METHOD FOR PREPARING FOOT-AND-MOUTH DISEASE VIRUS-LIKE PARTICLES, AND TEST STRIP FOR DETECTING FOOT-AND-MOUTH DISEASE
20210016272 ยท 2021-01-21
Inventors
- Shiqi SUN (Lanzhou, CN)
- Huichen GUO (Lanzhou, CN)
- Yun ZHANG (Lanzhou, CN)
- Yanyan CHANG (Lanzhou, CN)
- Yanquan WEI (Lanzhou, CN)
- Jiaxi RU (Lanzhou, CN)
- Xiaoying ZHI (Lanzhou, CN)
- Ping DU (Lanzhou, CN)
- Xiangtao Liu (Lanzhou, CN)
- Hong YIN (Lanzhou, CN)
- Jianxun LUO (Lanzhou, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2770/32152
CHEMISTRY; METALLURGY
C12N2770/32131
CHEMISTRY; METALLURGY
C12N2770/32122
CHEMISTRY; METALLURGY
C12N2770/32151
CHEMISTRY; METALLURGY
B01L3/5023
PERFORMING OPERATIONS; TRANSPORTING
International classification
Abstract
A test strip for detecting a serotype O foot-and-mouth disease, the test strip including: a bottom board; a detection layer being disposed on the bottom board and including a detection line and a control line; an absorbent layer being disposed at one end of the detection layer close to the control line; a gold colloidal conjugate pad being disposed at the other side of the detection layer close to the detection line; and a sample pad is disposed on a top of the gold colloidal conjugate pad. The gold colloidal conjugate pad is coated with colloidal gold particles that are conjugated with a Staphylococcus protein A (SPA) marker. The detection line is coated or impregnated with serotype O FMDV-like particles, and the control line is coated or impregnated with rabbit IgG.
Claims
1. A test strip for detecting a serotype O foot-and-mouth disease, the test strip comprising: a bottom board; a detection layer being disposed on the bottom board and comprising a detection line and a control line; an absorbent layer being disposed at one end of the detection layer close to the control line; a gold colloidal conjugate pad being disposed at the other side of the detection layer close to the detection line; and a sample pad disposed on a top of the gold colloidal conjugate pad; wherein: the gold colloidal conjugate pad is coated with colloidal gold particles that are conjugated with a Staphylococcus protein A (SPA) marker; the detection line is coated or impregnated with serotype O FMDV-like particles, and the control line is coated or impregnated with rabbit IgG; and a ratio of the colloidal gold particles to the SPA marker on the colloidal gold particles conjugate pad is between 210.sup.4:1 and 210.sup.4:2.
2. The test strip of claim 1, wherein the ratio of the colloidal gold particles to the SPA marker on the gold colloidal conjugate pad is 210.sup.4:1.3.
3. The test strip of claim 1, wherein an adsorption rate of the gold colloidal conjugate pad is 10-50 L/cm.
4. The test strip of claim 1, wherein the detection line is coated or impregnated with 0.5-1 mg/mL of serotype O FMDV-like particles.
5. The test strip of claim 1, wherein the control line is coated or impregnated with 0.8-1.5 mg/mL of immune rabbit serum IgG.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The invention is described hereinbelow with reference to accompanying drawings, in which the sole FIGURE is a schematic structural diagram of a test strip for detecting serotype O foot-and-mouth disease according to an embodiment of the disclosure.
[0035] In the drawings, the following reference numbers are used: 1bottom board, 2sample pad, 3immuno-gold pad, 4detection layer, 5absorbent layer, 6detection line, 7control line.
DETAILED DESCRIPTION
[0036] The disclosure provides a method for preparing serotype O foot-and-mouth disease virus-like particles, the method comprising the following steps:
[0037] S1: Construction of Small Ubiquitin-Like Modifier Fusion Expression Vector pSM
[0038] a. The smt3 gene (GenBank Accession No: AY558174) is amplified from the genome of Saccharomyces cerevisiae strain EGY48 by using the primer sequences that comprise an upstream primer smt3F: 5GCCATGGGTCATCACCATCATCATCAC (6His) GGGTCG GACTCAGAAGTCAATCAA 3 (SEQ ID NO. 1); and a downstream primer smt3F: 5GGATCCGAGACCTTAAGGTCTCAACCTCCAATCTGTTCGCGGTG 3 (SEQ ID NO. 2).
[0039] b. The smt3 gene that are enzymatically cleaved by Nco I and BamH I (both of which are a restriction endonucleases) are inserted into the pET-28a vector that are also enzymatically cleaved by Nco I and BamH I to obtain the vector pSM1, and the kanamycin resistance gene in the pSM1 is replaced by the ampicillin resistance gene, to obtain the vector pSM2.
[0040] S2: Construction of Recombinant Expression Vectors
[0041] S201: Amplification of structural protein VP0, VP3, and VP1 encoding genes of serotype O foot-and-mouth disease virusThe primers are designed according to the porcine serotype O FMDV deposited in GenBank. The viral RNA is extracted from the porcine serotype O FMDV by using the RNaeasy Mini kit commercially available from Qiagen, and the VP0, VP3, and VP1 gene are obtained respectively by amplification after reverse transcription. The PCR cycling parameters during the reverse transcription comprise: 1 cycle of 5 min at 94 C., 30 cycles of 60 s at 94 C., 60 s at 58 C., and 2.5 min at 72 C., followed by the last cycle of 8 min at 72 C.
TABLE-US-00001 Primersequences: UpstreamprimerVP0-FBsmBI: SEQIDNO.3: 5TACTTCGTCTCCGCGGATCCGGAGCCGGGCAATCCAGC; DownstreamprimerVP0-RBamHI: SEQIDNO.4: 5GCGAGTGGATCCATTAAGCTTGCCTCCTTCGAGGGGAGTTC; UpstreamprimerVP1-FBsmBI: SEQIDNO.5: 5GGACTTCGTCTCACTACTGCCACCGGGGAATC; DownstreamprimerVP1-RBamHI: SEQIDNO.6: 5GCTTATGGATCCTTACAGGAGTTGTTTTGCTGGG UpstreamprimerVP3-FBsmBI: SEQIDNO.7: 5GCACTTCGTCTCGCGATTGTCCCGGTTGCAT; DownstreamprimerVP3-RBamHI: SEQIDNO.8: 5GCGCACGGATCCTTGTGAGCGGGGGTCAATCG.
[0042] S202: The VP0, VP3, and VP1 fragments that are enzymatically cleaved by BsmB I/BamH I (both of which are a restriction endonucleases) are inserted respectively into the pSM1, pSM2, and pSM1 that are enzymatically cleaved by Bsa I, to obtain the recombinant expression vectors pSM1/VP0, pSM2/VP3, and pSM1/VP1.
[0043] S3: Construction of Recombinant Co-Expression Vector:
[0044] A DNA fragment comprising prokaryotic expression elements comprising T7 promoter and VP1 gene is obtained by amplification with pSM1/VP1 as a template and using T7BamH I/VP1Xho I as primers. The DNA fragment that is enzymatically cleaved by BamH I/Xho I and inserted into the pSM1/VP0 that is also enzymatically cleaved by BamH I/Xho I, to obtain the recombinant co-expression vector pSM1/VP0-VP1. The primer sequences comprise an upstream primer T7BamH I: 5GCAATTGGA CCCGTCCGGCGTAGAGGATCGA (SEQ ID NO. 9), and a downstream primer VP1Xho I: 5GCGCACCTCGAGCTACTGTTGCCGAGCGTCCAC (SEQ ID NO. 10).
[0045] S4: Expression and Purification of Proteins
[0046] The positive recombinant plasmids pSM2/VP3 and pSM1/VP0-VP1 that are precisely sequenced are co-transformed into the competent cells BL21-CodonPlus (DE3)-RIL. A monoclonal colony is picked and inoculated into an LB medium containing ampicillin, kanamycin and chloramphenicol, and cultured for 12 hrs at a temperature of 37 C. and a rotational speed of 220 rpm. Then the cultured expression bacteria are further 1:100 inoculated into 200 mL of the LB medium containing ampicillin, kanamycin and chloramphenicol again, and cultured at a temperature of 37 C. and a rotational speed of 220 rpm until the OD600 reaches about 0.9. 1 ml is sampled and used as a pre-induction control.
[0047] The remaining bacterial suspension is stood at 16 C., and added with isopropyl thiogalactoside (IPTG) at a concentration of 0.5 mmol/L to induce the expression for 16 hrs. The bacterial suspension after induction is centrifuged for 20 min at a rotational speed of 4750 rpm. The bacterial cells are collected, then 1:50 suspended in a buffer A (having a composition of 500 mmol/L NaCl, 20 mmol/L Tris-HCl, 20 mmol/L Imidazole, 2 mmol/L DTT, and 0.05% TritonX-100, pH 8.4), mixed fully, ultrasonicated on ice for 6 min, and then centrifuged for 15 min at 11500g at 4 C. The supernatant is collected, to obtain the recombinant proteins.
[0048] Purification of recombinant proteins by using His-tag Protein Purification Kit: The recombinant protein sample is subjected to 10% SDS-PAGE electrophoresis. Then the recombinant proteins are transferred to a polyvinylidene difluoride (PVDF) film by wet transfer, blocked for 1 hr at 37 C. with a blocking buffer (PBS containing 5% skimmed milk powder, pH 7.0), incubated for 1 hr at 37 C. with anti-His primary antibody (at a molar ratio of 1:3000) and anti-FLAG primary antibody respectively, washed fully with PBST (a buffer), incubated for 1 hr at 37 C. with horseradish peroxidase conjugated rabbit anti-mouse IgG (at a molar ratio of 1:6000) and goat anti-rabbit IgG (at a molar ratio of 1:4000) respectively, washed fully with PBST, added with a luminescent substrate and reacted for 3 min in dark, exposed under a Kozak film, developed, and fixed, to observe the expression of proteins of interest. It is found through observation that the proteins of expected sizes are obtained by this method, and the proteins are immunologically active.
[0049] S5: In-Vitro Assembly of Serotype O Foot-and-Mouth Disease Virus-Like Particles
[0050] The small ubiquitin-like modifier is removed by using HisTrap HP following the instruction for use of the reagent provided by Invitrogen, and a liquid containing VP0, VP1, and VP3 is collected, and dialyzed against the dialysis buffer PBS (pH 7.5). Then, VP0, VP1, and VP3 are assembled into serotype O foot-and-mouth disease virus-like particles. The virus-like particles are observed under an electron microscope, and a plurality of virus-like particles having a diameter of 18-21 nm can be clearly observed, indicating that virus particles are obtained successfully by assembly outside a prokaryote.
[0051] Referring to the sole FIGURE, an embodiment of the disclosure provides a test strip for detecting serotype O foot-and-mouth disease in an animal. The test strip comprises a bottom board 1 made from PVC, and a detection layer 4 disposed on the top of the bottom board 1. A detection line 6 and a control line 7 are disposed on the detection layer 4, and an absorbent layer 5 is disposed at one end of the detection layer close to the control line 7, and an immuno-gold pad 3 is disposed at the other side of the detection layer 4 close to the detection line 7. A sample pad 2 is disposed on the top of the immuno-gold pad 3.
[0052] The immuno-gold pad 3 comprises colloidal gold particles that are conjugated with a Staphylococcus Protein A (SPA) marker, the detection line 6 is coated/impregnated with serotype O foot-and-mouth disease virus-like particles, and the control line 7 is coated/impregnated with rabbit IgG.
[0053] The ratio of the colloidal gold to SPA on the immuno-gold pad 3 is 210.sup.4:1-2, and most preferably 210.sup.4:1.3. The adsorption rate of the immuno-gold pad 3 is 10-50 L/cm.
[0054] The detection line 6 is coated/impregnated with 0.5-1 mg/mL of serotype O foot-and-mouth disease virus-like particles, and the control line 7 is coated/impregnated with 0.8-1.5 mg/mL of immune rabbit serum IgG.
[0055] A method for preparing the test strip for detecting serotype O foot-and-mouth disease in an animal comprises the following steps.
[0056] S1: Preparation of IgG
[0057] a. The whole blood is sampled from 2 negative rabbits, and precipitated overnight in a freezer at 4 C. The precipitated whole blood is centrifuged for 10 min at a rotational speed of 4000 rpm, and the supernatant is collected that is serum. 20 mL of the serum is added to 20 mL of saline, and then 10 mL of a saturated (NH.sub.4).sub.2SO.sub.4 solution is added, mixed until uniform, stood for 30 min, and centrifuged for 20 min at a rotational speed of 3000 rpm. The pellet is discarded to remove the fibrin, and the supernatant is collected.
[0058] b. 30 mL of a saturated (NH.sub.4).sub.2SO.sub.4 solution is added to the supernatant, mixed until uniform, stood for 30 min, and centrifuged for 20 min at a rotational speed of 3000 rpm. The supernatant is discarded, and the pellet is collected. 20 mL of saline and 10 mL of a saturated (NH.sub.4).sub.2SO.sub.4 solution is added to the pellet, mixed until uniform, stood for 30 min, and centrifuged for 20 min at a rotational speed of 3000 rpm. The supernatant is discarded.
[0059] Step b is repeated 2-3 times, 10 mL of saline is added to the purified pellet, followed by dialysis. The dialysis is performed overnight in pure water initially for salt removal, and then in saline at 4 C. for 24 hrs, during which the dialysis fluid is changed once every 2-3 hrs.
[0060] Whether the dialysis is complete is detected as follows. The detection reagent is 1% BaCl.sub.2 (for the detection of SO.sub.4.sup.2) or Nessler's Reagent (for the detection of NH.sub.4.sup.+). 1-2 drops of the detection reagent are added to 3-4 mL of the dialysate. If the solution appears brick red, NH.sub.4.sup.+ is considered to be present; and if a white precipitate is produced, SO.sub.4.sup.2 is considered to be present. After dialysis to such an extent that no precipitate is produced, the precipitate is removed by centrifugation (to remove the miscellaneous proteins), and the supernatant is the purified rabbit IgG.
[0061] S2: Preparation of the colloidal gold: 1 g of aurichlorohydric acid is dissolved in 100 mL of triple distilled water to prepare a 1% aurichlorohydric acid solution. 1 mL of 1% aurichlorohydric acid solution in water is added to 100 mL of water, and heated to boiling. 1.7 mL of 1% trisodium citrate solution in water is added dropwise with stirring, and boiled for another 5 min. After cooling, distilled water is added to 100 mL. In this way, colloidal gold is obtained, which is stored at 4 C.
[0062] S3: Determination of the minimum dosage of SPA: 100 L of the colloidal gold is added respectively to each well of a 96-well plate. Then 1-20 L of 0.05 mg/mL SPA is added respectively to each well, mixed uniformly, and stood for 15 min. 20 L of 10% NaCl is added respectively to each well, and stood for 10 min. The volume of SPA added to the well that is maintained to be red is the minimum protein dosage, and an optimum marker dosage is obtained by a 30% increase on this basis. In this embodiment, the minimum protein dosage is 10 L, that is, each 100 L of 1 g/100 mL colloidal gold requires 10 L of 0.05 mg/mL SPA. The weight ratio of the colloidal gold to SPA is 210.sup.4:1, and most preferably 210.sup.4:1.3. In practical use, the ratio of the colloidal gold to SPA can be adjusted as desired.
[0063] S4: Preparation of SPA modified colloidal gold and immuno-gold pad 3: The colloidal gold is adjusted to pH 5.9 with 0.1 M K.sub.2CO.sub.3, and corresponding SPA solution is added to the colloidal gold at a weight ratio of 210.sup.4:1-1.5 (most preferably 210.sup.4:1-1.3), stood for 30 min, and then centrifuged for 30 min at a rotational speed of 10000 rpm at a temperature of 4 C. The pellet is dissolved in a re-suspending solution and mixed uniformly to obtain a SPA modified colloidal gold solution. A glass film is used as a substrate of the immuno-gold pad 3. The glass film is immersed in the SPA modified colloidal gold solution and air dried. The adsorption rate is 10-50 L/cm, and most preferably 30 L/cm. In this manner, the immuno-gold pad 3 is obtained.
[0064] S5: Preparation of Detection Layer 4
[0065] A nitrocellulose membrane is used as a substrate of the detection layer 4. The detection line 6 and the control line 7 are marked on the detection layer 4, in which the detection line 6 is 0.3-1 cm (and most preferably 0.5 cm) away from the control line 7, and the control line 7 is located in a middle section of the nitrocellulose membrane. 0.5-1 mg/mL (and most preferably 0.8 mg/mL) serotype O foot-and-mouth disease virus-like particles are coated on the detection line 6; and rabbit IgG is coated on the control line 7 in an amount of 10 L/1 cm.
[0066] S6: Preparation of the sample pad 2: A glass fiber membrane is used as a substrate of the sample pad 2. 20 mM phosphate buffer (PB), 1% Tween 20, 1% BSA, and 2.5% sucrose are dissolved in 100 mL of triple distilled water, and filtered to obtain a sample solution. The glass fiber membrane is soaked in the sample solution, removed, and air dried after fully impregnation.
[0067] S7: The detection layer 4 is disposed on the top of the bottom board 1, and pressed flat. A portion of the absorbent layer 5 (absorbent paper) is fixed onto the bottom board 1, and the other portion is fixed onto the detection layer 4 at the side close to the control line 7. A portion of the immuno-gold pad 3 is fixed onto the bottom board 1, and the other portion is fixed onto the detection layer 4 at the side close to the detection line 6. A portion of the sample pad 2 is fixed onto the bottom board 1, and the other portion is fixed onto the immuno-gold pad 3.
[0068] During the use of the colloidal gold test strip according to the disclosure, the sample is diluted first, and then the end with the sample pad 2 of the colloidal gold test strip is inserted into the sample. The sample pad 2 is provided with a liquid level mark, and the liquid level of the sample cannot go over the liquid level mark. After the absorbent layer 5 is completely wetted with the liquid, the test strip is taken out, laid flat for 5-15 min, and then observed.
[0069] If the blood sample contains an antibody against serotype O foot-and-mouth disease virus, the antibody in the blood sample binds to the SPA modified colloidal gold in the immuno-gold pad 3 to form a complex, and then to the serotype O foot-and-mouth disease virus-like particles on the detection line 6 to form a mauve line, and then keeps on moving, such that the recombinant protein SPA carried by the antibody not binding to the antigen binds to the IgG antibody on the control line 7, to form a mauve line.
[0070] If no mauve line is shown at the control line 7, it indicates that the test strip is invalid. If the blood sample does not contain relevant antibody against serotype O foot-and-mouth disease virus, no mauve line is shown at the detection line 6, and a mauve line is still shown at the control line 7.
[0071] Unless otherwise indicated, the numerical ranges involved include the beginning and end values. It will be obvious to those skilled in the art that changes and modifications may be made, and therefore, the aim in the appended claims is to cover all such changes and modifications.