MARKER AND METHOD FOR DETERMINATION OF PARKINSON'S DISEASE
20210010052 ยท 2021-01-14
Assignee
- KABUSHIKI KAISHA YAKULT HONSHA (Minato-ku, JP)
- National University Corporation Nagoya University (Nagoya-shi, Aichi, JP)
Inventors
- Hirokazu Tsuji (Minato-ku, JP)
- Takashi ASAHARA (Minato-ku, JP)
- Koji Nomoto (Minato-ku, JP)
- Masaaki HIRAYAMA (Nagoya-shi, JP)
- Kinji OHNO (Nagoya-shi, JP)
Cpc classification
G01N2333/24
PHYSICS
G01N33/92
PHYSICS
G01N2800/2835
PHYSICS
G01N33/56916
PHYSICS
International classification
Abstract
The present invention relates to a method for simply diagnosing the progress of disease condition of a Parkinson's disease patient. Provided are a method for determining Parkinson's disease using the number of one or more intestinal bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or the total number of intestinal bacteria as a marker, and a method for determining Parkinson's disease using the blood LPS level and/or the blood LBP level of a Parkinson's disease patient as an indicator.
Claims
1. A marker for detecting Parkinson's disease, the marker being the number of one or more intestinal bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or the total number of intestinal bacteria.
2. The marker according to claim 1, wherein the detecting of Parkinson's disease is detecting a risk of deterioration of Parkinson's disease.
3. The marker according to claim 2, wherein the deterioration of Parkinson's disease is deterioration of a constipation symptom or a psychiatric symptom.
4. The marker according to claim 3, wherein the psychiatric symptom is one or more selected from the group consisting of hallucination, cognition, and motivation.
5. A method for detecting deterioration of a disease condition of a Parkinson's disease patient, comprising measuring the numbers of one or more intestinal bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or the total numbers of intestinal bacteria in the patient at two or more different time points and comparing the numbers.
6. The method according to claim 5, wherein the deterioration of a disease condition of a Parkinson's disease patient is deterioration of a constipation symptom or a psychiatric symptom.
7. The method according to claim 6, wherein the psychiatric symptom is one or more selected from the group consisting of hallucination, cognition, and motivation.
8. A marker for detecting Parkinson's disease, the marker being a blood LPS level and/or a blood LBP level.
9. The marker according to claim 8, wherein the detecting of Parkinson's disease is detecting a risk of deterioration of Parkinson's disease.
10. The marker according to claim 9, wherein the deterioration of Parkinson's disease is deterioration of a constipation symptom or a psychiatric symptom.
11. The marker according to claim 10, wherein the psychiatric symptom is one or more selected from the group consisting of hallucination, cognition, and motivation.
12. A method for detecting deterioration of a disease condition of a Parkinson's disease patient, comprising measuring blood LPS levels and/or blood LBP levels of the patient at two or more different time points and comparing the levels.
13. The method according to claim 12, wherein the deterioration of a disease condition of a Parkinson's disease patient is deterioration of a constipation symptom or a psychiatric symptom.
14. The method according to claim 13, wherein the psychiatric symptom is one or more selected from the group consisting of hallucination, cognition, and motivation.
15. A kit for conducting the method according to claim 5, the kit comprising a protocol for measuring the intestinal bacteria.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DESCRIPTION OF EMBODIMENTS
[0033] The marker for determination of PD of the present invention is the number of one or more intestinal bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or the total number of intestinal bacteria. Although it is known that these intestinal bacteria are present in the human intestine, it has not been reported about the relationship between these intestinal bacteria and the progress of PD condition. Here, the total number of intestinal bacteria is, for example, the total bacterial number measured by a DAPI counting method but is not limited thereto. The total bacterial number may be the sum of the bacterial numbers of a plurality of dominant bacterial species in the intestine, which corresponds to about 70% or more of the total bacterial number measured by the DAPI counting method. Examples of the total bacterial number include the sum of the bacterial numbers of 19 bacterial species shown in Example (Table 1) below.
[0034] As described in Example below, there was a significant correlation between the number of the intestinal bacteria in feces of a PD patient and deterioration of the condition of PD. Specifically, a decrease in the number of at least one, preferably two or more, intestinal bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or in the total number of intestinal bacteria indicates an increase in the risk of deterioration of PD.
[0035] Here, deterioration of PD or deterioration of the condition of a PD patient means that the disease condition actually progresses and becomes severe. A risk of deterioration of PD or a risk of deterioration of the condition of a PD patient refers to a possibility that the condition of PD will further deteriorate in the future compared to the actual current disease condition.
[0036] The risk of deterioration of PD may be determined by measuring the number of the intestinal bacteria in a sample and applying the number to an approximate line equation (for example, approximate line equations shown in Example (e.g.,
[0037] In addition, a significant correlation was also observed between the blood LBP level and constipation, which is a typical symptom of PD. That is, it is inferred that the LBP level decreases in a group where the stool frequency is low (being constipation symptom) and the PD condition is probably getting worse and that the LBP level increases in a group where the stool frequency is high (not being constipation symptom) and the PD condition is probably mild. In PD patients, since the LBP level and the LPS level inversely correlate with each other, it is inferred that the LPS level increases in the group where the PD condition is getting worse and that the LPS level decreases in the group where the PD condition is mild. Accordingly, the deterioration of PD can be determined by examining the change in the blood LPS level and/or the blood LBP level.
[0038] Specifically, in order to determine deterioration of the disease condition of a PD patient, it is possible to perform the determination by measuring the numbers of one or more intestinal bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or the total numbers of intestinal bacteria in the patient at two or more different time points and comparing the measured bacterial numbers.
[0039] Measurement at two or more time points refers to that measurement of the intestinal bacteria is performed at a time point and is then performed at one or more time points after a certain interval. The interval varies depending on, for example, the condition and the pathological condition of the patient and is not particularly limited. For example, an arbitrary period of 1 week to 5 years, such as 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 6 months, 9 months, 1 year, 2 years, 3 years, 4 years, or 5 years is suitably selected.
[0040] In determination of deterioration of the disease condition of a PD patient, when the numbers of the intestinal bacteria in a single PD patient are measured at two or more different time points, if the number of the intestinal bacteria results in a decreased tendency, it can be determined that the PD is getting severe. In contrast, if the number of the intestinal bacteria results in an increased tendency, it can be determined that the PD is getting mild. Specifically, if the number of one or more bacteria selected from the group consisting of Bifidobacterium, Bacteroides fragilis group, Lactobacillus brevis, and Lactobacillus plantarum subgroup and/or the total number of intestinal bacteria is decreased, it can be determined that the PD condition is getting severe, and in contrast, when the number is increased, it can be determined that the condition is getting mild.
[0041] In determination of PD (determination of a risk of deterioration of PD or determination of deterioration of the PD symptom), it is possible to perform the determination by measuring the number of the intestinal bacteria in a sample and comparing whether the number is larger or smaller than a reference which is the value (P) of the vertical axis at the time point of 0 in the horizontal axis in an approximate line equation created in advance for a correlation between the number of the intestinal bacteria (vertical axis) and the deterioration of disease condition (horizontal axis). In addition, it is also possible to perform the determination by comparing whether an amount of change in the number of the intestinal bacteria is larger or smaller than a reference which is the value (Q) of the vertical axis at the time point of 0 in the horizontal axis in an approximate line equation created in advance for a correlation between the amount of change in the number of the intestinal bacteria measured at two or more different time points (vertical axis) and the deterioration of disease condition (horizontal axis) of a single PD patient. For example, based on the approximate line equation shown in Example (e.g.,
[0048] In addition, deterioration of PD of a patient can be determined by measuring the blood LPS levels and/or the blood LBP levels of the PD patient at two or more different time points and comparing the measured levels (between the LPS levels or between the LBP levels). The phrase two or more time points has the same meaning as described above. The blood levels of LPS and/or LBP are preferably serum levels.
[0049] In the determination of the degree of severity of PD, when the LPS levels and/or the LBP levels of a single PD patient are measured at two or more different time points, if the LPS level results in an increased tendency, it can be determined that the PD is getting severe. In contrast, if the LPS level results in a decreased tendency, it can be determined that the PD is getting mild. If the LBP level results in a decreased tendency, it can be determined that the PD is getting severe, and in contrast, the LBP level results in an increased tendency, it can be determined that the PD is getting mild.
[0050] In the present invention, the measurement of intestinal bacteria in a sample include measurement (quantification) of the number of intestinal bacteria. Examples of the method for measuring the number of intestinal bacteria in a sample include a method involving culturing intestinal bacteria in an appropriate medium and counting the number of the bacteria, a method involving culturing intestinal bacteria in a liquid selection medium and measuring the turbidity or absorbance, a FISH method, and a quantitative RT-PCR method (RT-qPCR method). Among these methods, the RT-qPCR method is preferable.
[0051] The RT-PCR method will now be described. The analytical method by the RT-PCR method can be performed by, for example, (1) a step of extracting RNA of a bacterium of interest in a sample, (2) a step of synthesizing cDNA by a reverse transcription (RT) reaction using a nucleic acid fragment (primer) that hybridizes to the extracted RNA and subsequently performing PCR using the cDNA as a template, and (3) a step of detecting the DNA fragment amplified in the step (2). A DNA fragment (PCR product) specific to the intestinal bacterium of interest can be obtained by combining the nucleic acid fragment with the template cDNA derived from a sample and performing amplification reaction. The number of the intestinal bacterium of interest in the sample can be determined by observing the PCR product over time and identifying the number of PCR cycles at the time when the amount of DNA reaches a certain level.
[0052] The observation of an amplified PCR product over time can be performed by labeling the PCR product with an intercalating fluorescent dye, such as SYBR(R) Green I, and measuring the fluorescence intensity at each PCR cycle. An intercalating dye has a property of being intercalated in a double-stranded nucleic acid and thereby increasing the fluorescence intensity and therefore it is possible to precisely measure the PCR product generated from cDNA of a target bacterium by PCR reaction. In particular, SYBR(R) Green I is suitably used.
[0053] The intestinal bacterium of interest in a sample can be quantitatively determined by identifying the number of PCR cycles (threshold cycle: C.sub.T) when the fluorescence intensity (DNA amount) reaches a certain level that has been arbitrarily set. In addition, for example, a TaqMan probe or molecular beacon labeled with a fluorescent dye can also be used. The TaqMan probe and the molecular beacon are each a probe in which a fluorescent dye and a quencher are bonded to an oligonucleotide having homology with the internal sequence of the region to be amplified by PCR and are used in the PCR reaction by existing together. Since fluorescence is emitted according to the PCR amplification reaction by the interaction between the fluorescent dye and the quencher bounded to the probe, the amplified PCR product can be observed over time by measuring the fluorescence intensity at each PCR cycle.
[0054] The intestinal bacterium of interest in a sample can be quantitatively determined by a calibration curve of the logarithmic values of the bacterial numbers measured by, for example, a DAPI counting method or a culture method and the C.sub.T values. That is, a calibration curve is created in advance by plotting the logarithmic values of the bacterial numbers of a target on the horizontal axis and the C.sub.T values on the vertical axis, and the C.sub.T value obtained as a result of PCR reaction is applied to the calibration curve to quantify the intestinal bacterium of interest in the sample.
[0055] In order to implement the method for determining PD of the present invention, it is preferable to use a kit including a protocol for measuring the intestinal bacteria in a sample. The kit includes a measuring reagent for the marker of the present invention and a protocol (a protocol describing, for example, a method for measuring intestinal bacteria and a method for determining PD, in particular, a reference for determining the degree of severity, and factors that influence the measurement results and the degree of the influence). The determination can be performed as in the above-described determination method by using the reference. Here, examples of the measuring reagent for the marker include a reagent for measuring the number of the intestinal bacteria described above, a reagent for detecting mRNA, and a reagent for detecting DNA.
[0056] The bacterial number in vivo varies depending on, for example, the living environment and eating habits of each patient. The status of the progress of PD can be determined by comparing the bacterial numbers in samples of a single patient measured time-serially.
EXAMPLES
[0057] The present invention will now be described in detail by way of examples but is not limited thereto. Bacterial strain used
[0058] Bacterial strains stored in the Yakult Central Institute, Yakult Honsha Co., Ltd. shown in Table 1 were used. The initial bacterial number of each bacterial strain was adjusted to about 110.sup.4 cells.
[0059] The culture conditions of each bacterial strain are shown in Table 1. The details of culture conditions A and B are as follows.
[0060] Condition A: static culture was performed in a 1% glucose addition modified GAM broth at 37 C. under an anaerobic condition for 24 to 72 hours.
[0061] Condition B: static culture was performed in an MRS broth at 37 C. under an anaerobic condition for 24 to 72 hours.
[0062] Condition C: static culture was performed in a BHI broth at 37 C. under an aerobic condition for 18 hours.
[0063] These bacterial cells were counted by a DAPI method and were then appropriately diluted to a certain bacterial number to prepare each bacterial liquid.
TABLE-US-00001 TABLE 1 Taxon Strain Culture condition Clostridium coccoides Blautia producta JCM 1471 Condition A group (ATCC 27340) Clostridium leptum Faecalibacterium prausnitzii Condition A subgroup ATCC 27768 Bacteroides fragilis Bacteroides vulgatus ATCC Condition A group 8482 Bifidobacterium Bifidobacterium adolescentis Condition A ATTC 15703 Atopobium cluster Collinsella aerofaciens DSM Condition A 3979 Genus Prevotella Prevotella melaninogenica Condition A ATCC 25845 Clostridium Clostridium perfringens Condition A perfringens JCM 1290 (ATCC 13124) Family Escherichia coli JCM 1649 Condition C Enterobacteriaceae (ATCC 11775) Lactobacillus casei Lactobacillus casei Condition B subgroup ATCC 334 Lactobacillus gasseri Lactobacillus acidophilus Condition B subgroup ATCC 4356 Lactobacillus Lactobacillus plantarum Condition B plantarum subgroup ATCC 14917 Lactobacillus reuteri Lactobacillus reuteri JCM Condition B subgroup 1112 (ATCC 23272) Lactobacillus ruminis Lactobacillus ruminis JCM Condition B subgroup 1152 (ATCC 27780) Lactobacillus sakei Lactobacillus sakei JCM Condition B subgroup 1157 (ATCC 15521) Lactobacillus brevis Lactobacillus brevis ATCC Condition B 14869 Lactobacillus Lactobacillus fermentum Condition B fermentum ATCC 14931 Genus Enterococcus Enterococcus faecalis Condition B ATCC 19433 Genus Staphylococcus Staphylococcus aureus Condition C GIFU 9120 (ATCC 12600) Genus Pseudomonas Pseudomonas aeruginosa Condition C IFO 12689
Reference Example 1
[0064] Preparation of Specific Primer
[0065] Table 2 shows each primer used in measurement of the number of the intestinal bacteria. Table 2 also shows literatures describing each primer.
TABLE-US-00002 TABLE2 SEQID Targetgene Primername Sequence(5-3) NO: Literature Clostridiumcoccoidesgroup g-Ccoc-F AAATGACGGTACCTGACTAA 1 1 g-Ccoc-R CTTTGAGTTTCATTCTTGCGAA 2 1 Clostridiumleptumsubgroup sg-Clept-F GCACAAGCAGTGGAGT 3 2 sg-Clept-R CTTCCTCCGTTTTGTCAA 4 2 Bacteroidesfragilisgroup g-Bfra-F2 AYAGCCTTTCGAAAGRAAGAT 5 3 g-Bfra-R CCAGTATCAACTGCAATTTTA 6 1 GenusBifidobacterium g-Bifid-F CTCCTGGAAACGGGTGG 7 1 g-Bifid-R GGTGTTCTTCCCGATATCTACA 8 1 Atopobiumcluster c-Atopo-F GGGTTGAGAGACCGACC 9 2 c-Atopo-R CGGRGCTTCTTCTGCAGG 10 2 GenusPrevotella g-Prevo-F CACRGTAAACGATGGATGCC 11 1 g-Prevo-R GGTCGGGTTGCAGACC 12 1 Clostridiumperfringens s-Clper-F GGGGGTTTCAACACCTCC 13 4 ClPER-R GCAAGGGATGTCAAGTGT 14 5 FamilyEnterobacteriaceae f-Enbac-F TGCCGTAACTTCGGGAGAAGGCA 15 6 f-Enbac-R TCAAGGACCAGTGTTCAGTGTC 16 6 Lactobacilluscaseisubgroup sg-Lcas-F ACCGCATGGTTCTTGGC 17 4 sg-Lcas-R CCGACAACAGTTACTCTGCC 18 4 Lactobacillusgasserisubgroup sg-Lgas-F GATGCATAGCCGAGTTGAGAGACAGAT 19 4 sg-Lgas-R TAAAGGCCAGTTACTACCTCTATCC 20 4 Lactobacillusplantarumsubgroup sg-Lpla-F CTCTGGTATTGATTGGTGCTTGCAT 21 4 sg-Lpla-R GTTCGCCACTCACTCAAATGTAAA 22 4 Lactobacillusreuterisubgroup sg-Lrcu-F GAACGCAYTGGCCCAA 23 4 sg-Lrcu-R TCCATTGTGGCCGATCAGT 24 4 Lactobacillusruminissubgroup sg-Lrum-F CACCGAATGCTTGCAYTCACC 25 4 sg-Lrum-R GCCGCGGGTCCATCCAAAA 26 4 Lactobacillussakeisubgroup sg-Lsak-F CATAAAACCTAMCACCGCATGG 27 4 sg-Lsak-R TCAGTTACTATCAGATACRTTCTTCTC 28 4 Lactobacillusbrevis s-Lbrc-F ATTTTGTTTGAAAGGTGGCTTCGG 29 4 s-Lbrc-R ACCCTTGAACAGTTACTCTCAAAGG 30 4 Lactobacillusfermentum LFer-1 CCTGATTGATTTTGGTCGCCAAC 31 4 LFer-2 ACGTATGAACAGTTACTCTCATACGT 32 4 GenusEnterococcus g-Encoc-F ATCAGAGGGGGATAACACTT 33 4 g-Encoc-R ACTCTCATCCTTGTTCTTCTC 34 4 GenusStaphylococcus g-Staph-F TTTGGGCTACACACGTGCTACAATGGACAA 35 4 g-Staph-R AACAACTTTATGGGATTTGCWTGA 36 4 GenusPseudomonas PSD7F CAAAACTACTGAGCTAGAGTACG 37 6 PSD7R TAAGATCTCAAGGATCCCAACGGCT 38 6 [0066] 1. Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto K, et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol 2002;68: 5445-5451. [0067] 2. Matsuki T, Watanabe K, Fujimoto J, Takeda T, Tanaka R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol 2004;70: 7220-7228. [0068] 3. Matsuki T. Development of quantitative PCR detection method with 16S rRNA gene-targeted genus- and species-specific primers for the analysis of human intestinal microflora and its application. Nihon Saikingaku Zasshi 2007;62: 255-261. [0069] 4. Matsuda K, Tsuji H, Asahara T, Matsumoto K, Takada T, Nomoto K. Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules. Appl Environ Microbiol 2009;75: 1961-1969. [0070] 5. Kikuchi E, Miyamoto Y, Narushima S, Itoh K. Design of species specific primers to identify 13 species of Clostridium harbored in human intestinal tracts. Microbiol Immunol 2002;46: 353-358. [0071] 6. Matsuda K, Tsuji H, Asahara T, Kado Y, Nomoto K. Sensitive quantitative detection of commensal bacteria by rRNA-targeted reverse transcription-PCR. Appl Environ Microbiol 2007;73: 32-39.
Reference Example 2
[0072] Preparation of Calibration Curve to be Used in RT-PCR
[0073] A calibration curve to be used in quantification of intestinal bacteria of interest in samples was created. Specifically, according to the procedure shown below, a calibration curve was created by plotting the numbers of intestinal bacteria measured by a DAPI counting method on the horizontal axis and the C.sub.T values on the vertical axis. [0074] 1) RNAlater (Arabian, Inc., 400 L) was added to a bacterial liquid (200 L) of each bacterial strain prepared in the above paragraph Bacterial strain used, followed by leaving to stand at room temperature for 5 minutes. Subsequently, centrifugation was performed at 13,000g for 5 minutes, and the supernatant was removed by decantation. A lysis buffer (450 L, prepared by mixing 346.5 L of RLT buffer, 100 L of TE, and 3.5 L of -mercaptomethanol per one sample) and glass beads having a diameter of 0.1 mm (TOMY Seiko Co., Ltd., 300 mg) were added to the residue after the removal of the supernatant. [0075] 2) The sample tube was set on a shaker (ShakeMaster) and was then shaken for 5 minutes to disrupt the bacterial cells. [0076] 3) Water saturated phenol (500 L) was added to the sample tube, followed by stirring with a vortex for 5 to 10 seconds. [0077] 4) The sample tube was set on a heat block of 60 C., followed by a reaction for 10 minutes (hot phenol method). [0078] 5) Chloroform/isoamyl alcohol (24:1, 100 L) were added to the sample tube, followed by stirring with a vortex for 5 to 10 seconds. [0079] 6) After centrifugation (13,000 g, for 5 minutes), 470 L of the supernatant was transferred to another 1.5-mL microtube with lid. [0080] 7) Chloroform/isoamyl alcohol (24:1, 470 L) were added to the microtube, followed by stirring with a vortex for 5 to 10 seconds. [0081] 8) After centrifugation (13,000 g, for 5 minutes), 400 L of the supernatant was transferred to another 1.5-mL microtube with lid. [0082] 9) 3 M Na acetate (pH 5.4, 40 L) and isopropanol (400 L) were added to the microtube, followed by inversion mixing. [0083] 10) Centrifugation (20,000 g, for 10 minutes) was performed. [0084] 11) After removing the supernatant by decantation, 80% ethanol (500 L) was added to the residue. [0085] 12) After centrifugation (20,000 g, for 2 minutes), the supernatant was removed by decantation. [0086] 13) After air drying (for about 20 minutes with the opening up), Nuclease-free water (Ambion, Inc.) was added thereto so as to give a concentration of 210.sup.8 cells/mL based on the number of bacteria measured by a DAPI method, and the mixture was stirred for homogenous dissolution. Furthermore, 10-fold serial dilution with Nuclease-free water was performed. The samples diluted within a range of 210.sup.3 to 210 cells/mL were used as RNA samples described in the following 14) and were subjected to RT-qPCR reaction. [0087] 14) RT-qPCR was performed using a QIAGEN OneStep RT-PCR Kit (QIAGEN). The composition of reaction solution (the total volume: 10 L) was composed of 1 x QIAGEN OneStep RT-PCR Buffer, 0.5Q-Solution, 0.4 mM dNTP Mix, 1/25 quantity of QIAGEN OneStep RT-PCR Enzyme Mix, 1/100,000 quantity of SYBR(R) Green I (Molecular Probes, Inc.), 1ROX Reference Dye (Invitrogen), 0.60 M of each primer shown in Table 2, and 5 L of the RNA sample prepared in the above 13). [0088] 15) The reaction solution was subjected to reverse transcription at 50 C. for 30 minutes, and the reverse transcriptase was then inactivated by heating at 95 C. for 15 minutes. Subsequently, a cycle consisting of 94 C. for 20 seconds, 55 C. or 60 C. (55 C. for SEQ ID NOs: 1, 2, and 15 to 28 of Table 2, 60 C. for SEQ ID NOs: 3 to 14, 29, and 30, 55 C. for SEQ ID NOs: 31 to 34, and 60 C. for SEQ ID NOs: 35 to 38) for 20 seconds, and 72 C. for 50 seconds was repeated 45 cycles to obtain an amplification product. The amount of the amplification product was measured at each cycle as the fluorescence intensity of SYBR(R) Green I to create a PCR curve. The base line and threshold of fluorescence intensity were set, and the number of cycles (C.sub.T value) at which the PCR curve and the threshold intersects each other was determined. The resulting C.sub.T value was plotted on the vertical axis, and the bacterial number of the sample applied to the PCR reaction was plotted on the horizontal axis. In these analyses, Sequence Detection System (SDS) software (Applied Biosystems) was used. In addition, in order to verify whether the amplification by PCR was specifically performed or not, the denaturation temperature was separately measured. The denaturation temperature was measured by producing the amplification product, then performing a reaction at 94 C. for 15 seconds, subsequently raising the temperature slowly from 55 C. or 60 C. to 99 C. at a rate of 0.2 C./sec, plotting the temperature on the horizontal axis and the fluorescence intensity of SYBR(R) Green I on the vertical axis to create a denaturation curve of the amplification product, and measuring the temperature at which the fluorescence intensity sharply decreases. This series of reactions was performed by an ABI PRISM(R) 7900HT system (Applied Biosystems). [0089] 16) A calibration curve was created by plotting each of the bacterial numbers of intestinal bacteria measured by the DAPI method on the horizontal axis and the C.sub.T values corresponding thereto obtained by RT-qPCR on the vertical axis.
Example 1
[0090] (1) Relationship between PD and intestinal microbiota
[0091] The intestinal microbiota of PD patients was examined carefully to evaluate the relationship between PD and intestinal microbiota.
[0092] Recruited were 52 PD patients (male: 21, female: 31, age: 68.96.8) and 36 partners of the patients (male: 21, female: 15, age: 68.49.7) as controls. The clinical symptoms of PD were evaluated using Hoehn-Yater (HY) severity classification and unified Parkinson's disease rating scale (UPDRS) Parts 1 to 4.
[0093] Among the recruited PD patients, 42 patients could be followed-up for 2 years. Furthermore, 6 patients who were found to have another disease during follow-up were excluded. Consequently, 36 patients in total were studied as subjects. [0094] (2) Biochemical test
[0095] The serum lipopolysaccharide (LPS)-binding protein (LBP) level was measured with an ELISA kit (HK315-01, Hycult Biotech). The diamine oxidase (DAO) level was measured with an ELISA kit (K8500, Immundiagnostik AG). [0096] (3) Measurement of bacterial number in feces by RT-qPCR targeting rRNA [0097] (a) Preparation of sample for RNA extraction
[0098] RNAlater (Arabian, Inc., 0.2 mL) was added to feces (4 mg) collected from a patient or a control, followed by leaving to stand at room temperature for 5 minutes. Subsequently, centrifugation was performed at 14,000 g for 10 minutes, the supernatant was removed by decantation, and the residue was then used as a sample for RNA extraction. [0099] (b) Nucleic acid extraction
[0100] RNA was extracted according to the following procedure.
[0101] 1) A lysis buffer (450 L, prepared by mixing 346.5 L of RLT buffer, 100 L of TE, and 3.5 L of -mercaptoethanol per one sample) and glass beads having a diameter of 0.1 mm (300 mg) were added to the sample for RNA extraction prepared in the above (a).
[0102] 2) Nucleic acid was extracted as in the method described in 2) to 12) of Reference Example 2.
[0103] 3) After air drying (for about 20 minutes with the opening up), Nuclease-free water (200 L) was added thereto, and the mixture was stirred for homogenous dissolution to prepare an RNA sample. [0104] (c) Measurement of bacterial number
[0105] The RNA sample prepared in (b) was subjected to measurement of bacterial number using an RT-qPCR method. The RT-qPCR was performed as in the method described in 14) and 15) of Reference Example 2. [0106] (4) Statistical analysis
[0107] Statistical analysis was performed by JMP Pro statistical software package version 11.0.0 (SAS Institute, Cary, N.C.). The analytical results are shown as meanstandard deviation. Mann-Whitney's U-test and Student's t-test were used for comparison between groups, and Spearman's correlation analysis was used for correlation analysis. A p value of 0.05 or less or a correlation coefficient of 0.3 or more was regarded as statistically significant. Outliers that were apparent in Smirnov's rejection test were rejected.
Results
[0108] (1) Patient information
[0109] Table 3 shows score information on each parameter when the subjects were divided into healthy subjects and PD patients.
TABLE-US-00003 TABLE 3 Patient information Healthy subject (control).sup.a P D.sup.a Sex (actual number) Male 21 21 Female 15 31 Total 36 52 Age (year) 68.4 9.7 68.9 6.8 LBP level 10140 5061 7785 2406 Stool frequency (/week) 7.6 4.6 3.1 1.2 Disease duration (year) 9.5 5.4 UPDRS Part 1 2.9 2.3 (Mentation, behavior, and mood) score UPDRTS Part 2 11.7 6.8 (Activities of daily living) UPDRS Part 3 25.6 11.8 (Motor examination) score UPDRS Part 4 3.4 2.4 (Complicartion of therapy) score [0110] a: showing mean and standard deviation.
[0111] Table 3 demonstrates that the stool frequency of the PD patient group was lower than that of the healthy subject group. [0112] (2) Biochemical test
[0113]
[0115] PD patients were divided into two groups for comparison, a group (worsening group) in which the deterioration of the PD condition is large and a group (non-worsening group) of those other than the worsening group, using the change in the condition after 2 years relative to that at the start of observation (0 year) as an indicator. Patients who were worsened by 15 points or more in the total of UPDRS or who were admitted or could not attend a hospital due to deterioration of the PD condition were identified in the worsening group. Patients who were worsened by less than 15 points in the total score of UPDRS were identified in the non-worsening group. [0116] (3-1) Comparison of scores of worsening group and non-worsening group
[0117] Table 4 shows the comparison of scores when the patients were divided into a worsening group and a non-worsening group.
TABLE-US-00004 TABLE 4 Comparison of patient background At the start of observation (0 year) After 2 years Worsening group Non-worsening group Worsening group Non-worsening group (n = 18) (n = 18) (n = 18) (n = 18) Age (year) 70.2 5. 6 67.0 8.2 Sex (actual number, %) Male 10 (52.6%) 4 (22.2%) Female 8 (42.1%) 14 (77.8%) Disease duration (year) 9.2 4.6 9.8 6.1 B M I (kg/m.sup.2) 20.4 2.7 19.6 2.4 21.7 2.5 19.4 2.6 UPDRS Part 1 score 3.17 2.4 2.4 1.9 5.1 3.8 1.9 1.9 UPDRS Part 2 score 12.3 7.2 9.4 5.7 21.8 8.5 11.9 6.4 UPDRS Part 3 score 28.9 13.5 21.6 8.1 36.5 15.9 20.2 8.1 UPDRS Part 4 score 3.5 2.0 2.9 2.8 6.3 3.9 4.6 2.6 UPDRS total score 51.4 24.9 36.3 13.2 70.3 27.1 38.6 14.2 L-dopa equivalent dose 449 174 390 186 465.6 206 497 202 [0118] (3-2) Change in clinical parameter in 2 years
[0119] Table 5 shows the changes in serum LBP level by comparison of those at the start of observation and at the time point after 2 years.
TABLE-US-00005 TABLE 5 Change in serum LBP level after 2 years 0 year After 2 years LBP level (ng/ml) Worsening group 12890 3614 12449 3433 Non-worsening 11925 3298 12545 3597 group
[0120] Table 5 demonstrates that the serum LBP level in the worsening group decreases after 2 years, but the serum LBP level in the non-worsening group rather tends to increase. [0121] (4) Correlation between change in clinical symptom of PD and change in bacterial composition
[0122] Correlation of the amount of change in the score (the amount of change two years after the start of observation) of the UPDRS Part 1 (mentation, behavior, and mood) score as the clinical symptom of PD with the bacterial number of Bacteroides fragilis group or Bifidobacterium at the start of observation (0 year) was examined. The results are shown in
[0124]
[0125]
[0127]
[0129]
[0130] As described above, intestinal bacteria can be used for determination of progress of the pathological condition of PD.