Enzyme Exhibiting a-1,6-Glucosyl Transfer Activity
20210009977 ยท 2021-01-14
Inventors
- Haruhide Mori (Sapporo-shi, JP)
- Wataru Saburi (Sapporo-shi, JP)
- Kenta Kanai (Fuji-shi, JP)
- Kenta Aizawa (Fuji-shi, JP)
- Takahisa Iizuka (Fuji-shi, JP)
- Noriaki Takechi (Fuji-shi, JP)
- Mioka Tani (Fuji-shi, JP)
Cpc classification
A23V2002/00
HUMAN NECESSITIES
C12P19/18
CHEMISTRY; METALLURGY
A23V2002/00
HUMAN NECESSITIES
A23L33/20
HUMAN NECESSITIES
C08B37/00
CHEMISTRY; METALLURGY
A61K8/732
HUMAN NECESSITIES
C12P19/04
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to an enzyme having -1,6-glucosyl transfer activity, which can use a partially degraded starch product as a substrate and is heat resistant and suitable for industrial applications; an enzyme preparation for use in manufacturing -1,6-glucan, comprising the enzyme as an active ingredient; and a method for manufacturing -1,6-glucan using the enzyme or enzyme preparation. The present invention provides an enzyme having -1,6-glucosyl transfer activity, which is any one of proteins (a), (b), and (c): (a) a protein consisting of an amino acid sequence of SEQ ID NO: 3; (b) a protein consisting of an amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3; and (c) a protein consisting of an amino acid sequence in which one or several amino acid(s) have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3.
Claims
1. An enzyme having -1,6-glucosyl transfer activity, which is any one of proteins (a), (b) and (c): (a) a protein consisting of an amino acid sequence of SEQ ID NO: 3; (b) a protein consisting of an amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3; and (c) a protein consisting of an amino acid sequence in which one or several amino acid(s) have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3.
2. The enzyme according to claim 1, which further has -1,4-glucosyl transfer activity.
3. An enzyme which is derived from Thermoanaerobacter siderophilus and has the following properties: (1) having -1,6-glucosyl transfer activity; (2) having -1,4-glucosyl transfer activity; (3) having a molecular weight, as measured by SDS-PAGE, of 80 to 90 kDa; (4) having an optimum pH at 4.0 to 5.0; (5) being stable within a pH range of 3.5 to 8.5; (6) having an optimum temperature at 55 to 60 C.; and (7) exhibiting temperature stability at 60 C. or less.
4. The enzyme according to claim 3, which (8) acts on maltose, maltotriose, maltotetraose, maltopentaose, isomaltose, isomaltotriose and dextrin as substrates.
5. An enzyme preparation for manufacturing -1,6-glucan from an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond, which comprises the enzyme according to claim 1.
6. The enzyme preparation according to claim 5, wherein the oligosaccharide and/or the polysaccharide having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond are/is partially degraded starch product(s).
7. The enzyme preparation according to claim 5, wherein the -1,6-glucan is an isomaltooligosaccharide and/or an isomaltomegalosaccharide having a degree of polymerization of 2 to 30.
8. A composition for catalyzing an -1,6-glucosyl transfer reaction, comprising any one of proteins (a), (b), and (c): (a) a protein consisting of an amino acid sequence of SEQ ID NO: 3; (b) a protein consisting of an amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3; and (c) a protein consisting of an amino acid sequence in which one or several amino acid(s) have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3.
9. The composition according to claim 8, which is used for manufacturing -1,6-glucan from an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond.
10. A method for manufacturing -1,6-glucan, comprising a reaction step of allowing the enzyme according to claim 1 to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to obtain -1,6-glucan.
11. The method according to claim 10, which further comprises, before said reaction step, the step of hydrolyzing starch to obtain the oligosaccharide and/or the polysaccharide having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond.
12. The method according to claim 10, further comprising preparing a food product, a feed, a bait, a cosmetic product or a pharmaceutical product using the -1,6-glucan.
13. A method for manufacturing a glycoside, comprising the step of allowing the enzyme according to claim 1 to act on a sugar acceptor and a sugar donor.
14. The method for manufacturing a glycoside according to claim 13, wherein the sugar donor is a maltooligosaccharide.
15. The method for manufacturing a glycoside according to claim 13, wherein the sugar acceptor is a compound having an alcoholic hydroxyl group or a compound having a phenolic hydroxyl group.
16. The method of claim 13, further comprising preparing a food product, a feed, a bait, a cosmetic product, or a pharmaceutical product using the glycoside.
17. An enzyme preparation for manufacturing -1,6-glucan from an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond, which comprises the enzyme according to claim 3.
18. A method for manufacturing -1,6-glucan, comprising a reaction step of allowing the enzyme according to claim 3 to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to obtain -1,6-glucan.
19. A method for manufacturing -1,6-glucan, comprising a reaction step of allowing the enzyme according to claim 3 to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to obtain -1,6-glucan.
20. A method for manufacturing -1,6-glucan, comprising a reaction step of allowing the composition according to claim 8 to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to obtain -1,6-glucan.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
DETAILED DESCRIPTION OF THE INVENTION
[0071] Hereinafter, the present invention will be sometimes described based on typical embodiments and specific examples, but is not limited to such embodiments. The numerical ranges expressed using the symbol herein mean ranges including the numerical values indicated before and after the symbol as lower and upper limit values, respectively. The degree of polymerization (DP) described in the present invention means a degree of polymerization of a constituent sugar, glucose, regardless of the type of glucosidic bonds. The sugar composition (%) of a reaction product by the enzyme of the present invention was calculated as an area ratio (%) of a peak corresponding to each saccharide when the total area of peaks detected by HPLC was 100.
[0072] (Enzyme and Enzyme Preparation)
[0073] The enzyme having -1,6-glucosyl transfer activity according to the present invention is any one of proteins (a), (b) and (c):
[0074] (a) a protein consisting of an amino acid sequence of SEQ ID NO: 3;
[0075] (b) a protein consisting of an amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3; and
[0076] (c) a protein consisting of an amino acid sequence in which one or several amino acid(s) has/have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3.
[0077] The protein consisting of the amino acid sequence of SEQ ID NO: 3 is obtained by deleting the 1.sup.st to 752.sup.th amino acids of an amino acid sequence of SEQ ID NO: 1 acquired from the genome information on the thermophilic bacterium Thermoanaerobacter siderophilus, and consists of the 753.sup.th to 1559.sup.th amino acids. Here, the protein consisting of the amino acid sequence of SEQ ID NO: 1 is a hypothetical protein which comprises a sequence annotated with the Glycoside Hydrolase family, but is unknown in specific activity. The hypothetical protein derived from Thermoanaerobacter siderophilus is a multi-domain protein comprising a GH66 catalytic domain, a carbohydrate binding module CBM35 and a GH15 catalytic domain in order from the N-terminal side (
[0078] The present inventors have found that the protein consisting of the amino acid sequence of SEQ ID NO: 3 has -1,6-glucosyl transfer activity. Here, the enzyme having -1,6-glucosyl transfer activity means an enzyme that catalyzes a reaction for forming an -1,6-glucosidic bond through a transglucosylation reaction. The -1,6-glucosyl transfer activity is evaluated by reacting an enzyme with any one of maltose, isomaltose and isomaltotriose as a substrate to obtain a reaction product, and detecting, in the resultant reaction product, a sugar in which glucose has been transferred and extended by an -1,6 bond from the substrate.
[0079] The enzyme of the present invention can have -1,4-glucosyl transfer activity in addition to the -1,6-glucosyl transfer activity. Here, the -1,4-glucosyl transfer activity is an activity of catalyzing a transglucosylation reaction for forming an -1,4-glucosidic bond. The -1,4-glucosyl transfer activity is evaluated by reacting an enzyme with any one of maltose, maltotriose, maltotetraose and maltopentaose as a substrate to obtain a reaction product, and detecting, in the resultant reaction product, a sugar in which glucose has been transferred and extended by an -1,4 bond from the substrate. The present enzyme can further have -1,4-/-1,6-glucosidic bond hydrolysis activities, but rarely shows the -1,4-glucosidic bond hydrolysis activity. Here, the -1,4-/-1,6-glucosidic bond hydrolysis activities are activities of catalyzing hydrolysis reactions for cleaving -1,4-/-1,6-glucosidic bonds, respectively.
[0080] In the enzyme of the present invention, normally, the anomer type of the product is retained for the substrate (anomer retention type). The enzyme of the present invention may mainly exhibit different activities, depending on the type and concentration of the substrate and the reaction time. For example, when the substrate is a maltooligosaccharide (for example, a saccharide having a degree of polymerization of 3 to 5), the enzyme of the present invention sometimes exhibits the -1,4-glucosyl transfer activity more strongly than the -1,6-glucosyl transfer activity in the initial stage of the reaction (for example, the reaction time is 15 minutes to about 1 hour under the conditions described in the Examples in the present specification). Even in the case where the substrate is a maltooligosaccharide, the enzyme of the present invention sometimes mainly exhibits the -1,6-glucosyl transfer activity when the reaction time is longer (for example, the reaction time is 1 hour or more under the conditions described in the Examples in the present specification).
[0081] Also, a protein consisting of an amino acid sequence having at least 70%, at least 80%, preferably at least 90%, especially preferably at least 95%, at least 96%, at least 97%, at least 98%, at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3 and exhibiting -1,6-glucosyl transfer activity is also encompassed in the enzyme of the present invention. The amino acid sequence identity is defined as a percent of amino acid residues which are identical between two amino acid sequences to be compared, after alignment of the two amino acid sequences, and, if necessary, introduction of a gap in order to obtain the maximum percent sequence identity. The amino acid sequence identity can be determined, for example, by using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
[0082] Further, a protein consisting of an amino acid sequence in which one or several amino acid(s) has/have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3 and having -1,6-glucosyl transfer activity is also encompassed in the enzyme according to the present invention. The range of the one or several in the amino acid sequence in which one or several amino acid(s) has/have been substituted, inserted, deleted and/or added referred to herein is not especially limited, and, for example, means around 1 to 20, preferably around 1 to 10, more preferably around 1 to 7, further preferably around 1 to 5, especially preferably around 1 to 3.
[0083] As for a method for manufacturing the enzyme of the present invention, see the section <Manufacture of enzyme> which will be given below.
[0084] The enzyme of the present invention is an enzyme which is derived from Thermoanaerobacter siderophilus and has the following properties:
[0085] (1) having -1,6-glucosyl transfer activity;
[0086] (2) having -1,4-glucosyl transfer activity;
[0087] (3) having a molecular weight, as measured by SDS-PAGE, of 80 to 90 kDa;
[0088] (4) having an optimum pH at 4.0 to 5.0;
[0089] (5) being stable within a pH range of 3.5 to 8.5;
[0090] (6) having an optimum temperature at 55 to 60 C.; and
[0091] (7) exhibiting temperature stability at 60 C. or less.
[0092] The enzyme of the present invention further has the following property:
[0093] (8) acting on maltose, maltotriose, maltotetraose, maltopentaose, isomaltose, isomaltotriose and dextrin as substrates.
[0094] The -1,6-glucosyl transfer activity of the present enzyme is determined by reacting the enzyme of the present invention with any one of maltose, isomaltose and isomaltotriose as a substrate to obtain a reaction product, and detecting, in the resultant reaction product, a sugar in which glucose has been transferred and extended by an -1,6 bond from the substrate. The -1,4-glucosyl transfer activity of the enzyme is determined by reacting the enzyme of the present invention with any one of maltose, maltotriose, maltotetraose se and maltopentaose as a substrate to obtain a reaction product, and detecting, in the resultant reaction product, a sugar in which glucose has been transferred and extended by an -1,4 bond from the substrate.
[0095] The present enzyme can have -1,6-glucosidic bond hydrolysis activity. The -1,6-glucosidic bond hydrolysis activity of the present enzyme is determined by reacting the enzyme of the present invention with any one of isomaltotetraose, isomaltopentaose, isomaltohexaose and dextran as a substrate and detecting glucose.
[0096] The present enzyme has a molecular weight, as measured by SDS-PAGE, of 80 to 90 kDa. It should be noted that the molecular weight herein is indicated for the protein which is expressed and secreted using Bacillus subtilis as a host cell based on plasmid recombination. The present enzyme having a molecular weight measured to be 80 to 90 kDa in Example 2 is a protein which has His-Tag (six histidines added) on the C-terminal side and in which a secretion signal composed of predicted 17 amino acids has been cleaved. When the protein is secreted extracellularly, the secretion signal is cleaved, but the cleavage site is somewhat shifted in some cases. The actual cleavage site has not been confirmed, but it is inferred that the secretion signal has been cleaved in a range of several amino acids from an amino acid having a high cleavage site score predicted by the signal peptide prediction server SignalP4.1 (http://www.cbs.dtu.dk/services/SignalP/). In a preferred embodiment of the present invention, the enzyme of the present invention has a molecular weight, as measured by SDS-PAGE, of 75 to 92 kDa. In a more preferred embodiment of the present invention, the enzyme of the present invention has a molecular weight, as measured by SDS-PAGE, of 80 to 90 kDa.
[0097] The enzyme of the present invention exhibits the maximum activity at a pH of 4.5 when measured at a temperature of 37 C., and has an optimum pH at 4.0 to 5.0. Also, the present enzyme was stable at a pH of 3.5 to 8.5 in a test in which it was retained at a temperature of 4 C. for 24 hours. The optimum pH and pH stability were determined when the maltose degradation activity was measured under the conditions indicated in Example 4.
[0098] The enzyme of the present invention exhibits the maximum activity at a temperature of 60 C. when measured at a pH of 4.5, and has an optimum temperature at 55 to 60 C. Also, the present enzyme was stable at 60 C. or less in a test in which it was retained at a pH of 4.5 for 15 minutes. The optimum temperature and temperature stability were determined when the maltose degradation activity was measured under the conditions indicated in Example 4. The optimum pH and temperature and the pH and temperature stabilities were determined by measuring the maltose degradation activity based on the amount of glucose produced using maltose as a substrate. With the present enzyme, the degradation of maltose into glucose may take place by an -1,4-glucosyl transfer reaction, an -1,6-glucosyl transfer reaction and an -1,4-glucosidic bond hydrolysis reaction. Since almost the same catalytic site is considered to be involved in the -1,4-glucosyl transfer activity, the -1,6-glucosyl transfer activity and the -1,4-glucosidic bond hydrolysis activity, the enzyme is considered to exhibit similar reaction properties (the optimum pH and temperature and the pH and temperature stabilities) in either case. Therefore, the maltose degradation activity was used to evaluate the reaction properties.
[0099] A conventional enzyme having -1,6-glucosyl transfer activity, for example, dextrin dextranase derived from Gluconobacter oxydans, exhibits the maximum activity at a pH of 5.2 and a temperature of 38 C., and exhibits temperature stability at 45 C. or less. Further, dextran glucanase derived from a 598K strain belonging to Paenibacillus sp. exhibits temperature stability at 50 C. or less. Thus, the enzyme of the present invention exhibits high heat resistance and has stability suitable for use on an industrial scale as compared with such conventional enzymes having -1,6-glucosyl transfer activity.
[0100] The enzyme of the present invention can act on maltose, maltotriose, maltotetraose, maltopentaose, isomaltose, isomaltotriose and dextrin, without limitation thereto, as substrates.
[0101] The enzyme preparation of the present invention is an enzyme preparation for manufacturing -1,6-glucan from an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond, which comprises the enzyme having -1,6-glucosyl transfer activity according to the present invention. Specifically, the enzyme preparation of the present invention is brought in contact with an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond in a reaction solution under conditions suitable for exhibition of the -1,6-glucosyl transfer activity of the enzyme, so that glucose is transferred and extended by an -1,6 bond due to the -1,6-glucosyl transfer effect of the enzyme, with the result that -1,6-glucan is obtained.
[0102] Examples of the oligosaccharide and/or the polysaccharide having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond, which is the substrate of the present invention, can include maltooligosaccharides, isomaltooligosaccharides and dextrins. As used herein, the oligosaccharide means a saccharide in which 2 to 10 monosaccharide molecules bind to each other through glucosidic bonds, and the polysaccharide means a saccharide in which many, specifically, more than 10, monosaccharide molecules are polymerized by glucosidic bonds. The maltooligosaccharide is a saccharide having a degree of polymerization of 2 to 10 in which glucoses bind to each other through -1,4 bonds, and includes maltose, maltotriose, maltotetraose, maltopentaose and maltohexaose. The isomaltooligosaccharide is a saccharide having a degree of polymerization of 2 to 10 in which glucoses bind to each other through -1,4 bonds and -1,6 bonds and in which glucoses bind to each other only through -1,6 bonds, and includes isomaltose, panose, isomaltotriose, isomaltotetraose and isopanose. The dextrin is obtained by partially hydrolyzing starch, and is obtained as a mixture of saccharides having various degrees of polymerization in which glucoses bind to each other through -1,4 bonds and -1,6 bonds. In general, the dextrin is sometimes differentiated as follows: those having a dextrose equivalent (DE) of 10 or more and 20 or less is referred to as maltodextrins, and those having a DE of less than 10 is referred to simply as dextrins. However, the term dextrin is used herein to mean a product obtained by lowering the molecular weight of starch regardless of the DE range, and is used as a term including maltodextrin.
[0103] When the enzyme or enzyme preparation of the present invention or a composition which will be described later is used to produce -1,6-glucan, a partially degraded starch product can be utilized as a raw material. This is because the partially degraded starch product is composed mainly of dextrin and comprises a maltooligosaccharide and an isomaltooligosaccharide in a part thereof. The partially degraded starch product can be obtained by hydrolyzing starch with an acid or enzyme and optionally separating/purifying the resultant starch hydrolysate.
[0104] The -1,6-glucan produced by using the enzyme or enzyme preparation of the present invention or the composition which will be described later is an oligosaccharide or polysaccharide having a degree of polymerization of 2 or more, which is composed of glucose as a constituent sugar and has an -1,6-glucosidic bond. Briefly, the -1,6-glucan may have -1,2-, -1,3- and -1,4-glucosidic bonds in addition to the -1,6-glucosidic bond. The -1,6-glucan of the present invention will be described in detail later.
[0105] (Composition)
[0106] The present invention provides a composition for catalyzing an -1,6-glucosyl transfer reaction, comprising any one of proteins (a), (b) and (c):
[0107] (a) a protein consisting of an amino acid sequence of SEQ ID NO: 3;
[0108] (b) a protein consisting of an amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3; and
[0109] (c) a protein consisting of an amino acid sequence in which one or several amino acid(s) has/have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3.
[0110] The protein consisting of the amino acid sequence of SEQ ID NO: 3, which is contained in the composition, is similar to that described in the section (Enzyme and enzyme preparation). For example, the protein contained in the composition may be a protein consisting of an amino acid sequence having at least 70%, at least 80%, preferably at least 90%, especially preferably at least 95%, at least 96%, at least 97%, at least 98%, at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3, and exhibiting -1,6-glucosyl transfer reaction activity. Further, the protein contained in the composition may be a protein consisting of an amino acid sequence in which one or several amino acid(s) has/have been substituted, inserted, deleted and/or added in the amino acid sequence of SEQ ID NO: 3 and having -1,6-glucosyl transfer reaction activity.
[0111] The protein contained in the composition can be derived from Thermoanaerobacter siderophilus and have any one of the following properties:
[0112] (1) having -1,6-glucosyl transfer activity;
[0113] (2) having -1,4-glucosyl transfer activity;
[0114] (3) having a molecular weight, as measured by SDS-PAGE, of 80 to 90 kDa;
[0115] (4) having an optimum pH at 4.0 to 5.0;
[0116] (5) being stable within a pH range of 3.5 to 8.5;
[0117] (6) having an optimum temperature at 55 to 60 C.;
[0118] (7) exhibiting temperature stability at 60 C. or less; and
[0119] (8) acting on maltose, maltotriose, maltotetraose, maltopentaose, isomaltose, isomaltotriose and dextrin as substrates.
[0120] The composition can be used for manufacturing -1,6-glucan from an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond. The -1,6-glucan can be manufactured based on a method for manufacturing -1,6-glucan which will be described later.
[0121] The composition of the present invention can comprise additional components in addition to the protein, as long as the additional components do not inhibit an -1,6-glucosyl transfer reaction. These components may be those used in common enzyme compositions, such as a buffer, a stabilizer and an excipient. Such additional components are known from the prior art, and also well known to those skilled in the art. The form of the composition of the present invention is also not particularly limited, and can be solid (for example, powdery) or liquid. The composition of the present invention can be used, for example, by being added, in a solid or liquid form, to a substrate solution.
[0122] (Method for Manufacturing -1,6-Glucan)
[0123] The method for manufacturing -1,6-glucan according to the present invention comprises a reaction step of allowing the enzyme, enzyme preparation or composition of the present invention to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to obtain -1,6-glucan. Specifically, the enzyme, enzyme preparation or composition of the present invention is brought in contact with an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond in a reaction solution under conditions suitable for exhibition of the -1,6-glucosyl transfer activity of the enzyme, so that glucose is transferred and extended by an -1,6 bond due to the -1,6-glucosyl transfer effect of the enzyme, with the result that -1,6-glucan can be manufactured.
[0124] Examples of the oligosaccharide and/or the polysaccharide having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond, which are/is the substrate(s) used in the method for manufacturing -1,6-glucan of the present invention, can include maltooligosaccharides, isomaltooligosaccharides and dextrins. The maltooligosaccharide, isomaltooligosaccharide and dextrin are as explained above. The maltooligosaccharide and isomaltooligosaccharide may be those at a high-purity reagent level or those having low purity such as maltooligosaccharide syrup. Examples of the maltooligosaccharide which can be used in the present invention include, but are not limited to, Fujioligo #360 and Fujioligo #450 (Nihon Shokuhin Kako Co., Ltd.). Examples of the isomaltooligosaccharide which can be used in the present invention include, but are not limited to, Isomalto 500 and Isomalto 900 (Showa Sangyo Co., Ltd.). Examples of the dextrin which can be used in the present invention include, but are not limited to, Pinedex #1, Pinedex #2, Pinedex #4, Pinedex #6 and Pinedex #100 (Matsutani Chemical Industry Co., Ltd.). The substrate concentration can be within the range of 0.1 to 40% (w/w) in the reaction solution, but is not limited thereto. Since a higher substrate concentration provides a higher sugar transfer activity, the substrate concentration is preferably higher from the viewpoint of obtaining a higher-concentration -1,6-glucan. In general, the substrate concentration is preferably higher also from the viewpoint that the heat resistance of the enzyme is improved in the presence of the substrate.
[0125] The method for manufacturing -1,6-glucan according to the present invention can comprise, before the above-described reaction step, the step of hydrolyzing starch to obtain the oligosaccharide and/or the polysaccharide having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond, according to need. In this step, starch is hydrolyzed with an acid or enzyme by a conventional method, and the resultant starch hydrolysate is separated/purified, according to need, to obtain maltooligosaccharide, isomaltooligosaccharide and dextrin, which are the oligosaccharides and/or the polysaccharides having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond. In this step, the degree of hydrolysis of starch can appropriately be adjusted. The degree of hydrolysis can be expressed by the dextrose equivalent (DE). The DE of the starch hydrolysate in this step is not limited to, but is sufficiently 2 to 70, and can be adjusted to a DE suitable for the degree of polymerization of the -1,6-glucan which is desired to be manufactured in the subsequent reaction step.
[0126] Also, a short-chain-length amylose can be used as the starch hydrolysate.
[0127] By the manufacture method of the present invention, -1,6-glucan having a degree of polymerization of 2 to 30 can be manufactured. The -1,6-glucan having a degree of polymerization of 2 to 30 is manufactured as a mixture of saccharides containing a large amount of -1,6-glucan having a degree of polymerization of 2 to 30. The composition of this mixture varies depending on various reaction conditions, for example, the type and concentration of the substrate, the reaction time, whether any other enzyme is used or not, and, if such an enzyme is used, the type thereof. In a preferred embodiment, the composition of the -1,6-glucan manufactured in the present invention comprises saccharides having a DP of 3 to 30 in a proportion of 70% or more, and, especially, can comprise such saccharides in a proportion of 80% or more. In a preferred embodiment, the composition of the -1,6-glucan manufactured in the present invention can comprise saccharides having a DP of 10 to 30 in a proportion of 30% or more, especially 40% or more, further 50% or more.
[0128] The -1,6-glucan which can be manufactured in the present invention may be an isomaltooligosaccharide and/or an isomaltomegalosaccharide. The isomaltooligosaccharide is a saccharide with a degree of polymerization of 2 to 10 in which glucoses bind to each other in a binding mode including an -1,6 bond, and the isomaltomegalosaccharide is a saccharide with a degree of polymerization of 10 to 100 in which glucoses bind to each other in a binding mode including an -1,6 bond. In particular, the -1,6-glucan which can be manufactured in the present invention is preferably an isomaltooligosaccharide and/or an isomaltomegalosaccharide having a degree of polymerization of 2 to 30. The enzyme, enzyme preparation or composition of the present invention is used, and the type and concentration of the substrate, the reaction conditions and the like are adjusted, thereby making it possible to manufacture an isomaltooligosaccharide and/or an isomaltomegalosaccharide having the desired degree of polymerization.
[0129] In a preferred embodiment, -1,6-glucan having a high content proportion of saccharides having a degree of polymerization of 10 to 30 can be manufactured by the manufacture method of the present invention. The substrate to be used in this case is preferably a maltooligosaccharide or isomaltooligosaccharide having a degree of polymerization of 2 to 10, and, especially, is more preferably a maltooligosaccharide or isomaltooligosaccharide having a degree of polymerization of 5 to 10. In another preferred embodiment, -1,6-glucan having a high content proportion of saccharides having a degree of polymerization of 10 to 30 can be manufactured by using dextrin as the substrate in the manufacture method of the present invention. The substrate to be used in this case is preferably dextrin having a DE of around 3 to 30, more preferably dextrin having a DE of around 4 to 20. In still another preferred embodiment, -1,6-glucan having a high content proportion of saccharides having a degree of polymerization of 2 to 10 can be manufactured by the manufacture method of the present invention.
[0130] In the reaction step of the manufacture method according to the present invention, the enzyme, enzyme preparation or composition of the present invention and any other enzyme can be used in combination. Any other enzyme can be used in combination with the enzyme, enzyme preparation or composition of the present invention for the purpose, but which is not limited thereto, of increasing a partially degraded starch product which can serve as the substrate of the enzyme and enhancing the efficiency of glucose transfer and extension by the -1,6 bond and the yield of the -1,6-glucan.
[0131] Any other enzyme can be used for the purpose, but which is not limited thereto, of cleaving the -1,4 bond and/or the -1,6 bond of the oligosaccharide and/or the polysaccharide having the -1,4-glucosidic bond and/or the -1,6-glucosidic bond. Especially when the degree of degradation of the partially degraded starch product is low, any other enzyme can be used for the purpose of cleaving the -1,4 bond and/or the -1,6 bond of saccharides having a high degree of polymerization. Although the present invention is not limited by any specific theory, this is because the cleavage of the -1,4 bond and/or the -1,6 bond of the partially degraded starch product is considered to increase the partially degraded starch product which can serve as the substrate of the present enzyme, so that the glucose transfer and extension by an -1,6 bond due to the present enzyme effectively take place.
[0132] Examples of any other enzyme include, but are not limited to, -amylase, isoamylase and pullulanase. The origins of and preparation methods for -amylase, isoamylase and pullulanase used in the present invention are not particularly limited. The -amylase is an enzyme that cleaves an -1,4 bond of starch or the like to degrade the starch into a polysaccharide, an oligosaccharide or maltose. The isoamylase is an enzyme that cleaves an -1,6 bond of starch or the like, and the pullulanase is an enzyme that cleaves an -1,6 bond of pullulan (a polysaccharide containing repeats of an -1,4 bond, an -1,4 bond and an -1,6 bond). The enzyme of the present invention and any other enzyme as described above are allowed to act, in combination, on the partially degraded starch product, thereby making it possible to effectively obtain -1,6-glucan in a high yield.
[0133] The concentrations (number of units) of the enzyme of the present invention used in the above-described reaction step and, if combined, the -amylase, isoamylase and/or pullulanase in a reaction solution can appropriately be determined, for example, in consideration of the type (i.e., degree of degradation) of the partially degraded starch product which is the substrate and the concentration thereof in the reaction solution, and further the length of the reaction time. When other enzymes are used in combination, the concentration ratio between the enzyme of the present invention and the -amylase, isoamylase and pullulanase can also be appropriately determined according to the type of the partially degraded starch product which is the substrate, and the origins and performances of the respective enzymes.
[0134] The reaction temperature in the above-described reaction step is not particularly limited, as long as it falls within a temperature range in which the enzyme of the present invention acts stably. To enhance the -1,6-glucan synthesis efficiency, the reaction temperature is preferably set within a temperature range in which the enzyme of the present invention having -1,6-glucosyl transfer activity acts more efficiently. The enzyme having -1,6-glucosyl transfer activity according to the present invention is stable at least at a temperature of 60 C. or less, when the pH ranges from 3.5 to 8.0. Accordingly, the temperature of the reaction system in which the present enzyme is used can be set, for example, within a wide temperature range of 35 to 60 C. Although precise temperature management is sometimes difficult in the reaction system on an industrial scale, the present enzyme is advantageous in that it can be used stably within a wide temperature range.
[0135] The above-described reaction step can be carried out at a reaction temperature of 35 to 60 C., but the reaction temperature is preferably 40 to 60 C., more preferably 50 to 60 C. This is because the enzyme of the present invention exhibits high temperature stability, and exhibits high activity also within a temperature range of 50 to 60 C.
[0136] When any other enzyme is used in combination, the reaction temperature in the above-described reaction step has only to fall within a temperature range in which the enzyme of the present invention and -amylase, isoamylase and/or pullulanase act stably. Since the enzyme of the present invention is stable within a wide temperature range as described above, the temperature can often be set within a range in which the activities of all the enzymes used in the reaction system can be utilized sufficiently, in view of the temperatures at which any other enzyme to be used in combination is activated stably.
[0137] The reaction temperature does not have to be constant through the entire reaction time, and can appropriately be adjusted as follows. In the case where it is desired to enhance the activity of any other enzyme to be used in combination in the initial stage of the reaction time, the temperature in the initial stage of the reaction is set within a temperature range in which the activity of the enzyme increases. In the medium and later stages of the reaction time, the temperature is set within a temperature range in which the activity of the enzyme of the present invention increases.
[0138] The reaction time in the above-described reaction step can appropriately be determined, for example, in consideration of the reaction temperature, the substrate concentration, and, when any other enzyme is used in combination, the activity of the enzyme used. The enzyme, enzyme preparation or composition of the present invention sometimes exhibits the -1,4-glucosyl transfer activity more strongly than the -1,6-glucosyl transfer activity in the initial stage of the reaction (for example, the reaction time is 15 minutes to about 1 hour under the conditions described in the Examples in the present specification). On the other hand, the enzyme, enzyme preparation or composition of the present invention sometimes exhibits the -1,6-glucosyl transfer activity strongly in the medium stage of the reaction (for example, the reaction time is 1 hour or more under the conditions described in the Examples in the present specification). On the other hand, the enzyme, enzyme preparation or composition of the present invention sometimes exhibits the hydrolysis activity strongly in the later stage of the reaction (for example, the reaction time is 6 hour or more under the conditions described in the Examples in the present specification). Based on the conventional techniques in the art, a reaction time suitable for manufacturing -1,6-glucan can appropriately be determined.
[0139] An aqueous solution containing -1,6-glucan is obtained through the reaction in the above-described reaction step. From this aqueous solution, -1,6-glucan can be purified by using, for example, a precipitation method by an organic solvent using ethanol or the like, a chromatographic fractionation method, or treatment with an ultrafiltration membrane. According to these methods, -1,6-glucan can be purified more efficiently through a single operation or a combination of some operations.
[0140] The method for manufacturing a food product, a feed, a bait, a cosmetic product or a pharmaceutical product according to the present invention can comprise the steps of: allowing the enzyme having -1,6-glucosyl transfer activity according to the present invention to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to manufacture -1,6-glucan, and using the -1,6-glucan manufactured in the above-described step to obtain a food product, a feed, a bait, a cosmetic product or a pharmaceutical product.
[0141] The step of allowing the enzyme having -1,6-glucosyl transfer activity according to the present invention to act on an oligosaccharide and/or a polysaccharide having an -1,4-glucosidic bond and/or an -1,6-glucosidic bond to manufacture -1,6-glucan, thereby obtaining the -1,6-glucan can be carried out based on the method for manufacturing -1,6-glucan described above.
[0142] In the step of using the -1,6-glucan manufactured in the above-described step to obtain a food product, a feed, a bait, a cosmetic product or a pharmaceutical product, it is possible to use the -1,6-glucan of the present invention as one of raw materials to manufacture a food product, a feed, a bait, a cosmetic product or a pharmaceutical product, or to prepare the -1,6-glucan itself into an appropriate form (powder, liquid or the like) to provide it as a food product, a feed, a bait, a cosmetic product or a pharmaceutical product.
[0143] The method for manufacturing a glycoside according to the present invention is a method for manufacturing a glycoside, comprising the step of allowing the enzyme, enzyme preparation or composition of the present invention to act on a sugar acceptor and a sugar donor. A microorganism which expresses the enzyme of the present invention may be allowed to act on the sugar acceptor and the sugar donor. The present enzyme can be allowed to act on a solution containing the sugar donor and the sugar acceptor to prepare a glycoside in which at least one glycosyl group has been transferred to the sugar acceptor. The method for manufacturing a glycoside according to the present invention can be carried out while the reaction temperature and pH are appropriately set based on the method for manufacturing -1,6-glucan described above. In the method for manufacturing a glycoside according to the present invention, the reaction temperature can be adjusted according to the properties of the sugar acceptor. The present enzyme can be used stably within a wide temperature range, and thus can be used to manufacture various glycoside compounds.
[0144] The sugar donor may be any compound as long as it is a compound from which glycosyl is transferred by the enzyme, enzyme preparation or composition of the present invention. More specifically, maltooligosaccharides are indicated as the sugar donor, and maltose and maltotriose are preferred.
[0145] The glycoside manufactured by the method of the present invention can have a glycosidic bond between its sugar moiety and a binding site of non-sugar compound.
[0146] The sugar acceptor may be any compound as long as it is a compound having a hydroxyl group to which a glycosyl group is transferred by the enzyme, enzyme preparation or composition of the present invention. Specifically, alcohols (for example, ethanol, 1-propanol, 2-propanol, L-menthol, 1-butanol and 2-butanol); polyols (for example, glycerol and propylene glycol); vitamins (for example, L-ascorbic acid, retinol, inositol and tocopherol); flavonoids (for example, quercetin, catechin, rutin and hesperidin); phenol derivatives (for example, hydroquinone), and the like can be used. The sugar acceptor is not particularly limited as long as it is a compound having a hydroxyl group. When the sugar acceptor is easily oxidized, it is also effective to preliminarily add a reducing agent to the reaction system, according to need.
[0147] The glycoside manufactured by using the enzyme, enzyme preparation or composition of the present invention can be used as one of raw materials for a food product, a feed, a bait, a cosmetic product or a pharmaceutical product, and can also be provided, as it is, as a food product, a feed, a bait, a cosmetic product or a pharmaceutical product. The glycoside manufactured by using the enzyme, enzyme preparation or composition of the present invention is easily dissolved in water, can exist as a solid powder at room temperature, and further is stable in quality, and thus can be widely utilized in foods and beverages, pharmaceutical products, cosmetic products and the like.
[0148] Examples of the food product to be manufactured by the method for manufacturing a food product according to the present invention include, but are not limited to: various carbohydrates (bread, noodles, boiled rice, and rice cakes); various Japanese-style confectionery (rice crackers, cubic rice crackers, millet-and-rice cakes, Turkish delight (gyuhi), rice cakes, buns with a beam jam filling, bean-jam pancakes, sweet rice jelly, sweet bean paste, sweet jelly of adzuki beans, soft adzuki-bean jelly, Japanese agar jelly (kingyoku), sponge cakes called Castella, and hard candies); various Western-style confectionery (bread, biscuits, crackers, cookies, pies, doughnuts, steamed cakes, puddings, jelly, mousse, bavarois, custard cream, cream puff, waffles, sponge cakes, chocolates, chewing gums, caramels, nougat, candies, and syrups); various ices (ice cream, sherbet, gelato, and shaved ice); various pasty foods (flour paste, peanut paste, margarine, and fruit paste); various beverages (fruit juice-containing beverages, fruit juice, vegetable juice, cider, ginger ale, isotonic beverages, amino acid beverages, jelly beverages, coffee beverages, green tea, black tea, oolong tea, barley tea, milk beverages, lactic acid bacteria beverages, cocoa, beer, low-malt beer, quasi-beer, non-alcoholic beverages, beer-flavored beverages, liqueur, shochu-based beverages, refined sake, fruit liquor, distilled liquor, nutritional drinks, healthy beverages, and powdered drinks); fruit and vegetable processed products (jams, marmalades, fruit and vegetable in syrup, candied fruits, and pickles); various dairy products (cheese, yogurt, butter, condensed milk, and dry milk powder); powdered foods (powdered soup, powdered mousse, powdered jelly, and powdered sweeteners); nutritional foods; diet foods;
[0149] nutritional foods for sports; fluid diets; semi-solid fluid diets; care foods; and swallowing food.
[0150] Examples of the feed and bait to be manufactured by the method for manufacturing a food product according to the present invention include, but are not limited to, feeds and baits for livestock, poultry, fish and shellfish, and insects (honeybee, silkworm, etc.). Their form includes a powder, a pellet, a tablet, a paste bait and a capsule.
[0151] Examples of the cosmetic product to be manufactured by the method for manufacturing a food product according to the present invention include, but are not limited to, moisturizers and cosmetic agents. Their form includes a milky lotion, a cream and an emulsion.
[0152] Examples of the pharmaceutical product to be manufactured by the method for manufacturing a food product according to the present invention include, but are not limited to, antiobesity agents and blood glucose level elevation inhibitors. Their form includes a tablet, a powder agent, a liquid agent and a capsule agent.
[0153] <Manufacture of Enzyme>
[0154] The enzyme of the present invention is not particularly limited, and may be a protein synthesized by chemical synthesis or a recombinant protein prepared by a gene recombination technique. Hereinafter, the case where a recombinant protein is prepared will be described.
[0155] The enzyme of the present invention having an amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3 can be prepared by a gene engineering technique. For example, the gene encoding the amino acid sequence of SEQ ID NO: 3 can produced by transforming a host cell with a DNA molecule (especially, in a form of being inserted into an expression vector) which can be replicated in the host cell or which is incorporated into a chromosome and comprises the gene in an expressible state, and culturing the host cell. This DNA molecule can be obtained by incorporating, into a vector molecule, a DNA fragment encoding the amino acid sequence of SEQ ID NO: 3 or the amino acid sequence having at least 90% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 3. According to a preferred embodiment of the present invention, this vector is a plasmid. The production of the DNA molecule in the present invention can be carried out in accordance with the method described in Molecular Cloning: A Laboratory Manual.
[0156] The vector which can be utilized in the present invention can appropriately be selected from a virus, a plasmid, a cosmid vector and the like, in consideration of the type of the host cell used. For example, the vector includes, but is not limited to, pJEXOPT2 (see JP 2009-17841 A) and pHT plasmids when the host cell is Bacillus subtilis; -phage bacteriophage, pET, pUC, pCold and pGEX plasmids when the host cell is E. coli; YEp, YCp and YIP vectors when the host cell is yeast; or pLeu4, pPPLeu4 and pJPLeu types (which are described in JP H4-218382 A). The plasmids may each contain a marker for selecting a transformant, and usable selection markers can be, but are not limited to, drug resistance marker and auxotrophic marker genes.
[0157] Further, the expression vector which can be used in the present invention can have DNA sequences necessary for expression of the enzyme gene, for example, a transcriptional regulation signal such as a promoter, a terminator, a ribosome-binding site, and a transcription termination signal, and a translation regulation signal. Promoters of subtilisin and SPAC can be used in Bacillus subtilis, and promoters of alcohol dehydrogenase (ADH), acid phosphatase (PHO), galactose gene (GAL) and glyceraldehyde-3-phosphate dehydrogenase gene (GAP) can be used in yeast, though the promoter is not limited thereto. The signal peptide is preferably used as having the advantage of facilitating purification from the culture supernatant. The signal peptide can be replaced with one derived from Bacillus subtilis or yeast (for example, invertase signal, acid phosphatase signal or -factor signal). Also, contrivance to increase the expression efficiency, e.g., simultaneous expression of a molecule chaperon using a cspA promoter or the like in addition to commonly and conventionally used lac promoter and T7 promoter, can be applied to E. coli.
[0158] The transformed host cell can be cultured by a common method for the host cell used. Normally, the enzyme is produced and accumulated in an intracellular or extracellular culture by culturing the host cell for around 1 to 4 day(s). As for culture conditions (medium, pH, temperature, etc.), a common temperature is, for example, 25 to 37 C. for bacteria, 25 to 30 C. for yeast, and around 37 C. for eukaryotic cells. As for the culture conditions, reference can be made to Gene Expression Experiment Manual (Kodansha Ltd.) and the like.
[0159] As the host cell, there can be used Rhizopus niveus, Rhizopus delemar and higher eukaryotes (for example, CHO cells), in addition to bacteria such as E. coli and Bacillus subtilis and yeasts such as Candida utilis, Saccaromyces cerevisiae and Pichia pastoris. As Bacillus subtilis, a microorganism belonging to the genus Bacillus is preferably used. The genus Bacillus is known to include strains secreting a protein extracellularly (for example, Bacillus subtilis). Also, strains hardly secreting protease are known, and it is also preferred to use such a strain as the host. In the present invention, the host cell is preferably yeast, a filamentous fungus or a bacterium, more preferably a bacterium, especially preferably E. coli or Bacillus subtilis. As indicated in the Examples which will be given below, when this gene was expressed using E. coli BL21 and Bacillus subtilis ISW1214 as the host, the enzyme activity was found in the purified protein in the case of E. coli BL21 and in the culture supernatant in the case of Bacillus subtilis ISW1214.
[0160] The recombinant enzyme produced by the transformant can be isolated/purified by an appropriate combination of known separation methods and purification methods. These separation/purification methods include methods using a difference in solubility, such as salt precipitation and solvent precipitation; methods using a difference in molecular weight, such as dialysis, ultrafiltration, gel filtration and SDS-polyacryl electrophoresis; methods using a difference in electric charge such as ion exchange chromatography; methods using a difference in hydrophobicity, such as hydrophobic chromatography and reversed phase chromatography; and, further, methods using a difference in isoelectric point, such as isoelectric focusing; and, additionally, affinity chromatography. In addition to the production method described in the Examples, as for common separation/purification methods, reference can be made, for example, to Theory and Practice on Enzymes and Other Proteins (Nankodo Co., Ltd.).
EXAMPLES
[0161] Hereinafter, the present invention will be described in more detail by way of the following examples, but is not limited thereto. Unless otherwise noted herein, the units % and part are on a mass basis, and numerical ranges are indicated on the premise that their end points are included therein. Unless otherwise noted herein, operation procedures were carried out in accordance with the method described in Molecular Cloning: A Laboratory Manual (Sambrook, Maniatis et al., Cold Spring Harbour Laboratory Press (1989)).
Example 1: Preparation of Enzyme
1. Construction of Expression Plasmid
[0162] Through search for novel enzymes for various microorganisms, a hypothetical protein derived from Thermoanaerobacter siderophilus (Accession number: WP_006569624.1) was selected, and the function thereof was analyzed. The amino acid sequence (SEQ ID NO: 1) and base sequence (SEQ ID NO: 2) of this hypothetical protein are shown in
[0163] In order to express a protein consisting of an amino acid sequence (SEQ ID NO: 3) in which the 1.sup.st to 752.sup.th amino acids from the N terminal had been deleted in the amino acid sequence of SEQ ID NO: 1, an expression plasmid was constructed using a base sequence of SEQ ID NO: 4 according to the following procedures.
[0164] The target gene (base sequence of SEQ ID NO: 4) was PCR-amplified using a primer added with sequences of 15 bases homologous to both terminals of a vector pET32b (Novagen, Germany). The PCR conditions are indicated below. The total amount of a reaction solution for the PCR amplification was 50 L.
TABLE-US-00001 5 PS buffer (Takara Bio Inc.) 10 L 2 mM dNTP mix (Takara Bio Inc.) 2 L 20 M primer (Ts_p20283242_R) 1 L 20 M primer (T_p32_d1-752S) 1 L 100 ng/L template 1 L Primestar HS DNA Polymerase (Takara 0.2 L Bio Inc.) H.sub.2O 34.8 L
[0165] The primers used are indicated in Table 1.
TABLE-US-00002 TABLE1 Primer Sequence(5.fwdarw.3) T_p32_d1-752S TTCTGGTCTGGTGCCACGCGGTTCTGGTCAATA (Sense) TGAAGCGGAATA(SEQIDNO:5) T_p32_d1-752R CGAGTGCGGCCGCAAGCTTGTCGACTTAGAAAT (Antisense) CTGGCAAACGCG(SEQIDNO:6)
[0166] A program for the PCR amplification reaction involved retaining the reaction solution at 96 C. for 1 minute, and then performing a cycle of 96 C. for 10 seconds->55 C. for 30 seconds->72 C. for 3 minutes 25 times. The resultant PCR product was subjected to agarose gel electrophoresis, and a band corresponding to the amplified fragment (2,418 bp) was cut from the gel, and extracted and purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, Wis., USA).
[0167] In order to prepare a linearized plasmid used in an In-fusion (registered trademark) cloning reaction, pET32b was used as a template to perform PCR using primers indicated in Table 2.
TABLE-US-00003 TABLE2 Primer Sequence(5.fwdarw.3) Direction pET32b_s GTCGACAAGCTTGCGGCCGC Sense (SEQIDNO:7) pET32b_r AGAACCGCGTGGCACCAGAC Antisense (SEQIDNO:8)
[0168] The composition of the reaction solution for the PCR amplification was identical with that of the reaction solution for the amplification of the target gene, except the primers used. A program for the PCR amplification reaction involved retaining the reaction solution at 96 C. for 1 minute, and then performing a cycle of 96 C. for 10 seconds->55 C. for 30 seconds->72 C. for 4 minutes 25 times. The amplified fragment was recovered by ethanol precipitation, and then treated with a restriction enzyme Dpnl to digest the vector DNA. This product was subjected to agarose gel electrophoresis, and a band corresponding to the target DNA fragment (5,900 bp) was cut, and extracted and purified according to the same procedures as is the case with the target gene. The amplified target gene and vector pET32b were ligated using the In-Fusion HD Cloning Kit (Takara Bio Inc.). The ligation reaction was performed by retaining them at 50 C. for 20 minutes.
[0169] Mixed were 2.5 L of the reaction solution containing the ligation reaction product and 50 L of E. coli DH5 Competent Cells, and the solution was allowed to stand on ice for 1 hour, subjected to heat shock at 42 C. for 60 seconds, and then retained on ice for 3 minutes. To the mixture, 900 L of an SOC medium (20 g/mL triptone, 5 mg/mL yeast extract, 8.6 mM NaCl, 2.5 mM KCl, 20 mM magnesium sulfate and 20 mM D-glucose) was added for shaking culture at 37 C. for 30 minutes. Bacterial cells were recovered by centrifugation (6,000g, 4 C., 10 minutes), and cultured at 37 C. overnight in an LB agar medium containing 100 g/mL ampicillin (10 mg/mL triptone, 5 mg/mL yeast extract, 1% NaCl and 1.5 w/v % agar). The resultant colonies were suspended in 2 mL of an LB liquid medium containing 100 g/mL ampicillin (1% triptone, 0.5% yeast extract and 0.5% sodium chloride), and cultured with shaking overnight. A plasmid DNA was extracted from the resultant bacterial cells by the alkaline-SDS method (Birnboim and Doly, 1979). The resultant plasmid was defined as a mutant enzyme (1-752)-E. coli expression plasmid.
[0170] 2. Preparation of Recombinant Enzyme
[0171] The mutant enzyme (1-752)-E. coli expression plasmid was introduced into E. coli BL 21 (DE: 3), inoculated into 30 mL of an LB medium containing 100 g/mL ampicillin, and cultured with shaking at 37 C. overnight. This culture solution (30 mL) was subcultured in 1 L of the same medium, and cultured under the same conditions until the turbidity (600 nm) reached 0.5. Added was 0.1 M isopropyl -D-1-thiogalactoside (IPTG) to attain a final concentration of 0.1 mM, and induction culture was started. After induction, shaking culture was performed at a culture temperature of 18 C. for 22 hours. Centrifugation (6,000g, 4 C., 10 minutes) was performed to recover bacterial cells. The bacterial cells were suspended in a 10 mM sodium phosphate buffer (pH: 8.0), and crushed ultrasonically. Ultrasonication was performed three times for 1 minute each, under the conditions of duty cycle: 50% and output control: 3, using Sonifier 250 (Branson, Danbury, Conn.). Each ultrasonication was followed by 1-minute ice cooling. Centrifugation (12,000g, 10 minutes, 4 C.) was performed twice, and the resultant extract liquid was used as a crude enzyme liquid. The crude enzyme liquid was obtained in an amount of 34 mL. Ni.sup.+2 was chelated with 0.5 M NiSO.sub.4 in advance, and the crude enzyme liquid was subjected to an Ni-chelating Sepharose Fast Flow column (1.0 i.d.7 cm, 5.5 mL; GE Healthcare Bioscience, Uppsala, Sweden) equilibrated with a 10 mM sodium phosphate buffer (pH: 8.0) containing 0.5 M NaCl. A non-adsorbed protein was eluted with a 10 mM sodium phosphate buffer (pH: 8.0), and fractionated into 60 fractions in each amount of 15 mL. An adsorbed protein was eluted with an imidazole linear concentration gradient (30 to 500 mM, 400 mL), and fractionated into 80 fractions in each amount of 5 mL. Active fractions 88 to 101 were recovered. The recovered fractions were dialyzed, four times, against 1 L of a 10 mM sodium phosphate buffer (pH: 7.0). UC16-32-100 (Sanko Junyaku Co., Ltd., Tokyo) was used as a dialysis membrane. The sample after the dialysis was concentrated using Vivaspin 20 (MWCO: 30,000) (Sartorius, Goettingen, Germany). This product was a purified enzyme of the mutant enzyme (1-752), which was stored at 4 C.
Example 2: Extracellular Expression Using Bacillus subtilis as Host
1. Construction of Expression Plasmid
[0172] An expression plasmid for producing the mutant enzyme (1-752) by Bacillus subtilis was constructed. Firstly, the (1-752)-E. coli expression plasmid constructed in Example 1 was used as a template to PCR-amplify the target gene using a primer added with base sequences homologous to the terminals of the vector for the sense chain amplification and a primer added with a part of the His-Tag sequence for the antisense chain amplification. The PCR conditions are indicated below. The total amount of a reaction solution for the PCR amplification was 50 L.
TABLE-US-00004 5 Primestar GXL buffer (Takara Bio Inc.) 10 L 2.5 mM dNTPs mix (Takara Bio Inc.) 4 L 10 M primer (TSDD-F) 1 L 10 M primer (TSDD-R) 1 L 1 ng/L template 1 L Primestar GXL DNA Polymerase (Takara Bio Inc.) 1 L H.sub.2O 32 L
[0173] The primers used are indicated in Table 3.
TABLE-US-00005 TABLE3 Primer Sequence(5.fwdarw.3) TSDD-F ACTGCTCTTGGATCCGGTCAATATGAAGCGGAATAC (Sense) (SEQIDNO:9) TSDD-R ATGGTGATGGTGGTGGAAATCTGGCAAACGCG (Antisense) (SEQIDNO:10)
[0174] A program for the PCR amplification reaction involved retaining the reaction solution at 96 C. for 1 minute, and then performing a cycle of 98 C. for 10 seconds->60 C. for 15 seconds->68 C. for 3 minutes 30 times. The resultant PCR product was subjected to agarose gel electrophoresis, and a band corresponding to the amplified fragment (2,451 bp) was cut from the gel, and extracted and purified using the illustraTMGFX PCR DNA and Gel Band Purification Kit (GE).
[0175] In order to prepare a linearized plasmid used in an In-fusion (registered trademark) cloning reaction, a plasmid obtained by modifying the vector pJEXOPT2 (see JP 2009-17841 A and JP 2009-17842 A) so as to optimize it for the present example was used as a template to perform PCR using primers indicated in Table 4. A primer added with His-Tag sequences at the terminals of the vector was used for the sense chain amplification, and a primer set so as to amplify the antisense chain from the terminals of the vector was used for the antisense chain amplification.
TABLE-US-00006 TABLE4 Primer Sequence(5.fwdarw.3) pJEXOPT2-F CACCACCATCACCATCATTGAGTCGACCTGCAGATC (Sense) TCTAGA(SEQIDNO:11) pJEXOPT2-R GGATCCAAGAGCAGTGGC (Antisense) (SEQIDNO:12)
[0176] The composition of the reaction solution for the PCR amplification was identical with that of the reaction solution for the amplification of the target gene, except the primers used. A program for the PCR amplification reaction involved retaining the reaction solution at 96 C. for 1 minute, and then performing a cycle of 98 C. for 10 seconds->60 C. for 15 seconds->68 C. for 7 minutes 30 times. The amplification product was subjected to agarose gel electrophoresis, and a band corresponding to the target DNA fragment (6,900 bp) was cut, and extracted and purified using Wizard SV Gel and PCR Clean-Up System. The amplified target gene and the amplified fragment of the vector pJEXOPT2 were ligated using the In-Fusion HD Cloning Kit (Takara Bio Inc.). The ligation reaction was performed by retaining them at 50 C. for 15 minutes.
[0177] The ligation reaction solution (2.5 L) was used for transformation of E. coli DH5, and a plasmid DNA was prepared from this culture solution using the Illustra plasmidPrep Mini Spin Kit (GE). The resultant plasmid was defined as a mutant enzyme (1-752)-Bacillus subtilis expression plasmid.
[0178] 2. Preparation of Recombinant Enzyme
[0179] The mutant enzyme (1-752)-Bacillus subtilis expression plasmid was introduced into Bacillus subtilis ISW1214 (Takara Bio Inc.) converted in the form of a protoplast, and cultured at 30 C. for 2 days in a regeneration agar medium containing 7.5 g/mL tetracycline (composition: 8.1% sodium succinate, 1% agar, 0.5% casamino acid, 0.5% yeast extract, 0.15% potassium dihydrogen phosphate, 0.35% dipotassium hydrogen phosphate, 0.5% glucose, 0.4% magnesium chloride, 0.01% bovine serum albumin, 0.001% methionine, and 0.001% leucine). The resultant colonies were cultured in a pre-culture medium and, subsequently, a main culture medium (cultured in a manner as described in JP 2009-17841 A and JP 2009-17842 A, but the media used each had a modified composition). Centrifugation (15,000g, 4 C., 5 minutes) was performed, and a solution obtained by filtering the supernatant through a 0.45-m filter (Merk) was used as an enzyme solution of the mutant enzyme (1-752). The enzyme solution was subjected to SDS-PAGE to confirm the production of a recombinant enzyme. A dark band was observed at 80 to 90 kDa close to a theoretical molecular weight size (about 91.5 kDa) of the mutant enzyme (1-752), and it was confirmed that the mutant enzyme (1-752) was secreted in the culture supernatant (
Example 3: Activity Measurement
[0180] In order to measure the activity of the purified enzyme (1-752) obtained in Example 1 (Present Enzyme 1), the maltose degradation activity was measured.
[0181] The maltose degradation activity was measured based on the amount of glucose produced. The amount of glucose was quantified by the glucose oxidase/peroxidase method (Miwa et al., 1972). For dilution of the enzyme, a 10 mM sodium acetate buffer (pH: 4.5) containing 1 mg/mL BSA was used. The composition of the enzyme reaction solution (total amount: 50 L) is as follows.
TABLE-US-00007 100 mM sodium acetate buffer (pH 4.5) 20 L 50 mM maltose 20 L Purified enzyme (1-752) solution 10 L
[0182] The enzyme reaction solution was retained at 37 C. for 10 minutes to cause a reaction. After the elapse of 10 minutes of the reaction, the reaction was stopped by mixing 50 L of the enzyme reaction solution and a 2M tris-hydrochloric acid buffer (pH: 7.0). To the enzyme reaction solution subjected to the reaction stopping treatment, 20 L of a glucose quantification reagent (Wako Pure Chemical Industries, Ltd., Glucose C-II) was added, and the solution was retained at 37 C. for 30 minutes. Thereafter, the absorbance (wavelength: 505 nm) was measured with an ultraviolet visible spectrophotometer, JASCO V-630 BIO Spectrophotometer (JASCO Corporation, Tokyo). Based on a calibration curve prepared with D-glucose (NACALAI TESQUE, INC., Kyoto) having a concentration of 0 to 0.5 mM, the glucose concentration of the enzyme reaction solution was determined. The amount of enzyme producing 1 mol glucose per minute, under the conditions of the present example, was defined as 1 U of the maltose degradation activity.
Example 4: Physicochemical Properties of Enzyme (pH and Temperature)
[0183] The physicochemical properties of the present enzyme were confirmed by measuring the maltose degradation activity. The enzyme used was the purified enzyme (1-752) (Present Enzyme 1) obtained in Example 1.
1. Optimum pH
[0184] The maltose degradation activity of the preset enzyme was measured in a buffer having a pH of 3.0 to 11.0. The maltose degradation activity was measured in accordance with the method described in Example 3: Activity measurement. However, a 40 mM Britton-Robinson (BR) buffer (pH: 3.0 to 11.0) was used as the reaction buffer. The present enzyme exhibited the maximum activity at a pH of 4.5, exhibited an activity of at least 90% relative to the maximum activity at a pH of 3.5, 4.0 and 5.0, and exhibited an activity of at least 98% relative thereto at a pH of 4.0 to 5.0 (
[0185] 2. pH Stability
[0186] Mixed were 75 L of a 0.1 M BR buffer at each pH (pH: 3.0 to 11.0) and 75 L of 4.08 g/mL the present enzyme to obtain a diluted enzyme solution, which was retained at 4 C. for 24 hours. The diluted enzyme solution after retention for 24 hours was used to measure the activity in accordance with the method described in Example 3: Activity measurement. The proportion (%) of the activity after retention (residual activity), relative to the activity before retention in the 0.1 M BR buffer at each pH, was calculated. When the pH range in which the present enzyme exhibited a residual activity of 85% or more was determined as the stable pH range, the stable pH range was 3.5 to 8.5 (
[0187] 3. Optimum Temperature
[0188] The enzyme reaction temperature was set to 30, 37, 45, 50, 55, 60, 65, 70, 75 or 80 C., and the maltose degradation activity was measured at each enzyme reaction temperature in accordance with the method described in Example 3: Activity measurement. The present enzyme exhibited the maximum activity at a temperature of 60 C., and exhibited an activity of 80% or more relative to the maximum activity within a temperature range of 55 to 60 C. (
[0189] 4. Temperature Stability
[0190] Mixed were 20 L of a 0.1 M sodium acetate buffer (pH: 4.5) and 10 L of 10.2 g/mL the present enzyme, and the solution was retained at 30, 37, 45, 50, 55, 60, 65, 70, 75 or 80 C. for 15 minutes. The activity of the present enzyme after retention at each temperature was measured in accordance with the method described in Example 3: Activity measurement. The proportion (%) of the activity after retention (residual activity), relative to the activity before retention at each temperature, was calculated. When the present enzyme exhibited a residual activity of 90% or more, it was determined to be stable at the temperature. The present enzyme was stable at a temperature of 60 C. or less (
Example 5: HPAEC-PAD Analysis of Enzyme Reaction Product
[0191] Reaction products of substrates by the mutant enzyme (1-752) were analyzed by HPAEC-PAD (High performance anion-exchange chromatography with pulsed amperometric detection; anion chromatography with a pulsed amperometric detector). The substrates used were maltose (G2), maltotriose (G3), maltotetraose (G4), maltopentaose (G5), isomaltose (IG2), and isomaltotriose (IG3).
[0192] A reaction solution (1 mL) containing the enzyme (1-752) (Present Enzyme 1) obtained in Example 1, 10 mM each substrate and a 42 mM sodium acetate buffer (pH: 4.5) was retained at 37 C. to cause a reaction. At 3, 6, 9 and 15 minutes after the beginning of the reaction, 180 L was collected from the reaction solution. With the collected 180-L reaction solution, 20 L of 1 mM inositol (internal standard) was mixed. Then, the reaction solution was thermally treated at 100 C. for 3 minutes, and the reaction was stopped. For each substrate, four 200-L reaction solutions reacted for 3 to 15 minutes were obtained. For dilution of the enzyme, a 10 mM sodium acetate buffer (pH: 4.5) containing 1 mg/mL BSA was used. The enzyme concentration used in the reaction varies depending on the substrate. The enzyme concentrations are indicated in Table 5.
TABLE-US-00008 TABLE 5 Enzyme concentration NaOH concentration of eluent Maltose 5.41 nM 400 mM Maltotriose 0.867 nM 400 mM Maltotetraose 0.867 nM 400 mM Maltopentaose 0.867 nM 640 mM Isomaltose 43.3 nM 160 mM Isomaltotriose 4.33 nM 160 mM
[0193] Each of the 200-L reaction solutions was desalted with Amberlite MB4 (ORGANO CORPORATION, Tokyo), filtered using a 0.45-m disposable membrane filter unit (Advantech Co., Ltd., Tokyo), and used as an analytical sample. The analytical sample (10 L) was injected into a column. CarboPac PAI (0.4 cm i.d.25 cm; Dionex) was used as the column. The NaOH concentrations of the respective eluents are indicated in Table 5. A saccharide analyzer (HPAEC-PAD, manufactured by Dionex) was used to determine the concentrations of the initial transfer products of the respective substrates. As the concentrations of the initial transfer products, for example, in the reaction using maltopentaose as the substrate, the maltohexaose concentration was calculated based on the standard curve (10 to 100 M). Inositol (100 M) was used as the internal standard and used for area correction.
[0194] When maltose (G2) was used as the substrate, glucose (Glc), panose (Pan) and maltotriose (G3) were produced by the present enzyme (
[0195] When maltotriose (G3) was used as the substrate, glucose (Glc), maltotetraose (G4) and 6.sup.3-O--D-glucosylmaltotriose (B4) were produced by the present enzyme (
[0196] When maltotetraose (G4) was used as the substrate, maltotriose (G3) and maltopentaose (G5) were produced by the present enzyme (
[0197] When maltopentaose (G5) was used as the substrate, maltotetraose (G4) and maltohexaose (G6) were produced by the present enzyme (
[0198] When isomaltose (IG2) was used as the substrate, glucose (Glc), isomaltotriose (IG3) and isopanose (IPan) were produced by the present enzyme (
[0199] When isomaltotriose (IG3) was used as the substrate, isomaltose (IG2) and isomaltotetraose (IG4) were produced by the present enzyme (
[0200] Through the experiment in the reaction time of up to 15 minutes, it was demonstrated that the present enzyme mainly catalyzes the -1,6 transfer reaction in some cases and mainly catalyzes the -1,4 transfer reaction in the other cases, depending on the substrate used. For example, under the conditions of Example 5, the present enzyme was understood to mainly catalyze the -1,4 transfer reaction when maltooligosaccharides G3, G4 and G5 were used as the substrates, but to catalyze the -1,6 transfer reaction more than the -1,4 transfer reaction when maltose (G2) and isomaltooligosaccharides were used as the substrate, in a short reaction time, i.e., around 15 minutes.
Example 6: Analysis of Change in Enzyme Reaction Over Time
[0201] Reaction products of substrates by the enzyme (1-752) were analyzed over time by TLC (thin-layer chromatography).
[0202] Firstly, the enzyme (1-752) (Present Enzyme 1) obtained in Example 1 was allowed to act on the substrate maltopentaose (G5). Specifically, 1 mL of a reaction solution having the following composition was retained at 37 C. to cause a reaction. For dilution of the enzyme, a 10 mM sodium acetate buffer (pH: 4.5) containing 1 mg/mL BSA was used.
[0203] Composition of Reaction Solution
TABLE-US-00009 30 mM Maltopentaose 500 L (final concentration: 15 mM) Present enzyme solution 400 L (final concentration: 36.7 g/mL) 100 mM sodium acetate 100 L (final concentration: 10 mM) buffer (pH: 4.5)
[0204] At 1, 6, 24, 48 and 96 hours after the beginning of the reaction, 100 L was collected from the reaction solution and thermally treated at 100 C. for 3 minutes, and the reaction was stopped.
[0205] Next, an equal amount of Rhizopus niveus-derived glucoamylase (SEIKAGAKU CORPORATION) (5 U/mL, dissolved in a 0.1 M sodium acetate buffer (pH: 5.0)) was added to the reaction solutions reacted with the present enzyme for a period of 1 to 96 hours, and the reaction solutions were retained at 50 C. for 30 minutes.
[0206] The glucoamylase-treated reaction solutions and the untreated reaction solutions were analyzed by TLC. A Silica Gel 60F254 Aluminum Sheet (Merck, Darmstadt, Germany) was used as the TLC plate. As samples, 1 L, of the respective reaction solutions were subjected to TLC. A development solvent composed of nitroethane:nitromethane:ethanol:water:1-propanol=1:1:3.5:4:5.5 (v/v/v/v/v) was used to perform development twice. After the development, the sheet was air-dried, and a detection liquid (acetic acid:sulfuric acid:anise aldehyde=100:2:1 (v/v/v) was sprayed. The sheet was heated to detect sugar.
[0207] In the TLC analysis, a plurality of spots of the maltooligosaccharides G2 to G7 degraded with glucoamylase were observed in the 1-hour reaction product by the present enzyme. Therefore, it is considered that the disproportionation reaction of maltooligosaccharides (-1,4-glucosyl transfer reaction) was catalyzed by the present enzyme (
[0208] The disappearance of spots due to glucoamylase degradation was not observed in the 6-hour reaction product by the present enzyme, and the production of maltooligosaccharides by the present enzyme was not detected. A reaction product having a degree of polymerization of around 10 was confirmed, but the production of a polymer which stayed at the spotted positions in the TLC sheet was not confirmed. This result is one of characteristics which demonstrate the difference of the present enzyme from Gluconobacter oxydans-derived dextrin dextranase.
[0209] The disappearance of spots due to glucoamylase degradation was not observed in the 24 to 96-hour reaction products by the present enzyme, and the production of maltooligosaccharides by the present enzyme was not detected. The spots which were not degraded with glucoamylase were observed at development positions equivalent to the marker sports of IG2 to IG5. However, as the reaction time was longer, long-chain products corresponding to IG3 to IG5 were degraded, so that the accumulation of glucose and the conversion into low-molecular isomaltooligosaccharides were found (-1,6-glucosidic bond hydrolysis activity).
Example 7: Saccharification Test 1
1. Method
[0210] Prepared were five reaction solutions each obtained by dissolving G67 rich syrup fraction-adjusted for this test in ultrapure water so as to attain a final concentration of 30%, and adding thereto a 1 M sodium acetate buffer (pH: 5.0) so as to attain a final concentration of 50 mM and CaCl.sub.2) so as to attain a final concentration of 3 mM. A culture supernatant (Present Enzyme 2) of Bacillus subtilis containing the mutant enzyme (1-752) prepared in Example 2 was added to each of the reaction solutions in an amount of 62.5, 125, 250, 500 or 1000 L/g-DS to cause a reaction at 53 C. for 72 hours.
[0211] The sugar compositions of G67 rich syrup and the reaction products of the present enzyme were analyzed by HPLC. The analysis conditions were as follows: column: MCI GELCK02AS (Mitsubishi Chemical Corporation); eluent: ultrapure water; flow rate: 0.7 ml/min; column temperature: 80 C.; and detector: differential refractive index detector. The sugar composition (%) of each of the reaction products was calculated as an area ratio (%) of a peak corresponding to each saccharide when the total area of peaks detected by HPLC was 100. Since it had been revealed, from the peaks in the chromatographic data on starch hydrolysates, that the retention time of 30 minutes corresponds to DP30, an area ranging from the peak (retention time) of DP10 to the retention time of 30 minutes was calculated as an area of DP10 to 30.
[0212] In order to confirm the -1,6 bond production, the reaction products of the present enzyme were subjected to dextranase treatment. The dextranase treatment involved adding 20 L of Dextranase L Amano diluted 200 times with a 200 mM sodium acetate buffer (pH: 5.0) to 0.5 mL of each of the samples having a solid content concentration of 1%, and retaining the mixture at 53 C. for 24 hours. After the dextranase treatment, the sugar composition was analyzed. The sugar compositions of the reaction products of the present enzyme and the sugar compositions thereof after the dextranase treatment were compared to calculate the increase proportions of DP1 to 3 after the dextranase treatment. The sugar compositions of DP1 to 3 were analyzed under the conditions: column Aminex HPX-42A (BioRad); eluent: ultrapure water; flow rate: 0.5 ml/min; column temperature: 75 C.; and detector: differential refractive index detector.
2. Results
[0213]
TABLE-US-00010 TABLE 6 Reaction Reaction Reaction Reaction Reaction G67 rich Product Product Product Product Product syrup 7-1 7-2 7-3 7-4 7-5 Amount (L/g-DS) of enzyme 62.5 125 250 500 1000 (1-752) added Sugar composition DP: 31 0 2.5 1.2 0.8 1 0.7 (%) of reaction DP: 10-30 4.7 37.2 46.4 49.1 47.5 46.2 product DP: 3-9 95.2 55.1 45.5 41.2 40.9 42 DP: 1-2 0.1 5.1 6.8 8.6 10.2 10.4 Increase proportion (%) of DP: +31 +33 +34.6 +35.6 +35.3 1-3 after dextranase treatment
[0214] The raw material G67 rich syrup contained saccharides of DP6 and DP7 in proportions of about 33% and about 37%, respectively, and contained saccharides of DP3 to 9 in a proportion of about 95% (
[0215] The content proportion of DP10 to 30 in the reaction products remarkably increase as compared with that in the raw material. The content proportion of DP10 to 30 is 4.7% in the raw material, but increases to 37.2% in Reaction Product 7-1 and is 46% or more in Reaction Products 7-2 to 7-5 (Table 6).
[0216] Also, there was a tendency that, as the amount of the present enzyme added increases, the content proportion of DP1 to 2 in the reaction products also increases (Table 6, and
[0217] On the other hand, the content proportion of DP 3 to 9 in the reaction products remarkably decreased as compared with that in the raw material. The content proportion of DP 3 to 9 is 95.2% in the raw material, but decreases to less than 40.9% in Reaction Product 7-4 having the lowest content proportion (Table 6).
[0218] For all of Reaction Products 7-1 to 7-5, the content proportion of DP 1 to 3 in the sample after the dextranase treatment was +30% or more relative to the content proportion of DP 1 to 3 in the reaction product before the treatment (Table 6). Since the increment of the content proportion of DP 1 to 3 was caused by hydrolysis of -1,6 bonds with dextranase, it was confirmed that DP10 to 30 having increased in the reaction products were produced due to the -1,6 transfer activity of the preset enzyme.
Example 8: Saccharification Test 2
1. Method
[0219] Prepared were six reaction solutions each obtained by dissolving Pinedex #1 (Matsutani Chemical Industry Co., Ltd.) in ultrapure water so as to attain a final concentration of 30%, and adding thereto a 1 M sodium acetate buffer (pH: 5.0) so as to attain a final concentration of 50 mM and CaCl.sub.2) so as to attain a final concentration of 3 mM. A culture supernatant (Present Enzyme 2) of Bacillus subtilis containing the mutant enzyme (1-752) prepared in Example 2, GODO-FIA (GODO SHUSEI CO., LTD.; isoamylase), Pullulanase Amano 3 (Amano Enzyme Inc.) and Kleistase L-1 (Amano Enzyme Inc.) were added to each reaction solution under the conditions indicated in Table 7 to cause a reaction at 53 C. for 72 hours. The sugar composition of each of the reaction products was analyzed by HPLC. The HPLC analysis and dextranase treatment were performed under the same conditions as in Example 7.
2. Results
[0220]
TABLE-US-00011 TABLE 7 Pinedex Reaction Reaction Reaction Reaction Reaction Reaction #1 Product 8-1 Product 8-2 Product 8-3 Product 8-4 Product 8-5 Product 8-6 Enzyme Amount (L/g-DS) of 125 125 125 625 625 625 composition enzyme (1-752) added Kleistase L-1 (mg/g-DS) 0.000 0.010 0.020 0.000 0.010 0.020 GODO-FIA (U/g-DS) 200 200 200 200 200 200 Pullulanase Amano 3 0.2 0.2 0.2 0.2 0.2 0.2 (mg/g-DS) Sugar composition DP: 31 59.242 9.7 3.4 2.8 5.7 4.8 4.7 (%) of reaction DP: 10-30 16.991 59.7 57.6 55.8 52.2 51.9 51.4 product DP: 3-9 22.049 26.1 32.5 34.9 33.5 34 34.7 DP: 1-2 1.717 4.3 6.2 6.3 8.2 8.8 8.8 Increase proportion (%) of DP: 1-3 after dextranase +35.9 +38.6 +41.5 +39.4 +40.2 +39.8 treatment
[0221] The raw material Pinedex #1 contained saccharides of DP31 or more in a proportion of about 60% (
[0222] The content proportion of DP10 to 30 in the reaction products remarkably increased as compared with that in the raw material. The content proportion of DP10 to 30 is 17% in the raw material, but increases to 50% or more in all the reaction products (Table 7). There was a tendency that the content proportions of DP 1 to 2 and DP 3 to 9 in the reaction products also increase as compared with those in the raw material. Also, there was a tendency that, as the amount of the present enzyme added increases, the content proportion of DP 1 to 2 in the reaction products increases, as is the case with Example 7.
[0223] On the other hand, the content proportion of DP 31 or more in the reaction products remarkably decreased as compared with that in the raw material. The content proportion of DP 31 or more is about 60% in the raw material, but decreases to less than 10% in all the reaction products (Table 7). The reduction in content proportion of the saccharides (dextrins) of DP 31 or more contained in the raw material Pinedex #1 is considered to have been caused by the action of the hydrolases (GODO-FIA, Pullulanase Amano 3 and Kleistase L-1).
[0224] For all of Reaction Products 8-1 to 8-6, the content proportion of DP 1 to 3 in the sample after the dextranase treatment increased to 35% or more relative to the content proportion of DP 1 to 3 in the reaction product before the treatment (Table 7). The chromatograms of the samples after the dextranase treatment show lower peaks of DP4 or more, as shown in
INDUSTRIAL APPLICABILITY
[0225] The present invention is useful in various fields including food products and medicine in which -1,6-glucan can be used.
SEQUENCE LISTING FREE TEXT
[0226] SEQ ID NO: 1. Amino acid sequence of hypothetical protein derived from Thermoanaerobacter siderophilus
[0227] SEQ ID NO: 2: Base sequence encoding hypothetical protein derived from Thermoanaerobacter siderophilus
[0228] SEQ ID NO: 3 Amino acid sequence of mutant enzyme (1-752)
[0229] SEQ ID NO: 4: Base sequence encoding mutant enzyme (1-752)
[0230] SEQ ID NOs: 5 and 6: Primers indicated in Table 1
[0231] SEQ ID NOs: 7 and 8: Primers indicated in Table 2
[0232] SEQ ID NOs: 9 and 10: Primers indicated in Table 3
[0233] SEQ ID NO: 11 and 12: Primers indicated in Table 4