PREPARATION AND USE OF NANOPARTICLE-DOPED RNA HYDROGEL TARGETING TO TRIPLE NEGATIVE BREAST CANCER

Abstract

The present invention discloses preparation and use of a nanoparticle-doped RNA hydrogel targeting to a triple negative breast cancer (TNBC). The RNA hydrogel is a pure RNA system formed in a rolling circle transcription manner. The transcription process generates a large number of GC bonds, which provides a large number of sites for the introduction of DOX. The large number of RNA copy structures generated by rolling circle replication is a polyanionic aggregate. Due to the strong electronegativity of the polyanionic aggregate, electropositive MnO.sub.2@Ce6 nanoparticles are introduced, such that the colloid cationic MnO.sub.2@Ce6 particles can be stabilized by the polyanionic hydrogel, and thus target into a breast cancer cell for synergistic treatment. It can be used for a drug slow release system, has good biocompatibility, and has broad prospects in the fields of growth inhibition effects on targeted MDA-MB-231 tumor cells, inhibition of cancer metastasis and recurrence, and the like.

Claims

1. An RNA hydrogel vector for targeted therapy of a triple negative breast cancer, comprising: (1) an RNA hydrogel formed from a linear DNA transcription template by rolling circle transcription; and (2) therapeutic genes microRNA-182 and microRNA-205 on the RNA hydrogel.

2. The RNA hydrogel vector according to claim 1, wherein the linear DNA transcription template has a nucleotide sequence as shown in SEQ ID No.1, and is phosphorylated at a 5 terminus.

3. A method for preparing the RNA hydrogel vector according to claim 1, wherein first a linear DNA transcription template is designed, antisense sequences of microRNA-182 and microRNA-205 are designed in the linear DNA transcription template, and a hydrogel vector of a pure RNA system is formed by rolling circle transcription.

4. A method for preparing the RNA hydrogel vector according to claim 1, comprising the following specific steps: (1) subjecting a linear DNA transcription template and a T7 promoter to an annealing treatment at the same concentration; (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form an RNA transcription template; and (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector.

5. An RNA hydrogel complex for targeted therapy of a triple negative breast cancer, comprising: (1) an RNA hydrogel formed from a linear DNA transcription template by rolling circle transcription; (2) therapeutic genes microRNA-182 and microRNA-205 on the RNA hydrogel; (3) an aptamer, a CpG fragment and a DOX on the RNA hydrogel; and (4) colloidal MnO.sub.2@Ce6 cationic nanoparticles adhered by an electrostatic action.

6. The RNA hydrogel complex according to claim 5, wherein the linear DNA transcription template has a nucleotide sequence as shown in SEQ ID No.1, and is phosphorylated at a 5 terminus.

7. The RNA hydrogel complex according to claim 5, wherein the aptamer is a aptamer targeting to a MDA-MB-231 cell, which has a nucleotide sequence as shown in SEQ ID No.5, and is modified with a Fam group at a 5 terminus and modified with cholesterol at a 3 terminus; and the CpG fragment is the nucleotide sequence as shown in SEQ ID No.3, and is modified with a Fam group at a 5 terminus and modified with cholesterol at a 3 terminus.

8. A method for preparing the RNA hydrogel complex according to claim 5, wherein first a linear DNA transcription template is designed, antisense sequences of microRNA-182 and microRNA-205 are designed in the linear DNA, a hydrogel vector of a pure RNA system is formed by rolling circle transcription, added with a CpG fragment, a aptamer and a DOX, and centrifuged to form an RNA triple helix hydrogel, and then added with colloidal MnO.sub.2@Ce6 cationic nanoparticles to obtain a magnetic RNA hydrogel complex.

9. The method for preparing the RNA hydrogel complex according to claim 8, comprising the following specific steps: (1) subjecting a linear DNA transcription template and a T7 promoter to an annealing treatment at the same concentration; (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form a RNA transcription template; (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector; and (4) maintaining the RNA hydrogel vector obtained from step (3), the TM buffer, the CpG fragment and the aptamer at 65 C. for 5 min, gradually reducing the temperature to 25 C., placing in a refrigerator at 4 C. for 2 h, mixing with the DOX at 37 C. for 2 h, and then centrifuging at a high speed to form an RNA triple helix hydrogel; and then being allowed to stand at room temperature for 15 min together with the colloidal MnO.sub.2@Ce6 cationic nanoparticles, so as to obtain the RNA hydrogel complex.

10. The use of the RNA hydrogel vector according to claim 1 in the preparation of a related medicament for treating a triple negative breast cancer.

11. A method for preparing the RNA hydrogel vector according to claim 2, wherein first a linear DNA transcription template is designed, antisense sequences of microRNA-182 and microRNA-205 are designed in the linear DNA transcription template, and a hydrogel vector of a pure RNA system is formed by rolling circle transcription.

12. A method for preparing the RNA hydrogel vector according to claim 2, comprising the following specific steps: (1) subjecting a linear DNA transcription template and a T7 promoter to an annealing treatment at the same concentration; (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form an RNA transcription template; and (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector.

13. A method for preparing the RNA hydrogel complex according to claim 8, wherein first a linear DNA transcription template is designed, antisense sequences of microRNA-182 and microRNA-205 are designed in the linear DNA, a hydrogel vector of a pure RNA system is formed by rolling circle transcription, added with a CpG fragment, a aptamer and a DOX, and centrifuged to form an RNA triple helix hydrogel, and then added with colloidal MnO.sub.2@Ce6 cationic nanoparticles to obtain a magnetic RNA hydrogel complex.

14. A method for preparing the RNA hydrogel complex according to claim 9, wherein first a linear DNA transcription template is designed, antisense sequences of microRNA-182 and microRNA-205 are designed in the linear DNA, a hydrogel vector of a pure RNA system is formed by rolling circle transcription, added with a CpG fragment, a aptamer and a DOX, and centrifuged to form an RNA triple helix hydrogel, and then added with colloidal MnO.sub.2@Ce6 cationic nanoparticles to obtain a magnetic RNA hydrogel complex.

15. The method for preparing the RNA hydrogel complex according to claim 11, comprising the following specific steps: (1) subjecting a linear DNA transcription template and a T7 promoter to an annealing treatment at the same concentration; (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form a RNA transcription template; (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector; and (4) maintaining the RNA hydrogel vector obtained from step (3), the TM buffer, the CpG fragment and the aptamer at 65 C. for 5 min, gradually reducing the temperature to 25 C., placing in a refrigerator at 4 C. for 2 h, mixing with the DOX at 37 C. for 2 h, and then centrifuging at a high speed to form an RNA triple helix hydrogel; and then being allowed to stand at room temperature for 15 min together with the colloidal MnO.sub.2@Ce6 cationic nanoparticles, so as to obtain the RNA hydrogel complex.

16. The method for preparing the RNA hydrogel complex according to claim 12, comprising the following specific steps: (1) subjecting a linear DNA transcription template and a T7 promoter to an annealing treatment at the same concentration; (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form a RNA transcription template; (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector; and (4) maintaining the RNA hydrogel vector obtained from step (3), the TM buffer, the CpG fragment and the aptamer at 65 C. for 5 min, gradually reducing the temperature to 25 C., placing in a refrigerator at 4 C. for 2 h, mixing with the DOX at 37 C. for 2 h, and then centrifuging at a high speed to form an RNA triple helix hydrogel; and then being allowed to stand at room temperature for 15 min together with the colloidal MnO.sub.2@Ce6 cationic nanoparticles, so as to obtain the RNA hydrogel complex.

17. The use of the RNA hydrogel vector according to claim 2 in the preparation of a related medicament for treating a triple negative breast cancer.

18. The use of the RNA hydrogel complex according to claim 7 in the preparation of a related medicament for treating a triple negative breast cancer.

19. The use of the RNA hydrogel complex according to claim 8 in the preparation of a related medicament for treating a triple negative breast cancer.

20. The use of the RNA hydrogel complex according to claim 9 in the preparation of a related medicament for treating a triple negative breast cancer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG. 1 is a schematic diagram of the diagnosis and treatment of a triple negative breast cancer in vitro and in vivo by Hydrogel/DOX-MnO.sub.2@Ce6;

[0041] FIG. 2 is a characterization of different stages of a macromolecular hydrogel by 2% agarose gel electrophoresis;

[0042] FIG. 3 is a TEM (transmission electron microscope) characterization map of a hydrogel;

[0043] FIG. 4 is an electron microscope characterization map of Hydrogel/DOX-MnO.sub.2@Ce6;

[0044] FIG. 5 is a diagram showing particle sizes of the hydrogel at four different stages;

[0045] FIG. 6 is a diagram showing the zeta potential of the hydrogel at four different stages;

[0046] FIGS. 7A, 7B, 7C, 7D, 8A, 8B, 8C and 8D are diagrams of confocal microscopic imaging and flow cytometry analysis;

[0047] FIGS. 9A, 9B, 9C and 9D are a cytotoxicity map and mouse tumor size tracking map; and

[0048] FIG. 10 shows the H&E staining analysis of mouse tumors.

DESCRIPTION OF THE EMBODIMENTS

[0049] The oligonucleotide sequences used in the present invention are as shown in Table 1.

TABLE-US-00001 TABLE1 Oligonucleotidesequencesasused ssDNA 5-phosphate-ATAGTGAGTCGTATTAAAAAAAAA CCGTTACCATCTTGAGTGTGACCACTCCAT TGTCCTAGGCCACCAAGATCTGAACGG TTGAAAAAAAGTCACCTCACTTCGAACAGGAA GTAAGGTGGCCTCAGACGAAAAAATCCCT-3 (SEQIDNO.1) ssDNAfor 5-phosphate-ATAGTGAGTCGTATTAAAAAAGGA scrambled CAACTGCCATCGCCGTCACTGATATTTCAT shRNA GATTCTACTAGGGATTCCGCCACAGGA CATAAAAAGCTGAGGAAAGTCCAGTGAAC GAACATACCCTAGCGTGACCTAAAAAATCCCT- 3(SEQIDNO.2) CpG 5-FAM-AAAATCCCTATAGTGAGTCGTATTA AAATCCATGACGTTCCTGACGTT---Chol-3 (SEQIDNO.3) T7 5-TAATACGACTCACTATAGGGAT-3 promotor: (SEQIDNO.4) F-C- 5-FAM-CACTCCATTGTCCTAGGCGAATTC LXLapt- AGTCGGACAGCGAAGTAGTTTTCCTTCTAA Chol CCTAAGAACCCGCGGCAGTTTAATGTAGAT GGACGAA-Chol-3(SEQIDNO.5)

Example 1

[0050] An RNA hydrogel vector for targeted therapy of a triple negative breast cancer, includes:

[0051] (1) an RNA hydrogel formed from a linear DNA transcription template (the ssDNA in table 1) by rolling circle transcription; and

[0052] (2) therapeutic genes microRNA-182 and microRNA-205 on the RNA hydrogel.

[0053] First, a single-stranded DNA template (ssDNA in Table 1) of which both termini could be complementary paired with primers for a T7 promoter (T7promotor in Table 1) was designed. The single-stranded DNA contained the complementary sequence of each shRNA as involved by us (antisense sequences of microRNA-182 and microRNA-205). A large amount of shRNA-182 and shRNA-205 copies was transcribed by rolling circle transcription at a low cost for using as gene therapy fragments and meanwhile also using as a vector for DOX and the immune gene CpG, such that a multi-functional intelligent nano-agent which integrated gene therapy, chemical agent treatment and combined immunotherapy was obtained, achieving integrated research on the diagnosis and treatment of the triple-negative breast cancer.

[0054] The specific steps were as follows:

[0055] (1) subjecting a linear DNA transcription template (ssDNA in Table 1) and a T7 promoter(T7promotor in Table 1) to an annealing treatment at the same concentration;

[0056] (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form an RNA transcription template; and

[0057] (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector.

Example 2

[0058] An RNA hydrogel complex for targeted therapy of a triple negative breast cancer, included:

[0059] (1) an RNA hydrogel formed from a linear DNA transcription template (the ssDNA in table 1) by rolling circle transcription;

[0060] (2) therapeutic genes microRNA-182 and microRNA-205 on the RNA hydrogel.

[0061] (3) the aptamer (FC-LXLapt-Chol in Table 1), CpG fragment (CpG in Table 1) and DOX (adriamycin) on the RNA hydrogel; and

[0062] (4) colloidal MnO.sub.2@Ce6 cationic nanoparticles adhered by an electrostatic action.

[0063] A method for preparing a RNA hydrogel complex is disclosed, where first a linear DNA transcription template is designed, antisense sequences of microRNA-182 and microRNA-205 are designed in the linear DNA, a hydrogel vector of a pure RNA system is formed by rolling circle transcription, added with a CpG fragment, a aptamer and a DOX, and centrifuged to form an RNA triple helix hydrogel, and then added with colloidal MnO.sub.2@Ce6 cationic nanoparticles to obtain a RNA hydrogel complex.

[0064] The specific steps were as follows:

[0065] (1) subjecting a linear DNA transcription template (ssDNA in Table 1) and a T7 promoter(T7promotor in Table 1) to an annealing treatment at the same concentration;

[0066] (2) adding a T4 ligase and a T4 ligase buffer, and maintaining at 19 C. for 13 h to form an RNA transcription template;

[0067] (3) adding a T7 polymerase, rNTP, a T7 polymerase buffer and a TM buffer, and maintaining at 37 C. for 5 h to form a multi-copy RNA hydrogel vector; and

[0068] (4) maintaining the RNA hydrogel vector obtained from step (3), the TM buffer, the CpG fragment (CpG in table 1) and the aptamer (F-C-LXLapt-Chol in table 1) at 65 C. for 5 min, gradually reducing the temperature to 25 C., placing in a refrigerator at 4 C. for 2 h, mixing with the DOX at 37 C. for 2 h, then mixing the aforementioned reaction product with double distilled water (DI water) at a ratio of 1:, centrifuging at a speed of 8000 rpm twice, each for 5 min, finally redistributing in 50 L of deionized water to form DNA nanogel, and storing in a refrigerator at 4 C. for later use. After a series of reactions, a micro-sponge-like nanosphere was finally formed. The hydrogel is allowed to stand at room temperature for 15 min together with the synthesized colloidal MnO.sub.2@Ce6 nanoparticles to obtain an RNA hydrogel complex.

[0069] The method of an annealing treatment was: heating to 95 C. for 5 min in a TM buffer, followed by cooling to 25 C. at 1 C./min for 30 min. The composition of the TM buffer is: 30 mM MgCl.sub.2, 10 mM Tris-HCl, pH=8.0.

[0070] The colloidal MnO.sub.2@Ce6 in the present invention is synthesized according to a method reported in previous studies, and in brief is obtained by reducing KMnO.sub.4 with PAH, then being subjected to ultrasonic treatment with a photosensitizer Ce6 for 4 h, and then centrifuging.

Experimental Example

[0071] (1) To determine the formation of hydrogel at each stage, the hydrogel product of each stage was subjected to characterization by transmission electron microscopy (the DOX-loaded RNA hydrogel vector as shown in FIG. 3, and the MnO.sub.2@Ce6-loaded RNA hydrogel vector as shown in FIG. 4), agarose gel electrophoresis (as shown in FIG. 2, the first band was a linear DNA, the second band was a circular DNA transcription template, the third band was a rolling circle product, the fourth band was a band for modified CPG, the fifth band was a band for a modified aptamer, the sixth band was a band for the modified CPG and the aptamer, and the seventh band was a marker at 500 bp) and a particle size analyzer (FIG. 5 showed a particle size, and FIG. 6 showed a zeta potential, where Rtrs represented a transcriptional copy, Hydrogel represented a hydrogel that was modified with the aptamer and the CpG fragment, HD represented a DOX-loaded Hydrogel, and HDMC represented the binding of the DOX-loaded Hydroge with MnO.sub.2@Ce6).

[0072] (2) For the characterization of targeted uptake of the RNA triple helix nanohydrogel by a cell, the specific operation process was as follows:

[0073] The MDA-MB-231 cells were placed and incubated in a 35 mm glass button petri dish under the condition of 37 C. for 24 h until the cell density reached about 80%, then added with the hydrogel and co-incubated for 2 h, and added with a DAPI nuclear staining reagent to mark the location of the cell nucleus, The culture medium was removed with PBS, and the cells were resuspended in 1 mL PBS, photographed by confocal microscopy for the position of uptaking the RNA triple helix hydrogel by a cell, as shown in the panel a of FIG. 7. After the end of the confocal microscopy, the cells were collected into a 1.5 mL centrifuge tube, and were subjected to flow cytometry determination to obtain a flow cytometry diagram as shown in the panel b of FIG. 7. The cells were added with the DOX-loaded hydrogel and co-incubated for 2 h, and added with the DAPI nuclear staining reagent to mark the location of the cell nucleus. The culture medium was removed with PBS, and the cells were resuspended in 1 mL PBS, photographed by confocal microscopy to obtain the distribution of the DOX-loaded hydrogel as uptaken after the cells were irradiated by a laser light at 650 nm, as shown in the panel c of FIG. 7. Therefore, it could be seen that, the enrichment of DOX at the cell nucleus could be accelerated under irradiation of laser light. The cells were added with and then co-incubated with the DOX-loaded hydroge and MnO.sub.2@Ce6(HDMC) for 2 h. The culture medium was removed with PBS, and the cells were resuspended in 1 mL PBS, photographed by confocal microscopy to obtain the cell uptake conditions as shown in the panel a of FIG. 8, and photographed by confocal microscopy to obtain the distribution of HDMC as uptaken after the cells were irradiated by a laser light at 650 nm, as shown in the panel b of FIG. 8. Therefore, it could be seen that, Ce6 entered the cell successfully, and emitted a strong fluorescence signal as excited by the laser light at 650 nm, and meanwhile the intracellular fluorescent signals were collected by flow cytometry to obtain panels c and d of FIG. 8.

[0074] (3) Cytotoxicity Experiment with CCK-8 Kit:

[0075] First 100 L of a cell suspension was formulated in a 96-well plate, and the culture plate was pre-incubated in an incubator at 37 C. under 5% CO.sub.2 for 24 h. the culture plate was added with 10 L of different kinds of drugs to be tested, and incubated in an incubator for a certain period of time. The original culture medium was discarded and replaced with 100 L of a fresh culture medium, and then each well was added with 10 L of a CCK-8 solution (it should be noted that no bubble was allowed to be formed in the well, otherwise it would affect the reading of the OD value), continued to incubate in the incubator for an appropriate period of time, and determined with a microplate reader for the absorbance at 450 nm. A well for which the cell suspension was only added with CCK-8 and not added with the substance to be tested, was selected as a control well, and the culture medium containing no cells was selected to be added to CCK-8 as a blank group, and the experiment was performed. The final cell viability %=[A (dosing)A (blank)]/[A (dosing of 0)A (blank)]100%.

[0076] The results were as shown in panels a and b of FIG. 9. Under the equal conditions, the rolling circle transcription copies in both the experimental group and the control group had almost no effect on the cell viability, and with the gradual increase of the therapeutic agent, the cell viability was also decreased gradually.

[0077] 4. In Vivo Detection Experiment

[0078] First a 4T1 cell subcutaneous tumor-bearing mouse model was established, where one group was used as a blank group that was injected with the buffer solution (the TM buffer) used in the experiment; one group was set as a control group that was injected intratumorally with a series of hydrogel drugs of any gene sequence; and one group was set as the experimental group that was injected intratumorally with a series of hydrogel drugs of therapeutic gene sequences. The injection dose of each group was 30 L per injection, and the injection frequency was consistent among the groups. After the injection operation, continuous tracking and observation were conducted, to track and record the fractional tumor volume (tumor volume changes of mice in the blank group and the control group as shown in panel c of FIG. 9, and tumor volume changes of mice in the blank group and the experimental group as shown in panel d of FIG. 9). After the end of the experiment, the mice were sacrificed by a carbon dioxide asphyxiation method, and the tumors and visceral organs of the mice of each group were peeled off.

[0079] FIG. 10 was a graph showing the analysis of the H&E staining data of tumors in murine breast cancer (4T1) tumor-bearing mice after they were administrated with the TM buffer, a series of hydrogels of any gene sequence, and a series of hydrogels of therapeutic gene sequences. It could be seen from the figure that, the tumor cell nucleus of the control group was richer than that of the treatment group, and thus it could be seen that the additive treatment effect was better, and the morphology of the tumor cell was severely damaged.

[0080] In view of the above, the hydrogel complex vector as designed in the research for the targeted treatment of the triple negative breast cancer achieved a multiple synergistic and gain treatment method, realizing targeted triple gene therapy for tumor cells. The effects of the hydrogel in this experiment were mainly presented in the following several aspects: (1) linking a aptamer that is targeted to MDA-MB-231; (2) realizing gene therapy for the triple negative breast cancer by microRNA-182 and microRNA-205 through a gene replacement method; and (3) acting as a vector to targeted bring the therapeutic gene, the chemical agent DOX, and MnO.sub.2@Ce6 for treating and improving the tumor microenvironment into tumor cells for synergistic gain therapy. By adopting laser confocal imaging and flow cytometry detection, the uptaken amount of the hydrogel by triple negative breast cancer cells in vitro was analyzed, and cytotoxicity verification was conducted using CCK8. A wild mouse model was established. By tracking the body weights of the mice, a good therapeutic effect was shown in tumor size and later pathological analysis.