Recombinantly-Modified Adeno-Associated Virus Helper Vectors and Their Use to Improve the Packaging Efficiency of Recombinantly-Modified Adeno-Associated Virus
20210017538 ยท 2021-01-21
Assignee
Inventors
Cpc classification
C12N2750/14152
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2800/40
CHEMISTRY; METALLURGY
C12N5/0601
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention is directed to recombinantly-modified adeno-associated virus (AAV) helper vectors that are capable of increasing the packaging efficiency of recombinantly-modified adeno-associated virus (rAAV) and their use to improve the packaging efficiency of such rAAV. The present invention is particularly directed to recombinantly-modified adeno-associated virus (AAV) helper vectors that have been further modified to replace (or augment) the P5 and/or P40 promoter sequences that are natively associated with the Rep proteins encoded by such rAAV with AAV P5 and/or P40 promoters that are associated with the Rep proteins of an rAAV of different serotype. The use of such substitute or additional promoter sequences causes increased production of recombinantly-modified adeno-associated virus.
Claims
1-19. (canceled)
20. A method for increasing the production titer of a recombinantly-modified adeno-associated virus (rAAV) that comprises a transgene cassette that is flanked by inverted terminal repeated sequences, wherein said method comprises culturing human embryonic kidney cells or baby hamster kidney cells transfected with: (1) an rAAV plasmid vector that comprises said transgene cassette flanked by said inverted terminal repeated sequences; and (2) an rAAV helper vector that comprises an AAV helper function-providing polynucleotide, wherein said polynucleotide comprises an AAV P5 promoter sequence, an AAV P40 promoter sequence, an AAV Cap encoding sequence, and an AAV Rep encoding sequence, and is capable of expressing an AAV Rep52 protein and an AAV Rep78 protein; wherein said AAV Rep encoding sequence is under the transcriptional control of said AAV P5 promoter sequence, and said AAV Cap encoding sequence is under the transcriptional control of said AAV P40 promoter sequence; and wherein said AAV P5 promoter sequence is not native to said AAV Rep encoding sequence and/or said AAV P40 promoter sequence is not native to said AAV Cap encoding sequence; and (3) an Ad helper plasmid vector that comprises a polynucleotide encoding viral transcription and translation factors required for the replication and packaging of rAAV; wherein said culturing is conducted in a culture medium under conditions sufficient to permit the production of said rAAV and wherein: (A) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV3, the P5 promoter of AAV5, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2; or (B) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1 or the P40 promoter of AAV8; or (C) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV3 or the P5 promoter of AAV5, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1; or (D) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV2, the P5 promoter of AAV3, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV6 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2; or (E) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV1 Cap encoding sequence, an AAV5 Cap encoding sequence or an AAV7 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2; wherein the presence of said AAV P5 promoter sequence that is not native to said AAV Rep coding sequence and/or the presence of said AAV P40 promoter sequence that is not native to said AAV Cap coding sequence causes said cells to produce said rAAV at a production titer that is increased relative to that which would be attained if said P5 promoter sequence were native to said Rep encoding sequence and said AAV P40 promoter sequence were native to said Cap encoding sequence.
21. The method of claim 20, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV3, the P5 promoter of AAV5, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2.
22. The method of claim 20, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, and (2) said AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1 or the P40 promoter of AAV8.
23. The method of claim 20, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV3 or the P5 promoter of AAV5, and (2) said AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1.
24. The method of claim 20, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV2, the P5 promoter of AAV3, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said AAV6 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2.
25. The method of claim 20, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said AAV1, AAV5 or AAV7 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2.
26. The method of claim 20, wherein said method comprises culturing human embryonic kidney cells.
27. The method of claim 26, wherein said human embryonic kidney cells are HEK 293 human embryonic kidney cells.
28. The method of claim 20, wherein said method comprises culturing baby hamster kidney cells.
29. The method of claim 28, wherein said baby hamster kidney cells are BHK21 baby hamster kidney cells.
30. The method of claim 20, wherein said transgene cassette encodes a protein, or comprises a polynucleotide domain that is transcribed into an RNA molecule, wherein said protein or said RNA molecule is therapeutic for a disease or a condition that is genetic or heritable.
31. The method of claim 30, wherein said transgene cassette encodes a protein that is therapeutic for said disease or said condition that is genetic or heritable.
32. The method of claim 30, wherein said transgene cassette comprises a polynucleotide domain that is transcribed into an RNA molecule that is therapeutic for said disease or said condition that is genetic or heritable.
33. The method of claim 30, wherein said disease or said condition that is genetic or heritable is: achromatopsia (ACHM); alpha-1 antitrypsin (AAT) deficiency; Alzheimer's Disease; aromatic L-amino acid decarboxylase (AADC) deficiency; choroideremia (CHM); cancer; Duchenne muscular dystrophy; dysferlin deficiency; follistatin gene deficiency (BMDSIBM); hemophilia A; hemophilia B; hepatitis A; hepatitis B; hepatitis C; Huntington's disease; idiopathic Parkinson's disease; late-infantile neuronal ceroid lipofuscinosis (LINCL, an infantile form of Batten disease); Leber congenital amaurosis (LCA); Leber's hereditary optic neuropathy (LHON); limb girdle muscular dystrophy 1B (LGMD1B); limb girdle muscular dystrophy 1C (LGMD1C); limb girdle muscular dystrophy 2A (LGMD2A); limb girdle muscular dystrophy 2B (LGMD2B); limb girdle muscular dystrophy 2I (LGMD2I); limb girdle muscular dystrophy 2L (LGMD2L); lipoprotein lipase (LPL) deficiency; metachromatic leukodystrophy; neurological disability; neuromotor deficit; neuroskeletal impairment; Parkinson's disease; rheumatoid arthritis; Sanfilippo A syndrome; spinal muscular atrophy (SMA); X-linked retinoschisis (XLRS); -sarcoglycan deficiency (LGMD2D); -sarcoglycan deficiency (LGMD2E); -sarcoglycan deficiency (LGMD2C); or -sarcoglycan deficiency (LGMD2F).
34. A method for increasing the production titer of a recombinantly-modified adeno-associated virus (rAAV) that comprises a transgene cassette that is flanked by inverted terminal repeated sequences, wherein said method comprises culturing human embryonic kidney cells or baby hamster kidney cells transfected with: (1) an rAAV plasmid vector that comprises said transgene cassette flanked by said inverted terminal repeated sequences; and (2) an rAAV helper vector that comprises: (a) an AAV helper function-providing polynucleotide portion that comprises an AAV P5 promoter sequence, an AAV P40 promoter sequence, an AAV Cap encoding sequence, and an AAV Rep encoding sequence, and is capable of expressing an AAV Rep52 protein and an AAV Rep78 protein; wherein said AAV Rep encoding sequence is under the transcriptional control of said AAV P5 promoter sequence, and said AAV Cap encoding sequence is under the transcriptional control of said AAV P40 promoter sequence; and wherein said AAV P5 promoter sequence is not native to said AAV Rep encoding sequence and/or said AAV P40 promoter sequence is not native to said AAV Cap encoding sequence; and (b) a non-AAV helper function-providing polynucleotide portion that encodes viral transcription and translation factors required for the replication and packaging of rAAV; wherein said culturing is conducted in a culture medium under conditions sufficient to permit the production of said rAAV and wherein: (A) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV3, the P5 promoter of AAV5, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2; or (B) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1 or the P40 promoter of AAV8; or (C) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV3 or the P5 promoter of AAV5, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1; or (D) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV2, the P5 promoter of AAV3, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV6 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2; or (E) (1) said Rep encoding sequence of said rAAV helper vector is an AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said Cap encoding sequence of said rAAV helper vector is an AAV1 Cap encoding sequence, an AAV5 Cap encoding sequence or an AAV7 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2; wherein the presence of said AAV P5 promoter sequence that is not native to said AAV Rep coding sequence and/or the presence of said AAV P40 promoter sequence that is not native to said AAV Cap coding sequence causes said cells to produce said rAAV at a production titer that is increased relative to that which would be attained if said P5 promoter sequence were native to said Rep encoding sequence and said AAV P40 promoter sequence were native to said Cap encoding sequence.
35. The method of claim 34, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV3, the P5 promoter of AAVS, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2.
36. The method of claim 34, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, and (2) said AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1 or the P40 promoter of AAV8.
37. The method of claim 34, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV3 or the P5 promoter of AAV5, and (2) said AAV2 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV1.
38. The method of claim 34, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV1, the P5 promoter of AAV2, the P5 promoter of AAV3, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said AAV6 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2.
39. The method of claim 34, wherein said rAAV helper vector comprises: (1) said AAV2 Rep encoding sequence that is under the transcriptional control of the P5 promoter of AAV2, the P5 promoter of AAV7 or the P5 promoter of AAV8, and (2) said AAV1, AAV5 or AAV7 Cap encoding sequence that is under the transcriptional control of the P40 promoter of AAV2.
40. The method of claim 34, wherein said method comprises culturing human embryonic kidney cells.
41. The method of claim 40, wherein said human embryonic kidney cells are HEK 293 human embryonic kidney cells.
42. The method of claim 34, wherein said method comprises culturing baby hamster kidney cells.
43. The method of claim 42, wherein said baby hamster kidney cells are BHK21 baby hamster kidney cells.
44. The method of claim 34, wherein said transgene cassette encodes a protein, or comprises a polynucleotide domain that is transcribed into an RNA molecule, wherein said protein or said RNA molecule is therapeutic for a disease or a condition that is genetic or heritable.
45. The method of claim 44, wherein said transgene cassette encodes a protein that is therapeutic for said disease or said condition that is genetic or heritable.
46. The method of claim 44, wherein said transgene cassette comprises a polynucleotide domain that is transcribed into an RNA molecule that is therapeutic for said disease or said condition that is genetic or heritable.
47. The method of claim 30, wherein said disease or said condition that is genetic or heritable is: achromatopsia (ACHM); alpha-1 antitrypsin (AAT) deficiency; Alzheimer's Disease; aromatic L-amino acid decarboxylase (AADC) deficiency; choroideremia (CHM); cancer; Duchenne muscular dystrophy; dysferlin deficiency; follistatin gene deficiency (BMDSIBM); hemophilia A; hemophilia B; hepatitis A; hepatitis B; hepatitis C; Huntington's disease; idiopathic Parkinson's disease; late-infantile neuronal ceroid lipofuscinosis (LINCL, an infantile form of Batten disease); Leber congenital amaurosis (LCA); Leber's hereditary optic neuropathy (LHON); limb girdle muscular dystrophy 1B (LGMD1B); limb girdle muscular dystrophy 1C (LGMD1C); limb girdle muscular dystrophy 2A (LGMD2A); limb girdle muscular dystrophy 2B (LGMD2B); limb girdle muscular dystrophy 2I (LGMD2I); limb girdle muscular dystrophy 2L (LGMD2L); lipoprotein lipase (LPL) deficiency; metachromatic leukodystrophy; neurological disability; neuromotor deficit; neuroskeletal impairment; Parkinson's disease; rheumatoid arthritis; Sanfilippo A syndrome; spinal muscular atrophy (SMA); X-linked retinoschisis (XLRS); -sarcoglycan deficiency (LGMD2D); -sarcoglycan deficiency (LGMD2E); -sarcoglycan deficiency (LGMD2C); or -sarcoglycan deficiency (LGMD2F).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056] P5-RC constructs are derivatives of parental plasmid AAV RC that have been modified to direct expression of the AAV rep gene using a non-native P5 promoter (i.e., an AAV P5 promoter that is not natively present within the AAV rep gene of the vector (downward striped box)) in lieu of the native AAV serotype P5 promoter (solid black box); P5-RC constructs direct expression of the AAV rep and cap genes using the native AAV serotype P19 and P40 promoter sequences (solid black boxes) of the parent vector. P40-RC constructs are derivatives of parental plasmid AAV RC that have been modified to direct expression of the AAV cap gene using a non-native P40 promoter (i.e., an AAV P40 promoter that is not natively present within the AAV rep gene (upward striped box)) of the vector in lieu of the native AAV serotype P40 promoter (solid black box); P40-RC constructs direct expression of the AAV rep gene using the native AAV serotype P5 and P19 promoter sequences (solid black boxes) of the parent vector. P5/P40-RC constructs are derivatives of parental plasmid AAV RC that have been modified to direct expression of the AAV rep gene using a non-native P5 promoter (i.e., an AAV P5 promoter that is not natively present within the AAV rep gene of the vector (downward striped box)) in lieu of the native AAV serotype P5 promoter (solid black box). P5/P40-RC constructs have additionally been modified to direct expression to direct expression of the AAV cap gene using a non-native P40 promoter (i.e., an AAV P40 promoter that is not natively present within the AAV rep gene (upward striped box)) of the vector in lieu of the native AAV serotype P40 promoter (solid black box). P40-RC constructs direct expression of the AAV rep gene using the native AAV serotype P19 promoter sequences (solid black boxes) of the parent vector. The sequences of the promoter regions are shown in Table 1.
[0057]
[0058]
[0059]
[0060]
[0061]
DETAILED DESCRIPTION OF THE INVENTION
I. The Methods of the Present Invention
[0062] The present invention is directed to recombinantly-modified adeno-associated virus (AAV) helper vectors that are capable of increasing the packaging efficiency of recombinantly-modified adeno-associated virus (rAAV) and their use to improve the packaging efficiency of such rAAV. The present invention is particularly directed to recombinantly-modified adeno-associated virus (AAV) helper vectors that have been further modified to replace (or augment) the P5 and/or P40 promoter sequences that are natively associated with the Rep proteins encoded by such rAAV with AAV P5 and/or P40 promoters that are associated with the Rep proteins of an rAAV of different serotype. The use of such substitute or additional promoter sequences causes increased production of recombinantly-modified adeno-associated virus.
[0063] The present invention is based in part on the recognition that high levels of Rep and Cap proteins increase the amount of rAAV genomes particles produced and, consequently, the efficiency of rAAV packaging, and thus result in high production titers of rAAV stocks. It has been unexpectedly found that by replacing the AAV P5 and/or P40 promoters that direct the expression of the Cap proteins with different AAV P5 and/or P40 promoters, or by adding such different AAV P5 and/or P40 promoters in addition to those initially present, causes the desired high levels of rAAV to be attained. AAV Rep proteins are described in U.S. Pat. Nos. 10,214,730; 7,122,348; 6,821,511; 6,753,419; 9,441,206; and 7,115,391.
[0064] As discussed above, AAV and rAAV are characterized based on their serotype, which is determined by their capsid proteins (Colella, P. et al. (2018) Emerging Issues in AAV-Mediated In Vivo Gene Therapy, Molec. Ther. Meth. Clin. Develop. 8:87-104; Hocquemiller, M. et al. (2016) Adeno Associated Virus-Based Gene Therapy for CNS Diseases, Hum. Gene Ther. 27(7):478-496; Lisowski, L. et al. (2015) Adeno-Associated Virus Serotypes For Gene Therapeutics, 24:59-67; U.S. Pat. Nos. 10,301,650; 10,266,846; 10,265,417; 10,214,785; 10,214,566; 10,202,657; 10,046,016; 9,884,071; 9,856,539; 9,737,618; 9,677,089; 9,458,517; 9,457,103; 9,441,244; 9,193,956; 8,846,389; 8,507,267; 7,906,111; 7,479,554; 7,186,552; 7,105,345; 6,984,517; 6,962,815; and 6,733,757). By forming AAV and rAAV in the presence of AAV helper function-providing polynucleotides that encode two or more capsid proteins of different serotype, one can produce AAV and rAAV having hybrid serotypes. Such AAV and rAAV exhibit the combined trophism of AAV and rAAV having each of such capsid proteins.
[0065] The Rep proteins of the different AAV serotypes differ, however, since such proteins are not structural proteins, the differences do not contribute to the observed serotype of an AAV.
[0066] As used herein, the term AAV is intended to denote adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally-occurring and recombinant forms. As used herein, the term rAAV is intended to denote a recombinantly-modified version of AAV that comprises a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV). The rAAV may be single-stranded or double-stranded, and may be composed of deoxyribonucleotides or ribonucleotides. As discussed above, rAAV typically lack certain AAV genes and thus are produced using a double plasmid transfection system, or more preferably a triple plasmid transfection system that comprises a plasmid vector that comprises an AAV helper function-providing polynucleotide, a plasmid vector that comprises a non-AAV helper function-providing polynucleotide, and the rAAV plasmid vector (
[0067] A. Illustrative AAV Helper Function-Providing Polynucleotides
[0068] As used herein, the term AAV helper functions denotes AAV proteins (e.g., Rep and Cap) and/or polynucleotides of AAV that are required for the replication and packaging of an rAAV. Such AAV helper functions are provided by an AAV helper function-providing polynucleotide, which as such term is used herein is a virus, plasmid vector, a non-plasmid vector, or a polynucleotide that has been integrated into a cellular chromosome, that provides AAV helper functions. AAV helper plasmids that may be used in accordance with the present invention to provide AAV helper functions include pAAV-RC (Agilent; Addgene; Cell Biolabs), pAAV-RC1, pAAV-RC2, pAAV-RC5, pAAV-RC6, and pAAV-RC7.
[0069] 1. Plasmid pAAV-RC1
[0070] Plasmid pAAV-RC1 (SEQ ID NO:1;
TABLE-US-00001 CodingStrandofPlasmidpAAV-RC1 (SEQIDNO:1): catggttttgggacgtttcctgagtcagattcgcgaaaaa ctgattcagagaatttaccgcgggatcgagccgactttgc caaactggttcgcggtcacaaagaccagaaatggcgccgg aggcgggaacaaggtggtggatgagtgctacatccccaat tacttgctccccaaaacccagcctgagctccagtgggcgt ggactaatatggaacagtatttaagcgcctgtttgaatct cacggagcgtaaacggttggtggcgcagcatctgacgcac gtgtcgcagacgcaggagcagaacaaagagaatcagaatc ccaattctgatgcgccggtgatcagatcaaaaacttcagc caggtacatggagctggtcgggtggctcgtggacaagggg attacctcggagaagcagtggatccaggaggaccaggcct catacatctccttcaatgcggcctccaactcgcggtccca aatcaaggctgccttggacaatgcgggaaagattatgagc ctgactaaaaccgcccccgactacctggtgggccagcagc ccgtggaggacatttccagcaatcggatttataaaatttt ggaactaaacgggtacgatccccaatatgcggcttccgtc tttctgggatgggccacgaaaaagttcggcaagaggaaca ccatctggctgtttgggcctgcaactaccgggaagaccaa catcgcggaggccatagcccacactgtgcccttctacggg tgcgtaaactggaccaatgagaactttcccttcaacgact gtgtcgacaagatggtgatctggtgggaggaggggaagat gaccgccaaggtcgtggagtcggccaaagccattctcgga ggaagcaaggtgcgcgtggaccagaaatgcaagtcctcgg cccagatagacccgactcccgtgatcgtcacctccaacac caacatgtgcgccgtgattgacgggaactcaacgaccttc gaacaccagcagccgttgcaagaccggatgttcaaatttg aactcacccgccgtctggatcatgactttgggaaggtcac caagcaggaagtcaaagactttttccggtgggcaaaggat cacgtggttgaggtggagcatgaattctacgtcaaaaagg gtggagccaagaaaagacccgcccccagtgacgcagatat aagtgagcccaaacgggtgcgcgagtcagttgcgcagcca tcgacgtcagacgcggaagcttcgatcaactacgcagaca ggtaccaaaacaaatgttctcgtcacgtgggcatgaatct gatgctgtttccctgcagacaatgcgagagaatgaatcag aattcaaatatctgcttcactcacggacagaaagactgtt tagagtgctttcccgtgtcagaatctcaacccgtttctgt cgtcaaaaaggcgtatcagaaactgtgctacattcatcat atcatgggaaaggtgccagacgcttgcactgcctgcgatc tggtcaatgtggatttggatgactgcatctttgaacaata aatgatttaaatcaggtatggctgccgatggttatcttcc agattggctcgaggacaacctctctgagggcattcgcgag tggtgggacttgaaacctggagccccgaagcccaaagcca accagcaaaagcaggacgacggccggggtctggtgcttcc tggctacaagtacctcggacccttcaacggactcgacaag ggggagcccgtcaacgcggcggacgcagcggccctcgagc acgacaaggcctacgaccagcagctcaaagcgggtgacaa tccgtacctgcggtataaccacgccgacgccgagtttcag gagcgtctgcaagaagatacgtcttttgggggcaacctcg ggcgagcagtcttccaggccaagaagcgggttctcgaacc tctcggtctggttgaggaaggcgctaagacggctcctgga aagaaacgtccggtagagcagtcgccacaagagccagact cctcctcgggcatcggcaagacaggccagcagcccgctaa aaagagactcaattttggtcagactggcgactcagagtca gtccccgatccacaacctctcggagaacctccagcaaccc ccgctgctgtgggacctactacaatggcttcaggcggtgg cgcaccaatggcagacaataacgaaggcgccgacggagtg ggtaatgcctcaggaaattggcattgcgattccacatggc tgggcgacagagtcatcaccaccagcacccgcacctgggc cttgcccacctacaataaccacctctacaagcaaatctcc agtgcttcaacgggggccagcaacgacaaccactacttcg gctacagcaccccctgggggtattttgatttcaacagatt ccactgccacttttcaccacgtgactggcagcgactcatc aacaacaattggggattccggcccaagagactcaacttca aactcttcaacatccaagtcaaggaggtcacgacgaatga tggcgtcacaaccatcgctaataaccttaccagcacggtt caagtcttctcggactcggagtaccagcttccgtacgtcc tcggctctgcgcaccagggctgcctccctccgttcccggc ggacgtgttcatgattccgcaatacggctacctgacgctc aacaatggcagccaagccgtgggacgttcatccttttact gcctggaatatttcccttctcagatgctgagaacgggcaa caactttaccttcagctacacctttgaggaagtgcctttc cacagcagctacgcgcacagccagagcctggaccggctga tgaatcctctcatcgaccaatacctgtattacctgaacag aactcaaaatcagtccggaagtgcccaaaacaaggacttg ctgtttagccgtgggtctccagctggcatgtctgttcagc ccaaaaactggctacctggaccctgttatcggcagcagcg cgtttctaaaacaaaaacagacaacaacaacagcaatttt acctggactggtgcttcaaaatataacctcaatgggcgtg aatccatcatcaaccctggcactgctatggcctcacacaa agacgacgaagacaagttctttcccatgagcggtgtcatg atttttggaaaagagagcgccggagcttcaaacactgcat tggacaatgtcatgattacagacgaagaggaaattaaagc cactaaccctgtggccaccgaaagatttgggaccgtggca gtcaatttccagagcagcagcacagaccctgcgaccggag atgtgcatgctatgggagcattacctggcatggtgtggca agatagagacgtgtacctgcagggtcccatttgggccaaa attcctcacacagatggacactttcacccgtctcctctta tgggcggctttggactcaagaacccgcctcctcagatcct catcaaaaacacgcctgttcctgcgaatcctccggcggag ttttcagctacaaagtttgcttcattcatcacccaatact ccacaggacaagtgagtgtggaaattgaatgggagctgca gaaagaaaacagcaagcgctggaatcccgaagtgcagtac acatccaattatgcaaaatctgccaacgttgattttactg tggacaacaatggactttatactgagcctcgccccattgg cacccgttaccttacccgtcccctgtaaggcgcgccaccg gttgcttgttaatcaataaaccgtttaattcgtttcagtt gaactttggtctctgcgtatttctttcttatctagtttcc atgctctaggatccactagtaacggccgccagtgtgctgg aattcggctttgtagttaatgattaacccgccatgctact tatctacgtagccatgctctagaggtcctgtattagaggt cacgtgagtgttttgcgacattttgcgacaccatgtggtc acgctgggtatttaagcccgagtgagcacgcagggtctcc attttgaagcgggaggtttgaacgcgcagccgccaagccg aattctgcagatatccaaacactggcggccgctcgactag agcggccgccaccgcggtggagctccagcttttgttccct ttagtgagggttaattgcgcgcttggcgtaatcatggtca tagctgtttcctgtgtgaaattgttatccgctcacaattc cacacaacatacgagccggaagcataaagtgtaaagcctg gggtgcctaatgagtgagctaactcacattaattgcgttg cgctcactgcccgctttccagtcgggaaacctgtcgtgcc agctgcattaatgaatcggccaacgcgcggggagaggcgg tttgcgtattgggcgctcttccgcttcctcgctcactgac tcgctgcgctcggtcgttcggctgcggcgagcggtatcag ctcactcaaaggcggtaatacggttatccacagaatcagg ggataacgcaggaaagaacatgtgagcaaaaggccagcaa aaggccaggaaccgtaaaaaggccgcgttgctggcgtttt tccataggctccgcccccctgacgagcatcacaaaaatcg acgctcaagtcagaggtggcgaaacccgacaggactataa agataccaggcgtttccccctggaagctccctcgtgcgct ctcctgttccgaccctgccgcttaccggatacctgtccgc ctttctcccttcgggaagcgtggcgctttctcatagctca cgctgtaggtatctcagttcggtgtaggtcgttcgctcca agctgggctgtgtgcacgaaccccccgttcagcccgaccg ctgcgccttatccggtaactatcgtcttgagtccaacccg gtaagacacgacttatcgccactggcagcagccactggta acaggattagcagagcgaggtatgtaggcggtgctacaga gttcttgaagtggtggcctaactacggctacactagaaga acagtatttggtatctgcgctctgctgaagccagttacct tcggaaaaagagttggtagctcttgatccggcaaacaaac caccgctggtagcggtggtttttttgtttgcaagcagcag attacgcgcagaaaaaaaggatctcaagaagatcctttga tcttttctacggggtctgacgctcagtggaacgaaaactc acgttaagggattttggtcatgagattatcaaaaaggatc ttcacctagatccttttaaattaaaaatgaagttttaaat caatctaaagtatatatgagtaaacttggtctgacagtta ccaatgcttaatcagtgaggcacctatctcagcgatctgt ctatttcgttcatccatagttgcctgactccccgtcgtgt agataactacgatacgggagggcttaccatctggccccag tgctgcaatgataccgcgagacccacgctcaccggctcca gatttatcagcaataaaccagccagccggaagggccgagc gcagaagtggtcctgcaactttatccgcctccatccagtc tattaattgttgccgggaagctagagtaagtagttcgcca gttaatagtttgcgcaacgttgttgccattgctacaggca tcgtggtgtcacgctcgtcgtttggtatggcttcattcag ctccggttcccaacgatcaaggcgagttacatgatccccc atgttgtgcaaaaaagcggttagctccttcggtcctccga tcgttgtcagaagtaagttggccgcagtgttatcactcat ggttatggcagcactgcataattctcttactgtcatgcca tccgtaagatgcttttctgtgactggtgagtactcaacca agtcattctgagaatagtgtatgcggcgaccgagttgctc ttgcccggcgtcaatacgggataataccgcgccacatagc agaactttaaaagtgctcatcattggaaaacgttcttcgg ggcgaaaactctcaaggatcttaccgctgttgagatccag ttcgatgtaacccactcgtgcacccaactgatcttcagca tcttttactttcaccagcgtttctgggtgagcaaaaacag gaaggcaaaatgccgcaaaaaagggaataagggcgacacg gaaatgttgaatactcatactcttcctttttcaatattat tgaagcatttatcagggttattgtctcatgagcggataca tatttgaatgtatttagaaaaataaacaaataggggttcc gcgcacatttccccgaaaagtgccacctaaattgtaagcg ttaatattttgttaaaattcgcgttaaatttttgttaaat cagctcattttttaaccaataggccgaaatcggcaaaatc ccttataaatcaaaagaatagaccgagatagggttgagtg ttgttccagtttggaacaagagtccactattaaagaacgt ggactccaacgtcaaagggcgaaaaaccgtctatcagggc gatggcccactacgtgaaccatcaccctaatcaagttttt tggggtcgaggtgccgtaaagcactaaatcggaaccctaa agggagcccccgatttagagcttgacggggaaagccggcg aacgtggcgagaaaggaagggaagaaagcgaaaggagcgg gcgctagggcgctggcaagtgtagcggtcacgctgcgcgt aaccaccacacccgccgcgcttaatgcgccgctacagggc gcgtcccattcgccattcaggctgcgcaactgttgggaag ggcgatcggtgcgggcctcttcgctattacgccagctggc gaaagggggatgtgctgcaaggcgattaagttgggtaacg ccagggttttcccagtcacgacgttgtaaaacgacggcca gtgagcgcgcgtaatacgactcactatagggcgaattggg taccgggccccccctcgaggtcgacggtatcgggggagct cgcagggtctccattttgaagcgggaggtttgaacgcgca gccgccatgccggggttttacgagattgtgattaaggtcc ccagcgaccttgacgagcatctgcccggcatttctgacag ctttgtgaactgggtggccgagaaggaatgggagttgccg ccagattctgacatggatctgaatctgattgagcaggcac ccctgaccgtggccgagaagctgcagcgcgactttctgac ggaatggcgccgtgtgagtaaggccccggaggctcttttc tttgtgcaatttgagaagggagagagctacttccacatgc acgtgctcgtggaaaccaccggggtgaaatc
[0071] In SEQ ID NO:1, residues 1-1561 of pAAV-RC1 encode the Rep protein, Rep78 (with residues 95-221 corresponding to the AAV2 P19 promoter and residues 1075-1254 corresponding to the AAV2 P40 promoter (SEQ ID NO:18)); residues 1578-3788 encode the AAV1 VP1 capsid protein; residues 7127-7431 encode a portion of the Rep68 protein; residues 3984-4114 correspond to AAV2 P5 promoter sequences (SEQ ID NO:10); residues 4237-4253 are M13 Rev sequences; residues 4261-4277 are Lac operator sequences; 4285-4315 are Lac promoter sequences; residues 4578-5302 correspond to pMB ori sequences, residues 5398-6258 encode an ampicillin resistance determinant; and residues 6259-6357 are bla promoter sequences (
[0072] 2. Plasmid pAAV-RC2
[0073] Plasmid pAAV-RC2 (SEQ ID NO:2;
TABLE-US-00002 CodingStrandofPlasmidpAAV-RC2 (SEQIDNO:2): ccgggccccccctcgaggtcgacggtatcgggggagctcg cagggtctccattttgaagcgggaggtttgaacgcgcagc cgccatgccggggttttacgagattgtgattaaggtcccc agcgaccttgacgagcatctgcccggcatttctgacagct ttgtgaactgggtggccgagaaggaatgggagttgccgcc agattctgacatggatctgaatctgattgagcaggcaccc ctgaccgtggccgagaagctgcagcgcgactttctgacgg aatggcgccgtgtgagtaaggccccggaggctcttttctt tgtgcaatttgagaagggagagagctacttccacatgcac gtgctcgtggaaaccaccggggtgaaatccatggttttgg gacgtttcctgagtcagattcgcgaaaaactgattcagag aatttaccgcgggatcgagccgactttgccaaactggttc gcggtcacaaagaccagaaatggcgccggaggcgggaaca aggtggtggatgagtgctacatccccaattacttgctccc caaaacccagcctgagctccagtgggcgtggactaatatg gaacagtatttaagcgcctgtttgaatctcacggagcgta aacggttggtggcgcagcatctgacgcacgtgtcgcagac gcaggagcagaacaaagagaatcagaatcccaattctgat gcgccggtgatcagatcaaaaacttcagccaggtacatgg agctggtcgggtggctcgtggacaaggggattacctcgga gaagcagtggatccaggaggaccaggcctcatacatctcc ttcaatgcggcctccaactcgcggtcccaaatcaaggctg ccttggacaatgcgggaaagattatgagcctgactaaaac cgcccccgactacctggtgggccagcagcccgtggaggac atttccagcaatcggatttataaaattttggaactaaacg ggtacgatccccaatatgcggcttccgtctttctgggatg ggccacgaaaaagttcggcaagaggaacaccatctggctg tttgggcctgcaactaccgggaagaccaacatcgcggagg ccatagcccacactgtgcccttctacgggtgcgtaaactg gaccaatgagaactttcccttcaacgactgtgtcgacaag atggtgatctggtgggaggaggggaagatgaccgccaagg tcgtggagtcggccaaagccattctcggaggaagcaaggt gcgcgtggaccagaaatgcaagtcctcggcccagatagac ccgactcccgtgatcgtcacctccaacaccaacatgtgcg ccgtgattgacgggaactcaacgaccttcgaacaccagca gccgttgcaagaccggatgttcaaatttgaactcacccgc cgtctggatcatgactttgggaaggtcaccaagcaggaag tcaaagactttttccggtgggcaaaggatcacgtggttga ggtggagcatgaattctacgtcaaaaagggtggagccaag aaaagacccgcccccagtgacgcagatataagtgagccca aacgggtgcgcgagtcagttgcgcagccatcgacgtcaga cgcggaagcttcgatcaactacgcagacaggtaccaaaac aaatgttctcgtcacgtgggcatgaatctgatgctgtttc cctgcagacaatgcgagagaatgaatcagaattcaaatat ctgcttcactcacggacagaaagactgtttagagtgcttt cccgtgtcagaatctcaacccgtttctgtcgtcaaaaagg cgtatcagaaactgtgctacattcatcatatcatgggaaa ggtgccagacgcttgcactgcctgcgatctggtcaatgtg gatttggatgactgcatctttgaacaataaatgatttaaa tcaggtatggctgccgatggttatcttccagattggctcg aggacactctctctgaaggaataagacagtggtggaagct caaacctggcccaccaccaccaaagcccgcagagcggcat aaggacgacagcaggggtcttgtgcttcctgggtacaagt acctcggacccttcaacggactcgacaagggagagccggt caacgaggcagacgccgcggccctcgagcacgacaaagcc tacgaccggcagctcgacagcggagacaacccgtacctca agtacaaccacgccgacgcggagtttcaggagcgccttaa agaagatacgtcttttgggggcaacctcggacgagcagtc ttccaggcgaaaaagagggttcttgaacctctgggcctgg ttgaggaacctgttaagacggctccgggaaaaaagaggcc ggtagagcactctcctgtggagccagactcctcctcggga accggaaaggcgggccagcagcctgcaagaaaaagattga attttggtcagactggagacgcagactcagtacctgaccc ccagcctctcggacagccaccagcagccccctctggtctg ggaactaatacgatggctacaggcagtggcgcaccaatgg cagacaataacgagggcgccgacggagtgggtaattcctc gggaaattggcattgcgattccacatggatgggcgacaga gtcatcaccaccagcacccgaacctgggccctgcccacct acaacaaccacctctacaaacaaatttccagccaatcagg agcctcgaacgacaatcactactttggctacagcacccct tgggggtattttgacttcaacagattccactgccactttt caccacgtgactggcaaagactcatcaacaacaactgggg attccgacccaagagactcaacttcaagctctttaacatt caagtcaaagaggtcacgcagaatgacggtacgacgacga ttgccaataaccttaccagcacggttcaggtgtttactga ctcggagtaccagctcccgtacgtcctcggctcggcgcat caaggatgcctcccgccgttcccagcagacgtcttcatgg tgccacagtatggatacctcaccctgaacaacgggagtca ggcagtaggacgctcttcattttactgcctggagtacttt ccttctcagatgctgcgtaccggaaacaactttaccttca gctacacttttgaggacgttcctttccacagcagctacgc tcacagccagagtctggaccgtctcatgaatcctctcatc gaccagtacctgtattacttgagcagaacaaacactccaa gtggaaccaccacgcagtcaaggcttcagttttctcaggc cggagcgagtgacattcgggaccagtctaggaactggctt cctggaccctgttaccgccagcagcgagtatcaaagacat ctgcggataacaacaacagtgaatactcgtggactggagc taccaagtaccacctcaatggcagagactctctggtgaat ccgggcccggccatggcaagccacaaggacgatgaagaaa agttttttcctcagagcggggttctcatctttgggaagca aggctcagagaaaacaaatgtggacattgaaaaggtcatg attacagacgaagaggaaatcaggacaaccaatcccgtgg ctacggagcagtatggttctgtatctaccaacctccagag aggcaacagacaagcagctaccgcagatgtcaacacacaa ggcgttcttccaggcatggtctggcaggacagagatgtgt accttcaggggcccatctgggcaaagattccacacacgga cggacattttcacccctctcccctcatgggtggattcgga cttaaacaccctcctccacagattctcatcaagaacaccc cggtacctgcgaatccttcgaccaccttcagtgcggcaaa gtttgcttccttcatcacacagtactccacgggacaggtc agcgtggagatcgagtgggagctgcagaaggaaaacagca aacgctggaatcccgaaattcagtacacttccaactacaa caagtctgttaatgtggactttactgtggacactaatggc gtgtattcagagcctcgccccattggcaccagatacctga ctcgtaatctgtaattgcttgttaatcaataaaccgttta attcgtttcagttgaactttggtctctgcgtatttctttc ttatctagtttccatgctctaggatccactagtaacggcc gccagtgtgctggaattcggctttgtagttaatgattaac ccgccatgctacttatctacgtagccatgctctagaggtc ctgtattagaggtcacgtgagtgttttgcgacattttgcg acaccatgtggtcacgctgggtatttaagcccgagtgagc acgcagggtctccattttgaagcgggaggtttgaacgcgc agccgccaagccgaattctgcagatatccaaacactggcg gccgctcgactagagcggccgccaccgcggtggagctcca gcttttgttccctttagtgagggttaattgcgcgcttggc gtaatcatggtcatagctgtttcctgtgtgaaattgttat ccgctcacaattccacacaacatacgagccggaagcataa agtgtaaagcctggggtgcctaatgagtgagctaactcac attaattgcgttgcgctcactgcccgctttccagtcggga aacctgtcgtgccagctgcattaatgaatcggccaacgcg cggggagaggcggtttgcgtattgggcgctcttccgcttc ctcgctcactgactcgctgcgctcggtcgttcggctgcgg cgagcggtatcagctcactcaaaggcggtaatacggttat ccacagaatcaggggataacgcaggaaagaacatgtgagc aaaaggccagcaaaaggccaggaaccgtaaaaaggccgcg ttgctggcgtttttccataggctccgcccccctgacgagc atcacaaaaatcgacgctcaagtcagaggtggcgaaaccc gacaggactataaagataccaggcgtttccccctggaagc tccctcgtgcgctctcctgttccgaccctgccgcttaccg gatacctgtccgcctttctcccttcgggaagcgtggcgct ttctcatagctcacgctgtaggtatctcagttcggtgtag gtcgttcgctccaagctgggctgtgtgcacgaaccccccg ttcagcccgaccgctgcgccttatccggtaactatcgtct tgagtccaacccggtaagacacgacttatcgccactggca gcagccactggtaacaggattagcagagcgaggtatgtag gcggtgctacagagttcttgaagtggtggcctaactacgg ctacactagaagaacagtatttggtatctgcgctctgctg aagccagttaccttcggaaaaagagttggtagctcttgat ccggcaaacaaaccaccgctggtagcggtggtttttttgt ttgcaagcagcagattacgcgcagaaaaaaaggatctcaa gaagatcctttgatcttttctacggggtctgacgctcagt ggaacgaaaactcacgttaagggattttggtcatgagatt atcaaaaaggatcttcacctagatccttttaaattaaaaa tgaagttttaaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtgaggcacctat ctcagcgatctgtctatttcgttcatccatagttgcctga ctccccgtcgtgtagataactacgatacgggagggcttac catctggccccagtgctgcaatgataccgcgagacccacg ctcaccggctccagatttatcagcaataaaccagccagcc ggaagggccgagcgcagaagtggtcctgcaactttatccg cctccatccagtctattaattgttgccgggaagctagagt aagtagttcgccagttaatagtttgcgcaacgttgttgcc attgctacaggcatcgtggtgtcacgctcgtcgtttggta tggcttcattcagctccggttcccaacgatcaaggcgagt tacatgatcccccatgttgtgcaaaaaagcggttagctcc ttcggtcctccgatcgttgtcagaagtaagttggccgcag tgttatcactcatggttatggcagcactgcataattctct tactgtcatgccatccgtaagatgcttttctgtgactggt gagtactcaaccaagtcattctgagaatagtgtatgcggc gaccgagttgctcttgcccggcgtcaatacgggataatac cgcgccacatagcagaactttaaaagtgctcatcattgga aaacgttcttcggggcgaaaactctcaaggatcttaccgc tgttgagatccagttcgatgtaacccactcgtgcacccaa ctgatcttcagcatcttttactttcaccagcgtttctggg tgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaa taagggcgacacggaaatgttgaatactcatactcttcct ttttcaatattattgaagcatttatcagggttattgtctc atgagcggatacatatttgaatgtatttagaaaaataaac aaataggggttccgcgcacatttccccgaaaagtgccacc taaattgtaagcgttaatattttgttaaaattcgcgttaa atttttgttaaatcagctcattttttaaccaataggccga aatcggcaaaatcccttataaatcaaaagaatagaccgag atagggttgagtgttgttccagtttggaacaagagtccac tattaaagaacgtggactccaacgtcaaagggcgaaaaac cgtctatcagggcgatggcccactacgtgaaccatcaccc taatcaagttttttggggtcgaggtgccgtaaagcactaa atcggaaccctaaagggagcccccgatttagagcttgacg gggaaagccggcgaacgtggcgagaaaggaagggaagaaa gcgaaaggagcgggcgctagggcgctggcaagtgtagcgg tcacgctgcgcgtaaccaccacacccgccgcgcttaatgc gccgctacagggcgcgtcccattcgccattcaggctgcgc aactgttgggaagggcgatcggtgcgggcctcttcgctat tacgccagctggcgaaagggggatgtgctgcaaggcgatt aagttgggtaacgccagggttttcccagtcacgacgttgt aaaacgacggccagtgagcgcgcgtaatacgactcactat agggcgaattgggta
[0074] In SEQ ID NO:2, residues 85-1950 of pAAV-RC2 encode the Rep protein, Rep78 (with residues 484-663 corresponding to the AAV2 P19 promoter, residues 1464-1643 corresponding to the AAV2 P40 promoter (SEQ ID NO:18) and residues 1668-1676 being a donor site); residues 1967-4174 encode the AAV2 VP1 capsid protein; residues 1992-2016 encode a portion of the Rep68 protein; residues 4175-4256 encode a polyA sequence; residues 4357-4487 correspond to the AAV2 P5 promoter sequences of SEQ ID NO:10); residues 4610-4626 are M13 Rev sequences; residues 4634-4650 are Lac operator sequences; 4658-4688 are Lac promoter sequences; residues 4951-5675 correspond to pMB ori sequences, residues 5771-6631 encode an ampicillin resistance determinant; and residues 6632-6730 are bla promoter sequences (
[0075] 3. Plasmid pAAV-RC5
[0076] Plasmid pAAV-RC5 (SEQ ID NO:3;
TABLE-US-00003 CodingStrandofPlasmidpAAV-RC5(SEQIDNO:3): catggttttgggacgtttcctgagtcagattcgcgaaaaactgattcaga gaatttaccgcgggatcgagccgactttgccaaactggttcgcggtcaca aagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgcta catccccaattacttgctccccaaaacccagcctgagctccagtgggcgt ggactaatatggaacagtatttaagcgcctgtttgaatctcacggagcgt aaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagca gaacaaagagaatcagaatcccaattctgatgcgccggtgatcagatcaa aaacttcagccaggtacatggagctggtcgggtggctcgtggacaagggg attacctcggagaagcagtggatccaggaggaccaggcctcatacatctc cttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggaca atgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtg ggccagcagcccgtggaggacatttccagcaatcggatttataaaatttt ggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggat gggccacgaaaaagttcggcaagaggaacaccatctggctgtttgggcct gcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcc cttctacgggtgcgtaaactggaccaatgagaactttcccttcaacgact gtgtcgacaagatggtgatctggtgggaggaggggaagatgaccgccaag gtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtgga ccagaaatgcaagtcctcggcccagatagacccgactcccgtgatcgtca cctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttc gaacaccagcagccgttgcaagaccggatgttcaaatttgaactcacccg ccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaagact ttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctac gtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatat aagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcag acgcggaagcttcgatcaactacgcagacaggtaccaaaacaaatgttct cgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagag aatgaatcagaattcaaatatctgcttcactcacggacagaaagactgtt tagagtgctttcccgtgtcagaatctcaacccgtttctgtcgtcaaaaag gcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccaga cgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatct ttgaacaataaatgatttaaatcaggtatgtcttttgttgatcaccctcc agattggttggaagaagttggtgaaggtcttcgcgagtttttgggccttg aagcgggcccaccgaaaccaaaacccaatcagcagcatcaagatcaagcc cgtggtcttgtgctgcctggttataactatctcggacccggaaacggtct cgatcgaggagagcctgtcaacagggcagacgaggtcgcgcgagagcacg acatctcgtacaacgagcagcttgaggcgggagacaacccctacctcaag tacaaccacgcggacgccgagtttcaggagaagctcgccgacgacacatc cttcgggggaaacctcggaaaggcagtctttcaggccaagaaaagggttc tcgaaccttttggcctggttgaagagggtgctaagacggcccctaccgga aagcggatagacgaccactttccaaaaagaaagaaggctcggaccgaaga ggactccaagccttccacctcgtcagacgccgaagctggacccagcggat cccagcagctgcaaatcccagcccaaccagcctcaagtttgggagctgat acaatgtctgcgggaggtggcggcccattgggcgacaataaccaaggtgc cgatggagtgggcaatgcctcgggagattggcattgcgattccacgtgga tgggggacagagtcgtcaccaagtccacccgaacctgggtgctgcccagc tacaacaaccaccagtaccgagagatcaaaagcggctccgtcgacggaag caacgccaacgcctactttggatacagcaccccctgggggtactttgact ttaaccgcttccacagccactggagcccccgagactggcaaagactcatc aacaactactggggcttcagaccccggtccctcagagtcaaaatcttcaa cattcaagtcaaagaggtcacggtgcaggactccaccaccaccatcgcca acaacctcacctccaccgtccaagtgtttacggacgacgactaccagctg ccctacgtcgtcggcaacgggaccgagggatgcctgccggccttccctcc gcaggtctttacgctgccgcagtacggttacgcgacgctgaaccgcgaca acacagaaaatcccaccgagaggagcagcttcttctgcctagagtacttt cccagcaagatgctgagaacgggcaacaactttgagtttacctacaactt tgaggaggtgcccttccactccagcttcgctcccagtcagaacctgttca agctggccaacccgctggtggaccagtacttgtaccgcttcgtgagcaca aataacactggcggagtccagttcaacaagaacctggccgggagatacgc caacacctacaaaaactggttcccggggcccatgggccgaacccagggct ggaacctgggctccggggtcaaccgcgccagtgtcagcgccttcgccacg accaataggatggagctcgagggcgcgagttaccaggtgcccccgcagcc gaacggcatgaccaacaacctccagggcagcaacacctatgccctggaga acactatgatcttcaacagccagccggcgaacccgggcaccaccgccacg tacctcgagggcaacatgctcatcaccagcgagagcgagacgcagccggt gaaccgcgtggcgtacaacgtcggcgggcagatggccaccaacaaccaga gctccaccactgcccccgcgaccggcacgtacaacctccaggaaatcgtg cccggcagcgtgtggatggagagggacgtgtacctccaaggacccatctg ggccaagatcccagagacgggggcgcactttcacccctctccggccatgg gcggattcggactcaaacacccaccgcccatgatgctcatcaagaacacg cctgtgcccggaaatatcaccagcttctcggacgtgcccgtcagcagctt catcacccagtacagcaccgggcaggtcaccgtggagatggagtgggagc tcaagaaggaaaactccaagaggtggaacccagagatccagtacacaaac aactacaacgacccccagtttgtggactttgccccggacagcaccgggga atacagaaccaccagacctatcggaacccgataccttacccgaccccttt aaggcgcgccaccggttgcttgttaatcaataaaccgtttaattcgtttc agttgaactttggtctctgcgtatttctttcttatctagtttccatgctc taggatccactagtaacggccgccagtgtgctggaattcggctttgtagt taatgattaacccgccatgctacttatctacgtagccatgctctagaggt cctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgt ggtcacgctgggtatttaagcccgagtgagcacgcagggtctccattttg aagcgggaggtttgaacgcgcagccgccaagccgaattctgcagatatcc aaacactggcggccgctcgactagagcggccgccaccgcggtggagctcc agcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatg gtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacaca acatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtg agctaactcacattaattgcgttgcgctcactgcccgctttccagtcggg aaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagag gcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctg cgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggt aatacggttatccacagaatcaggggataacgcaggaaagaacatgtgag caaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcg tttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctc aagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttc cccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttacc ggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatag ctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgg gctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggt aactatcgtcttgagtccaacccggtaagacacgacttatcgccactggc agcagccactggtaacaggattagcagagcgaggtatgtaggcggtgcta cagagttcttgaagtggtggcctaactacggctacactagaagaacagta tttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttgg tagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttg tttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcct ttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgtta agggattttggtcatgagattatcaaaaaggatcttcacctagatccttt taaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaact tggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgat ctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataa ctacgatacgggagggcttaccatctggccccagtgctgcaatgataccg cgagacccacgctcaccggctccagatttatcagcaataaaccagccagc cggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcc agtctattaattgttgccgggaagctagagtaagtagttcgccagttaat agtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctc gtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgag ttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcct ccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttat ggcagcactgcataattctcttactgtcatgccatccgtaagatgctttt ctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcgg cgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccaca tagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaa aactctcaaggatcttaccgctgttgagatccagttcgatgtaacccact cgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgg gtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcga cacggaaatgttgaatactcatactcttcctttttcaatattattgaagc atttatcagggttattgtctcatgagcggatacatatttgaatgtattta gaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgtt aaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttat aaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaa caagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagt tttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggag cccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaagg aagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcg gtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctaca gggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgat cggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgct gcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttg taaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaat tgggtaccgggccccccctcgaggtcgacggtatcgggggagctcgcagg gtctccattttgaagcgggaggtttgaacgcgcagccgccatgccggggt tttacgagattgtgattaaggtccccagcgaccttgacgagcatctgccc ggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagtt gccgccagattctgacatggatctgaatctgattgagcaggcacccctga ccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtgtg agtaaggccccggaggctcttttctttgtgcaatttgagaagggagagag ctacttccacatgcacgtgctcgtggaaaccaccggggtgaaatc
[0077] In SEQ ID NO:3, residues 1-1561 of pAAV-RC5 encode the Rep protein, Rep78 (with residues 91-221 corresponding to the AAV2 P19 promoter, and residues 1075-1254 corresponding to the P40 promoter (SEQ ID NO:18)); residues 1578-3749 encode the AAV5 VP1 capsid protein; residues 7091-7395 encode a portion of the Rep68 protein; residues 3948-4078 correspond to the AAV2 P5 promoter sequences of SEQ ID NO:10); residues 4201-4217 are M13 Rev sequences; residues 4225-4241 are Lac operator sequences; 4249-4279 are Lac promoter sequences; residues 4542-5266 correspond to pMB ori sequences, residues 5362-6222 encode an ampicillin resistance determinant; and residues 6223-6321 are bla promoter sequences (
[0078] 4. Plasmid pAAV-RC6
[0079] Plasmid pAAV-RC6 (SEQ ID NO:4;
TABLE-US-00004 CodingStrandofPlasmidpAAV-RC6(SEQIDNO:4): catggttttgggacgtttcctgagtcagattcgcgaaaaactgattcaga gaatttaccgcgggatcgagccgactttgccaaactggttcgcggtcaca aagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgcta catccccaattacttgctccccaaaacccagcctgagctccagtgggcgt ggactaatatggaacagtatttaagcgcctgtttgaatctcacggagcgt aaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagca gaacaaagagaatcagaatcccaattctgatgcgccggtgatcagatcaa aaacttcagccaggtacatggagctggtcgggtggctcgtggacaagggg attacctcggagaagcagtggatccaggaggaccaggcctcatacatctc cttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggaca atgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtg ggccagcagcccgtggaggacatttccagcaatcggatttataaaatttt ggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggat gggccacgaaaaagttcggcaagaggaacaccatctggctgtttgggcct gcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcc cttctacgggtgcgtaaactggaccaatgagaactttcccttcaacgact gtgtcgacaagatggtgatctggtgggaggaggggaagatgaccgccaag gtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtgga ccagaaatgcaagtcctcggcccagatagacccgactcccgtgatcgtca cctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttc gaacaccagcagccgttgcaagaccggatgttcaaatttgaactcacccg ccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaagact ttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctac gtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatat aagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcag acgcggaagcttcgatcaactacgcagacaggtaccaaaacaaatgttct cgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagag aatgaatcagaattcaaatatctgcttcactcacggacagaaagactgtt tagagtgctttcccgtgtcagaatctcaacccgtttctgtcgtcaaaaag gcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccaga cgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatct ttgaacaataaatgatttaaatcaggtatggctgccgatggttatcttcc agattggctcgaggacaacctctctgagggcattcgcgagtggtgggact tgaaacctggagccccgaaacccaaagccaaccagcaaaagcaggacgac ggccggggtctggtgcttcctggctacaagtacctcggacccttcaacgg actcgacaagggggagcccgtcaacgcggcggatgcagcggccctcgagc acgacaaggcctacgaccagcagctcaaagcgggtgacaatccgtacctg cggtataaccacgccgacgccgagtttcaggagcgtctgcaagaagatac gtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagaggg ttctcgaaccttttggtctggttgaggaaggtgctaagacggctcctgga aagaaacgtccggtagagcagtcgccacaagagccagactcctcctcggg cattggcaagacaggccagcagcccgctaaaaagagactcaattttggtc agactggcgactcagagtcagtccccgacccacaacctctcggagaacct ccagcaacccccgctgctgtgggacctactacaatggcttcaggcggtgg cgcaccaatggcagacaataacgaaggcgccgacggagtgggtaatgcct caggaaattggcattgcgattccacatggctgggcgacagagtcatcacc accagcacccgaacatgggccttgcccacctataacaaccacctctacaa gcaaatctccagtgcttcaacgggggccagcaacgacaaccactacttcg gctacagcaccccctgggggtattttgatttcaacagattccactgccat ttctcaccacgtgactggcagcgactcatcaacaacaattggggattccg gcccaagagactcaacttcaagctcttcaacatccaagtcaaggaggtca cgacgaatgatggcgtcacgaccatcgctaataaccttaccagcacggtt caagtcttctcggactcggagtaccagttgccgtacgtcctcggctctgc gcaccagggctgcctccctccgttcccggcggacgtgttcatgattccgc agtacggctacctaacgctcaacaatggcagccaggcagtgggacggtca tccttttactgcctggaatatttcccatcgcagatgctgagaacgggcaa taactttaccttcagctacaccttcgaggacgtgcctttccacagcagct acgcgcacagccagagcctggaccggctgatgaatcctctcatcgaccag tacctgtattacctgaacagaactcagaatcagtccggaagtgcccaaaa caaggacttgctgtttagccgggggtctccagctggcatgtctgttcagc ccaaaaactggctacctggaccctgttaccggcagcagcgcgtttctaaa acaaaaacagacaacaacaacagcaactttacctggactggtgcttcaaa atataaccttaatgggcgtgaatctataatcaaccctggcactgctatgg cctcacacaaagacgacaaagacaagttctttcccatgagcggtgtcatg atttttggaaaggagagcgccggagcttcaaacactgcattggacaatgt catgatcacagacgaagaggaaatcaaagccactaaccccgtggccaccg aaagatttgggactgtggcagtcaatctccagagcagcagcacagaccct gcgaccggagatgtgcatgttatgggagccttacctggaatggtgtggca agacagagacgtatacctgcagggtcctatttgggccaaaattcctcaca cggatggacactttcacccgtctcctctcatgggcggctttggacttaag cacccgcctcctcagatcctcatcaaaaacacgcctgttcctgcgaatcc tccggcagagttttcggctacaaagtttgcttcattcatcacccagtatt ccacaggacaagtgagcgtggagattgaatgggagctgcagaaagaaaac agcaaacgctggaatcccgaagtgcagtatacatctaactatgcaaaatc tgccaacgttgatttcactgtggacaacaatggactttatactgagcctc gccccattggcacccgttacctcacccgtcccctgtaaggcgcgccaccg gttgcttgttaatcaataaaccgtttaattcgtttcagttgaactttggt ctctgcgtatttctttcttatctagtttccatgctctaggatccactagt aacggccgccagtgtgctggaattcggctttgtagttaatgattaacccg ccatgctacttatctacgtagccatgctctagaggtcctgtattagaggt cacgtgagtgttttgcgacattttgcgacaccatgtggtcacgctgggta tttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttg aacgcgcagccgccaagccgaattctgcagatatccaaacactggcggcc gctcgactagagcggccgccaccgcggtggagctccagcttttgttccct ttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttc ctgtgtgaaattgttatccgctcacaattccacacaacatacgagccgga agcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacatt aattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgcc agctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtatt gggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcg gctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatcca cagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaa aaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggct ccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggc gaaacccgacaggactataaagataccaggcgtttccccctggaagctcc ctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgc ctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggt atctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttga gtccaacccggtaagacacgacttatcgccactggcagcagccactggta acaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaag tggtggcctaactacggctacactagaagaacagtatttggtatctgcgc tctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccg gcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcag attacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctac ggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatga agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagtta ccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgtt catccatagttgcctgactccccgtcgtgtagataactacgatacgggag ggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctc accggctccagatttatcagcaataaaccagccagccggaagggccgagc gcagaagtggtcctgcaactttatccgcctccatccagtctattaattgt tgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgt tgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatgg cttcattcagctccggttcccaacgatcaaggcgagttacatgatccccc atgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcag aagtaagttggccgcagtgttatcactcatggttatggcagcactgcata attctcttactgtcatgccatccgtaagatgcttttctgtgactggtgag tactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctc ttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaa aagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatc ttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactg atcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacag gaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttga atactcatactcttcctttttcaatattattgaagcatttatcagggtta ttgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaa taggggttccgcgcacatttccccgaaaagtgccacctaaattgtaagcg ttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattt tttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaata gaccgagatagggttgagtgttgttccagtttggaacaagagtccactat taaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggc gatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgag gtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagag cttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcg aaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgt aaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccatt cgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctct tcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaag ttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggcca gtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccc cccctcgaggtcgacggtatcgggggagctcgcagggtctccattttgaa gcgggaggtttgaacgcgcagccgccatgccggggttttacgagattgtg attaaggtccccagcgaccttgacgagcatctgcccggcatttctgacag ctttgtgaactgggtggccgagaaggaatgggagttgccgccagattctg acatggatctgaatctgattgagcaggcacccctgaccgtggccgagaag ctgcagcgcgactttctgacggaatggcgccgtgtgagtaaggccccgga ggctcttttctttgtgcaatttgagaagggagagagctacttccacatgc acgtgctcgtggaaaccaccggggtgaaatc
[0080] In SEQ ID NO:4, residues 1-1561 of pAAV-RC6 encode the Rep protein, Rep78 (with residues 91-221 corresponding to the AAV2 P19 promoter, and residues 1075-1254 corresponding to the P40 promoter (SEQ ID NO:18)); residues 1578-3788 encode the AAV6 VP1 capsid protein; residues 736-1281 encode a portion of the Rep68 protein; residues 3984-4114 correspond to the AAV2 P5 promoter sequences of SEQ ID NO:10); residues 4237-4253 are M13 Rev sequences; residues 4261-4277 are Lac operator sequences; 4285-4315 are Lac promoter sequences; residues 4578-5302 correspond to pMB ori sequences, residues 5398-6258 encode an ampicillin resistance determinant; and residues 6259-6357 are bla promoter sequences (
[0081] 5. Plasmid pAAV-RC7
[0082] Plasmid pAAV-RC7 (SEQ ID NO:5;
TABLE-US-00005 CodingStrandofPlasmidpAAV-RC7(SEQIDNO:5): catggttttgggacgtttcctgagtcagattcgcgaaaaactgattcaga gaatttaccgcgggatcgagccgactttgccaaactggttcgcggtcaca aagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgcta catccccaattacttgctccccaaaacccagcctgagctccagtgggcgt ggactaatatggaacagtatttaagcgcctgtttgaatctcacggagcgt aaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagca gaacaaagagaatcagaatcccaattctgatgcgccggtgatcagatcaa aaacttcagccaggtacatggagctggtcgggtggctcgtggacaagggg attacctcggagaagcagtggatccaggaggaccaggcctcatacatctc cttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggaca atgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtg ggccagcagcccgtggaggacatttccagcaatcggatttataaaatttt ggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggat gggccacgaaaaagttcggcaagaggaacaccatctggctgtttgggcct gcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcc cttctacgggtgcgtaaactggaccaatgagaactttcccttcaacgact gtgtcgacaagatggtgatctggtgggaggaggggaagatgaccgccaag gtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtgga ccagaaatgcaagtcctcggcccagatagacccgactcccgtgatcgtca cctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttc gaacaccagcagccgttgcaagaccggatgttcaaatttgaactcacccg ccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaagact ttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctac gtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatat aagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcag acgcggaagcttcgatcaactacgcagacaggtaccaaaacaaatgttct cgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagag aatgaatcagaattcaaatatctgcttcactcacggacagaaagactgtt tagagtgctttcccgtgtcagaatctcaacccgtttctgtcgtcaaaaag gcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccaga cgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatct ttgaacaataaatgatttaaatcaggtatggctgccgatggttatcttcc agattggctcgaggacaacctctctgagggcattcgcgagtggtgggacc tgaaacctggagccccgaaacccaaagccaaccagcaaaagcaggacaac ggccggggtctggtgcttcctggctacaagtacctcggacccttcaacgg actcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagc acgacaaggcctacgaccagcagctcaaagcgggtgacaatccgtacctg cggtataaccacgccgacgccgagtttcaggagcgtctgcaagaagatac gtcatttgggggcaacctcgggcgagcagtcttccaggccaagaagcggg ttctcgaacctctcggtctggttgaggaaggcgctaagacggctcctgca aagaagagaccggtagagccgtcacctcagcgttcccccgactcctccac gggcatcggcaagaaaggccagcagcccgccagaaagagactcaatttcg gtcagactggcgactcagagtcagtccccgaccctcaacctctcggagaa cctccagcagcgccctctagtgtgggatctggtacagtggctgcaggcgg tggcgcaccaatggcagacaataacgaaggtgccgacggagtgggtaatg cctcaggaaattggcattgcgattccacatggctgggcgacagagtcatt accaccagcacccgaacctgggccctgcccacctacaacaaccacctcta caagcaaatctccagtgaaactgcaggtagtaccaacgacaacacctact tcggctacagcaccccctgggggtattttgactttaacagattccactgc cacttctcaccacgtgactggcagcgactcatcaacaacaactggggatt ccggcccaagaagctgcggttcaagctcttcaacatccaggtcaaggagg tcacgacgaatgacggcgttacgaccatcgctaataaccttaccagcacg attcaggtattctcggactcggaataccagctgccgtacgtcctcggctc tgcgcaccagggctgcctgcctccgttcccggcggacgtcttcatgattc ctcagtacggctacctgactctcaacaatggcagtcagtctgtgggacgt tcctccttctactgcctggagtacttcccctctcagatgctgagaacggg caacaactttgagttcagctacagcttcgaggacgtgcctttccacagca gctacgcacacagccagagcctggaccggctgatgaatcccctcatcgac cagtacttgtactacctggccagaacacagagtaacccaggaggcacagc tggcaatcgggaactgcagttttaccagggcgggccttcaactatggccg aacaagccaagaattggttacctggaccttgcttccggcaacaaagagtc tccaaaacgctggatcaaaacaacaacagcaactttgcttggactggtgc caccaaatatcacctgaacggcagaaactcgttggttaatcccggcgtcg ccatggcaactcacaaggacgacgaggaccgctttttcccatccagcgga gtcctgatttttggaaaaactggagcaactaacaaaactacattggaaaa tgtgttaatgacaaatgaagaagaaattcgtcctactaatcctgtagcca cggaagaatacgggatagtcagcagcaacttacaagcggctaatactgca gcccagacacaagttgtcaacaaccagggagccttacctggcatggtctg gcagaaccgggacgtgtacctgcagggtcccatctgggccaagattcctc acacggatggcaactttcacccgtctcctttgatgggcggctttggactt aaacatccgcctcctcagatcctgatcaagaacactcccgttcccgctaa tcctccggaggtgtttactcctgccaagtttgcttcgttcatcacacagt acagcaccggacaagtcagcgtggaaatcgagtgggagctgcagaaggaa aacagcaagcgctggaacccggagattcagtacacctccaactttgaaaa gcagactggtgtggactttgccgttgacagccagggtgtttactctgagc ctcgccctattggcactcgttacctcacccgtaatctgtaaggcgcgcca ccggttgcttgttaatcaataaaccgtttaattcgtttcagttgaacttt ggtctctgcgtatttctttcttatctagtttccatgctctaggatccact agtaacggccgccagtgtgctggaattcggctttgtagttaatgattaac ccgccatgctacttatctacgtagccatgctctagaggtcctgtattaga ggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgctgg gtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggt ttgaacgcgcagccgccaagccgaattctgcagatatccaaacactggcg gccgctcgactagagcggccgccaccgcggtggagctccagcttttgttc cctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgt ttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagcc ggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcac attaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgt gccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgt attgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgt tcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttat ccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccag caaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccatag gctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggt ggcgaaacccgacaggactataaagataccaggcgtttccccctggaagc tccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtc cgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgta ggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcac gaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtct tgagtccaacccggtaagacacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttg aagtggtggcctaactacggctacactagaagaacagtatttggtatctg cgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgat ccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcag cagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttc tacggggtctgacgctcagtggaacgaaaactcacgttaagggattttgg tcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaa tgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacag ttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttc gttcatccatagttgcctgactccccgtcgtgtagataactacgatacgg gagggcttaccatctggccccagtgctgcaatgataccgcgagacccacg ctcaccggctccagatttatcagcaataaaccagccagccggaagggccg agcgcagaagtggtcctgcaactttatccgcctccatccagtctattaat tgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaa cgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggta tggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcc cccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgt cagaagtaagttggccgcagtgttatcactcatggttatggcagcactgc ataattctcttactgtcatgccatccgtaagatgcttttctgtgactggt gagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttg ctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactt taaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaagg atcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaa ctgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaa caggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgt tgaatactcatactcttcctttttcaatattattgaagcatttatcaggg ttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaac aaataggggttccgcgcacatttccccgaaaagtgccacctaaattgtaa gcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctca ttttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaaga atagaccgagatagggttgagtgttgttccagtttggaacaagagtccac tattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcag ggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtc gaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgattta gagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaa gcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcg cgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtccc attcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcc tcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgatt aagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacgg ccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccggg ccccccctcgaggtcgacggtatcgggggagctcgcagggtctccatttt gaagcgggaggtttgaacgcgcagccgccatgccggggttttacgagatt gtgattaaggtccccagcgaccttgacgagcatctgcccggcatttctga cagctttgtgaactgggtggccgagaaggaatgggagttgccgccagatt ctgacatggatctgaatctgattgagcaggcacccctgaccgtggccgag aagctgcagcgcgactttctgacggaatggcgccgtgtgagtaaggcccc ggaggctcttttctttgtgcaatttgagaagggagagagctacttccaca tgcacgtgctcgtggaaaccaccggggtgaaatc
[0083] In SEQ ID NO:5, residues 1-1561 of pAAV-RC7 encode the Rep protein, Rep78 (with residues 91-221 corresponding to the AAV2 P19 promoter, and residues 1075-1254 corresponding to the P40 promoter (SEQ ID NO:18)); residues 1578-3791 encode the AAV7 VP1 capsid protein; residues 736-1281 encode a portion of the Rep68 protein; residues 3987-4117 correspond to the AAV2 P5 promoter sequences of SEQ ID NO:10); residues 4240-4256 are M13 Rev sequences; residues 4264-4280 are Lac operator sequences; 4288-4318 are Lac promoter sequences; residues 4581-5305 correspond to pMB ori sequences, residues 5401-6261 encode an ampicillin resistance determinant; and residues 6262-6360 are bla promoter sequences (
[0084] B. Illustrative Non-AAV Helper Function-Providing Polynucleotides
[0085] As used herein, the term non-AAV helper functions denotes proteins of Ad, CMV, HSV or other non-AAD viruses (e.g., E1a, E1b, E2a, VA and E4) and/or polynucleotides of Ad, CMV, HSV or other non-AAD viruses that are required for the replication and packaging of an rAAV. Such non-AAV helper functions are provided by a non-AAV helper function-providing polynucleotide, which as such term is used herein is a virus, plasmid vector, a non-plasmid vector, or a polynucleotide that has been integrated into a cellular chromosome, that provides non-AAV helper functions. The vector, pHelper, and derivatives thereof (such as those commercially available from Cell Biolabs, Inc., Invitrogen, Stratagene and other sources), are suitable non-AAV helper function-providing polynucleotide (see, e.g., Matsushita, T. et al. (1998) Adeno-Associated Virus Vectors Can Be Efficiently Produced Without Helper Virus, Gene Ther. 5:938-945; Sharma, A. et al. (2010) Transduction Efficiency Of AAV 2/6, 2/8 And 2/9 Vectors For Delivering Genes In Human Corneal Fibroblasts, Brain Res. Bull. 81(2-3):273-278).
[0086] Plasmid pHelper-Kan (SEQ ID NO:6;
TABLE-US-00006 CodingStrandofPlasmidpHelper-Kan(SEQIDNO:6): ggtacccaactccatgcttaacagtccccaggtacagcccaccctgcgtc gcaaccaggaacagctctacagcttcctggagcgccactcgccctacttc cgcagccacagtgcgcagattaggagcgccacttctttttgtcacttgaa aaacatgtaaaaataatgtactaggagacactttcaataaaggcaaatgt ttttatttgtacactctcgggtgattatttaccccccacccttgccgtct gcgccgtttaaaaatcaaaggggttctgccgcgcatcgctatgcgccact ggcagggacacgttgcgatactggtgtttagtgctccacttaaactcagg cacaaccatccgcggcagctcggtgaagttttcactccacaggctgcgca ccatcaccaacgcgtttagcaggtcgggcgccgatatcttgaagtcgcag ttggggcctccgccctgcgcgcgcgagttgcgatacacagggttgcagca ctggaacactatcagcgccgggtggtgcacgctggccagcacgctcttgt cggagatcagatccgcgtccaggtcctccgcgttgctcagggcgaacgga gtcaactttggtagctgccttcccaaaaagggtgcatgcccaggctttga gttgcactcgcaccgtagtggcatcagaaggtgaccgtgcccggtctggg cgttaggatacagcgcctgcatgaaagccttgatctgcttaaaagccacc tgagcctttgcgccttcagagaagaacatgccgcaagacttgccggaaaa ctgattggccggacaggccgcgtcatgcacgcagcaccttgcgtcggtgt tggagatctgcaccacatttcggccccaccggttcttcacgatcttggcc ttgctagactgctccttcagcgcgcgctgcccgttttcgctcgtcacatc catttcaatcacgtgctccttatttatcataatgctcccgtgtagacact taagctcgccttcgatctcagcgcagcggtgcagccacaacgcgcagccc gtgggctcgtggtgcttgtaggttacctctgcaaacgactgcaggtacgc ctgcaggaatcgccccatcatcgtcacaaaggtcttgttgctggtgaagg tcagctgcaacccgcggtgctcctcgtttagccaggtcttgcatacggcc gccagagcttccacttggtcaggcagtagcttgaagtttgcctttagatc gttatccacgtggtacttgtccatcaacgcgcgcgcagcctccatgccct tctcccacgcagacacgatcggcaggctcagcgggtttatcaccgtgctt tcactttccgcttcactggactcttccttttcctcttgcgtccgcatacc ccgcgccactgggtcgtcttcattcagccgccgcaccgtgcgcttacctc ccttgccgtgcttgattagcaccggtgggttgctgaaacccaccatttgt agcgccacatcttctctttcttcctcgctgtccacgatcacctctgggga tggcgggcgctcgggcttgggagaggggcgcttctttttctttttggacg caatggccaaatccgccgtcgaggtcgatggccgcgggctgggtgtgcgc ggcaccagcgcatcttgtgacgagtcttcttcgtcctcggactcgagacg ccgcctcagccgcttttttgggggcgcgcggggaggcggcggcgacggcg acggggacgacacgtcctccatggttggtggacgtcgcgccgcaccgcgt ccgcgctcgggggtggtttcgcgctgctcctcttcccgactggccatttc cttctcctataggcagaaaaagatcatggagtcagtcgagaaggaggaca gcctaaccgccccctttgagttcgccaccaccgcctccaccgatgccgcc aacgcgcctaccaccttccccgtcgaggcacccccgcttgaggaggagga agtgattatcgagcaggacccaggttttgtaagcgaagacgacgaggatc gctcagtaccaacagaggataaaaagcaagaccaggacgacgcagaggca aacgaggaacaagtcgggcggggggaccaaaggcatggcgactacctaga tgtgggagacgacgtgctgttgaagcatctgcagcgccagtgcgccatta tctgcgacgcgttgcaagagcgcagcgatgtgcccctcgccatagcggat gtcagccttgcctacgaacgccacctgttctcaccgcgcgtaccccccaa acgccaagaaaacggcacatgcgagcccaacccgcgcctcaacttctacc ccgtatttgccgtgccagaggtgcttgccacctatcacatctttttccaa aactgcaagatacccctatcctgccgtgccaaccgcagccgagcggacaa gcagctggccttgcggcagggcgctgtcatacctgatatcgcctcgctcg acgaagtgccaaaaatctttgagggtcttggacgcgacgagaaacgcgcg gcaaacgctctgcaacaagaaaacagcgaaaatgaaagtcactgtggagt gctggtggaacttgagggtgacaacgcgcgcctagccgtgctgaaacgca gcatcgaggtcacccactttgcctacccggcacttaacctaccccccaag gttatgagcacagtcatgagcgagctgatcgtgcgccgtgcacgacccct ggagagggatgcaaacttgcaagaacaaaccgaggagggcctacccgcag ttggcgatgagcagctggcgcgctggcttgagacgcgcgagcctgccgac ttggaggagcgacgcaagctaatgatggccgcagtgcttgttaccgtgga gcttgagtgcatgcagcggttctttgctgacccggagatgcagcgcaagc tagaggaaacgttgcactacacctttcgccagggctacgtgcgccaggcc tgcaaaatttccaacgtggagctctgcaacctggtctcctaccttggaat tttgcacgaaaaccgcctcgggcaaaacgtgcttcattccacgctcaagg gcgaggcgcgccgcgactacgtccgcgactgcgtttacttatttctgtgc tacacctggcaaacggccatgggcgtgtggcagcaatgcctggaggagcg caacctaaaggagctgcagaagctgctaaagcaaaacttgaaggacctat ggacggccttcaacgagcgctccgtggccgcgcacctggcggacattatc ttccccgaacgcctgcttaaaaccctgcaacagggtctgccagacttcac cagtcaaagcatgttgcaaaactttaggaactttatcctagagcgttcag gaattctgcccgccacctgctgtgcgcttcctagcgactttgtgcccatt aagtaccgtgaatgccctccgccgctttggggtcactgctaccttctgca gctagccaactaccttgcctaccactccgacatcatggaagacgtgagcg gtgacggcctactggagtgtcactgtcgctgcaacctatgcaccccgcac cgctccctggtctgcaattcgcaactgcttagcgaaagtcaaattatcgg tacctttgagctgcagggtccctcgcctgacgaaaagtccgcggctccgg ggttgaaactcactccggggctgtggacgtcggcttaccttcgcaaattt gtacctgaggactaccacgcccacgagattaggttctacgaagaccaatc ccgcccgccaaatgcggagcttaccgcctgcgtcattacccagggccaca tccttggccaattgcaagccatcaacaaagcccgccaagagtttctgcta cgaaagggacggggggtttacctggacccccagtccggcgaggagctcaa cccaatccccccgccgccgcagccctatcagcagccgcgggcccttgctt cccaggatggcacccaaaaagaagctgcagctgccgccgccgccacccac ggacgaggaggaatactgggacagtcaggcagaggaggttttggacgagg aggaggagatgatggaagactgggacagcctagacgaagcttccgaggcc gaagaggtgtcagacgaaacaccgtcaccctcggtcgcattcccctcgcc ggcgccccagaaattggcaaccgttcccagcatcgctacaacctccgctc ctcaggcgccgccggcactgcctgttcgccgacccaaccgtagatgggac accactggaaccagggccggtaagtctaagcagccgccgccgttagccca agagcaacaacagcgccaaggctaccgctcgtggcgcgggcacaagaacg ccatagttgcttgcttgcaagactgtgggggcaacatctccttcgcccgc cgctttcttctctaccatcacggcgtggccttcccccgtaacatcctgca ttactaccgtcatctctacagcccctactgcaccggcggcagcggcagcg gcagcaacagcagcggtcacacagaagcaaaggcgaccggatagcaagac tctgacaaagcccaagaaatccacagcggcggcagcagcaggaggaggag cgctgcgtctggcgcccaacgaacccgtatcgacccgcgagcttagaaat aggatttttcccactctgtatgctatatttcaacaaagcaggggccaaga acaagagctgaaaataaaaaacaggtctctgcgctccctcacccgcagct gcctgtatcacaaaagcgaagatcagcttcggcgcacgctggaagacgcg gaggctctcttcagcaaatactgcgcgctgactcttaaggactagtttcg cgccctttctcaaatttaagcgcgaaaactacgtcatctccagcggccac acccggcgccagcacctgtcgtcagcgccattatgagcaaggaaattccc acgccctacatgtggagttaccagccacaaatgggacttgcggctggagc tgcccaagactactcaacccgaataaactacatgagcgcgggaccccaca tgatatcccgggtcaacggaatccgcgcccaccgaaaccgaattctcctc gaacaggcggctattaccaccacacctcgtaataaccttaatccccgtag ttggcccgctgccctggtgtaccaggaaagtcccgctcccaccactgtgg tacttcccagagacgcccaggccgaagttcagatgactaactcaggggcg cagcttgcgggcggctttcgtcacagggtgcggtcgcccgggcgttttag ggcggagtaacttgcatgtattgggaattgtagtttttttaaaatgggaa gtgacgtatcgtgggaaaacggaagtgaagatttgaggaagttgtgggtt ttttggctttcgtttctgggcgtaggttcgcgtgcggttttctgggtgtt ttttgtggactttaaccgttacgtcattttttagtcctatatatactcgc tctgtacttggccctttttacactgtgactgattgagctggtgccgtgtc gagtggtgttttttaataggtttttttactggtaaggctgactgttatgg ctgccgctgtggaagcgctgtatgttgttctggagcgggagggtgctatt ttgcctaggcaggagggtttttcaggtgtttatgtgtttttctctcctat taattttgttatacctcctatgggggctgtaatgttgtctctacgcctgc gggtatgtattcccccgggctatttcggtcgctttttagcactgaccgat gttaaccaacctgatgtgtttaccgagtcttacattatgactccggacat gaccgaggaactgtcggtggtgctttttaatcacggtgaccagttttttt acggtcacgccggcatggccgtagtccgtcttatgcttataagggttgtt tttcctgttgtaagacaggcttctaatgtttaaatgtttttttttttgtt attttattttgtgtttaatgcaggaacccgcagacatgtttgagagaaaa atggtgtctttttctgtggtggttccggaacttacctgcctttatctgca tgagcatgactacgatgtgcttgcttttttgcgcgaggctttgcctgatt ttttgagcagcaccttgcattttatatcgccgcccatgcaacaagcttac ataggggctacgctggttagcatagctccgagtatgcgtgtcataatcag tgtgggttcttttgtcatggttcctggcggggaagtggccgcgctggtcc gtgcagacctgcacgattatgttcagctggccctgcgaagggacctacgg gatcgcggtatttttgttaatgttccgcttttgaatcttatacaggtctg tgaggaacctgaatttttgcaatcatgattcgctgcttgaggctgaaggt ggagggcgctctggagcagatttttacaatggccggacttaatattcggg atttgcttagagacatattgataaggtggcgagatgaaaattatttgggc atggttgaaggtgctggaatgtttatagaggagattcaccctgaagggtt tagcctttacgtccacttggacgtgagggcagtttgccttttggaagcca ttgtgcaacatcttacaaatgccattatctgttctttggctgtagagttt gaccacgccaccggaggggagcgcgttcacttaatagatcttcattttga ggttttggataatcttttggaataaaaaaaaaaaaacatggttcttccag ctcttcccgctcctcccgtgtgtgactcgcagaacgaatgtgtaggttgg ctgggtgtggcttattctgcggtggtggatgttatcagggcagcggcgca tgaaggagtttacatagaacccgaagccagggggcgcctggatgctttga gagagtggatatactacaactactacacagagcgagctaagcgacgagac cggagacgcagatctgtttgtcacgcccgcacctggttttgcttcaggaa atatgactacgtccggcgttccatttggcatgacactacgaccaacacga tctcggttgtctcggcgcactccgtacagtagggatcgcctacctccttt tgagacagagacccgcgctaccatactggaggatcatccgctgctgcccg aatgtaacactttgacaatgcacaacgtgagttacgtgcgaggtcttccc tgcagtgtgggatttacgctgattcaggaatgggttgttccctgggatat ggttctgacgcgggaggagcttgtaatcctgaggaagtgtatgcacgtgt gcctgtgttgtgccaacattgatatcatgacgagcatgatgatccatggt tacgagtcctgggctctccactgtcattgttccagtcccggttccctgca gtgcatagccggcgggcaggttttggccagctggtttaggatggtggtgg atggcgccatgtttaatcagaggtttatatggtaccgggaggtggtgaat tacaacatgccaaaagaggtaatgtttatgtccagcgtgtttatgagggg tcgccacttaatctacctgcgcttgtggtatgatggccacgtgggttctg tggtccccgccatgagctttggatacagcgccttgcactgtgggattttg aacaatattgtggtgctgtgctgcagttactgtgctgatttaagtgagat cagggtgcgctgctgtgcccggaggacaaggcgtctcatgctgcgggcgg tgcgaatcatcgctgaggagaccactgccatgttgtattcctgcaggacg gagcggcggcggcagcagtttattcgcgcgctgctgcagcaccaccgccc tatcctgatgcacgattatgactctacccccatgtaggcgtggacttccc cttcgccgcccgttgagcaaccgcaagttggacagcagcctgtggctcag cagctggacagcgacatgaacttaagcgagctgcccggggagtttattaa tatcactgatgagcgtttggctcgacaggaaaccgtgtggaatataacac ctaagaatatgtctgttacccatgatatgatgctttttaaggccagccgg ggagaaaggactgtgtactctgtgtgttgggagggaggtggcaggttgaa tactagggttctgtgagtttgattaaggtacggtgatcaatataagctat gtggtggtggggctatactactgaatgaaaaatgacttgaaattttctgc aattgaaaaataaacacgttgaaacataacatgcaacaggttcacgattc tttattcctgggcaatgtaggagaaggtgtaagagttggtagcaaaagtt tcagtggtgtattttccactttcccaggaccatgtaaaagacatagagta agtgcttacctcgctagtttctgtggattcactagaatcgatgtaggatg ttgcccctcctgacgcggtaggagaaggggagggtgccctgcatgtctgc cgctgctcttgctcttgccgctgctgaggaggggggcgcatctgccgcag caccggatgcatctgggaaaagcaaaaaaggggctcgtccctgtttccgg aggaatttgcaagcggggtcttgcatgacggggaggcaaacccccgttcg ccgcagtccggccggcccgagactcgaaccgggggtcctgcgactcaacc cttggaaaataaccctccggctacagggagcgagccacttaatgctttcg ctttccagcctaaccgcttacgccgcgcgcggccagtggccaaaaaagct agcgcagcagccgccgcgcctggaaggaagccaaaaggagcgctcccccg ttgtctgacgtcgcacacctgggttcgacacgcgggcggtaaccgcatgg atcacggcggacggccggatccggggttcgaaccccggtcgtccgccatg atacccttgcgaatttatccaccagaccacggaagagtgcccgcttacag gctctccttttgcacggtctagagcgtcaacgactgcgcacgcctcaccg gccagagcgtcccgaccatggagcactttttgccgctgcgcaacatctgg aaccgcgtccgcgactttccgcgcgcctccaccaccgccgccggcatcac ctggatgtccaggtacatctacggattacgtcgacgtttaaaccatatga tcagctcactcaaaggcggtaatacggttatccacagaatcaggggataa cgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgta aaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgag catcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggact ataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctg ttccgaccctgccgcttaccggatacctgtccgcctttctcccttcggga agcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgta ggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccg accgctgcgccttatccggtaactatcgtcttgagtccaacccggtaaga cacgacttatcgccactggcagcagccactggtaacaggattagcagagc gaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacg gctacactagaagaacagtatttggtatctgcgctctgctgaagccagtt accttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgc tggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaa aaggatctcaagaagatcctttgatcttttctacggggtctgacgctcag tggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaag gatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatct aaagtatatatgagtaaacttggtctgacagtcagaagaactcgtcaaga aggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaag cacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcac gggtagccaacgctatgtcctgatagcggtccgccacacccagccggcca cagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaa gcaggcatcgccatgggtcacgacgagatcctcgccgtcgggcatgctcg ccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcg tccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcg ctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaa gcgtatgcagccgccgcattgcatcagccatgatggatactttctcggca ggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatag cagccagtcccttcccgcttcagtgacaacgtcgagtacagctgcgcaag gaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagt tcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgccc ctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgtt gtgcccagtcatagccgaatagcctctccacccaagcggccggagaacct gcgtgcaatccatcttgttcaatcatactcttcctttttcaatattattg aagcatttatcagggttattgtctcatgagcggatacatatttgaatgta tttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtg ccacctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttt tgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatccc ttataaatcaaaagaatagaccgagatagggttgagtgttgttccagttt ggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcga aaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatc aagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaag ggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgaga aaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgt agcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgc tacagggcgcgatggatcc
[0087] In SEQ ID NO:6, residues 1-5343 of pHelper-Kan are derived from adenovirus, and include a polynucleotide encoding the E2A protein (residues 258-1847); residues 5344-8535 are derived from adenovirus, and include a polynucleotide encoding the E4orf6 protein; residues 9423-10011 correspond to ori sequences; residues 10182-10976 encode a kanamycin resistance determinant expressed by a bla promoter sequence (residues 10977-11081); residues 11107-11561 correspond to f1 ori sequences (
[0088] C. Illustrative rAAV Plasmid Vectors
[0089] As discussed above, AAV helper function-providing polynucleotides and non-AAV helper function-providing polynucleotides are typically employed in concert with an rAAV plasmid vector to comprise a triple plasmid transfection system. Multiple commercially available rAAV plasmid vectors (e.g., pAV-CMV-EGFP, pGOI, etc. (Cell Biolabs, Inc., Invitrogen and Stratagene)) may be used in accordance with the present invention. An illustrative rAAV plasmid vector that may be used in accordance with the present invention is pAV-CMV-EGFP (SEQ ID NO:7;
TABLE-US-00007 CodingStrandofPlasmidpAV-CMV-EGFP(SEQIDNO:7): cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcg ggcgacctttggtcgcccggccctccagtgagcgagcgcgcagagaggga gtggccaactccatcactaggggttcctgcggccgcacgcgtctagttat taatagtaatcgaattcgtgttactcataactagtaaggtcgggcaggaa gagggcctatttcccatgattccttcatatttgcatatacgatacaaggc tgttagagagataattagaattaatttgactgtaaacacaaagatattag tacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagtt ttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaa gtatttcgatttcttgggtttatatatcttgtggaaaggacgcgggatcc actggaccaggcagcagcgtcagaagacttttttggaaaagcttgactag taatactgtaatagtaatcaattacggggtcattagttcatagcccatat atggagttccgcgttacataacttacggtaaatggcccgcctggctgacc gcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatag taacgccaatagggactttccattgacgtcaatgggtggagtatttacgg taaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgcc ccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagt acatgaccttatgggactttcctacttggcagtacatctacgtattagtc atcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtgg atagcggtttgactcacggggatttccaagtctccaccccattgacgtca atgggagtttgttttgcaccaaaatcaacgggactttccaaaatgtcgta acaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggag gtctatataagcagagctggtttagtgaaccgtcagatccgctagagatc cggtaccgaggagatctgccgccgcgatcgccggcgcgccagatctcacg cttaactagctagcggaccgacgcgtacgcggccgctcgagatggtgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctgga cggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcg atgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaag ctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgca gtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggac gacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccct ggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaaca tcctggggcacaagctggagtacaactacaacagccacaacgtctatatc atggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgcca caacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaaca cccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagc acccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggt cctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagc tgtacaagtaagtcgaggattataaggatgacgacgataaattcgtcgag caccaccaccaccaccactaataaggtttatccgatccaccggatctaga taagatatccgatccaccggatctagataactgatcataatcagccatac cacatttgtagaggttttacttgctttaaaaaacctcccacacctccccc tgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttatt gcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaa taaagcatttttttcactgcattctagttgtggtttgtccaaactcatca atgtatcttaacgcggtaaccacgtgcggaccgagcggccgcaggaaccc ctagtgatggagttggccactccctctctgcgcgctcgctcgctcactga ggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcct cagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtat tttctccttacgcatctgtgcggtatttcacaccgcatacgtcaaagcaa ccatagtacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggt tacgcgcagcgtgaccgctacacctgccagcgccttagcgcccgctcctt tcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaa gctctaaatcgggggctccctttagggttccgatttagtgctttacggca cctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggccat cgccctgatagacggtttttcgccctttgacgttggagtccacgttcttt aatagtggactcttgttccaaactggaacaacactcaaccctatctcggg ctattcttttgatttataagggattttgccgatttcggcctattggttaa aaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatatta acgtttacaattttatggtgcactctcagtacaatctgctctgatgccgc atagttaagccagccccgacacccgccaacacccgctgacgcgccctgac gggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctcc gggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgag acgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataa taatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcgga acccctatttgtttatttttctaaatacattcaaatatgtatccgctcat gagacaataaccctgataaatgcttcaataatattgaaaaaggaagagta tgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattt tgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgc tgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaaca gcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatg agcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgc cgggcaagagcaactcggtcgccgcatacactattctcagaatgacttgg ttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagta agagaattatgcagtgctgccataaccatgagtgataacactgcggccaa cttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctg aatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaat ggcaacaacgttgcgcaaactattaactggcgaactacttactctagctt cccggcaacaattaatagactggatggaggcggataaagttgcaggacca cttctgcgctcggcccttccggctggctggtttattgctgataaatctgg agccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatg gtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaact atggatgaacgaaatagacagatcgctgagataggtgcctcactgattaa gcattggtaactgtcagaccaagtttactcatatatactttagattgatt taaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgat aatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgc gcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtt tgtttgccggatcaagagctaccaactctttttccgaaggtaactggctt cagcagagcgcagataccaaatactgtccttctagtgtagccgtagttag gccaccacttcaagaactctgtagcaccgcctacatacctcgctctgcta atcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgg gttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaa cggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaa ctgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagc gcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtc gggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcc tggccttttgctggccttttgctcacatgt
[0090] In SEQ ID NO:7, residues 1-128 of pAV-CMV-EGFP correspond to the 5 ITR; residues 201-441 are U6 promoter sequences; residues 562-865 are human cytomegalovirus (CMV) immediate early enhancer sequences; residues 866-1068 comprise the CMV immediate early promoter; residues 1192-1911 comprise a mammalian codon-optimized polynucleotide that encodes the EGFP; residues 1918-1941 encode the FLAG-tag; residues 1951-1968 encode the 6 His-tag; residues 2139-2260 encode the SV40 poly(A) sequence; residues 2293-2433 correspond to the 3 ITR; residues 2508-22963 correspond to F1 ori sequences; residues 3350-4210 encode an ampicillin resistance determinant and its signal sequence (residues 3350-3418) expressed by a bla promoter sequence (residues 3245-3349); residues 4381-4969 correspond to an ori sequence (
[0091] A second illustrative rAAV plasmid vector that may be used in accordance with the present invention is pAV-TBG-EGFP (SEQ ID NO:8;
TABLE-US-00008 CodingStrandofPlasmidpAV-TBG-EGFP(SEQIDNO:8): cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcg ggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagg gagtggccaactccatcactaggggttcctgcggccggtcgcgtctagta ctagtaggttaatttttaaaaagcagtcaaaagtccaagtggcccttggc agcatttactctctctgtttgctctggttaataatctcaggagcacaaac attccagatccaggttaatttttaaaaagcagtcaaaagtccaagtggcc cttggcagcatttactctctctgtttgctctggttaataatctcaggagc acaaacattccagatccggcgcgccagggctggaagctacctttgacatc atttcctctgcgaatgcatgtataatttctacagaacctattagaaagga tcacccagcctctgcttttgtacaactttcccttaaaaaactgccaattc cactgctgtttggcccaatagtgagaactttttcctgctgcctcttggtg cttttgcctatggcccctattctgcctgctgaagacactcttgccagcat ggacttaaacccctccagctctgacaatcctctttctcttttgttttaca tgaagggtctggcagccaaagcaatcactcaaagttcaaaccttatcatt ttttgctttgttcctcttggccttggttttgtacatcagctttgaaaata ccatcccagggttaatgctggggttaatttataactaagagtgctctagt tttgcaatacaggacatgctataaaaatggaaagatgttgctttctgaga gacaggtaccgaggagatctgccgccgcgatcgccaccatggtgagcaag ggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacgg cgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatg ccacttacggcaagctgaccctgaagttcatctgcaccaccggcaagctg cccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtg cttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccg ccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgac ggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggt gaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcc tggggcacaagctggagtacaactacaacagccacaacgtctatatcatg gccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaa catcgaggacggcagcgtgcagctcgccgaccactaccagcagaacaccc ccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacc cagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcct gctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgt acaagtagacgcgtacgcggccgctcgaggattataaggatgacgacgat aaattcgtcgagcaccaccaccaccaccactaataaggtttatccgatcc accggatctagataagatatccgatccaccggatctagataactgatcat aatcagccataccacatttgtagaggttttacttgctttaaaaaacctcc cacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgtt aacttgtttattgcagcttataatggttacaaataaagcaatagcatcac aaatttcacaaataaagcatttttttcactgcattctagttgtggtttgt ccaaactcatcaatgtatcttaacgcggtaaccacgtgcggacccaacgg ccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcg ctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttg cccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgc ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcat acgtcaaagcaaccatagtacgcgccctgtagcggcacattaagcgcggc gggtgtggtggttacgcgcagcgtgaccgctacacctgccagcgccttag cgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggc tttccccgtcaagctctaaatcgggggctccctttagggttccgatttag tgctttacggcacctcgaccccaaaaaacttgatttgggtgatggttcac gtagtgggccatcgccctgatagacggtttttcgccctttgacgttggag tccacgttctttaatagtggactcttgttccaaactggaacaacactcaa ctctatctcgggctattcttttgatttataagggattttgccgatttcgg tctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaatttt aacaaaatattaacgtttacaattttatggtgcactctcagtacaatctg ctctgatgccgcatagttaagccagccccgacacccgccaacacccgctg acgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagct gtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcacc gaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggtta atgtcatgataataatggtttcttagacgtcaggtggcacttttcgggga aatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatat gtatccgctcatgagacaataaccctgataaatgcttcaataatattgaa aaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttt tttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaa agtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaac tggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgt tttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatc ccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctc agaatgacttggttgagtactcaccagtcacagaaaagcatcttacggat ggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataa cactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaa ccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgg gaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgat gcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac ttactctagcttcccggcaacaattaatagactggatggaggcggataaa gttgcaggaccacttctgcgctcggcccttccggctggctggtttattgc tgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcac tggggccagatggtaagccctcccgtatcgtagttatctacacgacgggg agtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgc ctcactgattaagcattggtaactgtcagaccaagtttactcatatatac tttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaag atcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgtt ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatc ctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgcta ccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaa ggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatac ctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtc gtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagc ggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacg acctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcg gaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctt tatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtg atgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcct ttttacggttcctggccttttgctggccttttgctcacatgt
[0092] In SEQ ID NO:8, residues 1-130 of pAV-TBG-EGFP correspond to the 5 ITR; residues 150-854 are TBG promoter sequences, with residues 415-824 comprising the TBG promoter; residues 886-1608 encode the EGFP; residues 1630-1653 encode the FLAG-tag; residues 1663-1680 encode the 6 His-tag; residues 1851-1972 encode the poly(A) sequence; residues 2005-2145 corresponds to the 3 ITR; residues 2220-2675 correspond to F1 ori sequences; residues 3062-3922 encode an ampicillin resistance determinant and its signal sequence (residues 3062-3130) expressed by a bla promoter sequence (residues 2957-3061); residues 4093-4681 correspond to an ori sequence (
[0093] As used herein, the term native AAV serotype promoter sequence is intended to denote a promoter sequence that natively controls the transcription of an AAV rep gene or is natively present within such rep gene. For example: [0094] AAV1 P5 promoter sequences natively control the transcription of the rep gene of AAV1 and AAV1 P40 promoter sequences are natively found within the rep gene of AAV1. Thus, the AAV1 P5 promoter sequences and the AAV1 P40 promoter sequences are native AAV serotype promoter sequences of the rep gene of AAV1; [0095] AAV2 P5 promoter sequences natively control the transcription of the rep gene of AAV2 and the AAV2 P40 promoter sequences are natively found within the rep gene of AAV2. Thus, the AAV2 P5 promoter sequences and the AAV2 P40 promoter sequences are native AAV serotype promoter sequences of the rep gene of AAV2; [0096] AAV5 P5 promoter sequences natively control the transcription of the rep gene of AAV5 and the AAV5 P40 promoter sequences are natively found within the rep gene of AAV5. Thus, the AAV5 P5 promoter sequences and the AAV5 P40 promoter sequences are native AAV serotype promoter sequences of the rep gene of AAV5; [0097] AAV6 P5 promoter sequences natively control the transcription of the rep gene of AAV6 and the AAV6 P40 promoter sequences are natively found within the rep gene of AAV6. Thus, the AAV6 P5 promoter sequences and the AAV6 P40 promoter sequences are native AAV serotype promoter sequences of the rep gene of AAV6; and [0098] AAV7 P5 promoter sequences natively control the transcription of the rep gene of AAV7 and the AAV7 P40 promoter sequences are natively found within the rep gene of AAV7. Thus, the AAV7 P5 promoter sequences and the AAV7 P40 promoter sequences are native AAV serotype promoter sequences of the rep gene of AAV7;
[0099] Native AAV P5 and P40 promoter sequences for AAV serotypes 1-8 are shown in Table 1. Such sequences, or subsequences thereof that are capable of mediating transcription, may be used in accordance with the methods of the present invention.
TABLE-US-00009 TABLE1 SEQID AAV Native NO Promoter Serotype Sequence SEQID P5 AAV1 ggtcctgtattagctgtcacgtgagtgctt NO:9 ttgcgacattttgcgacaccacgtggccat ttagggtatatatggccgagtgagcgagca ggatctccattttgaccgcgaaatttgaac gagcagcagcc SEQID P5 AAV2 ggtcctgtattagaggtcacgtgagtgttt NO:10 tgcgacattttgcgacaccatgtggtcacg ctgggtatttaagcccgagtgagcacgcag ggtctccattttgaagcgggaggtttgaac gcgcagccgcc SEQID P5 AAV3 ccagctgcgtcagcagtcaggtgacccttt NO:11 tgcgacagtttgcgacaccacgtggccgct gagggtatatattctcgagtgagcgaacca ggagctccattttgaccgcgaaatttgaac gagcagcagcc SEQID P5 AAV4 ggtccctgtattagcagtcacgtgagtgtc NO:12 gtatttcgcggagcgtagcggagcgcatac caagctgccacgtcacagccacgtggtccg tttgcgacagtttgcgacaccatgtggtca ggagggtatataaccgcgagtgagccagcg aggagctccattttgcccgcgaattttgaa cgagcagcagcc SEQID P5 AAV5 atgtgatgtgttttatccaataggaagaaa NO:13 gcgcgcgtatgagttctcgcgagacttccg gggtataaaagaccgagtgaacgagcccgc cgccattctttgctctggactgctagagga ccctcgctgcc SEQID P5 AAV6 ggtcctgtattagaggtcacgtgagtgttt NO:14 tgcgacattttgcgacaccatgtggtcacg ctgggtatttaagcccgagtgagcacgcag ggtctccattttgaagcgggaggtttgaac gcgcagcgcc SEQID P5 AAV7 ggtcctgtattagctgtcacgtgagtgctt NO:15 ttgcgacattttgcgacaccacgtggccat ttgaggtatatatggccgagtgagcgagca ggatctccattttgaccgcgaaatttgaac gagcagcagcc SEQID P5 AAV8 ggtcctgtattagctgtcacgtgagtgctt NO:16 ttgcggcattttgcgacaccacgtggccat ttgaggtatatatggccgagtgagcgagca ggatctccattttgaccgcgaaatttgaac gagcagcagcc SEQID P40 AAV1 ggtgacaaagcaggaagtcaaagagttctt NO:17 ccgctgggcgcaggatcacgtgaccgaggt ggcgcatgagttctacgtcagaaagggtgg agccaacaaaagacccgcccccgatgacgc ggataaaagcgagcccaagcgggcctgccc ctcagtcgcggatccatcgacgtcagacgc SEQID P40 AAV2 ggtcaccaagcaggaagtcaaagacttttt NO:18 ccggtgggcaaaggatcacgtggttgaggt ggagcatgaattctacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgc agatataagtgagcccaaacgggtgcgcga gtcagttgcgcagccatcgacgtcagacgc SEQID P40 AAV3 ggtcaccaaacaggaagtaaaggacttttt NO:19 ccggtgggcttccgatcacgtgactgacgt ggctcatgagttctacgtcagaaagggtgg agctaagaaacgccccgcctccaatgacgc ggatgtaagcgagccaaaacgggagtgcac gtcacttgcgcagccgacaacgtcagacgc SEQID P40 AAV4 ggtcaccaagcaggaagtcaaagacttttt NO:20 ccggtgggcgtcagatcacgtgaccgaggt gactcacgagttttacgtcagaaagggtgg agctagaaagaggcccgcccccaatgacgc agatataagtgagcccaagcgggcctgtcc gtcagttgcgcagccatcgacgtcagacgc SEQID P40 AAV5 gattactaagcaggaagtcaaggacttttt NO:21 tgcttgggcaaaggtcaatcaggtgccggt gactcacgagtttaaagttcccagggaatt ggcgggaactaaaggggcggagaaatctct aaaacgcccactgggtgacgtcaccaatac tagctataaaagtctggagaagcgggcctg gagcatgaggctctcatttgttcccgagac gcctcgcagttcagacg SEQID P40 AAV6 ggtgacaaagcaggaagtcaaagagttctt NO:22 ccgctgggcgcaggatcacgtgaccgaggt ggcgcatgagttctacgtcagaaagggtgg agccaacaagagacccgcccccgatgacgc ggataaaagcgagcccaagcgggcctgccc ctcagtcgcggatccatcgacgtcagacgc SEQID P40 AAV8 ggtgacgaagcaggaagtcaaagagttctt NO:23 ccgctgggccagtgatcacgtgaccgaggt ggcgcatgagttctacgtcagaaagggcgg agccagcaaaagacccgcccccgatgacgc ggatataagcgagcccaagcgggcctgccc ctcagtcgcggatccatcgacgtcagacgc SEQID P40 AAV8 ggtgacaaagcaggaagtcaaagagttctt NO:24 ccgctgggccagtgatcacgtgaccgaggt ggcgcatgagttttacgtcagaaagggcgg agccagcaaaagacccgcccccgatgacgc ggataaaagcgagcccaagcgggcctgccc ctcagtcgcggatccatcgacgtcagacgc
[0100] In contrast, the term non-native AAV serotype promoter sequence is intended to denote a promoter sequence that does not natively control a rep gene of an AAV and is not natively found within such rep gene. Illustrative, non-limiting examples of non-native AAV serotype promoter sequences include: the AAV1 P5 promoter when used to direct the expression of an AAV2, AAV5, AAV6, or AAV7 rep gene; the AAV2 P5 promoter when used to direct the expression of an AAV1, AAV5, AAV6, or AAV7 rep gene; the AAV5 P5 promoter when used to direct the expression of an AAV1, AAV2, AAV6, or AAV7 rep gene; the AAV6 P5 promoter when used to direct the expression of an AAV1, AAV2, AAV5, or AAV7 rep gene; the AAV7 P5 promoter when used to direct the expression of an AAV1, AAV2, AAV5, or AAV6 rep gene; the AAV1 P40 promoter, when present within an AAV2, AAV5, AAV6, or AAV7 rep gene; the AAV2 P40 promoter, when present within an AAV1, AAV5, AAV6, or AAV7 rep gene; the AAV5 P40 promoter, when present within an AAV1, AAV2, AAV6, or AAV7 rep gene; the AAV6 P40 promoter, when present within an AAV1, AAV2, AAV5, or AAV7 rep gene; the AAV7 P40 promoter, when present within an AAV1, AAV2, AAV5, or AAV6 rep gene, etc.
[0101] In one embodiment, one or more of such AAV serotype promoter sequences can be genetically engineered into recombinant AAV helper plasmids that are designed to provide the Rep and Cap proteins to replace or augment the existing P5 or P40 promoters of such plasmids. Such modification is preferably accomplished using well-known methods of recombinant DNA technology.
[0102] The identity of the serotype of promoter sequences is indicated herein by denoting the involved promoter (e.g., P5, P40, etc.), the serotype of the rep gene with which it is natively associated, and the name of the vector. Thus, for example, a pAAV-RC2 plasmid that comprises a P5 promoter sequence that is natively associated with AAV2 is denoted as P5(2)-RC2; a pAAV-RC2 plasmid that comprises a P5 promoter sequence that is natively associated with AAV3 is denoted as P5(3)-RC2; a pAAV-RC5 plasmid that comprises a P40 promoter sequence that is natively associated with AAV7 is denoted as P40(7)-RCS; a pAAV-RC2 plasmid that comprises a P5 promoter sequence that is natively associated with AAV3 and a P40 promoter sequence that is natively associated with AAV8 is denoted as P5(3)/P40(8)-RC2; etc.
[0103] In one embodiment, the introduced AAV serotype promoter sequence will replace an initially present AAV serotype promoter sequence. In other embodiments, the introduced AAV serotype promoter sequence will be present in addition to such initially present AAV serotype promoter sequence, and will be positioned 5 to, or 3 to, such initially present AAV serotype promoter sequence. The introduced nucleotide sequence may be positioned adjacent to, or apart from, such initially present AAV serotype promoter sequence.
[0104] The substitution or addition of one or more of such AAV serotype promoter sequences invention increases rAAV production titers. As used herein, the term production titer is intended to denote the amount of concentration of infectious rAAV in a preparation. Such amounts or concentrations are preferably determined by titering the AAV or rAAV in such preparation. The production titers of the rAAV preparations of the present invention are preferably titered after subjecting producing cells (e.g., HEK293 transformed with an rAAV plasmid vector, an AAV helper vector providing Rep and Cap proteins, and an Ad helper vector providing required adenovirus transcription and translation factors) to three rounds of freeze/thawing, followed by sonication to release the rAAV particles. The preparation is then centrifuged. The employed AAV helper vector is localized to the supernatant. An aliquot of the preparation is treated with proteinase K, and the number of AAV genomes is determined. An aliquot of the preparation is infected into HeLa-32C2 cells (which express AAV2 Rep and Cap proteins), and infectious titer is measured using the infectious center assay (ICA) (Franois, A. et al. (2018) Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls, Molec. Ther. Meth. Clin. Develop. 10:223-236) or more preferably, as the median tissue culture infective dose (TCID50) (Zen, Z. et al. (2004) Infectious Titer Assay For Adeno Associated Virus Vectors With Sensitivity Sufficient To Detect Single Infectious Events, Hum. Gene Ther. 15:709-715).
[0105] As used herein, an rAAV production titer is said to be increased by the methods of the present invention if the production titer obtained from the use of the methods of the present invention is at least 10% greater, more preferably at least 20% greater, still more preferably at least 30% greater, still more preferably at least 40% greater, still more preferably at least 50% greater, still more preferably at least 60% greater, still more preferably at least 70% greater, still more preferably at least 80% greater, still more preferably at least 90% greater, still more preferably at least 2-fold greater, still more preferably at least 110% greater, still more preferably at least 120% greater, still more preferably at least 130% greater, still more preferably at least 140% greater, still more preferably at least 2.5-fold greater, still more preferably at least 160% greater, still more preferably at least 170% greater, still more preferably at least 180% greater, still more preferably at least 190% greater, and still more preferably at least 3-fold greater than the titer obtained from a similarly conducted production in which the additionally provided ions were not provided.
[0106] The rAAV whose production titer may be increased using the methods of the present invention may comprise any transgene cassette that permits the rAAV to be packaged into an rAAV plasmid vector that may be encapsidated within an AAV capsid particle. Without limitation, such transgene cassette(s) may be of human, primate (including chimpanzee, gibbon, gorilla, orangutan, etc.), cercopithecine (including baboon, cynomolgus monkey, velvet monkey, etc.), canine, glirine (including rat, mouse, hamster, guinea pig, etc.), feline, ovine, caprine, or equine origin.
[0107] In preferred embodiments, such an rAAV or rAAV plasmid vector will encode a protein (e.g., an enzyme, hormone, antibody, receptor, ligand, etc.), or comprise a transcribed nucleic acid, that is relevant to a genetic or heritable disease or condition, such that it may be used in gene therapy to treat such disease or condition.
[0108] The methods of the present invention may be used to increase the production titer of rAAV and rAAV plasmid vectors in cells that have been additionally transfected with: [0109] (1) an AAD helper vector possessing a non-native AAV serotype promoter sequence and capable of expressing proteins or RNA molecules that are not natively provided by such rAAV or rAAV plasmid vectors, but are required for their production. As discussed above, such proteins or RNA molecules include the genes encoding the Rep52 and Rep78 proteins that are required for vector transcription control and replication, and for the packaging of viral genomes into the viral capsule, and cap genes that encode VP capsid proteins required to form infectious particles; and [0110] (2) an Ad helper vector that can provide the non-AAV helper proteins (e.g., E1a, E1b, E2a, VA and E4) or RNA molecules that are not provided by such rAAV or rAAV plasmid vectors, but are required for their production.
[0111] In one embodiment for producing the rAAV of the present invention, all of such genes and RNA molecules are provided on the same helper virus (or more preferably, helper vector) so as to comprise, in concert with an rAAV, a double plasmid transfection system. More preferably, however, for producing the rAAV of the present invention, the AAV helper function-providing polynucleotide that provides the required rep and cap genes and such non-native AAV serotype promoter sequences are provided on a vector that is separate from the vector that comprises the non-AAV helper function-providing polynucleotide, so that such vectors or plasmids, in concert with the rAAV, comprise a triple plasmid transfection system.
[0112] The invention thus derives in part from the recognition that the production of rAAV may be increased by causing the expression of Rep and Cap proteins to be directed by promoter sequences that are not native promoter sequences. Thus, by modifying a particular rAAV to replace its native P5 and/or P40 AAV serotype promoter sequence(s) with a non-native P5 and/or P40 AAV serotype promoter sequence (or by incorporating a non-native P5 and/or P40 AAV serotype promoter sequence into such rAAV), the methods of the present invention may be employed to increase the production titer of rAAV belonging to any serotype, including the AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV10 serotypes, and including hybrid serotypes (e.g., AAV2/5 and rAAV2/5, which is a hybrid of AAV serotypes 2 and 5 and thus has the trophism of both such serotypes).
[0113] The methods of the present invention may be employed to increase the production titers of rAAV that are to be produced using helper RNA or proteins provided by an adenovirus, a herpes simplex virus, a cytomegalovirus, a vaccinia virus or a papillomavirus.
[0114] The methods of the present invention may be employed to increase the production titers of rAAV produced by cells in adherent monolayer culture or in suspension culture, and may be used with any method capable of producing rAAV. Preferably, however, rAAV is produced by transfecting baby hamster kidney (BHK) cells, or more preferably, human embryonic kidney (HEK) cells grown in tissue culture with the plasmid vectors described above. The BHK cell line BHK-21 (ATCC CCL-10), which lacks endogenous retroviruses is a preferred BHK cell line. The HEK cell line HEK293 (ATCC CRL-1573) and its derivatives, such as HEK293T (ATCC CRL-3216, which is a highly transfectable derivative of the HEK293 cell line into which the temperature-sensitive gene for SV40 T-antigen was inserted) or HEK293T/17 (ATCC CRL-11268, which was selected for its ease of transfection) are particularly preferred. The HEK293T/17 SF cell line (ATCC ACS-4500) is a derivative of the 293T/17 cell line (ATCC CRL-11268), adapted to serum-free medium and suspension, and may be employed if desired.
[0115] The preferred base medium of the present invention for culturing such cells is Eagle's Minimum Essential Medium (ATCC Catalog No. 30-2003) or Dulbecco's Modified Eagle's Medium (DMEM; Mediatech, Manassas, Va.). Fetal bovine serum (e.g., FBS; HyClone Laboratories, South Logan, Utah) is added to a final concentration of 10% in order to make the complete growth medium. Eagle's Minimum Essential Medium and Dulbecco's Modified Eagle's Medium are complex media that contain amino acids, vitamins, and optionally glucose, in addition to various inorganic salts. The media differ in that Dulbecco's modified Eagle's medium contains approximately four times as much of the vitamins and amino acids present in the original formula of Eagle's Minimum Essential Medium, and two to four times as much glucose. Additionally, it contains iron in the form of ferric sulfate and phenol red for pH indication (Yao, T et al. (2017) Animal-Cell Culture Media: History, Characteristics, And Current Issues, Reproduc. Med. Biol. 16(2): 99-117).
[0116] Cells to be used for such transfection are preferably passaged twice weekly to maintain them in exponential growth phase. For small-scale transfections, an aliquot of, for example, 110.sup.6 HEK293 or BHK cells per well on a multi-well plate, or 1.510.sup.7 HEK293 cells per 15-cm dish, may be employed. For large-scale production HEK293 or BHK cells may be collected from multiple confluent 15-cm plates, and split into two 10-layer cell stacks (Corning, Corning, N.Y.) containing 1 liter of complete culturing medium. In one embodiment, such cells are grown for 4 days in such medium before transfection. The day before transfection, the two cell stacks may be trypsinized and the cells (e.g., approximately 610.sup.8 cells) may be resuspended in 200 ml of medium. Preferably, the cells are allowed to attach for 24 hours before transfection. Confluency of the cell stacks may be monitored using a Diaphot inverted microscope (Nikon, Melville, N.Y.) from which the phase-contrast hardware had been removed in order to accommodate the cell stack on the microscope stage.
[0117] In particular, the present invention thus provides a method for increasing the production titer of a recombinantly-modified adeno-associated virus (rAAV) that comprises a transgene cassette, wherein the method comprises culturing cells that have been transfected with: [0118] (1) the rAAV; [0119] (2) a recombinantly-modified adeno-associated virus (AAV) helper vector that comprises an AAV helper function-providing polynucleotide, wherein such polynucleotide comprises a non-native AAV serotype P5 or P40 promoter sequence in replacement of, or in addition to, a native AAV serotype promoter sequence; and [0120] (3) a vector that comprises a non-AAV helper function-providing polynucleotide;
wherein the culturing is conducted in a culture medium under conditions sufficient to permit the production of the rAAV, and wherein the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce the rAAV at an increased production titer relative to that which would be attained if the AAV helper function-providing polynucleotide contained native serotype P5 and P40 promoters.
[0121] The present invention further provides a method for increasing the production titer of a recombinantly-modified adeno-associated virus (rAAV) that comprises a transgene cassette, wherein the method comprises culturing cells that have been transfected with: [0122] (1) the rAAV; and [0123] (2) a recombinantly-modified adeno-associated virus (AAV) helper vector that comprises: [0124] (a) an AAV helper function-providing polynucleotide, wherein such polynucleotide comprises a non-native AAV serotype P5 or P40 promoter sequence in replacement of, or in addition to, a native AAV serotype promoter sequence; and [0125] (b) a non-AAV helper function-providing polynucleotide;
wherein the culturing is conducted in a culture medium under conditions sufficient to permit the production of the rAAV, and wherein the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce the rAAV at an increased production titer relative to that which would be attained if the AAV helper function-providing polynucleotide contained native serotype P5 and P40 promoters.
[0126] In preferred embodiments, the transgene cassette of such rAAV encodes a protein, or comprises a transcribed nucleic acid, that is therapeutic for a genetic or heritable disease or condition.
II. Pharmaceutical Compositions of the Present Invention
[0127] The invention additionally includes pharmaceutical compositions that comprise a pharmaceutically acceptable preparation of rAAV produced in accordance with the methods of the present invention, and a pharmaceutically acceptable carrier. The rAAV of such pharmaceutical compositions comprises a transgene cassette that encodes a protein, or comprises a transcribed nucleic acid, that is therapeutic for a genetic or heritable disease or condition, and is present in such pharmaceutical composition in an amount effective to (effective amount)
[0128] The term pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term carrier refers to a diluent, adjuvant (e.g., Freund's adjuvant complete and incomplete), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. Suitable pharmaceutical excipients are described in U.S. Pat. Nos. 8,852,607; 8,192,975; 6,764,845; 6,759,050; and 7,598,070.
[0129] Generally, the ingredients of compositions of the invention are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate, or as an aqueous solution in a hermetically sealed container such as a vial, an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline, or other diluent can be provided so that the ingredients may be mixed prior to administration.
[0130] The invention also provides a pharmaceutical pack or kit comprising one or more containers such pharmaceutical composition. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
[0131] The rAAV of such pharmaceutical compositions is preferably packaged in a hermetically sealed container, such as a vial, an ampoule or sachette indicating the quantity of the molecule, and optionally including instructions for use. In one embodiment, the rAAV of such kit is supplied as a dry sterilized lyophilized powder or water-free concentrate in a hermetically sealed container and can be reconstituted, e.g., with water, saline, or other diluent to the appropriate concentration for administration to a subject. The lyophilized material should be stored at between 2 C. and 8 C. in their original container and the material should be administered within 12 hours, preferably within 6 hours, within 5 hours, within 3 hours, or within 1 hour after being reconstituted. In another embodiment, the rAAV of such kit is supplied as an aqueous solution in a hermetically sealed container and can be diluted, e.g., with water, saline, or other diluent, to the appropriate concentration for administration to a subject. The kit can further comprise one or more other prophylactic and/or therapeutic agents useful for the treatment of the disease or condition, in one or more containers; and/or the kit can further comprise one or more cytotoxic antibodies that bind one or more cancer antigens associated with cancer. In certain embodiments, the other prophylactic or therapeutic agent is a chemotherapeutic. In other embodiments, the prophylactic or therapeutic agent is a biological or hormonal therapeutic.
III. Uses of the Invention
[0132] The methods of the present invention may be used to facilitate the production of rAAV, and may particularly be used to facilitate the production of rAAV that comprise transgene cassettes that encode a protein (e.g., an enzyme, hormone, antibody, receptor, ligand, etc.), or of rAAV that comprise a transcribed nucleic acid, that is relevant to a genetic or heritable disease or condition, such that it may be used in gene therapy to treat such disease or condition. Examples of such diseases and conditions include: achromatopsia (ACHM); alpha-1 antitrypsin (AAT) deficiency; Alzheimer's Disease; aromatic L-amino acid decarboxylase (AADC) deficiency; choroideremia (CHM); cancer; Duchenne muscular dystrophy; dysferlin deficiency; follistatin gene deficiency (BMDSIBM); hemophilia A; hemophilia B; hepatitis A; hepatitis B; hepatitis C; Huntington's disease; idiopathic Parkinson's disease; late-infantile neuronal ceroid lipofuscinosis (LINCL, an infantile form of Batten disease); Leber congenital amaurosis (LCA); Leber's hereditary optic neuropathy (LHON); limb girdle muscular dystrophy 1B (LGMD1B); limb girdle muscular dystrophy 1C (LGMD1C); limb girdle muscular dystrophy 2A (LGMD2A); limb girdle muscular dystrophy 2B (LGMD2B); limb girdle muscular dystrophy 2I (LGMD2I); limb girdle muscular dystrophy 2L (LGMD2L); lipoprotein lipase (LPL) deficiency; metachromatic leukodystrophy; neurological disability; neuromotor deficit; neuroskeletal impairment; Parkinson's disease; rheumatoid arthritis; Sanfilippo A syndrome; spinal muscular atrophy (SMA); X-linked retinoschisis (XLRS); -sarcoglycan deficiency (LGMD2D); -sarcoglycan deficiency (LGMD2E); -sarcoglycan deficiency (LGMD2C) and -sarcoglycan deficiency (LGMD2F).
IV. Embodiments of the Invention
[0133] The invention concerns a recombinantly-modified adeno-associated virus (AAV) helper vector that comprises an AAV helper function-providing polynucleotide, and uses and compositions thereof. It is particularly directed to the following embodiments E1-E16: [0134] E1. A recombinantly-modified adeno-associated virus (AAV) helper vector that comprises an AAV helper function-providing polynucleotide, wherein the polynucleotide comprises a non-native AAV serotype P5 or P40 promoter sequence. [0135] E2. The recombinantly-modified adeno-associated virus (AAV) helper vector of E1, wherein the AAV helper function-providing polynucleotide vector comprises a non-native AAV serotype P5 promoter sequence. [0136] E3. The recombinantly-modified adeno-associated virus (AAV) helper vector of any one of E1 or E2, wherein the AAV helper function-providing polynucleotide vector comprises a non-native AAV serotype P40 promoter sequence. [0137] E4. The recombinantly-modified adeno-associated virus (AAV) helper vector of any one of E1-E3, wherein the vector is a plasmid vector. [0138] E5. The recombinantly-modified adeno-associated virus (AAV) helper vector of E1, wherein the non-native AAV serotype P5 or P40 promoter sequence replaces a native AAV serotype promoter sequence. [0139] E6. The recombinantly-modified adeno-associated virus (AAV) helper vector of any one of E1-E5, wherein the vector additionally comprises a non-AAV helper function-providing polynucleotide. [0140] E7. A method for increasing the production titer of a recombinantly-modified adeno-associated virus (rAAV) that comprises a transgene cassette, wherein the method comprises culturing cells that have been transfected with: [0141] (1) the rAAV; [0142] (2) the recombinantly-modified adeno-associated virus (AAV) helper vector of E6;
wherein the culturing is conducted in a culture medium under conditions sufficient to permit the production of the rAAV and wherein the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce the rAAV at an increased production titer relative to that which would be attained if the AAV helper function-providing polynucleotide contained native serotype P5 and P40 promoters. [0143] E8. A method for increasing the production titer of a recombinantly-modified adeno-associated virus (rAAV) that comprises a transgene cassette, wherein the method comprises culturing cells that have been transfected with: [0144] (1) the rAAV; [0145] (2) the recombinantly-modified adeno-associated virus (AAV) helper vector of any one of E1-E6; and [0146] (3) an additional vector, especially a plasmid vector, that comprises a non-AAV helper function-providing polynucleotide;
wherein the culturing is conducted in a culture medium under conditions sufficient to permit the production of the rAAV, and wherein the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce the rAAV at an increased production titer relative to that which would be attained if the AAV helper function-providing polynucleotide contained native serotype P5 and P40 promoters. [0147] E9. The method of any one of E7-E8, wherein: [0148] (A) the AAV helper function-providing polynucleotide of the vector encodes an AAV1 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the serotypes; [0149] (B) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the serotypes; [0150] (C) the AAV helper function-providing polynucleotide of the vector encodes an AAV3 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the serotypes; [0151] (D) the AAV helper function-providing polynucleotide of the vector encodes an AAV4 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the serotypes; [0152] (E) the AAV helper function-providing polynucleotide of the vector encodes an AAV5 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV6, AAV7 or AAV8, or a hybrid of one or more of the serotypes; [0153] (F) the AAV helper function-providing polynucleotide of the vector encodes an AAV6 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV7 or AAV8, or a hybrid of one or more of the serotypes; [0154] (G) the AAV helper function-providing polynucleotide of the vector encodes an AAV7 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV8, or a hybrid of one or more of the serotypes; or [0155] (H) the AAV helper function-providing polynucleotide of the vector encodes an AAV8 Cap protein, and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV7, or a hybrid of one or more of the serotypes. [0156] E10. The method of any one of E7-E9, wherein the cells are human embryonic kidney cells, baby hamster kidney cells or sf9 insect cells. [0157] E11. The method of E10, wherein the cells are HEK293 human embryonic kidney cells. [0158] E12. The method of E10, wherein the cells are BHK21 baby hamster kidney cells. [0159] E13. The method of any one of E7-E12, wherein the transgene cassette encodes a protein, or comprises a transcribed nucleic acid, that is therapeutic for a genetic or heritable disease or condition. [0160] E14. A preparation of the recombinantly-modified adeno-associated virus (rAAV) produced by the method of E13. [0161] E15. A pharmaceutical composition that comprises the recombinantly-modified adeno-associated virus (rAAV) produced by the method of E13, and a pharmaceutically acceptable carrier. [0162] E16. The preparation of recombinantly-modified adeno-associated virus (rAAV) of E14, or the pharmaceutical composition of E15, for use in the treatment of the genetic or heritable disease or condition.
EXAMPLES
[0163] Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention unless specified.
Example 1
Comparison of rAAV Production Titers by Cells Transfected with AAV RC2 Helper Plasmid Vectors Having a Non-Native AAV Serotype P5 Promoter Sequence
[0164] In order to demonstrate the ability of non-native AAV serotype promoter sequences to affect the production titer of rAAV, derivatives of AAV helper plasmid AAV RC2 (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAV2 serotype) were constructed that comprised a non-native AAV serotype promoter sequence (
[0165] The following constructs were employed; the sequences of the promoter regions are shown in Table 1: [0166] (1) Parent-RC2pAAV-RC2 (SEQ ID NO:2), which contains the AAV2 rep gene and a partial portion of the full AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV2 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0167] (2) P5(1)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 1 (SEQ ID NO:9); [0168] (3) P5(2)-RC2a derivative of plasmid vector pAAV-RC2 in which the partial AAV2 serotype P5 promoter sequences of Parent-RC2 had been replaced with the full-length P5 promoter sequences of AAV serotype 2 (SEQ ID NO:10); [0169] (4) P5(3)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 3 (SEQ ID NO:11); [0170] (5) P5(4)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 4 (SEQ ID NO:12); [0171] (6) P5(5)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 5 (SEQ ID NO:13); [0172] (7) P5(6)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 6 (SEQ ID NO:14); [0173] (8) P5(7)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 7 (SEQ ID NO:15); and [0174] (9) P5(8)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequences of AAV serotype 8 (SEQ ID NO:16).
[0175]
Example 2
Comparison of rAAV Production Titers by Cells Transfected with AAV RC2 Helper Plasmid Vectors Having a Non-Native AAV Serotype P40 Promoter Sequence
[0176] In order to further demonstrate the ability of non-native AAV serotype promoter sequences to affect the production titer of rAAV, derivatives of AAV helper plasmid AAV RC2 (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAV2 serotype) were constructed that comprised a non-native AAV serotype promoter sequence (
[0177] The following constructs were employed; the sequences of the promoter regions are shown in Table 1: [0178] (1) Parent-RC2pAAV-RC2 (SEQ ID NO:2), which contains the AAV2 rep gene and a partial portion of the full AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV2 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0179] (2) P40(1)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 1 (SEQ ID NO:17); [0180] (3) P40(2)-RC2a derivative of plasmid vector pAAV-RC2 in which the AAV2 serotype P40 promoter sequences of Parent-RC2 had been replaced with the P40 promoter sequences of AAV serotype 2 (SEQ ID NO:18); [0181] (4) P40(3)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 3 (SEQ ID NO:19); [0182] (5) P40(4)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 4 (SEQ ID NO:20); [0183] (6) P40(5)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 5 (SEQ ID NO:21); [0184] (7) P40(6)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 6 (SEQ ID NO:22); [0185] (8) P40(7)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 7 (SEQ ID NO:23); and [0186] (9) P40(8)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequences of AAV serotype 8 (SEQ ID NO:24).
[0187]
Example 3
Comparison of rAAV Production Titers by Cells Transfected with AAV RC2 Helper Plasmid Vectors Having Non-Native AAV Serotype P5 and P40 Promoter Sequences
[0188] In order to further demonstrate the ability of non-native AAV serotype promoter sequences to affect the production titer of rAAV, derivatives of AAV helper plasmid AAV RC2 (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAV2 serotype) were constructed that comprised non-native AAV serotype promoter sequences (
[0189] The following constructs were employed; the sequences of the promoter regions are shown in Table 1: [0190] (1) Parent-RC2pAAV-RC2 (SEQ ID NO:2), which contains the AAV2 rep gene and a partial portion of the full AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV2 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0191] (2) P5(2)-RC2a derivative of plasmid vector pAAV-RC2 in which the partial AAV2 serotype P5 promoter sequences of Parent-RC2 had been replaced with the full-length P5 promoter sequences of AAV serotype 2 (SEQ ID NO:10); [0192] (3) P5(3)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV3 (SEQ ID NO:11); [0193] (4) P5(5)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV5 (SEQ ID NO:13); [0194] (5) P40(1)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P40 promoter sequences had been replaced with the P40 promoter sequence of AAV1 (SEQ ID NO:17); [0195] (6) P5(2)/P40(1)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV2 (SEQ ID NO:10) and in which native P40 promoter sequences had been replaced with the P40 promoter sequence of AAV1 (SEQ ID NO:17); [0196] (7) P5(3)/P40(1)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV3 (SEQ ID NO:11) and in which native P40 promoter sequences had been replaced with the P40 promoter sequence of AAV1 (SEQ ID NO:17); and [0197] (8) P5(5)/P40(1)-RC2a derivative of plasmid vector pAAV-RC2 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV5 (SEQ ID NO:13) and in which native P40 promoter sequences had been replaced with the P40 promoter sequence of AAV1 (SEQ ID NO:17).
[0198] Production titers of rAAV were obtained essentially as described in Example 1.
Example 4
Comparison of rAAV Production Titers by Cells Transfected with AAV RC6 Helper Plasmid Vectors Having Non-Native AAV Serotype P5 and P40 Promoter Sequences
[0199] In order to further demonstrate the ability of non-native AAV serotype promoter sequences to affect the production titer of rAAV, derivatives of AAV helper plasmid AAV RC6 (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAV6 serotype) were constructed that comprised non-native AAV serotype promoter sequences (
[0200] The following constructions were employed; the sequences of the promoter regions are shown in Table 1: [0201] (1) Parent-RC6pAAV-RC6 (SEQ ID NO:4), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV6 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0202] (2) P5(1)-RC6a derivative of plasmid vector pAAV-RC6 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV1 (SEQ ID NO:9); [0203] (3) P5(2)-RC6a derivative of plasmid vector pAAV-RC6 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV2 (SEQ ID NO:10); [0204] (4) P5(3)-RC6a derivative of plasmid vector pAAV-RC6 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV3 (SEQ ID NO:11); [0205] (5) P5(7)-RC6a derivative of plasmid vector pAAV-RC6 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV7 (SEQ ID NO:15); and [0206] (6) P5(8)-RC6a derivative of plasmid vector pAAV-RC6 in which native AAV2 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV8 (SEQ ID NO:16).
[0207]
[0208] The results of the investigation are shown in
Example 5
Comparison of rAAV Production Titers by Cells Transfected with AAV RC1, AAV RC5 or AAV RC7 Helper Plasmid Vectors Having Non-Native AAV Serotype P5 and P40 Promoter Sequences
[0209] In order to further demonstrate the ability of non-native AAV serotype promoter sequences to affect the production titer of rAAV, derivatives of AAV helper plasmid AAV RC1 (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAV1 serotype), derivatives of AAV helper plasmid AAV RCS (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAVS serotype) and derivatives of AAV helper plasmid AAV RC7 (having an AAV2 rep gene and a cap gene that encodes Cap protein of the AAV7 serotype) were constructed that comprised non-native AAV serotype promoter sequences (
[0210] The following constructions were employed; the sequences of the promoter regions are shown in Table 1: [0211] (1) Parent-RC1pAAV-RC1 (SEQ ID NO:1), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV1 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0212] (2) Parent-RC5pAAV-RC5 (SEQ ID NO:3), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV5 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0213] (3) Parent-RC7pAAV-RC7 (SEQ ID NO:5), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV7 cap gene, whose expression is controlled by a native AAV2 P40 promoter sequence (SEQ ID NO:18); [0214] (4) P5(2)-RC1a derivative of plasmid vector pAAV-RC1 in which native AAV1 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV2 (SEQ ID NO:10); [0215] (5) P5(7)-RC1a derivative of plasmid vector pAAV-RC1 in which native AAV1 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV7 (SEQ ID NO:15); [0216] (6) P5(8)-RC1a derivative of plasmid vector pAAV-RC1 in which native AAV1 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV8 (SEQ ID NO:16); [0217] (7) P5(7)-RC5a derivative of plasmid vector pAAV-RC5 in which native AAV5 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV7 (SEQ ID NO:15); [0218] (8) P5(2)-RC7a derivative of plasmid vector pAAV-RC7 in which native AAV7 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV2 (SEQ ID NO:10). [0219] (9) P5(7)-RC7a derivative of plasmid vector pAAV-RC7 in which native AAV7 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV7 (SEQ ID NO:15); and [0220] (10) P5(8)-RC7a derivative of plasmid vector pAAV-RC7 in which native AAV7 serotype P5 promoter sequences had been replaced with the P5 promoter sequence of AAV8 (SEQ ID NO:16).
[0221] Production titers of rAAV were obtained essentially as described in Example 1. The results of the investigation are shown in
[0222] All publications and patents mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference in its entirety. While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth.