0212] The strains BUT_OXG1 and BUT_OXG2 were cultivated in High Density Medium (HDM) adapted from (Sivashanmugam, A. et al. (2009), 18(1), pp. 936-948.), supplemented with a solution of amino acids, extra glutamate, riboflavin and iron citrate (III), according to table 9. The pH of the medium was adjusted to 7.1 using 2 mol.Math.L.sup.1 NaOH.

TABLE-US-00009 TABLE 9 Medium composition of HDM, adapted from (Sivashanmugam (2009) ibid) Component Amount per Liter Unit Glucose 10 g Dibasic sodium phosphate dihydrate 8.89 g Monobasic potassium phosphate 6.8 g Sodium chloride 0.58 g Magnesium sulphate 1.35 g Calcium chloride dihydrate 0.038 g Ammonium chloride 1 g Trace metals 250 L Vitamins BME100x 250 L Amino acid mix 2 g Glutamate 0.468 g Riboflavin 0.07529 g Iron (III) citrate 0.525 g

[0213] The trace metals solution contained (per liter): FeSO.sub.4.7H.sub.2O (30 mg); ZnSO.sub.4.7H.sub.2O (45 mg); CaCl.sub.2.2H.sub.2O (45 mg); MnCl.sub.2.2H.sub.2O (100 mg); CoCl.sub.2.6H.sub.2O (30 mg); CuSO.sub.4.5H.sub.2O (30 mg); Na.sub.2MoO.sub.4.2H.sub.2O (40 mg); H.sub.3BO.sub.3 (10 mg); KI (10 mg) and Na.sub.2EDTA (1.5 g). The amino acid mix contained 1 g of adenine and 4 g of arginine, aspartate, glutamate, histidine, isoleucine, lysine, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine and valine. The vitamin BME 100 solution (Sigma Aldrich, St. Louis, Mo., USA) contained (per liter): D-biotin (0.1 g); choline chloride (0.1 g); folic acid (0.1 g); myo-inositol (0.2 g); niacinamide (0.1 g); D-pantothenic acid. % Ca (0.1 g); riboflavin (0.01 g); thiamine.HCl (0.1 g) and NaCl (8.5 g).

[0214] For the pre-cultures, a single colony was picked from Luria-Bertani (LB) plates and inoculated in 10 mL of LB medium. Cultivation was performed with the addition of suitable antibiotics according to the employed plasmids (50 g.Math.mL.sup.1 ampicillin, 50 g.Math.mL.sup.1 spectinomycin, and 30 g.Math.mL.sup.1 kanamycin). The pre-cultures were grown aerobically on a rotary shaker at 37 C. and 200 rpm, overnight. Cells were washed and harvested by centrifugation (10 min at 3000g). Afterwards, an appropriate volume of pre-culture was transferred to 500 mL shake flasks with 100 mL of HDM medium, containing the appropriate antibiotics, yielding an initial OD.sub.600 of 0.1. This culture was cultivated on a rotary shaker at 200 rpm at 37 C. The butanol production genes were induced with 0.1, 0.5 or 1 mmol.Math.L.sup.1 isopropyl 1-thio--D-galactopyranoside (IPTG) at an OD.sub.600 of 0.4-0.5.

[0215] After induction, 60 mL of the culture were transferred to 120 mL sealed serum flasks to promote butanol production under anaerobic conditions. The culture was supplemented with 600 L of a 0.01 mol.Math.L.sup.1 stock solution of sodium bicarbonate to achieve a final concentration of 10 mmol.Math.L.sup.1 (to reduce lag phases in E. coli anaerobic growth (Hornsten, 1995, Bioprocess Engineering, 12, pp. 157-162)). Selenium, nickel and molybdenum are part of the formate hydrogen lyase (FHL) complex, which is induced under anaerobic conditions. For this reason, 60 L of a solution of extra trace metals (NiCl.sub.2(1.7 mg.Math.L.sup.1); (NH.sub.4).sub.6Mo.sub.7O.sub.24 (14.5 mg.Math.L.sup.1); 4H.sub.2O Na.sub.2SeO.sub.3 (2.4 mg.Math.L.sup.1)) was supplied to the medium.

[0216] The cultures were incubated at 30 C. and 180 rpm, for 96 hours. Samples of supernatant were collected at time 0, induction time and 96 h. All the experiments were performed in triplicate and the samples were analysed by GC.

[0217] Analytical Methods

[0218] Samples were centrifuged at 6000g for 10 min to separate cells from the medium. Afterwards, the supernatant was filtered with a 0.22 m pore filter membrane to glass vials and stored at 20 C. until analysed.

[0219] Butanol concentration was quantified by a Gas Chromatograph GP-9000 system (Chrompack) with a Meta-WAX capillary column (30 m0.25 mm0.25 m) equipped with a flame ionization detector (FID); helium was used as carrier gas with a flow rate of 1 mL.Math.min.sup.1. The filtered supernatant (900 L) was mixed with 100 L of a 5 g.Math.L.sup.1 solution of isobutanol, the internal standard, yielding a final concentration of 0.5 g.Math.L.sup.1, and 1 L of this mixture was injected. The temperature of injector and detector were maintained at 250 C. The column was initially at 50 C., heated to 177.5 C. at a 5 C..Math.min.sup.1 rate and then heated to 230 C. at 10 C..Math.min.sup.1, which was held for 15 minutes. A calibration curve was obtained by injecting standards with several concentrations of butanol and a fixed concentration of internal standard (0.5 g.Math.L.sup.1 of isobutanol). Butanol concentration was calculated by comparing the ratio between its peak area and internal standard peak area with calibration curves.

[0220] All cell optical density measurements at 600 nm (OD.sub.600) were performed using the spectrophotometer Ultrospec 10 from Biochrom (Cambridge, UK).

Example 1

[0221] Preparation of a n-Butanol Producing Microbial Organism Having a Pathway Coupling the Enzymes Glutaryl-CoA Dehydrogenase and Trans-2-Enoyl-CoA Reductase in Complex Medium.

[0222] This example describes the generation of a microbial organism capable of producing n-butanol from 2-oxoglutarate in complex medium. Escherichia coli is used as target organism to engineer the butanol pathway shown in FIG. 1, where glutaryl-CoA dehydrogenase activity was coupled to enzymes activities of 2-hydroxyglutarate dehydrogenase, glutaconate-CoA transferase, 2-hydroxyglutaryl-CoA dehydratase, trans-2-enoyl-CoA reductase, aldehyde dehydrogenase and alcohol dehydrogenase. The resulting genetically engineered strains of E. coli, BUT_OXG1 and BUT_OXG2, were used for butanol production by cultivation in Terrific Broth (TB) medium. Butanol production 96 h after inoculation is shown in Table 10.

TABLE-US-00010 TABLE 10 Butanol production in TB medium 96 h after inoculation. Butanol (mg .Math. L.sup.1) IPTG (mmol .Math. L.sup.1) BUT_OXG1 BUT_OXG2 1 4.5 0.1 16.07 2.3 0.5 6.8 0.46 24.05 4.6 0.1 3.2 0.05 7.25 0.8

Example 2

[0223] Preparation of a Producing Microbial Organism Having a Pathway Coupling the Enzymes Glutaryl-CoA Dehydrogenase and Trans-2-Enoyl-CoA Reductase Capable to Produce n-Butanol from 2-Oxoglutarate in Defined Medium.

[0224] This example describes the generation of a microbial organism capable of producing butanol from 2-oxoglutarate in a defined medium. Escherichia coli is used as target organism to engineer the butanol pathway shown in FIG. 1, where glutaryl-CoA dehydrogenase activity was coupled to enzymes activities of 2-hydroxyglutarate dehydrogenase, glutaconate-CoA transferase, 2-hydroxyglutaryl-CoA dehydratase, trans-2-enoyl-CoA reductase, aldehyde dehydrogenase and alcohol dehydrogenase. Butanol production 96 h after inoculation is shown in Table 11.

TABLE-US-00011 TABLE 11 Butanol production in defined medium 96 h after inoculation. Butanol (mg .Math. L.sup.1) IPTG (mmol .Math. L.sup.1) BUT_OXG1 BUT_OXG2 1 7.0 0.59 59.95 6.14 0.5 29.04 1.72 75.32 4.21 0.1 5.6 0.05 20.96 2.86

Example 3

[0225] Negative Control for the n-Butanol Producing Microbial Organism Having a Pathway where Glutaryl-CoA Dehydrogenase Activity was Coupled Only to Enzymes Activities of 2-Hydroxyglutaryl-CoA Dehydratase, Trans-2-Enoyl-CoA Reductase, Alcohol Dehydrogenase and Aldehyde Dehydrogenase.

[0226] This example describes the generation of a microbial organism incapable of producing butanol from 2-oxoglutarate. This example is considered as negative control since the absence of coupled enzymes will lead to an n-butanol unproductive microbial organism. Butanol production 96 h after inoculation is shown in Table 12. The method detection limit is 3 mg.Math.L.sup.1.

TABLE-US-00012 TABLE 12 Butanol production in TB and defined medium 96 h after inoculation from a strain lacking hgdH and gctAB. Butanol final titer (mg .Math. L.sup.1) Strain TB HDM Ct_OXG1 n.d. n.d. Ct_OXG2 n.d. n.d. n.d.: not detectable.

Example 4

[0227] Preparation of a n-Butanol Producing Microbial Organism Having a Pathway where Glutaryl-CoA Dehydrogenase Activity was Coupled to Enzymes Activities of 2-Hydroxyglutaryl-CoA Dehydratase, Trans-2-Enoyl-CoA Reductase, Alcohol Dehydrogenase and Aldehyde Dehydrogenase in Aerobic Conditions.

[0228] This example describes the generation of a microbial organism incapable of producing butanol from 2-oxoglutarate. This example is considered as negative control since the absence of anaerobic conditions will lead to an n-butanol unproductive microbial organism. Butanol production 96 h after inoculation is shown in Table 13. The method detection limit is 3 mg. L.sup.1.

TABLE-US-00013 TABLE 13 Butanol production under aerobic conditions in TB and HDM medium 96 h after inoculation. Butanol final titer (mg .Math. L.sup.1) Strain TB HDM BUT_OXG1 n.d. n.d. BUT_OXG2 n.d. n.d. n.d.: not detectable.

Example 5

[0229] Optimizing the n-Butanol Production

[0230] Three factors were changed to increase n-butanol production.

[0231] In the first task, the switch to serum bottles was delayed by 4 and 12 h after IPTG induction. By doing so, the butanol titer was increased by 1.6-fold (to 1298 mg.Math.L.sup.1 for 12 h delay).

[0232] Secondly, alcohol dehydrogenase 1 (adhE1) was replaced by alcohol dehydrogenase 2 (adhE2). Reportedly, the protein-product of adhE2 has more activity in E. coli. A codon-optimized sequence of the adhE2 gene (WT: SEQ NO 14, codon-optimized: SEQ NO 15) and of the gene encoding the trans-2-enoyl-reductase (ter) (SEQ NO 16) were cloned and expressed in E. coli obtaining BUT_OXG3 strain. These two genes were the only ones that were not codon-optimized in the previous engineered strains. The maximum butanol titer obtained in the experiments with the codon-optimized strains was 1722 mg.Math.L.sup.1 (with a switch to serum bottles 12 h after IPTG induction).

[0233] Thirdly, the medium was supplemented with extra glutamate (2 g.Math.L.sup.1) at the anaerobic switch moment. The conditions of this last experiment were the following: the working volume was reduced from 60 mL to 40 mL and the switch to anaerobic conditions was 4 h after the IPTG induction. The maximum butanol titer obtained in this experiment was 1872 mg.Math.L.sup.1.