DUCK HEPATITIS A VIRUS TYPE 3 MUTANT CH-P60-117C AND CONSTRUCTION THEREOF

Abstract

Disclosed herein are a duck hepatitis A virus type 3 (DHAV-3) mutant CH-P60-117C and a construction method thereof. The DHAV-3 mutant CH-P60-117C is constructed by mutating A at position 117 of 5-UTR of the genome of the DHAV-3 virulent strain to C; mutating T at position 1142 to A to mutate tyrosine-164 of VP0 protein of the parent strain to asparagine; and mutating C at position 4334 to A so that leucine-71 of the viral protein 2C of the parent strain is mutated to isoleucine.

Claims

1. A duck hepatitis A virus-3 mutant CH-P60-117C (DHAV-3 CH-P60-117C), wherein the DHAV-3 mutant CH-P60-117C is deposited in the China Center for Type Culture Collection (CCTCC) on Dec. 2, 2018, with an accession number of CCTCC NO: V201860.

2. The DHAV-3 mutant CH-P60-117C of claim 1, wherein the DHAV-3 mutant CH-P60-117C is obtained by mutating A at position 117 of 5-UTR of genome of a DHAV-3 virulent strain to C; mutating Tat position 1142 to A to mutate tyrosine-164 of a VP0 protein of the DHAV-3 virulent strain to asparagine; and mutating C at position 4334 to A so that leucine-71 of protein 2C of the DHAV-3 virulent strain is mutated to isoleucine.

3. The DHAV-3 mutant CH-P60-117C of claim 2, wherein the DHAV-3 virulent strain is deposited in the China Center for Type Culture Collection with an accession number of CCTCC NO: V201305.

4. The DHAV-3 mutant CH-P60-117C of claim 1, wherein G at position 3403 of genome of the DHAV-3 mutant CH-P60-117C is mutated to T as a genetic marker of infectious clones.

5. The DHAV-3 mutant CH-P60-117C of claim 2, wherein G at position 3403 of genome of the DHAV-3 mutant CH-P60-117C is mutated to T as a genetic marker of infectious clones.

6. A method of constructing the DHAV-3 mutant CH-P60-117C of claim 1, comprising: 1) dividing a genome of a parental virus into a first fragment, a second fragment and a third fragment of similar size and amplifying the first fragment, the second fragment and the third fragment through PCR; adding a cytomegalovirus immediate early promoter (pCMV) (SEQ ID NO:19) to 5 end of the first fragment and introducing a first mutation site and a second mutation site respectively in 5-UTR gene and VP0 gene of the first fragment, introducing a third mutation site in 2C gene of the second fragment and adding hepatitis delta virus ribozyme (HDVR) sequence (SEQ ID NO:20) and SV40 early mRNA polyadenylation signal (SV40pA) sequence (SEQ ID NO:21) to 3 end of the third fragment to construct an infectious subgenomic replicon of the DHAV-3 mutant CH-P60-117C; and 2) mixing the infectious subgenomic replicon of the DHAV-3 mutant CH-P60-117C with a transfection reagent followed by transfection into duck embryo fibroblasts; wherein the infectious subgenomic replicon is transcribed in the duck embryo fibroblasts and undergoes spontaneous recombination using a homologous recombination mechanism of the duck embryo fibroblasts to form an infectious complete virus transcript, thereby leading to replication and proliferation of virus to finally obtain the DHAV-3 mutant CH-P60-117C with a genetic marker.

7. The method of claim 6, wherein in the DHAV-3 mutant CH-P60-117C, A at position 117 of 5-UTR of genome of a DHAV-3 virulent strain is mutated to C; Tat position 1142 to A to mutate tyrosine-164 of a VP0 protein of the DHAV-3 virulent strain is mutated to asparagine; and C at position 4334 is mutated to A so that leucine-71 of protein 2C of the DHAV-3 virulent strain is mutated to isoleucine.

8. The method of claim 6, wherein there is a 74 bp overlapping region between the first fragment and the second fragment, and there is an 83 bp overlapping region between the third fragment contain and the second fragment.

9. The method of claim 6, wherein step (1) further comprises: introducing a nonsense mutation into 2A gene of the second fragment as a site of the genetic marker.

10. A method of preparing a DHAV-3 vaccine, comprising: inoculating the DHAV-3 mutant CH-P60-117C of claim 1 into duck embryos through allantoic cavity; incubating the duck embryos; collecting and cooling the duck embryos that die; aseptically collecting an allantoic fluid from the duck embryos; treating the allantoic fluid with a formaldehyde solution and incubating the allantoic fluid at 37 C. for 24 h to inactivate the DHAV-3 mutant CH-P60-117C; diluting the allantoic fluid; and emulsifying the diluted allantoic fluid with an adjuvant to produce the DHAV-3 vaccine.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG. 1 schematically shows the construction of infectious subgenomic replicons of mutant strain CH-P60-117C with molecular marker based on DHAV-3.

[0035] FIG. 2 shows the results of the transfection of duck embryo fibroblasts with infectious subgenomic replicons of DHAV-3 mutant strain CH-P60-117C.

[0036] FIG. 3 shows the sequencing result of the molecular genetic marker site at position 3403 of genome of the mutant strain CH-P60-117C.

[0037] FIG. 4 shows the sequencing result of the target mutation site at position 117 of genome of the mutant strain CH-P60-117C.

[0038] FIG. 5 shows the sequencing result of the target mutation site at position 1142 of genome of the mutant strain CH-P60-117C.

[0039] FIG. 6 shows the sequencing result of the target mutation site at position 4334 of genome of the mutant strain CH-P60-117C.

DETAILED DESCRIPTION OF EMBODIMENTS

[0040] The disclosure will be further described in detail below with reference to the embodiments, but is not limited thereto. Unless otherwise specified, the experimental methods used below all are conventional methods, and the experimental materials are all commercially available.

[0041] Materials and reagents used in the following examples are described as follows.

[0042] Virus Strain

[0043] DHAV-3 virulent strain: isolated by our laboratory and deposited in the China Center for Type Culture Collection at Wuhan University (China) with an accession number of CCTCC NO: V201305; classification: Duck Hepatitis A Virus type 3 (DHAV-3), Picornavirus, Avihepadnavirus.

[0044] Reagents and Instruments

[0045] TaKaRa MiniBEST Universal RNA Extraction kit, PrimeSTAR Max DNA Polymerase, DNA Marker, etc. were purchased from Takara Biomedical Technology (Dalian) Co., Ltd; E.Z.N.A. Gel Extraction kit and E.Z.N.A. Plasmid Purification kit were purchased from Omega Bio-Tek, Inc. (U.S.); Lipofectamine 3000 Transfection kit was purchased from Invitrogen, and other reagents are all analytical grade reagents made in China.

[0046] Nucleic Acid Protein Detector (Bio Rad, Smartspec 3000), Gradient PCR Instrument (Biometra, Tgradient), Electrophoresis Apparatus (Bio Rad, Powerpac 300), and Gel Imaging System (Bio Rad Versa Doc Model 2000) were used herein.

Example 1 Construction of Infectious Subgenomic Replicon of DHAV-3 Mutant Strain CH-P60-117C and Rescue of Virus

[0047] 1.1 Design and Synthesis of Primers

[0048] Based on the complete genome sequence of DHAV-3 in GenBank, nine pairs of primers were designed to amplify the complete genome sequence of DHAV-3, pCMV sequence and SV40pA sequence, and the specific primer information was shown in Table 1. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

TABLE-US-00001 TABLE1 ConstructionofprimesofinfectioussubgenomicrepliconofDHAV-3mutant strainCH-P60-117C Primer Sequence5-3 Note pCMV-F TAGTTATTAATAGTAATCAATTACGGG Thesequenceinbold GTCA(SEQIDNO:1) waspCMVsequence pCMV-R ACACCACAGCCGCTTTCAAACGGTTCAC TAAACCAGCTCT(SEQIDNO:2) F1-F AGAGCTGGTTTAGTGAACCGTTTGAAA GCGGCTGTGGTGT(SEQIDNO:3) A117C-F GCCTAGTCCTAGCGCTATAGGACTCCC Thebaseinboldwas (SEQIDNO:4) themutationsite A117C-R GGGAGTCCTATAGCGCTAGGACTAGGC (SEQIDNO:5) F1-R CAACCTGCCAAAAGTCAAACCA(SEQID NO:6) T1142A-F TCACTGGATCTAACAATGTGGATGC(SEQ Thebaseinboldwas IDNO:7) themutationsite T1142A-R GCATCCACATTGTTAGATCCAGTGA(SEQ IDNO:8) F2-1-F ATTCTGTTACACCTTTACGCCCCACA Thebaseinboldwas (SEQIDNO:9) BlnIenzymesite F2-1-R CAACCTAGGTAAGTGAGCACGAT(SEQ IDNO:10) F2-2-F GTGCTCACTTACCTAGGTTGGTT(SEQID Thebaseinboldwas NO:11) thegeneticmarkersite F2-2-R TGGCAACTTCCTGTCTAACCTG(SEQID NO:12) C4334A-F ACTTGTGCATGATCCGGACTGATAA(SEQ Thebaseinboldwas IDNO:13) themutationsite C4334A-R TTATCAGTCCGGATCATGCACAAGT(SEQ IDNO:14) F3-HDVR-F CCTTGAACACTGGAACCCAA(SEQID NO:15) F3-HDVR-R AAGTAGCCCAGGTCGGACCGCGAGGA Thesequenceinbold GGTGGAGATGCCATGCCGACCCTTTTT wasHDVRsequence TTTTTTTTTAGGGTGG(SEQIDNO:16) HDVR- CGGTCCGACCTGGGCTACTTCGGTAG SV40pA-F GCTAAGGGAGAAGAACTTGTTTATTGCA GCTTA(SEQIDNO:17) HDVR- TAAGATACATTGATGAGTTTGGA(SEQID SV40pA-R NO:18)

[0049] 1.2 Extraction of Viruses

[0050] Following the instructions of TaKaRa MiniBEST Universal RNA Extraction kit, the whole genome RNA of DHAV-3 isolated strain was extracted from the duck embryo allantoic fluid, determined for the nucleic acid concentration and purity using a nucleic acid-protein detector (Bio Rad, Smartspec3000) and then stored at 70 C. for use.

[0051] 1.3 Amplification and Cloning of Gene Fragments

[0052] (1) The total extracted RNA was reverse transcribed into cDNA template using PrimeScript II 1.sup.st Strand cDNA Synthesis kit, and then fragments DHAV-3-F1-A117C, DHAV-3-F1-A117C-T1142A and DHAV-3-F1-T1142A were obtained via amplification using DNA high-fidelity PCR enzyme PrimeSTAR Max DNA Polymerase, primers F1-F and A117C-R, A117C-F and T1142A-R, T1142A-F and F1-R, and the reverse transcription product of the total RNA of parent strain virus as template. Fragments DHAV-3-F2-1, DHAV-3-F2-C4334A-1, and DHAV-3-F2-C4334A-2 were obtained via amplification using primers F2-1-F and F2-1-R, F2-2-F and C4334A-R, C4334A-F and F2-2-R, and the reverse transcription product of the total RNA of parent strain virus as template. Fragment DHAV-3-F3-HDVR was obtained via amplification using primers F3-HDVR-F and F3-HDVR-R, and the reverse transcription product of the total RNA of parent strain virus as template. In the use of an eukaryotic expression plasmid pEGFP-C1 as template, fragment pCMV was obtained via amplification using primers pCMV-F, pCMV-R and pCMV and fragment HDVR-SV40pA was obtained via amplification using primers HDVR-SV40pA-F and HDVR-SV40pA-R.

[0053] (2) As shown in FIG. 1, fragments DHAV-3-F1-A117C, DHAV-3-F1-A117C-T1142A and DHAV-3-F1-T1142A were fused to form F1-A117C-T1142A by fusion PCR, and then the fragments pCMV and F1-A117C-T1142A were fused to form pCMV-F1. Fragments DHAV-3-F2-1, DHAV-3-F2-C4334A-1 and DHAV-3-F2-C4334A-2 were fused to form fragment F2. Fragments DHAV-3-F3-HDVR and HDVR-SV40pA were fused to form fragment F3-HdvRz/SV40pA. The fragments pCMV-F1, F2, and F3-HdvRz/SV40pA together constituted an infectious subgenomic replicon of the mutant strain CH-P60-117C. After the amplified fragments were separated by 1% agarose gel electrophoresis, target fragments were respectively recovered by gel extraction using the Gel Extraction kit (Omega). The recovered DNA fragments were sequenced by Sangon Biotech (Shanghai) Co., Ltd.

[0054] 1.4 Transfection Rescue of Infectious Subgenomic Replicon of Mutant Strain CH-P60-117C

[0055] Primary duck embryo fibroblasts were prepared from 9-day-old duck embryos. When the cells grew to a confluency of 90% in the 3.5 cm culture dish, fragments pCMV-F1 (1.5 g), F2 (1.5 g) and F3-HdvRz-SV40pA (1.5 g) were mixed with Lipofectamine 3000 (Invitrogen) and transfected into the duck embryo fibroblasts with 90% confluency. Those fibroblasts only transfected with Lipofectamine 3000 (Invitrogen) were used as control. Cells were cultured and observed at 37 C. and 5% CO.sub.2 in an incubator, and the medium was replaced after 16 h. 72 h after the transfection, a rupture was observed in the cells in the experimental group, while the cells in the control group showed good growth status. 120 h after transfection, the growth status of the cells was shown in FIG. 2. After recorded by photographing, the cells were subjected to repeated freezing and thawing 3 times, and the cell culture medium was inoculated into five duck embryos (0.2 mL each) aged 9 days through the allantoic cavity. The dish was sealed with paraffin, and then continuously incubated in the incubator. The cells were exposed to irradiation once every other 8 hours to observe the death of duck embryos after inoculation, and the duck embryos that died within 24 h were discarded. The results showed that the duck embryos died between 24 h and 48 h after the inoculation, and the dead duck embryos showed severe bleeding. The allantoic fluid was collected as the reverse genetic virus strain of the first passage for preservation.

Example 2 Identification and Characteristic Determination of DHAV-3 Mutant Strain CH-P60-117C

[0056] 2.1 Identification of the Genetic Marker in the Rescued Virus

[0057] To exclude the possibility that the rescued virus comes from the parental virus or wild virus strain due to the contamination during the transfection and passaging process, the base G at position 3403 of the mutant genome was mutated to T by reverse genetics method, and the mutation did not change the corresponding amino acid of the 2A protein. This mutation site was used as a molecular genetic marker site to enable the mutant strain to be distinguished from the parental strain and the wild strain through the combination of PCR and DNA sequencing. The rescued virus was passaged and purified 5 times on the duck embryo by limiting dilution assay. Total RNA was extracted from the allantoic fluid, and subjected to reverse transcription. The reverse transcription product was amplified to obtain DNA fragments containing mutation sites by PCR using F2-F and F2-R primers. The amplified fragments were separated by 1% agarose gel electrophoresis and then recovered by gel extraction using Gel Extraction kit (Omega). The DNA fragments were sequenced by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results showed that the amplified product contained introduced silent mutation (G3403T), as shown in FIG. 3, further indicating that the desired rescued virus rather than the parental strain or the wild strain was obtained.

[0058] 2.2 Detection of Genetic Stability of Rescued Virus and its Mutation Sites

[0059] To observe whether the rescued reverse genetic virus can undergo proliferation and passage in duck embryos and chicken embryos, the rescued virus of the first passage was diluted with sterilized saline in a ratio of 1:100 and inoculated into 5 duck embryos or chicken embryos aged 9 days. The results showed that the death of the duck embryos/chicken embryos mainly occurred between 24 h and 48 h after the inoculation, and obvious pathological changes were observed in the embryoid bodies. The viruses underwent successive 10 passages, and the virus fluid of each passage was collected and stored in a refrigerator at 80 C. The virus fluids from the viruses of the 1.sup.st, 5.sup.th, and 10.sup.th passages were subjected to RNA extraction and reverse transcription to produce cDNA, and then the DNA fragments containing the mutation sites were amplified through PCR, and the mutation sites and genetic marker sites were detected. As shown in FIGS. 4-6, the sequencing results showed that the viruses of the 1.sup.st, 5.sup.th, and 10.sup.th passage did not show mutations, indicating that the virus had good genetic stability.

[0060] 2.3 Virus Proliferation and Content Determination

[0061] Sterilized saline was used in the serial 10-fold dilution of the rescued DHAV-3 and parental strain, and the virus suspensions with the dilution factor of 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7 and 10.sup.8 were respectively inoculated into 5 duck embryos aged 9 days in 0.2 mL per embryo through the allantoic cavity. 5 other embryos were inoculated with sterilized saline and used as control. After the inoculation, the embryos were all incubated at 37 C. in a constant-temperature incubator. The embryos which died within 24 h were not taken into account, and the death and survival of the inoculated embryos within 7 d were observed and recorded. ELD50 of the virus was calculated using Reed-Muech method, and the results showed that the rescued virus and the parental strain had different proliferative capabilities, specifically, the virus contents in 0.2 mL of allantoic fluids from the experimental group and the control group were 10.sup.7.55ELD50 and 10.sup.4.50ELD50, respectively, indicating that the mutant strain was superior to the parental strain in the proliferative capacity in duck embryos. Therefore, the mutant strain may facilitate the production increase and cost reduction when used in the production of antigens in vaccines.

[0062] In addition, the same experimental operation was also carried out on 9-day-old chicken embryos. The results showed that the DHAV-3 mutant strain CH-P60-117C can proliferate in chicken embryos and cause the death of the chicken embryos, and the virus titer of the mutant strain in the allantoic cavity fluid of the chicken embryos was 10.sup.6.55ELD50; while the parental strain failed to proliferate in the chicken embryos and was not lethal to the chicken embryos. Given the above, the materials for culturing the mutant strain had wider sources, which will allow for reduced cost when the mutant strain was used in the production of antigens in vaccines. Moreover, the mutant strain was also different from the parental strain in the host tropism. Therefore, the mutant strain may be used as basic materials for the study of genes and key sites related to the host tropism and virulence change of duck hepatitis viruses.

[0063] 2.4 Detection of Viral Antigenicity by Serum Neutralization Test

[0064] This experiment was performed to detect whether the reverse genetic strain produced mature progeny virions during the duck embryo passage and whether the virus antigenicity had changed. The neutralizing titer of rabbit anti-DHAV-3 serum against the mutant strain and the parental strain was determined by serum neutralization test. First, the rabbit anti-DHAV-3 standard serum (titer1:128) previously prepared in the laboratory was subjected to a serial 2-fold dilution with sterilized saline to produce 9 diluted serums with a dilution degree from 2.sup.1 to 2.sup.9, and at the same time, the virus was diluted to a content of 200ELD50/0.2 mL. The diluted rabbit anti-DHAV-3 standard serums were respectively mixed with the diluted virus suspension in equal amount, added with 5% penicillin-streptomycin solution and placed in water bath at 37 C. for 1 h. Then the serum-virus mixtures were respectively inoculated into the allantoic cavity of five 9-day-old healthy duck embryos at 0.2 mL per embryo. Five 9-day-old healthy duck embryos inoculated with a mixture of healthy rabbit serum and virus were used as the negative serum control group, and five 9-day-old healthy duck embryos inoculated with a mixture of sterilized saline mixed and virus were used as blank control group. The duck embryos that died within 24 h were discarded, and the death and survival of the embryos within 7 d were observed and recorded, and then the neutralizing titer of rabbit anti-DHAV-3 standard serum against the virus was calculated.

[0065] The results showed that the rescued virus and the parental virus had similar antigenicity since the duck embryos in the negative serum control group and the blank control group all died between 24 h and 48 h after the inoculation. In the case of a serum dilution between 2.sup.1 and 2.sup.6, the duck embryos in the mutant strain neutralization group and parental strain neutralization group all survived; when the serum dilution reached 2.sup.7, the protection of the duck embryo began to lose, as the dilution degree increased, the protection rate of the duck embryo decreased; the protection of the duck embryo was completely lost until the dilution was 2.sup.9, indicating that the use of mutant strain in preparing vaccine antigens can also protect the embryo from the infection of DHAV-3.

[0066] 2.5 Virulence and Safety Test for the Susceptible Ducklings

[0067] The parental strain and the mutant strain were both subjected to safety tests. The liver tissues of the dead duck embryos in step (2.3) were collected, homogenized, added with sterilized phosphate buffer solution at a volume ratio of 1:100, ground and repeatedly frozen and thawed 3 times. The resulting tissue suspension was centrifuged at 12,000g for 10 min, the supernatant was filtered by 0.22 m filter for removing bacteria. The filtrate was inoculated into 9-day-old duck embryos through the allantoic cavity for the determination of ELD50, and then the virus solution was diluted to 10.sup.3.0 ELD50/0.4 mL. In addition, 30 one-day-old healthy ducklings were randomly divided into 3 groups. The ducklings in the test groups were inoculated with 0.4 mL of the parental strain or mutant strain by intramuscular injection, while the ducklings in the control group were inoculated with an equal volume of sterilized normal saline. The three groups of ducklings were separated and fed in different animal rooms with free access to water and feed, and observed daily after the inoculation to record the morbidity and mortality. The dead ducklings were subjected to necropsy in time, and the surviving ducklings were also subjected to necropsy after observed for 7 d to record the pathological changes in the liver, kidney and other organs of the ducklings.

[0068] No clinical symptoms were shown in the ducklings in the control group within 7 days, of which the eating and drinking behavior was normal; while the morbidity and mortality in the ducklings inoculated with the parental strain were 80% and 60%, respectively. The ducklings inoculated with the mutant strain also showed no clinical symptoms and exhibited normal eating and drinking behavior since the mutant strain underwent a significant reduction in the pathogenicity on the ducklings. Moreover, virus was detected in cloacal swabs of the ducklings inoculated with the mutant strain, which indicated that the mutant strain successfully replicated in the ducklings but was not pathogenic to the ducklings, so the mutant strain had the potential to be a candidate strain of the attenuated vaccine. The mutant strain could be distinguished from the parent strain through the combination of PCR method and DNA sequencing.

Example 3 Preparation of Inactivated Vaccine and Efficacy Evaluation

[0069] As measured in Example 2, the mutant strain CH-P60-117C had higher proliferation efficiency and virus titer in duck embryos than the parental strain, and could also proliferate in chicken embryos. Moreover, the mutant strain also had good immunogenicity and genetic stability, and significantly-reduced pathogenicity to the ducklings, and the mutant strain could proliferate in the ducklings but was not pathogenic to the ducklings. These results showed that the mutant strain ISA-A117C-T1142A-C4334A was the desired candidate strain for the preparation of DHAV-3 vaccines.

[0070] 3.1 Preparation of Vaccine

[0071] As seed virus, the DHAV-3 mutant strain CH-P60-117C was diluted 100 times with sterilized normal saline, and then inoculated into the 20 9-day-old duck embryos each for 0.2 mL through the allantoic cavity. The embryos were incubated at 37 C. in the constant-temperature incubator, and then subjected to candling inspection once 24 h after the inoculation. The dead embryos were discarded, and the remaining embryos were subjected to candling inspection every 8 h, and the dead embryos were removed immediately. All the embryos were dead 48 h after the inoculation, and the collected duck embryos were placed with the air cells upright, and cooled at 4 C. for 8 h. The allantoic fluid of the duck embryos was aseptically collected and stored at 20 C. for use.

[0072] The virus solution was processed with formaldehyde solution with a final concentration of 0.1%, inactivated at 37 C. for 24 h, diluted to 10.sup.3 ELD50/0.1 mL with sterilized normal saline and emulsified and mixed with equal volume of Fruend's incomplete adjuvant to produce the DHAV-3 mutant strain inactivated vaccine.

[0073] 3.2 Testing of Sterility and Mycoplasma

[0074] According to the appendix of the existing Veterinary Pharmacopoeia of the People's Republic of China, the inactivated vaccine was tested for sterility and mycoplasma, and the test results were both negative.

[0075] 3.3 Testing of Exogenous Virus

[0076] According to the appendix of the existing Veterinary Pharmacopoeia of the People's Republic of China, the inactivated vaccine was tested for the exogenous virus, and the test results were all negative.

[0077] 3.4 Testing of the Safety of the Vaccine

[0078] To test the safety of the vaccine, 10 one-day-old ducklings were immunized with 10 times the immunization dose, and each duckling was inoculated with 0.2 mL of the vaccine through the leg muscle. Meanwhile, 10 ducklings injected with sterilized normal saline were used as control. The ducklings were isolatedly fed with free access to water and feed. The health condition of the ducklings was observed and recorded daily, and after observed for 7 d, the ducklings were dissected. The results showed that ducklings both in the immunization group and the control group did not suffer from hepatitis, and the dissection results further showed that there were no pathological changes in the immune organs and the virus tropic tissues of the ducklings. Moreover, virus was not detected in the cloacal swab, indicating that the vaccine was not pathogenic to one-day-old ducklings.

[0079] 3.5 Immune Efficacy of Vaccine

[0080] 20 one-day-old ducklings were randomly divided into 2 groups, where 10 ducklings in the vaccination group were immunized respectively with one dose of the vaccine prepared above through intramuscular injection at the leg, and the other 10 ducklings were injected with equal volume of sterile normal saline and used as control. The ducklings in the two groups were isolatedly fed with free access to water and feed. After inoculation, the condition of the ducklings was observed and recorded daily. 7 d after the inoculation, the ducklings were challenged with 10 times the LD50 dose of parental strain, and then the morbidity and death of the ducklings were recorded daily. The dead ducklings were subjected to dissection and postmortem in time. After observation for 7 d, the dissection and postmortem were performed on the surviving ducklings, and the pathological changes in the liver, kidney, and other organs of the ducklings were recorded.

[0081] Within 7 days after vaccination, the ducklings in the vaccination group and the negative control group both did not show clinical symptoms, and the eating and drinking behaviors of the ducklings were normal. Two days after the virus challenge, some ducklings in the negative control group showed lassitude and neurological symptoms, and by the seventh day, a total of 6 ducklings died. The surviving ducklings suffered from different degrees of liver hemorrhage and other pathological changes. The morbidity and mortality of the control group were 80% (8/10) and 60% (6/10). The ducklings in the vaccination group did not show onset of disease or death, and had normal drinking and eating behavior, which indicated that the inactivated vaccine prepared from the mutant virus was safe and effective, protecting the ducklings from the challenge of homologous virulent viruses.

[0082] Described above are merely preferred embodiments of the application, which are merely illustrative of the concept and features of the invention and are not intended to limit the application. Any changes, replacements and modifications made without departing from the spirit of the application should fall within the scope of the application.