Method for identifying the quantitative cellular composition in a biological sample

Abstract

The present invention provides an epigenetic haemogram, also referred to as an epigenetic blood cell count that identifies the quantitative, comprehensive picture of cellular composition in a biological sample, wherein advantageously a normalization standard is used. The normalization standard is a nucleic acid molecule comprising at least one marker-region being specific for each of the blood cells to be detected, and at least one control-region being cell-unspecific, wherein said regions are present in the same number of copies on said molecule and/or a natural blood cell sample of known composition. Furthermore, the present invention relates to a kit and the use of a kit for performing the epigenetic assessment of comprehensive, quantitative cellular composition of a biological sample. The biological sample is derived from e.g. a mammalian body fluid, including peripheral, capillary or venous blood samples or subfractions thereof, such as peripheral blood mononuclear cells or peripheral blood monocytes, or a tissue sample, organ sample, or from frozen, dried, embedded, stored or fresh body fluids or tissue samples.

Claims

1. A method for producing a neutrophilic granulocytogram in a mammalian sample, the method comprising: epigenetically detecting neutrophil granulocyte (nGRC) cells in the mammalian sample, said epigenetically detecting comprises determining conversion of at least one CpG position with bisulfite, the at least one CpG position selected from CpG positions 1 (nucleotide 26), 2 (nucleotide 48), 3 (nucleotide 103), 4 (nucleotide 206), 5 (nucleotide 251), and 6 (nucleotide 263) in the sequence of SEQ ID NO: 685, or respective CpG positions in the sequence of SEQ ID NO: 686, wherein the conversion of the at least one CpG position with bisulfite is indicative of a nGRC cell when compared to a non-nGRC cell; quantifying the epigenetically detected nGRC cells using a normalization standard, wherein said normalization standard comprises a nucleic acid molecule comprising at least one marker-region specific for the nGRC and at least one cell-unspecific control-region, wherein said marker-region and control-region are present in the same number of copies on said nucleic acid molecule and/or on a blood cell sample of known composition; and producing the neutrophilic granulocytogram from the number of epigenetic detected nGRC cells quantified.

2. The method according to claim 1, wherein said mammalian sample is selected from a mammalian body fluid, or a subfraction(s) thereof.

3. The method, according to claim 2, wherein the mammalian sample is selected from peripheral blood monocytes, blood clots, dried blood spots, and fresh body fluids.

4. The method according to claim 1, wherein the determining conversion of at least one CpG position with bisulfite comprises a method selected from specific enzymatic digests, dye exclusion technologies, bisulfite sequencing, next generation sequencing, nanopore sequencing, single molecule real-time sequencing, analyses of epigenetic modifications in promoter regions, using primers specific for bisulfite-converted DNA, using blocking oligonucleotides specific for bisulfite-converted DNA, using fluorescence-labeled, quenched oligonucleotide probes, using primers for single nucleotide primer extension specific for bisulfate-converted DNA, digital or quantitative PCR analysis, and specific selective nucleic acid precipitation and/or chromatin precipitation.

5. The method according to claim 1, further comprising distinguishing said nGRC from all, or at least one, of the cell types selected from basophils (bGRAN), eosinophils (eGRAN), monocytes (MOC), and B-lymphocytes (BLC).

6. The method according to claim 1, further comprising the step of monitoring said nGRC in said mammalian sample by quantifying the relative amount of said nGRC and by comparing said relative amount of nGCR: with a relative amount of nGCR identified in a prior sample taken from a same mammal, and/or with a relative amount of nGCR identified in a control sample.

7. The method according to claim 1, wherein said at least one CpG position is selected from CpG positions 4 (nucleotide 206) and 5 (nucleotide 251).

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) The present invention will now be explained further in the following examples and figures, nevertheless, without being limited thereto. For the purposes of the present invention, all references as cited herein are incorporated by reference in their entireties.

(2) FIG. 1 shows a schematic overview over the epigenetic haemogram. The haemogram comprises the leukocytogram, which includes B cells, monocytes, granulocytes, CD3.sup.+ T-lymphocytes, and NK cells. Each subpopulation establishes an additional cytogram, respectively i.e. the B-lymphocytogram, monocytogram, granulocytogram, T-lymphocytogram, and NK cytogram. For these five sub-cytograms, the corresponding cell types are depicted. Each of these five sub-cytograms can be divided into additional subpopulations, e.g., the T cell cytogram can be further divided into the CD4.sup.+ T-helper cytogram and the CD8.sup.+ cytotoxogram.

(3) FIG. 2 shows a matrix indicating bisulfite-non-convertibility in cell-type specific genomic marker region. Different cell types were analyzed indicating that CpGs within genomic region AMP1730 are completely convertible by bisulfite treatment corresponding to 0% bisulfite-non-convertibility. The total fraction of granulocytes corresponds to neutrophilic granulocytes. Neutrophilic granulocytes account for about 90% of granulocytes, eosinophilic for about 7%, and basophilic for about 3% (see Example 4).

(4) FIG. 3 shows a matrix indicating bisulfite-non-convertibility in cell-type specific genomic marker regions. Different cell types were analyzed indicating that CpGs within genomic region AMP2034 and 2035 are, in contrary to other cell types given, convertible by bisulfite to a high extent and indicative for this specific cell-type (see Example 5).

(5) FIG. 4 shows the results of the test-template as amplified according to Example 7. unM (TpG Template): bisulfite-converted test-DNA; Meth (CpG template): non-bisulfite converted test-DNA; NTC: no template control; left panel: Mg2+ concentration 3.2 mM; right panel: Mg2+ concentration 3.6 mM.

BRIEF DESCRIPTION OF THE SEQUENCES

(6) SEQ ID No. 1 to 689 show sequences as used in the context of the present invention.

EXAMPLES

(7) The present examples have been performed on a sample of known and unknown leukocyte and T-lymphocyte compositions. The person of skill will understand how to modify the experiments in order to identify and quantify other cell types, in particular blood cells in the context of an epigenetic haemogram, without undue burden and/or the need to become inventive.

Example 1Assessment of Cell-Specific Assay-Correction Factors Using A Sample of Known Composition

(8) The inventors provided a human blood sample of known leukocyte and T-lymphocyte composition. The composition of this blood sample was analyzed via flow cytometry. The sample contained 61% granulocytes, 12% monocytes, 3% B-lymphocyte, 4% natural killer cells, and 19% T-lymphocytes (Table 5). The T cell population consisted of 13% of CD4.sup.+ T helper cells, 1.4% regulatory T cells, 5% CD8.sup.+ cytotoxic cells, and 2% nave CD8 cells.

(9) In a next step, this sample of known leukocyte and T-lymphocyte composition was analyzed for the relative amount of bisulfite convertible chromatin in cell-type specific gene regions, resulting in a unique, discriminating cell-type specific pattern of bisulfite convertible chromatin, e.g. for granulocytes a region in the gene for neutrophil gelatinase-associated lipocalin, for monocytes a region in the leukocyte immunoglobulin-like receptor gene, for B cells in a region of the gene for the low-affinity receptor for IgE, for natural killer cells a region in the gene for oxysterol-binding protein-like protein 5 isoform a, for T-lymphocytesin a region in the CD3D/G gene, for CD4.sup.+ T helper cells in a region in the CD4 gene, for regulatory T cells in a region in the FOXP3 gene, for CD8.sup.+ cytotoxic T cells in a region in the CD8A/B gene, for nave CD8.sup.+ cells a region in the endosialin gene. Analyses were performed by qPCR using a bisulfite-converted normalization standard indicating the relative amount of numbers of gene copies containing mentioned unique, said cell-type specific pattern of bisulfite convertibility. These relative numbers of cell-specific gene copies indicate the relative amount of said specific cells.

(10) This relative number of specific cells (said leukocytes and T-lymphocytes) was compared with the result of flow cytometry. Both results were set in relation, and a correction factor was determined (Table 1). Flow cytometry revealed 61% and qPCR 91.6% of granulocytes, and therefore the cell-specific granulocyte assay-correction factor was 1.502.

(11) Correction factors were determined separately for each set of assessments as well as are incorporated into data base for assay-specific correction factors. In addition to the individual and separate determination of correction factors (for each set of assessments), the average of past correction factors can be used as well.

(12) TABLE-US-00015 TABLE 5 Assessment of cell-specific assay-correction factors. Cell composition of human blood sample was assessed by flow cytometry and qPCR for leukocytes as well as T-lymphocytes. qPCR was performed using a bisulfite-converted normalizations standard. Correction factors for following qPCRs on samples of unknown composition were determined by ratio of qPCR/FC. (C-Factor) correction factor, (FC) Flow cytometry, (GRK01) internal sample number. (qPCR) real time quantitative polymerase chain reaction. FC GRK01 qPCR (%) GRK01 C-Factor Leukocytogram granulozytes 61.0 91.6 1.502 monozytes 12.0 29.9 2.494 B cells 3.0 1.3 0.429 natural killer cells 4.0 3.9 0.977 T cells 19.0 29.8 1.568 T-Lymphocytogram CD4.sup.+ T helper cells 13.0 9.7 0.745 regulatory T cells 1.4 2.3 1.668 CD8.sup.+ cytotoxix T cells 5.0 8.0 1.594 naive CD8.sup.+ cells 2.0 2.1 1.051

Example 2Assessment of Absolute Cell Composition in an Unknown Blood Sample of Healthy Volunteers Using an Assay-Correction Factor Determined Using a Sample of Known Composition (as Shown in Example 1)

(13) Human blood samples of unknown leukocyte and T-lymphocyte composition of healthy volunteers were obtained for assessment of absolute leukocyte and T-lymphocyte composition via qPCR. As for Example 1, DNA of blood samples were isolated, bisulfite converted and relative amount of bisulfite converted DNA assessed via qPCR under the use of Bisulfite-converted normalization standards. Amount of bisulfite convertible DNA in cell-specific gene regions was set in relation to bisulfite-convertible DNA of cell-unspecific DNA region (always, cell independent, constant pattern of bisulfite-convertibility) to obtain relative amount of assessed cells.

(14) Cell-specific assay-correction factors were determined in a parallel experimental set for assays of granulocytes, monocytes, B-lymphocytes, natural killer cells, T-lymphocytes, CD4.sup.+ T helper cells, regulatory T cells, and CD8.sup.+ cytotoxic T cells using flow cytometry on a human blood sample (methodology see example 1, human blood sample differs for Example 2 compared to Example 1). Relative amounts of assessed cells as obtained were corrected using the cell-specific assay correction factors. E.g., qPCR for monocytes patient sample S04 gave a relative amount of monocytes of 7.94%, but the correction revealed an absolute cell amount of 3.69% monocytes.

(15) One would expect the sum of cells belonging to a leukocytogram to be 100%, and the sum of cells belonging to a T-lymphocytogram to have exactly the same amount of cells as determined for T-lymphocytes in the leukocytogram. It is known that even the flow cytometry quantification is not without limitations, as described above.

(16) TABLE-US-00016 TABLE 6 Assessment of absolute cell composition of blood from healthy volunteers. Cell com- position of human blood samples were assessed by qPCR for leukocytes as well as T-lymphocytes. qPCR was performed using a bisulfite-converted normalizations standard. Correction factors for qPCRs were determined in a parallel set of experiments (not described in detail here, example of assessment of C-Factor see Example 1). (C-Factor) correction factor, (FC) Flow cytometry, (S04)(S08) internal sample numbers. (qPCR) real time quantitative polymerase chain reaction.

(17) Flow cytometry measurement errors are reflected in qPCR corrections. On the other hand, the epigenetics based qPCR, as described herein, detected cell types independently of marker expression. Even if a cell-specific marker is expressed at a very low amount, or is not present at all, epigenetic-qPCR can detect these cells (e.g. as found for Th17 cells, see above). In addition, certain cells do express cell-specific markers, even if these cells did not enter a specific cellular state known to be associated with the marker expression (e.g. as found for regulatory T cells, see description above). Such cells are not detected by epigenetic-based qPCR. Additionally, for this example, the selection of T-lymphocytes (CD4.sup.+ T helper cells, CD8.sup.+ cytotoxic cells) does not represent the complete T-lymphocyte set (see FIG. 1). Cytograms represent the current status of scientific knowledge and cannot exclude the existence of additional cell types or of the incorrect definition of subpopulations thereof.

Example 3Assessment of Absolute Cell Composition in an Unknown Blood Sample of Auto-Immune Diseased Volunteers Using an Assay-Correction Factor Determined Using a Sample of Known Composition (as Shown in Example 1)

(18) Human blood samples of unknown leukocyte and T-lymphocyte composition of auto-immune diseased volunteers were obtained for assessment of absolute leukocyte and T-lymphocyte composition via qPCR. As for Example 1, DNA of blood samples were isolated, bisulfite converted and relative amount of bisulfite converted DNA assessed via qPCR. Amount of bisulfite convertible DNA in cell-specific gene regions was set in relation to bisulfite convertible DNA of cell-unspecific DNA region (always, cell independent, constant pattern of bisulfite convertibility) to obtain relative amount of assessed cells.

(19) Cell-specific assay-correction factors were determined in a parallel experimental set for assays of granulocytes, monocytes, B-lymphocytes, natural killer cells, T-lymphocytes, CD4.sup.+ T helper cells, regulatory T cells, and CD8.sup.+ cytotoxic T cells using flow cytometry on a human blood sample (methodology see example 1, human blood sample differs for Example 3 compared to Example 1). Obtained relative amounts of assessed cells were corrected using these cell-specific assay correction factors. E.g., qPCR for T-lymphocytes assessed a relative amount of T-lymphocytes of 8.49% for patient M06 and 23.94% for patient M10. Correction revealed an absolute cell amount of 5.4% and 15.3% T cells, respectively.

(20) In comparison to data from healthy patients, see Example 2, for auto-immune diseased patient M06 an obvious decrease in 4 of the 5 subtypes of leukocytes within the leukocytogram was observed. For patient M10 an obvious decrease in absolute number of only B-lymphocytes and monocytes was observed.

(21) Additionally, also for T-lymphocyte subtypes, differences between both patients were observed. qPCR analysis of three subtypes of T-lymphocytes for patient M06 revealed a strong decrease of CD4+ T helper cells as well as CD8+ cytotoxic cells whereas the decrease in level of regulatory T cells was less pronounced. For patient M10 all three cell levels decreased simultaneously by about 50-60% compared to the average of the two healthy patients in Example 2.

(22) All these differences might be related to e.g. a different medication and/or disease stage of these both patients and offer a clinical routine instrument for disease diagnosis, prediction as well as accompanying monitoring.

(23) TABLE-US-00017 TABLE 8 Assessment of absolute cell composition of blood from auto-immune disaeased patients. Cell composition of human blood samples were assessed by qPCR for leukocytes as well as T- lymphocytes. qPCR was performed using a bisulfite-converted normalizations standard. An obvious decrease of the level of certain cell populations was seen that is known for auto immune diseases. Cor- rection factors for qPCRs were determined in a parallel set of experiments (not described in detail here, example of assessment of C-Factor see Example 1). (C-Factor) correction factor, (FC) Flow cytometry, (S04)(S08) internal sample numbers. (qPCR) real time quantitative polymerase chain reaction.

Example 4Detection of Neutrophilic Granulocytes Based on Amp1730 in the Gene for Neutrophil Gelatinase-Associated Lipocalin (LCN2) (See FIG. 2)

(24) FIG. 2 shows a matrix indicating bisulfite-unconvertibility in cell-type specific genomic marker region. Different cell types were analyzed indicating that CpGs within genomic region AMP1730 are completely convertible by bisulfite treatment corresponding to 0% bisulfite-unconvertibility. Within basophil and eosinophil granulocytes specific CpGs of AMP1730 are not convertible by bisulfite. Therefore, the term (Total) Granulocytes within figure corresponds to neutrophilic granulocytes. Neutrophilic granulocytes account for about 90% of granulocytes, eosinophilic for about 7%, and basophilic for about 3%.

(25) TABLE-US-00018 TABLE 7 Discriminatory quality of AMP1730: qPCR using assay specific primers for AMP1730 was performed on cells indicated under sample to analyze amount of bisulfite-convertibility of CpGs present in genomic region given by AMP1730. DNA from purified cell samples was isolated, bisulfite treated and qPCR assay performed under the use of a bisulfite- converted normalization standard. Relative amount of cells was assessed via comparing copy numbers of busulfite-convertible DNA of AMP1730 with bisulfite-unconvertible DNA of AMP1730, named TpG/CpG- System (copy numer convertible/(copy number convertible + copy number non-convertible) = % cell type). Cells were purified and sorted via flow cytometry. Within the neutrophiles cell sample, more than 95% of the cells were detected as neutrohiles using AMP1730. (bGRAN) basophiles. (eGRAN) eosinophiles (nGRAN) neutrophiles, (MOC) monocytes, (THC) CD3.sup.+CD4.sup.+ T-lymphocyets, (CTL) cytotoxic CD3.sup.+CD8.sup.+ T-lymphocytes, (NKC) CD3.sup. natural killer cells, (NKT) CD3.sup.+ natural killer cells, (BLC) B-lymphocytes. AMP1730 - neutrophilic granulocytes assay PCR-System PCR-System specific to TpG specific to CpG copy numbers copy numbers % nGRC CP acc. To plasmid CP acc. To plasmid TpG Sample Value units Value units variant bGRAN 35.49 14.27 29.09 875.33 1.60 eGRAN 25.24 16.20 30.68 300.00 5.12 nGRAN 30.52 270.67 35.73 11.70 95.86 MOC 35.72 12.93 29.85 525.00 2.40 THC 42.70 0.91 30.80 278.00 0.33 CTL 37.72 5.04 29.41 706.00 0.71 NKC 36.95 7.03 29.34 740.33 0.94 NKT 38.35 3.85 30.37 369.67 1.03 BLC 39.75 2.41 29.91 502.67 0.48

Example 5Detection of Eosinophilic Granulocytes Based on Amp 2034 and/or 2035 (PRG2)

(26) Matrix indicating bisulfite-inconvertibility in cell-type specific genomic marker regions. Different cell types were analyzed indicating that CpGs within genomic region AMP2034 and 2035 are, in contrary to other cell types given, convertible by bisulfite to a high extent and indicative for this specific cell-type (see FIG. 3).

Example 6Assessment of Cell-Specific Assay-Correction Factor Using a Non-Bisulfite-Converted Nucleic Acid Molecule (Plasmid Standard) as Normalization Standard

(27) The inventors developed non-bisulfite converted, genomic plasmid standards as a normalization standard. One of these genomic plasmid standards comprises marker regions being specific for stable regulatory T cells (TSDR region)(Treg cells) as well as marker regions being cell-type unspecific (GAPDH, housekeeping gene, detecting all cells, 100% of cells). This plasmid standard is used to determine the Treg-specific assay correction factor that allows assessing the absolute amount of stable Tregs within an unknown blood sample.

(28) In a first step, a human blood sample of unknown composition was provided, DNA isolated, and bisulfite treated. Following, the amount of bisulfite converted TSDR copies and GAPDH copies were assessed (Table 8, section 2). These qPCR analyses were performed using a bisulfite-converted normalization standard (Table 8, section 1) indicating the number of bisulfite-converted DNA copies containing the TSDR marker region as well as the GAPDH marker region (Table 8 section 2). The relative amount of stable Tregs is calculated as number of bisulfite converted TSDR copies related to bisulfite converted GAPDH copies in percent.
no. bisulfite-converted TSDR copies/no. bisulfite-converted GAPDH copies100=% Treg 67.70/6026.67100=1,123%

(29) The cell-type specific region for stable regulatory T cells, TSDR, is located on the X-chromosome. For women an epigenetic silencing of one allele of the X-chromosome is known. This affect is deduced by using a factor 2 when calculating relative amount of stable Tregs (final result=2.25% stable Tregs)(Table 8, section 2).

(30) In a second step, Treg-specific assay-correction factor based on said genomic plasmid standard was assessed. Said plasmid standard was bisulfite converted and number of plasmid copies assessed by qPCR using primers specific for bisulfite-converted marker regions for Treg cells and for GAPDH. These qPCR analyses were also performed using the bisulfite-converted normalization standard (Table 8, section 1). The efficiency of qPCR for Treg cells and GAPDH should be equal as the novel genomic, non-bisulfite converted plasmid standard (the substrate) contains an equimolar amount of Treg cell-specific and GAPDH-specific genomic copies. Therefore, assessed deviation of Treg copy numbers from GAPDH copy numbers corresponds to differences in assay efficiencies.
Treg (TSDR) copy numbers=6760 vs. GAPDH copy numbers=6273.33
This deviation defines the cell-type assay-specific correction factor. E.g.:
Treg (TSDR) copy numbers/GAPDH copy numbers/100=6760/6273.33=1,077.

(31) For Treg cells an assay correction factor of 1.1 (average, n=3) was assessed (Table 8, section 3). Correcting the relative amount of Treg cells by factor 1.1 results in an absolute amount of 2.05% Treg cells within the unknown blood sample WB01.
relative amount of Treg cells/specific assay-correction factor=absolute amount of Treg 2.25%/1.1=2.05% Treg cells

(32) TABLE-US-00019 TABLE 8 Assessment of Treg-specific assay-correction factor using a bisulfite-unconverted nucleic acid molecule as a plasmid standard. qPCR1 (FOXP3 TSDR) Assay Run-ID: 115_genomSTD_NormalizationFactorTreg 1) qPCR for bisulfite-converted normalization standard: qPCR for GAPDH bisulfite-converted qPCR for TSDR bisulfite- normalization converted normalization standard Standards for standard copy Quantification copy numbers numbers Standard- Plasmid normalization CP normalization ID Units CP Value standard Value standard Standard-1 31250 units 23.18 31500.00 23.10 32766.67 Standard-2 6250 units 25.55 6150.00 25.49 6010.00 Standard-3 1250 units 27.86 1250.00 27.71 1243.33 Standard-4 250 units 30.20 249.00 29.91 260.00 Standard-5 50 units 32.86 53.00 32.78 44.13 Standard-6 30 units 34.05 31.80 33.36 32.70 2) qPCR on blood sample of unknown composition for assessment of relative amount of Treg cells using the bisulfite-converted normalization standard as given under 1): qPCR for GAPDH bisulfite converted qPCR for TSDR bisulfite DNA Sample converted DNA copy ID copy numbers numbers acc. unknown acc. to to relative blood normalization CP normalization amount sample gender CP Value standard (1) Value standard (1) stable Treg WB01 female 32.38 67.70 25.49 6026.67 2.25% 3) qPCR on genomic plasmid standard for assessment of Treg-specific correction factor qPCR for GAPDH qPCR bisulfite converted for TSDR bisulfite DNA converted DNA copy Sample copy numbers numbers acc. % stable ID dilution acc. to to Treg/GAPDH genomic genom. normalization CP normalization genomic standard standard CP Value standard (1) Value standard (1) plasmid units GP5000 1 25.41 6760.00 25.44 6273.33 107.76 GP1000 1:5 27.71 1380.00 27.75 1206.67 114.36 GP200 1:25 29.93 301.00 29.82 278.00 108.27 Mean: 110.13 Normalization Factor: 1.10 4) Correction of relative amount of Tregs using Treg-specific correction factor to obtain absolute amount of Treg cells Treg relative Normalization Treg absolute amount Factor amount 2.25% 1.1 2.05%

Example 7Development of Cell-Specific QPCR Assay for Detection and Discrimination of Neutrophil Granulocytes

(33) Detecting Cell-Type Specific, Differential Bisulfite Convertibility:

(34) DNA from the purified neutrophil granulocytes (neutrophils), monocytes, CD4+ cells CD8+ cells, B cells, NK-cells, and NKT cells was bisulfite-treated and bisulfite converted DNA analyzed at various CpG dinucleotide motifs. The inventors then compared the bisulfite convertibility (finding C as for Cytosine that was methylated in the original (genomic) sequence versus T for cytosine that was unmethylated in the original sequence) of these CpG dinucleotides (see Table 4, position 259).

(35) Surprisingly, it was found that specific areas in the genomic region of lipocalin-2 were differentially methylated in neutrophil granulocytes compared to all other blood cell types tested. These areas were defined as discovery fragments, such as e.g. SEQ ID 517 for neutrophils (Table 4, position 259).

(36) Validation of Bisulfite Convertibility:

(37) Then, upon finding of the differential bisulfite convertibility, the inventors analyzed larger genomic regions by means of bisulfite sequencing. This latter procedure served for exploring and extending the discovered, differentially methylated areas and was conducted, for example with the differentially bisulfite converted discovery fragment, SEQ ID 517, within the gene lipocalin-2 as disclosed herein (see Table 4, SEQ ID 517 discovery fragment and 518 discriminative region of interest (ROI)).

(38) Within the discriminative ROI defined as SEQ ID 518 a preferred region of interest including preferable CpG positions to be analyzed was identified (amplicon (AMP) 1730, see FIG. 2 and SEQ ID 685).

(39) Development of Cell-Type Specific qPCR Assay:

(40) In AMP 1730, a detailed analysis was performed in order to develop a highly specific qPCR assay based on the use of amplification primers and probes. Amplification primers (forward and reverse) for bisulfite converted neutrophils specific AMP 1730 as well as probes were designed and tested (data not shown).

(41) In order to develop a particularly preferred perfect primer system for the assay, primers were developed that do not correspond 100% to the original bisulfite converted sequence but include specific mismatches that surprisingly increased the specificity. Mismatches in the primer sequence are underlined and bold.

(42) TpG System (Detecting TpG Positions in Bisulfite-Converted DNA):

(43) TABLE-US-00020 Forward Primer: q1730 nm2Fw2_M1: ACCAAAAATACAACACTTCAA; Reverse Primer: q1730 nm2R2: GGTAATTGTTAGTAATTTTTGTG; Hydrolysis Probe: q1730 nm2P4: FAM-CACTCTCCCCATCCCTCTATC-BHQ1.
CpG System (Detecting CpG Positions in Bisulfite-Converted DNA):

(44) TABLE-US-00021 Forward Primer: q1730_m2F1: TACCAAAAATACAACACTCCG Reverse Primer: q1730_m2R2_M1: AGGTAATTGTTAGTAATTTTTACG Hydrolysis Probe: q1730 m2P1: HEX-CTCACTCTCCCCGTCCCTCTATC-BHQ1

(45) The technical specificity of the TpG-specific PCR-system was tested based on test-templates (see FIG. 4). TpG and the CpG specific PCR system were found to be highly specific for the bisulfite converted and the non-bisulfite converted template, respectively. Additionally, the TpG-specific and CpG-specific PCR system show no cross reactivity with the CpG and the TpG templates, respectively (FIG. 4 shown for TpG-specific PCR system). In order to further increase specificity of the qPCR primer system, Mg2+ concentration was increased from 3.2 mM (usually applied) to 3.5 mM (see FIG. 4).

(46) The biological specificity of the neutrophils-specific qPCR-system was tested using certain sorted cell fractions as well as using whole blood samples (see Table 9). The established qPCR assay was found to be highly specific for neutrophils.

(47) TABLE-US-00022 q1730 (nGRC) Assay Run-ID: UBq1730_b_BSCT-Valid. qPCR for bisulfite-converted normalization standard: qPCR for nGRC qPCR for nGRC non- bisulfite-converted bisulfite-converted normalization standard normalization standard (TpG) (CpG) Standards for Quantification CP CP Standard-ID Plasmid Units Value Plasmid units Value Plasmid units Standard-1 31250 units 23.5 30433.3 23.,8 30766.,7 Standard-2 6250 units 25.8 6340.0 26.,2 6300.,0 Standard-3 1250 units 28.2 1316.7 28.,6 1240.,0 Standard-4 250 units 30.6 257.7 30.,9 256.,0 Standard-5 50 units 32.8 62.2 33.,1 60.,5 Standard-6 30 units NTC NTC ND ND ND ND PCR-System specific to PCR-System specific to TpG CpG Analyzed Samples CP CP % nGRC Epoints-ID Cell Type Value Plasmid units Value Plasmid units TpG/CpG bGRAN06 Basophils 35.49 14.27 29.09 875.33 1.60 eGRAN09 Eosinophils 35.24 16.20 30.68 300.00 5.12 nGRAN02 Neutrophils 30.52 270.67 35.73 11.70 95.86 MOC28 Monocytes 35.72 12.93 29.85 525.00 2.40 THC14 T-Helper Cells 42.70 0.91 30.80 278.00 0.33 CTL16 Cyototox. T-Cells 37.72 5.04 29.41 706.00 0.71 NKC_Pool NK Cells 36.95 7.03 29.34 740.33 0.94 NKT19 NK T-Cells 38.35 3.85 30.37 369.67 1.03 BLC06 B-Lymphocytes 39.57 2.41 29.91 502.67 0.48 WBL51 Whole Blood 30.61 253.67 31.69 152.67 62.43 WBL55 Whole Blood 29.43 561.00 30.84 268.67 67.62 WBL57 Whole Blood 31.59 134.00 32.08 117.67 53.25 WBL58 Whole Blood 31.94 107.33 31.68 154.33 41.02

(48) Table 9 summarizes the results of the qPCR-analysis of sorted immune cells and whole blood samples. Shown are the CP-values for plasmid standards, for immune cell types and whole blood samples, each for the bisulfite converted, neutrophil-specific marker copies (TpG PCR-system) and the non-bisulfite converted, neutrophil-specific marker copies (CpG PCR-system) system. Based on the plasmid standard the corresponding copy numbers (plasmid copies) were calculated from the CP-value as measured. (NTC) no template control; (nGRC) neutrophil granulocytes.

(49) The relative amount of neutrophils in the sample is calculated from the number of bisulfite converted, neutrophil-specific marker copies and the sum of bisulfite converted and non-bisulfite converted neutrophil-specific marker copies in the sample as follows:
% neutrophils=no. of bisulfite converted neutrophil copies/no. of non-bisulfite converted neutrophil copies100; % neutrophils=253.67/(253.67+152.67)100=62.43

(50) The present assay is special in the sense that the amplification of the bisulfite-converted neutrophils-target-DNA using common fitted primers and standard PCR-protocols does not provide a sufficient result. Only after using amplification primers that were designed having a mutation (a mismatch) at strategic sites as identified herein, together with the use of a much higher Mg.sup.2+-concentration in the PCR allows for the efficient amplification of the neutrophils-target region. In a next step a genomic plasmid standard can be designed and cell-specific assay-correction factor can be assessed (see Example 6).

Example 8Assessment of Cell-Specific Assay-Correction Factor Using A Non-Bisulfite-Converted Nucleic Acid Molecule (Genomic Plasmid Standard) as Normalization Standard to Quantify Absolute Number of Cells Per Microliter

(51) The inventors developed non-bisulfite converted, genomic plasmid standards as a normalization standard. One of these genomic plasmid standards comprises a marker region being specific for T-lymphocytes as well as a marker region being cell-type unspecific (GAPDH, housekeeping gene, detecting all cells, 100% of cells). Each single plasmid contains the same number of copies of these two marker regions (equimolar); two of these plasmids correspond to the number of DNA copies per one single immune cell and are therefore counted as one single cell. A stock solution containing defined numbers of said genomic plasmid molecules is used to determine the T-lymphocyte-specific assay-correction factor as well as to assess the absolute number of T-lymphocytes per microliter within an unknown blood sample.

(52) In a first step, DNA of four human blood samples of unknown composition was isolated. This isolated DNA as well as the genomic plasmids of genomic plasmid standard were bisulfite treated. Following, the amount of copies of bisulfite converted T-lymphocyte-specific and GAPDH-specific marker regions were assessed by qPCR (Table 10, section B, C). These qPCR analyses were performed using a bisulfite-converted normalization standard (Table 10, section A) indicating the relative number of bisulfite-converted DNA as well as relative number of genomic plasmid copies containing the T-lymphocyte-specific marker region and the GAPDH marker region (Table 10 section B, C).

(53) The relative amount of T-lymphocytes in percent within unknown blood samples is calculated as number of bisulfite converted T-lymphocyte-specific marker copies related to bisulfite converted GAPDH copies (Table 10, section B).

(54) $\%T\text{-}\mathrm{lymphocytes}=\frac{\begin{array}{c}\mathrm{no}.\mathrm{bisulfite}\text{-}\mathrm{converted}\\ T\text{-}\mathrm{lymphocytes}\text{-}\mathrm{specific}\mathrm{marker}\mathrm{copies}100\end{array}}{\mathrm{no}.\mathrm{bisulfite}\text{-}\mathrm{converted}\mathrm{GAPDH}\mathrm{copies}}$$\left(e.g.\mathrm{RD}260314\right)\text{:}1896.7/6570.0100=28.87\%$

(55) In a next step, T-lymphocyte-specific assay-correction factor based on said genomic plasmid standard was assessed (Table GR, section C). As described above, said genomic plasmid standard was bisulfite converted and number of plasmid copies assessed by qPCR using primers specific for bisulfite-converted marker regions for T-lymphocytes and for GAPDH. These qPCR analyses were also performed using the bisulfite-converted normalization standard (Table 10, section A). The efficiency of qPCR for T-lymphocytes and GAPDH should be equal as the novel genomic, non-bisulfite converted plasmid standard contains an equimolar amount of copies T-lymphocyte-specific and GAPDH-specific marker regions. Therefore, assessed deviation of genomic T-lymphocyte copy numbers from GAPDH copy numbers corresponds to differences in qPCR assay efficiencies.
e.g. Mean T-lymphocyte copy numbers=6058 vs. mean GAPDH copy numbers=5483
This deviation defines the cell-type assay-specific correction factor:
Mean T-lymphocytes copy numbers/GAPDH copy numbers=6058/5483=1.1.

(56) For T-lymphocytes an assay correction factor of 1.1 (average, n=2) was assessed (Table 10, section C). Correcting the relative amount of T-lymphocytes by factor 1.1 results in an absolute amount, e.g., of 26.24% T-lymphocytes within the unknown blood sample RD260314 (Table 10, section D).
absolute amount of T-lymphocytes=relative amount of T-lymphocytes/specific assay-correction factor
e.g.: 28.87%/1.1=26.24% Treg cells

(57) Additionally, the absolute number of T-lymphocytes per microliter within unknown blood samples was assessed (Table 10, section E). As described above, said genomic plasmid standard (stock solution of 6250 copies per microliter) was bisulfite converted and number of plasmid copies assessed by qPCR using primers specific for bisulfite-converted marker region for T-lymphocytes (section C). These qPCR was performed using the bisulfite-converted normalization standard (section A).

(58) The amount of T-lymphocytes per microliter within unknown blood samples is calculated from relation of known, initial number of genomic plasmids of stock solution (6250 copies) and qPCR assessed number of copies of T-lymphocyte-specific marker within unknown blood samples (see section B) to qPCR assessed number of copies of genomic plasmid standard (see section C).

(59) $T\text{-}\mathrm{lymphocytes}\text{/}\mathrm{.Math.l}=\frac{\begin{array}{c}\mathrm{no}.\mathrm{plasmid}\mathrm{copies}\text{/}\mathrm{.Math.l}\mathrm{no}.\mathrm{bisulfite}\text{-}\mathrm{converted}\\ T\text{-}\mathrm{lymphocyte}\text{-}\mathrm{specific}\mathrm{marker}\mathrm{copies}\end{array}}{\mathrm{Mean}\mathrm{no}.\mathrm{of}\mathrm{qPCR}\mathrm{assessed}\mathrm{plasmid}\mathrm{copies}2}$$\left(e.g.\mathrm{RD}260314\right)\text{:}\left(62501896.7\right)/\left(6058.32\right)=978T\text{-}\mathrm{lymphocytes}\text{/}\mathrm{.Math.l}$
(See Table 10 below.)

(60) TABLE-US-00023 TABLE 10 Assessment of Treg-specific assay-correction factor using a bisulfite-unconverted nucleic acid molecule as a plasmid standard. Assessment of absolute cell number in % as well as of cells per l A) qPCR for bisulfite-converted normalization standard: qPCR for T- qPCR for GAPDH bisulfite- lymphocyte bisulfite- converted normalization converted normalization standard Standards for standard copy Quantification copy numbers numbers Standard- Plasmid CP normalization normalization ID Units Value standard CP Value standard Standard-1 31250 units 23.99 30500.00 23.30 31533.33 Standard-2 6250 units 26.22 6510.00 25.62 6263.33 Standard-3 1250 units 28.65 1223.33 27.93 1260.00 Standard-4 250 units 30.90 258.67 30.30 241.33 Standard-5 50 units 33.14 50.00 32.86 48.93 B) qPCR on blood sample of unknown composition for assessment of relative amount of T- Lymphocytes using the bisulfite-converted normalization standard as given under A): qPCR for GAPDH- specific bisulfite converted qPCR for T-lymphocyte- DNA specific bisulfite converted copy DNA numbers relative Sample ID copy numbers acc. to amount unknown acc. to normalization normalization T- blood standard standard lymphocytes sample CP Value (A) CP Value (A) (%) RD260314 28.01 1896.7 25.55 6570.0 28.87 BF260314 27.54 2626.7 24.72 11700.0 22.45 MK260314 27.49 2703.3 24.86 10566.7 25.58 LK260314 27.69 2363.3 24.85 10700.0 22.09 C) qPCR on genomic plasmid standard for assessment of T-Lymphocyte-specific correction factor qPCR for GAPDH- qPCR for T- specific bisulfite converted lymphocyte-specific DNA bisulfite converted copy % T- number DNA numbers lymphocytes/ plasmid copy numbers acc. to GAPDH Sample ID copies acc. to normalization normalization genomic genomic per CP standard standard plasmid standard microliter Value (A) CP Value (A) units gnomSTD_02 6250 26.47 5503.3 25.88 5213.3 106 gnomSTD_02 6250 26.20 6613.3 25.74 5753.3 115 Mean: 6058.3 Mean: Mean: 5483 110 Normalization Factor: 1.1 D) Correction of relative amount of T-lymphocytes using assay-specific correction factor (C) to obtain absolute amount of T-Lymphocytes (in %) Sample ID T- unknown Relative lymphocytes blood amount T- Normalization absolute sample lymphocytes Factor amount RD260314 28.87 1.1 26.24% BF260314 22.45 1.1 20.41% MK260314 25.58 1.1 23.26% LK260314 22.09 1.1 20.08% E) Normalizing relative amount of T-lymphocyte to cell number per microliter using genomic plasmid standard Sample ID no. plasmid copies per l no. copies T- unknown copy numbers of T- I bcDNA blood lymphocyte-specific bisulfite Mean qPCR assessed no. of plasmid sample converted DNA (see B) copies 2 RD260314 1896.7 978 T-Lymphocytes/l BF260314 2626.7 1355 T-Lymphocytes/l MK260314 2703.3 1394 T-Lymphocytes/l LK260314 2363.3 1219 T-Lymphocytes/l