Method for Restoring Sexual Reproduction in the Fungus Trichoderma Reesei

Abstract

The present invention relates to a method for restoring sexual reproduction between two sterile, female strains of Trichoderma reesei using a helper strain MAT, said helper strain being a fertile female strain of Trichoderma reesei in which the sexual-type locus MAT has been eliminated.

Claims

1. A method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei, comprising the following steps: a) incubation in a suitable medium of a MAT helper strain, said strain being a fertile female strain of Trichoderma reesei wherein the locus of the MAT mating type has been knocked out, b) a first watering of said MAT helper strain with conidia of a first Trichoderma reesei strain of a first mating type, c) a second watering of said MAT helper strain resulting from step b) with conidia of a second Trichoderma reesei strain of a second mating type.

2. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein the first mating type of the first Trichoderma reesei strain is MAT1-1.

3. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein the second mating type of the second Trichoderma reesei strain is MAT1-2.

4. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein the Trichoderma reesei strain is the QM6a strain or a strain derived from the QM6a strain.

5. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein step a) of incubating, in a suitable medium, said MAT helper strain lasts at least 2 days.

6. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein step a) of incubating, in a suitable medium, said MAT helper strain is an incubation in the dark.

7. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein the conidia of the first Trichoderma reesei strain of a first mating type and/or the conidia of the second Trichoderma reesei strain of a second mating type are present at a concentration of at least 105 conidia/ml.

8. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, comprising, in addition, between the first and second watering, a step of incubating, in a suitable medium, said MAT helper strain resulting from step b).

9. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein step b), and optionally the step of incubating, in a suitable medium, said MAT helper strain resulting from step b), last at least 2 days.

10. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein step b), and optionally the step of incubating, in a suitable medium, said MAT helper strain resulting from step b), are optionally carried out in alternating light and darkness.

11. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, comprising, in addition, after the second watering, a step of incubating, in a suitable medium, the MAT helper strain resulting from step c) until stromata appear.

12. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein step c), and optionally the step of incubating, in a suitable medium, the MAT helper strain resulting from step c), last at least 5 days.

13. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, wherein step c), and optionally the step of incubating, in a suitable medium, the MAT helper strain resulting from step c) are carried out in alternating light and darkness.

14. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, comprising, in addition, after the stromata have appeared, a step of amplifying the stromata.

15. The method for restoring sexual reproduction between two sterile female strains of Trichoderma reesei as claimed in claim 1, comprising, in addition, the obtaining of a Trichoderma reesei strain.

16. A method of producing cellulases or biofuel comprising incubating a Trichoderma reesei strain obtained by means of the method as claimed in claim 1 and isolating the cellulases or biofuel from the incubation media.

Description

FIGURES

[0077] FIG. 1 represents the principle of sexual reproduction in the filamentous fungus T. reesei.

[0078] FIG. 2 represents sexual reproduction in T. reesei. Part (A) represents sexual reproduction between two natural isolates (A) and part (B) represents sexual reproduction between two QM6a strains.

[0079] FIG. 3 represents the principle of the method of the helper strain.

[0080] FIG. 4 represents the protocol for implementing the method of the helper strain according to the present invention.

[0081] FIG. 5 represents the stromata obtained following the implementation of the method of the helper strain according to the present invention.

[0082] FIG. 6 represents the final assembly of the knockout cassette in the pUC19 plasmid (plasmid used to obtain the MAT helper strain according to the present invention). The lines correspond to the primers which are not positioned to scale. The numbers correspond to the primers: 1=5mat1-2-F; 2=5mat1-2-R; 3=mat1-2/Hph-F; 4=mat1-2/Hph-R; 5=3mat1-2-F; 6=3mat1-2-R; 7=K7 Del Mat1-2-F and 8=K7-Del-Mat1-2-R.

[0083] FIG. 7 represents the position of the primers chosen for the amplification of the various fragments of the knockout cassette. The number (1) represents the 5flank+marker fragment, and the number (2) represents the marker+3flank fragment.

[0084] FIG. 8 represents the amplification of stromata. The stromata obtained following the implementation of the method of the helper strain according to the present invention (such as those obtained in FIG. 5) are presented in the petri dishes A1 and B1. The stromata are transferred onto a PDA medium (this corresponds to the petri dishes A2 and B2) and the number of stromata can thus be multiplied. This amplification/multiplication step can thus be repeated several times, by transferring the stromata obtained onto a new PDA medium (this corresponds to the petri dishes A3 and B3).

EXAMPLES

Example 1: Materials & methods

[0085] The present invention uses three different strains. The three strains that were used in the examples are the following: [0086] the two sterile strains to be crossed: the QM6a MAT1-1 strain and the QM6a MAT1-2 strain. To obtain the QM6a MAT1-1 strain, the MAT1-2 locus was replaced with the MAT1-1 locus in the QM6a MAT1-2 strain. The QM6a MAT1-2 strain was obtained from the ATCC (reference ATCC 13631). It is the natural isolate from which all the industrial strains originate. [0087] the MAT helper strain which is a strain wherein the MAT mating type locus has been knocked out. This strain can be constructed according to the protocol indicated below:

[0088] Construction of the MAT Helper Strain

[0089] This strain must be constructed from a fertile female strain which can cross with the two sterile strains to be crossed before the genetic manipulation.

[0090] To construct the MAT1-2 locus knockout cassette, the hygromycin B resistance gene and the 5 and 3 sequences of the MAT1-2 locus were assembled in a plasmid pUC19 (FIG. 6) by means of the Gibson Assembly Kit (New England Biolabs) according to the producer's recommendations. The hygromycin B resistance gene was used as a selectable marker in the present invention, but another selectable marker may absolutely be used.

[0091] The pUC19 recipient plasmid was digested beforehand with the XbaI and EcoRI enzymes. The sequences of approximately 1000 bp upstream and downstream of the MAT1-2 locus were amplified using the 5mat1-2-F and 5mat1-2-R primers for the upstream region and the 3mat1-2-F and 3mat1-2-R primers for the downstream region (Table 1). These primers contain homology regions which allow recombination with pUC19 on one side and the hygromycin resistance gene on the other. The hygromycin B resistance gene was amplified from the pUT1140 plasmid by means of the mat1-2/Hph-F and mat1-2/Hph-R primers. These primers contain homology regions which allow recombination with the MAT1-2 locus on one side and pUC19 on the other.

[0092] Secondly, the knockout cassette was amplified from the bacterial DNA by means of the K7-Del-Mat1-2-F and K7-Del-Mat1-2-R primers. The PCR products obtained were purified using the PCR Purification Kit (Qiagen) and were used to transform protoplasts of the B31 fertile wild-type strain using CaCl.sub.2 and polyethylene glycol (PEG). A strain other than the B31 strain could have been used, provided that it is fertile female. The sequence of the plasmid used to transform the B31 strains is represented by SEQ ID No.: 17.

[0093] The B31 strain (MAT1-2 mating type) is a descendant of the T. reesei strain CBS999.97 (ATCC 204423) (Sexually Competent, Sucrose- and Nitrate-Assimilating Strains of Hypocrea jecorina (Trichoderma reesei)from South American Soils). It is the equivalent of the MAT1-2 strain CBS999.97 of the article by Seidl et al. (2009).

[0094] The transformants were stabilized and regenerated on a PDA medium containing 0.8 M of sucrose and 100 g/ml of hygromycin B. The colonies were then subcultured and were purified by isolation of the conidia on the PDA-hygromycin selection medium. They were then subjected to phenotypic screening which consists in crossing the B31 transformants with the A2 natural isolate which is of MAT1-1 mating type and which is compatible with the B31 strain: if the MAT locus has indeed been knocked out, then there will be no sexual reproduction and thus an absence of stromata.

[0095] A PCR amplification then makes it possible to verify that the native gene has indeed been replaced with the knockout cassette. This validation is carried out in two steps. The first consists in verifying the knockout of the gene by performing a PCR with the primers for amplifying the gene (Mat1-2-F internal and Mat1-2-R internal) (FIG. 7). If said gene is indeed knocked out, no amplification should be obtained. However, in order to verify that this result is indeed a consequence of the absence of the gene and not of a poor operation of the PCR, a control pair of primers (EF1 and EF2), making it possible to amplify an internal fragment of 880 bp of the tef1 gene (encoding the al translation elongation factor) present in the genome of all the T. reesei strains, is also used. In a second step, the amplification of the 5flank+marker and marker+3flank fragments is carried out in order to verify the presence of the knockout cassette at the locus. The position of the primers chosen is presented in FIG. 7. In order to validate the insertion of the genetic cassette at the site, the primers must be chosen downstream of the 5flank fragment and upstream of the 3flank fragment (primers Dmat1-2verif5F associated with verifHygro5 and Dmat1-2verif3R associated with verifHygro3).

[0096] The sequences of the primers used in the present invention are indicated in Table 1 below.

TABLE-US-00001 TABLE1 Summariesoftheprimersusedfortheknockout andreplacementoftheMATlocus Primername Primersequence(5.fwdarw.3) 5mat1-2-F TGCATGCCTGCAGGTCGACTCTAGACCCTTCCTGACCCTGGACTG(SEQIDNO:1) 5mat1-2-R GGTACACTTGGACTGCGTTGACTGATGGTG(SEQIDNO:2) mat1-2/Hph-F CAACGCAGTCCAAGTGTACCTGTGCATTCTG(SEQIDNO:3) mat1-2/Hph-R CCTTGCCAAGGCAGTGCTAGTGTGTGTAC(SEQIDNO:4) 3mat1-2-F TAGCACTGCCTTGGCAAAGGCTAGACACTAC(SEQIDNO:5) 3mat1-2-R TTGTAAAACGACGGCCAGTGAATTCATGTACAATTACCACATGCG(SEQIDNO:6) K7-Del-Mat1-2-F CCAGGGCTTTGAGAGCAGTA(SEQIDNO:7) K7-Del-Mat1-2-R CTGGTGGCTGACACTTGCTA(SEQIDNO:8) Dmat1-2verif5F GTACTGGTTGTTGGGCTGTG(SEQIDNO:9) Dmat1-2verif3R CGGAGCAACTCTCAGGAAAC(SEQIDNO:10) verifHygro5 CTCCGTAACACCCAATACGC(SEQIDNO:11) verifHygro3 CTCTGGGCAAAGCACCAATC(SEQIDNO:12) MAT1-2-Finternal TTCAGTGTTGGCCATTTTGA(SEQIDNO:13) MAT1-2-Rinternal GCTTCTCAAGCAAGGCAAGT(SEQIDNO:14) EF1 ATGGGTAAGGAGGACAAGAC(SEQIDNO:15) EF2 GGAAGTACCAGTGATCATGTT(SEQIDNO:16)

TABLE-US-00002 TABLE2 Sequenceoftheplasmidusedtotransformthe B31strains Sequenceoftheplasmid(SEQIDNo.:17) indicates data missing or illegible when filed

[0097] Following these phenotypic and molecular verifications, the B31::MAT-hph helper strain was obtained. It is a MAT helper strain (a strain of T. reesei wherein the locus of the MAT mating type has been knocked out) according to the present invention.

Example 2: Comparative Examples with Various Methods Aiming to Restore Sexual Reproduction Between Two QM6a Industrial Strains of T. reesei

[0098] All the tests were carried out in Petri dishes containing PDA medium. This is the most optimal medium for sexual reproduction of T. reesei.

[0099] a/ Method 1: Production of a Trikaryon

[0100] This is the same method as that described in P. anserina (Jamet-Vierny, C., Debuchy, R., Prigent, M. & Silar, P. (2007). IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina. Fungal genetics and biology FG & B 44, 1219-1230).

[0101] In order to obtain a trikaryon, the strains were incubated separately for two days at most at 30 C. in order to prevent the formation of conidia and to obtain only mycelium. After two days of growth, an agar implant 0.5 cm by 0.5 cm of each of the strains involved (three for a trikaryon) was cut out and placed in a 2 ml Eppendorf tube containing 500 l of sterile water. The mycelia were mixed by means of a FastPrep-24 (MP Biomedicals) for 20 seconds at a speed of 4 m/s, and 10 l of the ground material were deposited on the Petri dishes. The dishes were incubated in an incubator at 24 C. with alternating 12 hours of light and 12 hours of darkness.

[0102] The experiment was carried out a first time in triplicate. No stromata were obtained. The dishes were kept in the incubator until the medium dried, that is to say approximately one month.

[0103] Since the obtaining of trikaryon is a rare event, the experiment was repeated and 10 different Petri dishes were inoculated. No stromata were obtained.

[0104] b/ Method 2: Production of a Trikaryon

[0105] This method is identical to method 1, but differs by virtue of its incubation. In this case, the Petri dishes are not placed in an incubator where it is 24 C. or where there are 12 hours of light and 12 hours of darkness, but are left on the workbench in the laboratory in which the temperature is not constant (daily variation) and where there is no luminosity control (natural luminosity). The mixture of the three strains was inoculated onto ten different Petri dishes. No stromata were obtained.

[0106] c/ Method 3: Confrontation of the Three Strains

[0107] The three strains were inoculated onto a Petri dish at equal distance from one another and at a maximum distance from the center of the Petri dish. The dish was incubated at 24 C. with alternating day/night (12 hours of light and 12 hours of darkness). No stromata were obtained.

[0108] d/ Method 4: Mixture of the Three Strains at the Center of the Petri Dish

[0109] The three strains were inoculated in isolation onto a sheet of cellophane placed on the Petri dish. After 2-3 days of growth in the dark, the mycelia were removed, ground using balls in a FastPrep, mixed in a 1:1:1 ratio and then deposited at the center of the Petri dish with various concentrations (1, 1/10, 1/100, 1/1000). No stromata were obtained.

[0110] e/ Method 5: Isolated Inoculation of the Three Strains

[0111] The three strains were inoculated in isolation onto a sheet of cellophane placed on a Petri dish. After 2-3 days of growth in the dark, the mycelia were removed, ground using balls in a FastPrep, then mixed in a 1:1:1 ratio. This mixture was inoculated into a PD (Potato Dextrose Broth) liquid medium supplemented with 1% of KH.sub.2PO.sub.3 and incubated (with or without shaking) for one to two days and was then deposited at the center of a Petri dish with various concentrations (1, 1/10), with or without addition of 5 mM of ascorbic acid. No stromata were obtained.

[0112] f/ Method 6: Inoculation of the Three Strains

[0113] The three strains were inoculated together from conidia into a PD (Potato Dextrose Broth) liquid medium supplemented with 1% of KH.sub.2PO.sub.3, and incubated (with or without shaking) for 1 to 2 days and were then deposited at the center of a dish of PDA with various concentrations (1, 1/10), with or without addition of 5 mM of ascorbic acid. No stromata were obtained.

[0114] g/ Method 7: Isolated Inoculation of the Three Strains

[0115] The three strains were inoculated in isolation onto a sheet of cellophane placed on a Petri dish. After 2-3 days of growth in the dark, the mycelia were removed, ground using balls in a FastPrep, then mixed with a 1:1:1 ratio (QM6a 1-1:QM6a 1-2:MAT), or 1:1:2 or 1:1:5. The mixture was (i) either plated out over the entire dish, (ii) or inoculated at the center of the dish with various dilutions (1, 1/10 and 1/100) on PDA medium, with or without addition of 5 mM of ascorbic acid. The dishes were then incubated at 24 C., (i) either in alternating day/night, (ii) or for an incubation of one night in the dark then alternating day/night, (iii) or in the dark for three days followed by alternating day/night, (iv) or in the dark from 15 days followed by alternating day/night. No stromata were obtained.

[0116] h/ Method 8: Sequential Watering with Addition of Cellular Extracts

[0117] Fertile wild-type isolates of T. reesei strains were placed in confrontation on a sheet of cellophane deposited on PDA. The biological material of these crosses was recovered from T=0 to T=96h after inoculation and was subjected to protein extraction. The protein extracts were sterilized by filtration. Finally, the watering method was applied and the various cell extracts obtained were added to the conidia. A first watering with the MAT1-1 conidia, then a second watering with the MAT1-2 conidia (or vice versa) were carried out. No stromata were obtained.

[0118] i/ Method 9: Sequential Watering According to the Invention

[0119] Obtaining Conidia:

[0120] Four to six days before the watering, Petri dishes are inoculated with each of the conidia donor strains (MAT1-1 then MAT1-2) which will serve for the watering of the helper strain, and incubated at 30 C. in the light in order for there to be production of conidia.

[0121] On the day of the watering, 4 ml of sterile water is deposited on the donor strain (MAT1-1 or MAT1-2) and the conidia are harvested. The conidia are counted and their concentration is adjusted to between 10.sup.6 and 10.sup.8 conidia/ml.

[0122] Watering:

[0123] In the watering technique, the MAT helper strain has the function of a female strain that will provide the maternal tissues required for the production of the stromata. The helper strain will be successively watered by the MAT1-1 then MAT1-2 conidia.

[0124] The MAT helper strain is watered uniformly with 1 ml of conidia of the first mating type, then incubated for 7 days, watered with 1 ml of conidia of the second mating type and incubated until stromata are obtained.

[0125] The MAT helper strain is cultured on a PDA medium and incubated at 24 C. for 4 days and in the dark. After 4 days in incubation, the helper strain was watered with 1 ml of conidia of MAT1-1 mating type and incubated at 24 C. for 7 days with alternating light for 12 h and darkness for 12 h.

[0126] Finally, the helper strain was watered with 1 ml of MAT1-2 conidia and incubated at 24 C. with alternating light for 12 h and darkness for 12 h until the stromata appeared. This method made it possible to obtain stromata.

[0127] Six different experiments (exp 1 to exp 6) were carried out. The latter differ by virtue of the preincubation time (4, 5 or 6 days) and by virtue of the number of conidia that were watered. The results are presented in

[0128] Table 3 below.

TABLE-US-00003 TABLE 3 Total number of stromata obtained with the 6 dishes Exp 1 = Exp 2 = Exp 3 = Exp 4 = Exp 5 = Exp 6 = pre- pre- pre- pre- pre- pre- incubation incubation incubation incubation incubation incubation Watering 4 d 5 d 6 d 4 d 5 d 6 d 10.sup.6 1 3 1 0 0 0 10.sup.7 53 46 37 1 Many 0 pigmented structures* 10.sup.8 61 71 28 1 26 0 *Many pigmented structures which resemble stromata, but which are very small in size (approximately 2 mm), were obtained. There are so many of them that they are stuck to one another, which makes them difficult to count.

[0129] The sequential watering technique makes it possible to repeatedly obtain stromata. The optimal conditions for obtaining the stromata are the following: [0130] preincubation of the helper strain: 4 or 5 days; [0131] concentration of conidia: 10.sup.7 and 10.sup.8 conidia/ml.

Example 3: Various Conditions for Sequential Watering According to the Invention

[0132] In this example, and as indicated in Table 4, the helper strain was watered by: [0133] a strain of MAT1-1 mating type, then the same strain of the MAT1-2 mating type, or [0134] a strain of MAT1-2 mating type, then the same strain of the MAT1-1 mating type, or [0135] water at each of the waterings (negative control).

TABLE-US-00004 TABLE 4 Summary of the various conditions tested Watering 1 Watering 2 MAT helper MAT1-1 MAT1-2 strain MAT helper MAT1-2 MAT1-1 strain MAT helper H.sub.2O H.sub.2O strain

[0136] Between watering 1 and watering 2, there is an incubation for 7 days at 24 C. with alternating of light for 12h and darkness for 12h. The results are presented in Table 5 below.

TABLE-US-00005 TABLE 5 Total number of stromata obtained with the 2 dishes Number of stromata obtained Watering 1 Watering 2 on 2 dishes MAT1-1 MAT1-2 40 MAT1-2 MAT1-1 12 H.sub.2O H.sub.2O 0

[0137] A first watering with a strain of MAT1-1 mating type thus favors the obtaining of a large number of stromata, in comparison with a first watering with a strain of MAT1-2 mating type.

Example 4: Amplification of the Stromata

[0138] The amplification was carried out under alternating of light for 12 h and darkness for 12 h, for a period of 7 to 21 days: the time elapsed between the first series of photos (A1 or B1) and the second series of photos (A2 or B2) is 15 days. The stromata of the A1/B1 Petri dishes obtained according to the invention (for example such as those obtained in example 2) were transferred into a new suitable medium (in this case PDA). The stromata obtained at the end of this transfer are represented in the A2/B2 Petri dishes. A second transfer into a new suitable medium was then carried out: the stromata of the A2/B2 Petri dishes were transferred into a new suitable medium. The stromata obtained at the end of this transfer are represented in the A3/B3 Petri dishes.

[0139] The results of these transfers are represented in FIG. 8.

[0140] The analysis of the number of stromata obtained made it possible to conclude that:

[0141] 1) The amplification step (i.e. the transfer of the stromata into a new suitable medium) makes it possible to quantitatively increase the number of stromata, by at least 20% and even by at least 50% compared with a method without amplification step, 2) The amplification step also makes it possible to increase the maturity of the stromata.

REFERENCES

[0142] Jamet-Vierny, C., Debuchy, R., Prigent, M. and Silar, P. (2007). IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina. Fungal genetics and biology: FG & B 44, 1219-1230. [0143] Kubicek, C., Linke, R., Seiboth, B., Haarmann, T, and Lorenz, P, (2014), Genes/Genetic Elements Associated With Mating Impairment In Trichoderma reesei QM6a And Its Derivatives And Process For Their Identification (WO2014/102241). [0144] Linke, R., Thallinger, G. G., Haarmann, T., Eidner, J., Schreiter, M., Lorenz, P., Seiboth, B., and Kubicek, C. P. Restoration of female fertility in Trichoderma reesei QM6a provides the basis for inbreeding in this industrial cellulase producing fungus. Biotechnology for biofuels 8, 155. [0145] Seidl, V., Seibel, C., Kubicek, C. P. and Schmoll, M. (2009). Sexual development in the industrial workhorse Trichoderma reesei. Proceedings of the National Academy of Sciences of the United States of America 106, 13909-13914.

[0146] Silar, P. (2014). Simple Genetic Tools to study fruiting body development in Fungi. The Open Mycology Journal, 8, 148-155); Jamet-Vierny, C., Debuchy, R., Prigent, M. & Silar, P. (2007). IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina. Fungal genetics and biology: FG & B 44, 1219-1230