ANTIGENIC TRIPEPTIDES DERIVED FROM MYCOBACTERIUM AVIUM SUBSP. PARATUBERCULOSIS S-TYPE STRAINS, DERIVATIVES AND USES THEREOF

Abstract

The present invention is directed to an isolated synthetic tripeptide of formula H-D-Phe-N-Methyl-L-Val-L-Ala-OMe (SEQ ID NO:1), or a derivative thereof, and to the corresponding lipotripeptides, which are specific to Mycobacterium avium subsp. paratuberculosis (Map)S-type strain, as well as derivatives and conjugates thereof. The invention also concerns the use of these antigens in different methods and tests for detecting Map infection, especially by detecting humoral response and cell mediated response of infected animals. The invention is also directed to a genetic signature of Map and a mass spectrometry and NMR spectroscopy signature of Map presence or infection.

Claims

1. A method for genetically discriminating between a Mycobacterium avium subsp. paratuberculosis (Map)C-type and S-type in a sample, comprising detecting a 6.3 kb deletion in the msp1 gene of Map S-type with respect to the msp1 gene of Map C-type.

2. The method according to claim 1, wherein the sample is a sample of blood, serum, faeces, milk, lymph nodes, gut biopsies or urine.

3. A method for genetically characterizing a tested bacterium as a Mycobacterium avium subsp. paratuberculosis (Map)S-type or for detecting the presence of Map S-strain in a sample, comprising: a) amplifying the genomic DNA of the tested mycobacterium with the following primers: TABLE-US-00007 forward primer P1 (SEQ ID NO: 10) GTGCAGTACGCCGACTACAC and reverse primer P3 (SEQ ID NO: 12) ACCGGGAAAACAGCAGTG; and b) detecting an amplified product having a length comprised between 1000 and 1224 bases.

4. The method according to claim 3, wherein the amplified product has a length of about 1112 bases.

5. The method according to claim 3, wherein the amplification step is carried out by PCR.

6. The method according to claim 3, wherein the sample is a sample of blood, serum, faeces, milk, lymph nodes, gut biopsies or urine.

7. The method according to claim 4, wherein the sample is a sample of blood, serum, faeces, milk, lymph nodes, gut biopsies or urine.

8. The method according to claim 5, wherein the sample is a sample of blood, serum, faeces, milk, lymph nodes, gut biopsies or urine.

9. A method for genetically discriminating between a Mycobacterium avium subsp. paratuberculosis (Map)C-type and S-type, comprising: a) amplifying the genomic DNA of a mycobacterium with the following primers: TABLE-US-00008 forward primer P1 (SEQ ID NO: 10) GTGCAGTACGCCGACTACAC, reverse primer P2: (SEQ ID NO: 11) AGAAACCGATCAGCTCGTCG, and reverse primer P3 (SEQ ID NO : 12) ACCGGGAAAACAGCAGTG; and b) detecting an amplified product; wherein an amplified product of a length comprised between 320 and 392 is indicative of C-type and an amplified product of a length comprised between 1000 and 1224 bases is indicative of S-type.

10. The method according to claim 6, wherein the amplified product indicative of S-type has a length of about 1112 bases.

11. The method according to claim 6, wherein the amplified product indicative of C-type has a length of about 356 bases.

12. The method according to claim 9, wherein the amplification step is carried out by PCR.

13. The method according to claim 10, wherein the amplification step is carried out by PCR.

14. The method according to claim 11, wherein the amplification step is carried out by PCR.

Description

LEGEND OF THE FIGURES

[0146] FIG. 1A-D: Mass spectrometry analysis of the lipids from Map. MALDI-TOF spectra of chloroform/methanol-extracted lipids from C-type Map K-10 (A), S-type Map S397 (B), purified native L3P (C) and synthetic L3P (D). The peak at 940 amu corresponds to L5P in the lipid extract of the C-type strain K-10, but is absent from the native lipids extracted from S397. The peak at 680 amu corresponds to the L3P.

[0147] FIG. 2A-C: DNA analysis of the mps1 deletion in the S-type strains. (A) Schematic illustration showing the mps1 coding region in K-10 and S397. The larger arrow indicates the mps1 coding sequence with the Sacl sites and primer binding locations shown. The asterisk shows the location of the labeled probe used in the experiment. The shaded area represents the 6.3 kb segment that is present uniquely in the K-10 strain. The same primers were used for the experiment in panel C. (B) Agarose gel and Southern blot of Sacl-digested genomic DNAs. The right half of panel B shows the respective sizes of the Sacl fragment after hybridization with the labeled probe. Molecular size standards (M) are indicated in kilobase pairs in the left margin. The K-10 fragment is over 10 kb and the S397 fragment is approximately 6.5 kb. (C) Amplification products from a panel of C- and S-type Map DNAs using a three-primer amplification approach where P1 is the forward primer and P2 and P3 are the reverse primers used in a single reaction. The primers were designed such that the resulting PCR products would be of different sizes depending on the presence or absence of the LSP.sup.mps1. This experiment was performed using a collection of 18 C-type and S-type strains previously characterized and genotyped (Biet et al., 2012). See Table 1 for details about these strains.

[0148] FIG. 3: Proposed model for NRP assembly of L3P and L5P in Map. Shown are the modules and domains predicted for Mps1 in K-10 and S397. Based on comparative sequence analysis, modules 3 and 4 are predicted to be absent in S397. When the 3- and 5- amino acid peptide moieties are combined with the fatty acid (n=18-20), the lipopeptide emerges. The underlined amino acids in L5P are missing in L3P. C=condensation domain; A=adenylation domain; PCP=peptidyl carrier domain; E=epimerisation domain and Te=thioesterase domain to release the full-length peptide chain.

[0149] FIG. 4A-B: S-type Map contains L3P. (A) 2-D TLC of total S397 lipids (500 μg spotted), using chloroform/methanol (96:4) as first dimension and toluene/acetone (80:20) as second dimension, and chemically synthesized L3P (15 μg) as a marker (black arrows). The asterisk indicates the position of native L3P. (B) 1-D TLC of the purified native L3P (line 3), compared to the synthetic controls L5P (line 1) and L3P (line 5) using chloroform/methanol (95:5) as the solvent system. The samples are also loaded as mixtures of the adjacent spots: synthetic L5P and purified native L3P (line 2), purified native L3P and synthetic L3P (line 4). The TLC plates were sprayed with 10% copper sulfate in 8% phosphoric acid, and lipids were visualized by heating.

[0150] FIG. 5: Tandem MS spectra of purified native and synthetic L3P show identical fragmentation patterns. L3P purified from S397 lipids was analyzed by MALDI-TOF MS/MS and compared to synthetic L3P and LSP. Structure of L3P and typical fragmentation at the Phe-N-Methyl-Val bond. Table 2 reports the ions originating from the fragmentation at the Phe-N-Methyl-Val bond.

[0151] FIG. 6A-E: Alignment of Mps1 sequences from Map K-10 and S397. The amino acid sequences of Mps1 of K-10 (SEQ ID No: 16) was aligned with its homologue in S397 (SEQ ID No:17) by using the NCBI BLAST program with the BLOSUM64 matrix allowing gaps, Gap Costs: Existence: 11 Extension: 1, Compositional adjustments: Conditional compositional score matrix adjustment. The sequence corresponding to the LSP not present in S397, amino acids 179 to 5289 (underlined), was excluded.

[0152] The alignment statistics give 98% of identities (4175/4275), 98% of positives (4218/4275) and 0.7% of gaps (3/4275).

[0153] FIG. 7A-C: .sup.1H-NMR spectra of purified native and synthetic L3P show similar profiles. Synthetic L3P (A) and native L3P purified by preparative 2-D TLC (B) were analyzed by .sup.1H-NMR and compared to a contaminant compound (C) which partially co-eluted with the native L3P (typical extra peaks indicated with an asterix).

[0154] FIG. 8A-D: The native S397 L3P and the native K-10 L5P are cell surface-exposed. MALDI-TOF spectra of cell bound (A and C) and cell surface-exposed (B and D) lipids from C-type Map K-10 (A and B), and S-type Map S397 (C and D). The peak at 940 amu corresponds to L5P in the lipid extracts of the C-type strain K-10 and the peak at 680 amu to the L3P in S-type strain S397.

[0155] FIG. 9: Structures of the lipopeptides L5P and L3P identified in M. avium ssp. paratuberculosis (Map) and of their respective L5P hydrosoluble analogues L5P.sup.H2O, and L3P.sup.H2O (R═(CH.sub.2).sub.3—O(CH.sub.2CH.sub.2O).sub.2—(CH.sub.2).sub.3NHCOCH.sub.2OCH.sub.2COOH).

[0156] FIG. 10: Receiver operating characteristic (ROC) analysis of detection by ELISA of the antibody response against the L5P and L5P.sup.H2O using bovine sera. L5P is hydrophobic and solubilized in ethanol, and L5P.sup.H2O was used in ethanol or in PBS.

[0157] MAP+: Sera from bovine infected by Map and 53; Controls: sera from healthy bovine

[0158] FIG. 11: ROC analysis of detection by ELISA of the antibody response against the lipid moiety of L5P using bovine sera. The lipid (eicosanoic acid) is hydrophobic and solubilized in ethanol.

[0159] FIG. 12: Recognition of the L5P by sera of Map-infected bovines compared to M. bovis-infected bovines and Map-negative controls. The ELISA was performed with serial twofold dilution of reactive sera and the results are expressed as the means of triplicates.

[0160] FIG. 13: Immunodetection of L5P by sheep sera naturally or experimentally infected with S-type strains of Map. (Control n=15, positive n=39)

[0161] FIG. 14: ELISA recognition of L3P by bovine or sheep sera (n=3) naturally infected with C- or S-type strains of Map, respectively. Ref+; reference bovine positive serum to Map (n=3). Ref-; reference bovine negative serum to Map (n=3).

[0162] FIGS. 15A-B: T cell and B cell response to the Map lipopeptides. Proliferation of CD25+ T cells (FIG. 15A) and B cells (FIG. 15B) after culture of PBMCs isolated from cows naturally infected with Map and exposed to lipopeptides. Results are presented as percentage of CD25+ T or B cells (mean±SEM).

[0163] FIG. 16: Cytokine secretion by PBMCs after 24-hour stimulation with Map lipopeptides. Shown are cytokines measurements on PBMCs isolated from control cows and cows naturally infected with Map. Results are expressed as picograms/ml for IFN-γ (left), IL-1β (middle) and TNF-α (right) after stimulation with either bovine (K-10) or ovine (S397) strains of Map or lipopeptides L3P and L5P (1 μg/ml (1); 5 μg/ml (5); 10 μg/ml (10)). Histogram bars represent the mean with error bars indicating the SEM.

EXAMPLES

Example 1: Identification of Cell Wall Peptidolipid of M. avium Subsp. Paratuberculosis (Map) Ovine Strain (S-Type)

[0164] Mycobacteria have a complex cell wall structure that includes many lipids; however, even within a single subspecies of Mycobacterium avium these lipids can differ. Total lipids from an M. avium subsp. paratuberculosis (Map) ovine strain (S-type) contained no identifiable glycopeptidolipids or lipopentapeptide, yet both lipids are present in other M. avium subspecies. The inventors determined the genetic and phenotypic basis for this difference using sequence analysis as well as biochemical and physico-chemical approaches. This strategy showed that a nonribosomal peptide synthase, encoded by mps1, contains three amino acid specifying modules in all ovine strains analyzed, compared to five modules in bovine strains (C-type). Sequence analysis predicted these modules would produce the tripeptide Phe-N-Methyl-Val-Ala with a lipid moiety, termed lipotripeptide (L3P). Comprehensive physico-chemical analysis of Map S397 extracts confirmed the structural formula of the native L3P as D-Phe-N-Methyl-L-Val-L-Ala-OMe attached in N-ter to a 20-carbon fatty acid chain. These data demonstrate that Map S-type strains, which are more adapted in sheep, produce a unique lipid. Implications for these lipid differences may include patho-evolution toward host specificity and disease presentation.

[0165] Introduction:

[0166] Map is considered as a genetically homogenous subspecies of M. avium, especially among bovine, human and wildlife isolates (Wu et al., 2006). However, two primary lineages have emerged following extensive phylogenetic analyses and comparative genomic studies (Biet et al., 2012). These lineages are classified as type I/III or S-type (ovine) and type II or C-type (bovine) strains. Map appears to have emerged from the common ancestor, M. avium subsp. hominissuis, to yield these two lineages. The Map C-type was first isolated from cattle and is the most commonly isolated type, while the Map S-type are typically isolated from sheep and are less prevalent. The S-type isolates are readily distinguishable from C-type isolates based on genome sequencing studies (Li et al., 2005, Bannantine et al., 2012). But these two lineages can also be readily discriminated by genotyping methods due to single nucleotide polymorphisms (Marsh et al., 1999) as well as deletions/insertions of large DNA segments (termed large sequence polymorphisms or LSP) using phylogenetic techniques such as variable number tandem repeats (Lefrancois et al., 2013), single sequence repeats (Amonsin et al., 2004, Thibault et al., 2008), representational difference analysis (Dohmann et al., 2003) and hsp65 sequencing (Turenne et al., 2006). Furthermore, genomic hybridization of S-type strains on a C-type microarray revealed a large 23-gene deletion in S-type strains (Marsh et al., 2006). However, in no case has a genetic difference been linked to a phenotypic difference between C- and S-type strains, until this study.

[0167] In addition to the genotypic distinctions between S- and C-type strains, phenotypic differences involving growth characteristics have been noted since the middle of the last century. The S-type strains are more fastidious and have slower growth rates in laboratory media than C-type strains. In contrast to C-type, the S-type strains do not grow readily on Herold's egg yolk media or Middlebrook 7H9 media that is not supplemented with egg yolk (Whittington et al., 2011). Nutrient limitation will kill S-type strains but it is only bacteriostatic for C-type (Gumber et al., 2009). Motiwala and coworkers have shown transcriptional changes in human macrophages infected with C-type, human and bison isolates, which induce an anti-inflammatory gene expression pattern, while the Map S-type isolates showed expression of pro-inflammatory cytokines (Motiwala et al., 2006), (Stevenson et al., 2002, Biet et al., 2012). Furthermore, many of the S-type strains are pigmented while C-type strains are not. On the transcriptional level, C- and S-type strains exposed to low iron or heat stress conditions had different mRNA expression patterns (Gumber & Whittington, 2009). Furthermore, iron storage in low iron conditions was only observed in the C-type but not S-type strains (Janagama et al., 2009) and virulence adhesin differences were characterized (Lefrancois et al., 2013). In this study, differences in a lipopeptide that is a component of the mycobacterial cell envelope were identified between C- and S-type strains.

[0168] Non-ribosomally synthesized peptides include a diverse class of important metabolites such as antibiotics. Nonribosomal peptides (NRP) are usually 3-10 amino acids in length and are synthesized by large multi-modular enzymes called non-ribosomal-peptide synthetases (NRPSs). These peptides are not assembled by ribosome, but rather are RNA template and ribosomal independent to allow for maximum biological flexibility by incorporating many unique amino acids. Although 10% of bacterial NRPS genes are non-modular (Wang et al., 2014), most have a modular organization where each module specifies the sequential addition of an amino acid. Several kilobases of DNA are needed for each module that consists of three domains termed the adenylation domain, peptidyl carrier domain and condensation domain. The adenylation domain binds ATP, selects its cognate amino acid building block and performs substrate acyl adenylation. Amino acid translocation occurs with the peptidyl carrier domain. The largest NRPS yet discovered is from Photorhabdus luminescens (WP_011146892; 16,367 aa) and contains 15 modules (Wang et al., 2014). This may represent the upper limit of NRPSs. In Map the mps1 gene encodes a NRPS with five modules that have been previously shown to be involved in production of the pentapeptidic moiety of the lipopentapeptide (L5P) (Biet et al., 2008).

[0169] The objective of this study was to identify the composition of lipopeptides in the S-type strains of Map and determine if they are different from the C-type strains.

[0170] Genetic characterization allowed the inventors to predict the production of different lipopeptide components, depending on the strain type. Synthesis of the predicted S-type lipopeptide together with thorough biochemical and physico-chemical analyses demonstrated that typical lipopeptides from Map are different in S-type (lipotripeptide) and C-type strains (lipopentapeptide). Overall, the inventors reveal key elements of Map cell wall change, involving genes and lipopeptides, occurring on the patho-evolution of the subspecies paratuberculosis.

[0171] Results:

[0172] The lipid composition differs between C- and S-type strains of Map. A panel of genetically diverse Map strains isolated from different animal species appears similar in their lipid profiles when analyzed by thin layer chromatography (TLC) in a single dimension (1-D) (Biet et al., 2008). However, the analysis of extracted lipids from both the S397 and K-10 Map (sequenced strains characteristic of S- and C-type, respectively) revealed a striking difference by Matrix-Assisted Laser Desorption Ionization-Time Of Flight Mass Spectrometry (MALDI-TOF MS). Only the C-type strain showed a major peak at a mass-to-charge ratio (m/z) of 940 atomic mass units (amu) (FIG. 1A), which corresponds to the [M+Na].sup.+ ion of the previously characterized L5P (Riviere et al., 1996). Additional minor peaks were also observed differing by 14 amu (including a peak at m/z 968 amu), all of which are present uniquely in the C-type strain, and assigned to variable lengths of the fatty acid moiety of the L5P (Biet et al., 2008, Eckstein et al., 2006). Instead of the ion peaks at m/z 940±14 amu, the extracted lipids from the S397 strain show three major peaks at 680, 694 and 708 amu (FIG. 1B). The rest of the MS spectra were nearly identical between the two strains. These data indicate that the lipid composition of the S397 sheep strain is different from that of the C-type strains and does not include the L5P molecule.

[0173] The mps1 gene is different between C- and S-type strains. A comparative genomic study was performed to determine the genetic basis for the absence of L5P in S397. While approximately 28 genes are necessary for GPL biosynthesis (Ripoll et al., 2007), the peptide core of L5P in Map is assembled by the product of a single nrps gene, termed mps1 (Biet et al., 2008). The mps1 gene of Map K-10 is also known by the locus tag MAP_1420 and has a size of 19.15 kb encoding 6,384 amino acids (Li et al., 2005). This gene is under the control of the LuxR regulator and has shown increased transcription when exposed to cow's milk (Alonso-Hearn et al., 2010). It has been suggested that the pentapeptide moiety is non-ribosomally assembled by the modules encoded in this gene (Eckstein et al., 2006), therefore, it was of interest to examine the homolog in the S-type strain. However, previous de novo whole genome assemblies of the Map S397 genome using the available Roche GS20, Roche FLX (i.e. 454), and Sanger sequence data (Bannantine et al., 2012) were unsuccessful at producing a complete assembly of the mps1 gene due to the large size and the presence of long, highly syntenic repeats in the amino-acid-specifying modules. Therefore two large sequence gaps were present in mps1 in the S-type genome.

[0174] While genome sequencing revealed that the mps1 gene is present in the S-type strain, the question of why that strain does not produce L5P remained unanswered. To address this, additional sequence data were obtained to completely assemble the region containing mps1 in the S397 genome. Surprisingly, the mps1 gene was only 12,822 bp in size compared to 19,148 bp in the K-10 genome, representing a difference of 6,326 bp. Southern blot analysis was used to confirm the 6.3 kb deletion (FIGS. 2A and 2B). By taking advantage of two Sacl restriction sites that border the deletion (FIG. 2A), it was observed that the S397 Sacl fragment was approximately 6 kb smaller than the corresponding fragment in K-10 (FIG. 2B).

[0175] The deletion was further characterized by PCR analysis and tested across multiple strains (Table 1). To verify that the difference in size of the mps1 gene is characteristic of all sheep strains, a PCR to detect this large sequence polymorphism (LSP.sup.mps1) was developed based on the model described by Semret et al. (Semret et al., 2006). From the mps1 locus in K-10, three primers (P1, P2, and P3, forward primer P1 GTGCAGTACGCCGACTACAC (SEQ ID NO:10);reverse primer P2: AGAAACCGATCAGCTCGTCG (SEQ ID NO:11) and reverse primer P3 ACCGGGAAAACAGCAGTG (SEQ ID NO:12) were designed and used in a single reaction to amplify DNA depending on the presence or absence of the 6.3 kb region (FIG. 2A). The primers were designed so that the size of the PCR product is different when using this 3-primer combination. The P1-P3 pair results in no amplification from C-type DNA due to the large distance between primers. However, P1-P2 results in successful amplification since they are only separated by 376 bp (FIG. 2C). Conversely, the P1-P2 primer combination does not work in S-type strains since P2 is located within the LSP.sup.mps1 (FIG. 2A). However, P1-P3 does amplify S-type DNA because they are only separated by 1,112 bp due to the LSP.sup.mps1 (FIG. 2C). Collectively, these results confirmed the boundaries of the deletion and showed it is consistent in all ten S-type strains tested including characteristic subtypes I and III.

TABLE-US-00003 TABLE 1 Source of strains or DNA used and their genotyping characterization Type Strain ID Host origin Subtype Country K10 Bovine C II USA S397 Ovine S III USA 235G Ovine S I UK, Shetland M189 Ovine S I UK, Scotland 22G Ovine S III ES, Basque 269OV Ovine S III ES, Basque FO21 Ovine S III ES, Aragon OVICAP16 Caprine S III ES, Andalucia OVICAP34 Ovine S III ES, Basque OVICAP49 Ovine S III ES, Navarra PCR311 Caprine S III ES, Balearic  13 Bovine C II France  20 Bovine C II France  47 Bovine C II France  54 Bovine C II France  64 Bovine C II France  85 Bovine C II France 104 Bovine C II France

[0176] NRPS encoded by mps1 is missing modular domains in the S-type strains. The NRPS of mps1 is modular in its organization such that each module specifies the incorporation of one amino acid in the peptidic moiety of the lipopeptide. It became of interest to examine how the LSP.sup.mps1 deletion might have affected lipopeptide production in the S-type strains. Using bioinformatics (Rottig et al., 2011), the functional modules and domains within each module of the NRPS were identified and this analysis established that the S-type NRPS is composed of 3 modules while the C-type has 5 modules. Furthermore, these analyses have established the nature and the position of the NRPS domains in S-type along with the domains present in C-type but missing in the S-type strain (FIG. 3). Comparison of the protein sequences corresponding to the three domains of Mps1 present in both strains shows a perfect homology suggesting a same functionality in terms of amino acid assembly (see FIG. 6).

[0177] Altogether, the sequence analysis and bioinformatic predictions of NRPS module composition identified the tripeptide Phe-Val-Ala as the antigen backbone. By analogy with the known L5P, the inventors therefore predicted that the S397 strain produces a lipotripeptide, named L3P, bearing the same structural formula as L5P but missing the two amino-acids L-Ile and L-Phe (FIG. 3).

[0178] S-Type Strains Produce a Lipid Antigen Identical to the Synthetic Lipotripeptide L3P.

[0179] To determine if S-type Map effectively produces this novel L3P antigen, the L3P molecule was chemically synthesized and compared with the native source of lipid (either the crude or the purified lipid extract from S397).

[0180] The synthetic L3P was obtained by solid-phase peptide synthesis using Fmoc chemistry and purified by chromatography on silica gel. It was then used as a control in a series of physico-chemical comparative analyses to formally identify the S-type lipid antigen.

[0181] Analysis and Purification by TLC

[0182] The analytical 2-dimensional (2-D) TLC of S397 lipid extracts shows a spot, not as prominent as L5P in C-type strains, co-migrating with the synthetic L3P (FIG. 4A). After loading a preparative 2-D TLC with 7 mg of crude extract obtained from 317 mg of cells (dry weight), the spot of interest was purified by scraping the silica gel and subsequent elution in CH.sub.2Cl.sub.2/methanol 95:5 (vol/vol). The resulting purified native antigen (approximately 50 μg) is clearly different from the C-type Map L5P, and it co-migrates with the synthetic L3P, as shown by the 1-D TLC (FIG. 4B).

[0183] Analysis by MALDI-TOF MS and MS/MS

[0184] The peak of the synthetic L3P at m/z 680 amu ([M+Na].sup.+ ion) matches that of the native antigen from the S397 strain, whether in the crude extract or in the purified lipids (FIGS. 1B, 1C and 1D). The extra peaks differing by 14 amu (i.e. one methylene unit) observed for the native antigen (FIGS. 1B and 1C) suggest the presence of different fatty acid chain lengths. In particular, the compound at m/z 708, which co-elutes with the L3P in 2-D TLC, may correspond to the L3P with a C.sub.22 acyl chain. The presumed L3P antigen is O-methylated at the C-terminus, as are the synthetic L3P and the L5P from C-type Map (Biet et al., 2008). Indeed MALDI-TOF MS of both the synthetic and native L3P compounds showed, after saponification, a down-shift of 14 amu of the molecular ion, due to the hydrolysis of the O-methyl ester group from the C-terminus (data not shown). Additional MS/MS analysis was conducted to confirm the structure of the putative L3P compound. Importantly, the purified S397 lipid and the synthetic compound displayed identical MS/MS spectra. Probably because of the unusual structure of the lipopeptide, specifically the acylation at the N-terminus and the presence of an N-Methyl-Val residue, fragmentation of the peptide moiety of the synthetic L3P did not yield all the expected canonical couples of fragment ions, namely, the [a, b, c] ions from the N-terminus and the [x, y, z] ions from the C-terminus (FIG. 5). Nevertheless, from the parental ion m/z 680 amu, the major observed fragmentation peaks were shared between synthetic and native L3P and were totally in agreement with the structural formula of the L3P. Representative fragment ions detected and corresponding to all the possible cleavages of the peptidic bond between the Phe and the N-Methyl-Val residues are shown in Table 2. This bond has been chosen because i) it gives the most complete sampling of the various fragment ions expected after cleavage of a peptide bond (FIG. 5) and it is conserved in both the L3P and L5P lipopeptides and ideally located to discriminate between these two compounds. Indeed, L3P and L5P share a common structure at the N-terminus, from the C20 fatty acid to N-Methyl-Val (FIG. 3). MS/MS analysis of the parental ions at m/z 694 and 708 amu of the native L3P variants confirmed the identity of the [a, b, c] fragment ions (N-terminal moiety of the lipopeptide with variation of 14 or 28 amu for the fragment ions, according to the variation of the length of the fatty acyl chain) and of the [x, y, z] fragment ions (invariant C-terminal moiety regardless of the length of the fatty acyl chain) (Table 2). Fewer expected fragment ions were detected with the 694 species of the L3P, probably due to the lower intensity observed with the corresponding parental ion.

[0185] Finally, MS/MS analysis of the L5P parental ion at 940 amu confirmed the assignment of these fragment ions: the [a, b, c] ions were identical between L3P and LSP, and the [x, y, z] ions increased in agreement with the presence of two additional amino acids (Table 2). Collectively, these data are consistent with an identity of structure between the purified native S397 lipid and the synthetic L3P, i.e. a tripeptide sequence Phe-N-Methyl-Val-Ala with a N-ter C20 fatty acid and a C-ter methyl ester.

TABLE-US-00004 TABLE 2 Ions originating from the fragmentation at the Phe-N-Methyl-Val bond. Antigen L3P L3P L3P L3P L5P Source native synthetic native native synthetic Parental ion (m/z) 680.7 680.7 694.5 708.6 940.7 Fatty acyl chain C20 C20 C21 C22 C20 a2 436.7 436.7  (464.5)* 436.5 x2 (267.3) (267.3) 527.4 b2 464.6 464.6 (478.4) 492.5 (464.5) y2 239.3 239.3 239.3 239.2 499.4 c2 495.7 495.7 523.4 495.5 z2 208.3 208.3 208.2 208.2 468.4 *in brackets: peak of low intensity

[0186] Analysis by Nuclear Magnetic Resonance (NMR) Spectroscopy.

[0187] To confirm the structure of the native antigen, .sup.1H-NMR spectroscopy was performed on the presumed L3P purified from the lipid extract of S397 cells.

[0188] Results of the NMR analysis were in agreement with the structure proposed for the native L3P. .sup.1H-NMR spectra of the purified S397 lipid and the synthetic L3P are overlapping (FIGS. 7A and 7B), showing all the characteristic peaks for Phe, N-Methyl-Val and Ala, including peak multiplicities, coupling constants and chemical shifts (Table 3). The spectra revealed three resonances characteristic of the alpha protons of Phe, Val and Ala at 5.20, 4.47 and 4.50 ppm respectively. Two resonances typical of the amide region instead of three, between 6.0 and 7.0 ppm, confirm that one of the amino acids has no amide proton. The presence of a singlet at 2.92 ppm is consistent with the presence of a N-Methyl group on this amino acid.

TABLE-US-00005 TABLE 3 Characteristic 1H NMR data for the native purified L3P The synthetic L3P gives similar data Chemical Peak multiplicity, shift (ppm) Coupling constant Assignment* 0.61 Doublet, J = 6.8 Hz γ-CH.sub.3 Val 0.97 Doublet, J = 6.4 Hz γ-CH.sub.3 Val 1.35 Doublet, J = 7.4 Hz β-CH.sub.3 Ala 2.22 Multiplet β-CH Val 2.92 Singlet N—CH.sub.3 Val 2.95/3.06 2 Doublets of doublet, J = 13.4 Hz β-CH.sub.2 Phe 3.52 Singlet O—CH.sub.3 4.47 Doublet, J = 10.9 Hz α-CH Val 4.50 Pentet α-CH Ala 5.20 Multiplet α-CH Phe 6.08 Doublet, J = 7.9 Hz NH Phe 6.52 Doublet, J = 7.6 Hz NH Ala *The assigned protons are underlined

[0189] The assignments (Table 3) were determined by the .sup.1H-.sup.1H-COSY NMR experiment where typical spin systems were observed for the three amino-acids.

[0190] .sup.1H-NMR spectrum of the purified S397 shows additional peaks in comparison to the synthetic L3P (FIGS. 7A and 7B). These peaks may originate from distinct contaminant compound(s) which partially co-elute with the L3P during the preparative 2-D TLC. Indeed, the .sup.1H-.sup.1H-COSY NMR spectra show that spin systems of the extra peaks are not linked to any of the L3P peaks. Moreover, when the preparative TLC silica gel was scraped in the zone adjacent to that of L3P, the resulting eluted compound unambiguously gave a 1H-NMR spectrum displaying all the peaks that could not be attributed to L3P in the characteristic range from 2 to 5 ppm (FIG. 7C). Due to the resolution limit of the 2-D TLC and to the very low amount of native antigen, the complete purification of the antigen could not be achieved.

[0191] Nevertheless these results, together with the MS data highlighting the presence of L3P, demonstrate that the S397 strain produces a lipid content with, at least, the L3P compound.

[0192] Analysis of the Optical Purity

[0193] Finally, the optical purity of the individual amino acids within the native L3P was determined by gas chromatography coupled to MS after hydrolysis of the lipopeptide in 6N DCI in D.sub.2O.

[0194] The results demonstrated the presence of the enantiomeric forms of D-Phe (91.4%), N-Methyl-L-Val (99.0%) and L-Ala (98.3%) (data not shown). Notably, in the course of this analysis, the identity of the three predicted amino acids was also confirmed based on their retention time and their mass spectra. Overall, the structure proposed for the L3P (FIG. 5) produced by S-type Map from the sequence of the mps1 gene has been confirmed: a peptidic core as D-Phe-N-Methyl-L-Val-L-Ala attached mostly to a 20-carbon fatty acid chain.

[0195] Lipopeptides are Cell Surface-Exposed

[0196] It has been assumed for a long time that L5P is localized in the cell wall of Map, but to the best of inventors' knowledge this has never been experimentally demonstrated. Analysis by MALDI-TOF MS of the lipids extracted from surface-exposed materials of Map K-10 shown that L5P is localized in the outer-most layers of the cell envelope (FIGS. 8A and 8B). Control TLC established that cord factor, a lipid which is never exposed at the mycobacterial cell surface (Ortalo-Magne et al., 1996) is indeed absent from the surface-exposed material analyzed here (data not shown), thus strengthening the inventors' conclusions.

[0197] Similarly, L3P was detected in surface-exposed materials prepared from Map S397 (FIG. 8D). MS/MS analysis of the compound at m/z 680 confirmed its identity as L3P, since all the representative fragment ions are present (data not shown). Minor amounts of cord factor were also detected in the surface extract of S397 (data not shown), suggesting a certain degree of cellular lysis for that strain. Nevertheless, the fact that the cell-bound and surface-exposed fractions displayed different lipid compositions (FIGS. 8C and 8D) suggests that L3P should be present at the cell surface of the S-type strain. But additional experiments are needed to confirm this localization. In both cases, detection of lipopeptides in the cell-bound lipidic fraction (FIGS. 8A and 8C) implies that they are also present within deeper layers of the cell-envelope.

[0198] Discussion:

[0199] In the process of characterizing the differences in lipids among C-type and S-type strains of Map, the inventors uncovered a new LSP not previously described. LSPs have been shown to distinguish Map from other M. avium subspecies, including hominissuis and silvaticum. In addition, three S-type-specific LSPs were characterized by genomic hybridization to DNA microarrays (Marsh et al., 2006). While these LSPs usually span several genes and range in size from 4.5 kb to over 65 kb, the LSP reported here is located exclusively within the mps1 gene and spans 6.3 kb of DNA present in C-type strains, but not in any of the S-type strains examined. It is likely that this LSP remained hidden, despite extensive genomic comparison studies, because it is entirely contained within a single gene. This newly discovered LSP now provides an additional target to distinguish S-type from C-type strains of Map.

[0200] Over 10% of the mycobacterial genome is coded for proteins involved in lipid metabolism. Large genes, including mmpL/S, pks and nrp are involved in lipid biosynthesis or transport (Ripoll et al., 2007), but the role of each of these needs to be determined by investigating genetic differences and correlating those to phenotypic differences as has been accomplished for lipooligosaccharides in M. smegmatis. Although numerous genetic differences between C- and S-type Map strains have been reported, the inventors' results represent the first example of a genetic difference that has been phenotypically defined. It had been previously thought that all Map strains produce L5P since only one bovine strain had been evaluated by 2-D TLC (Eckstein et al., 2006) and several other Map strains examined by 1-D TLC (Biet et al., 2008); however, 1-D TLC did not resolve differences due to limits of the technique. The difference in lipid composition was discovered only through extensive biochemical and physicochemical analysis of lipid extracts combined with detailed sequence and assembly of the large and highly repeated mps1 gene in the S-type strain.

[0201] Based on TLC analysis, Map does not produce GPLs but instead contains a lipopeptide molecule (Biet et al., 2008) initially termed Lipopeptide-I (Riviere et al., 1996) and later Para-LP-01 (Eckstein et al., 2006). This nonpolar lipid, most recently termed L5P for lipopentapeptide, is an abundant molecule in Map and is not detected in M. avium subsp. avium (Eckstein et al., 2006). It has been demonstrated that L5P is antigenic in antibody-based tests (Biet et al., 2008, Verdier et al., 2013) with minor cell-mediated immune responses, and can stimulate IFN-γ (Holbert et al., 2015). The inventors further show for the first time that L5P is clearly surface-exposed, i. e. localized in the outer-most layers of the cell envelope. The antigenicity of L3P in the S-type strains has yet to be tested, but as the L3P amino acids are conserved with that of L5P, it is unlikely that L3P will enable the specific detection of S-type Map strains.

[0202] The unique mycobacterial cell wall is important in the physiology of these bacteria and has been studied for its properties on immune stimulation and increased virulence (Howard et al., 2006, Bernut et al., 2014). Considering that L3P shares with L5P and GPLs a cell-envelope surface localization, and depending on the presence/absence of GPLs and lipopeptides described herein for a small subset of closely related mycobacteria, their physiological properties may change greatly depending on the mycobacterial strain and their evolutionary history.

[0203] NRPSs create substantial biological flexibility because no ribosomes or RNA template are needed for peptide assembly. The ribosome recognizes only 20 naturally occurring amino acids for peptide assembly; however, NRPS can specify over 500 amino acids, creating unlimited peptides for highly specialized biological functions (Walsh et al., 2013). In this study the inventors showed that the tripeptide produced in S-type strains consists of only one naturally occurring amino acid, L-Ala, and two that are “non-coded” amino acids. The C-type mps1 has five modules encoding a lipopentapeptide, but there are examples of two NRP genes, arranged in tandem, that together encode a five module NRPS to construct the antibiotic nocardicin A (Gaudelli et al., 2015). Perhaps to further increase diversity in these nonribosomal peptides, known NRPSs can be classified into three groups, linear, iterative and nonlinear. In linear NRPSs, the sequence of the resulting peptide chain is entirely determined by the number and order of the modules. Iterative NRPSs use their modules or domains more than once in the assembly of one single product. Nonlinear NRPSs involve complex scenarios with parallel nonlinear organization of domains and unusual arrangements such as internal cyclisation or incorporation of small soluble molecules. Data from this study show that mps1 for both L3P and L5P NRPSs are linear in organization.

[0204] Could the defined change in peptide length described in this study be enough to account for host preferences in C- and S-type strains of Map? S-type has a substantial host preference for sheep, but not exclusively, since S-type has also recently been isolated from several Arabian camels (Ghosh et al., 2012). However, C-type has a broader host range since it has been isolated from many ruminant species, including goat, deer and bison (Biet et al., 2012, Sibley et al., 2007). Nonetheless, there is a clear host preference or adaptation among these strains. It may be possible that this subtle change in peptide composition could define the growth rates or other phenotypic differences between these types. However, it can be excluded the fact that this NRP is responsible for pigment production reported in the S-type strains (Biet et al., 2012), since the inventors observed that L3P is colorless (data not shown). Regardless, it is clear that both lipopeptides share common epitopes since D-Phe, N-Methyl-L-Val and L-Ala are conserved in both Map types. The two amino acids missing from the S-type strain L3P are L-Ile and L-Phe. Mutational studies will confirm this point.

[0205] Rough and smooth colony appearance among Mycobacterium species is not only attributed to changes in their lipid composition (Wright et al., 1996) but also to virulence and drug resistance (Kansal et al., 1998, Howard et al., 2006). In fact L5P disappears when Map are cultured in cow's milk but is present in high abundance when cultured in Middlebrook 7H9 media (Alonso-Hearn et al., 2010), suggesting that the lipid profile of Map changes significantly when exposed to different environments. But there may be much more going on biologically that accounts for these lipid differences. Only recently were lipopeptides shown to interact with TLR2 receptors on key immune cells (Jimenez-Dalmaroni et al., 2015). Much research is still needed in this area to understand the biological significance of subtle lipid changes among mycobacterial species and isolates.

[0206] Materials and Methods:

[0207] Culture of S-type Map. S397 is an S-type strain of Map that has been previously characterized by whole genome sequencing (Bannantine et al., 2012). It was initially isolated from a Suffolk breed of sheep in Iowa in 2004. Both strains S397 and K-10 were cultured in Middlebrook 7H9 media (BD Biosciences, San Jose, Calif.) supplemented with 10% OADC, 0.05% TWEEN 80 (Polyoxyethylenesorbitan monooleate) and 2 μg/mL Mycobactin J. The culture conditions were 37° C. with no shaking in 2-liter Erlenmeyer flasks each containing 500-mL volumes of media. Milligram quantities were obtained from multiple cultures for downstream analyses.

[0208] Sequencing and assembly of mps1. A combination of sequencing and assembly strategies were required to fully assemble the mps1 gene from Map S397. The large size of this gene and the presence of long repeats resulted in incomplete mps1 assembly regardless of the assembler employed (MIRA v. 3.9.9, Roche gsAssembler v. 2.6, and Velvet v. 0.7.09). Targeted de novo subassemblies of the mps1 region were created by first extracting reads that mapped to the region via MIRA's mirabait functionality using the partial contigs that aligned with MAP_1420 from K-10 and the MAP4_2425 homolog (Bannantine et al., 2014) as targets, and then de novo assembling those reads with MIRA. This was done in an iterative fashion and was supplemented as needed with additional targeted subcloning, PCR, and Sanger sequencing of the mps1 gene region until full unambiguous assembly was obtained. The GenBank accession number for mps1 in Map S397 is KP720596.

[0209] Southern hybridization analysis. Mycobacteria were grown to late log phase in Middlebrook 7H9 medium (10 mL) and harvested by centrifugation at 6,000×g for 10 min. The bacteria were heat killed for 10 min at 95° C. The pellet was resuspended in 10 mL of TE buffer (10 mM Tris-HCl [pH 7.6], 1 mM EDTA) and centrifuged again at 6,000×g for 10 min. The semidried mycobacterial pellet was resuspended into 1 mL TE buffer (10 mM Tris-HCl [pH 7.6], 1 mM EDTA). After the addition of 200 μL of lysozyme (200 mg/mL) and incubation overnight at 37° C., 100 μL of SDS 10% and 50 μL Proteinase K (Macherey-Nagel) were added and incubated 4 hours at 56° C. 100 μL of 10% CTAB were mixed and incubated for 1 h at 65° C. 1 volume of phenol-chloroform-isoamyl alcohol (25:24:1 (vol/vol)) was added and the solution was vigorously mixed and then centrifuged at 14,000×g for 5 min in phase lock gel (Qiagen). The supernatant was mixed with 1 volume of chloroform-isoamyl alcohol (24:1 (vol/vol)) and centrifuged again. The DNA was precipitated by the addition of 0.8 volume of isopropanol and 0.3 M sodium acetate (final concentration). After centrifugation for 30 min at 14,000×g, the DNA was air dried, dissolved in 50 μL of TE buffer (10 mM Tris-HCl [pH 7.6], 1 mM EDTA), and stored at −20° C. until further use.

[0210] Southern blot of Map DNA was performed as previously described (Southern, 1975, van Soolingen et al., 1994) with some modifications. The mps1 DNA probe was prepared by PCR amplification of a 491-bp fragment sequence specific for Map using the primers described in this study (table 4). PCRs were performed starting from 10 ng of chromosomal DNA of Map strain K-10 by using a TC-512 thermal cycler (Techne). The PCR product was purified on Macherey-Nagel spin columns according to the manufacturer's instructions. The probe was biotin labeled with the NEBlot Phototope kit (New England Biolabs) by following the instructions of the manufacturer. Digestion was performed with 3 μg of DNA prepared as described above and 7 U of Sacl (Promega) at 37° C. for at least 6 h. Fragments were resolved by agarose gel electrophoresis and transferred onto lmmobilon-S nylon membranes (Millipore) by vacuum transfer with the Vacu-Gene system (Pharmacia LKB Biotechnology). Detection of DNA fragments hybridizing with the biotinylated probe was performed with the Phototope-Star detection kit for nucleic acids (New England Biolabs), according to the manufacturer's instructions. The 2-Log DNA Ladder (New England Biolabs) was used as a molecular size marker.

TABLE-US-00006 TABLE 4 primer sequences: Primer 1: forward primer; primers 2 and 3: reverse primers: Target: MIRU 292 Primer 1: CTTGAGCAGCTCGTAAAGCGT (SEQ ID NO: 18)- Primer 2: GCTGTATGAGGAAGTCTATTCATGG (SEQ ID NO: 19) Target MIRU X3 Primer 1: AACGAGAGGAAGAACTAAGCCG (SEQ ID NO: 20)- Primer 2: TTACGGAGCAGGAAGGCCAGCGGG (SEQ ID NO: 21) target: VNTR 25 Primer 1: GTCAAGGGATCGGCGAGG (SEQ ID NO: 22)- Primer 2: TGGACTTGAGCACGGTCAT (SEQ ID NO: 23) target: VNTR 47 Primer 1: CGTTGCGATTTCTGCGTAGC (SEQ ID NO: 24)- Primer 2: GGTGATGGTCGTGGTCATCC (SEQ ID NO: 25) target: VNTR 3 Primer 1: CATATCTGGCATGGCTCCAG (SEQ ID NO: 26)- Primer 2: ATCGTGTTGACCCCAAAGAAAT (SEQ ID NO: 27) target: VNTR 7 Primer 1: ACAACGAAACCTACCTCGTC (SEQ ID NO: 28)- Primer 2: GTGAGCTGGCGGCCTAAC (SEQ ID NO: 29) target: VNTR 10 Primer 1: GACGAGCAGCTGTCCGAG (SEQ ID NO: 30)- Primer 2: GAGAGCGTGGCCATCGAG (SEQ ID NO: 31) target: VNTR 32 Primer 1: CCACAGGGTTTTTGGTGAAG (SEQ ID NO: 32)- Primer 2: GGAAATCCAACAGCAAGGAC (SEQ ID NO: 33) target: msp1 probe Primer 1: CGCGGCGAGCGGGAGCTGGTGC (SEQ ID NO: 34)- Primer 2: CGCAGCGGGGAGCGCCGGTCGG (SEQ ID NO: 35) target: LSP mps1 Primer 1: GCAGTACGCCGACTACAC (nt 3-20 of SEQ ID NO: 10)- Primer 2: AGAAACCGATCAGCTCGTCG (SEQ ID NO: 11) Primer 3: ACCGGGAAAACAGCAGTG (SEQ ID NO: 12) target: LSP A 20 Primer 1: GGCGTTACAGAATTGCCTTG (SEQ ID NO: 36)- Primer 2: GCTCGAAGTTGGAGATCAGG (SEQ ID NO: 37) Primer 3: GTACGTGGTGACCAATGTCG (SEQ ID NO: 38) target: LSP A 4-II Primer 1: TAGAAGGTGCGGGAAAGTTG (SEQ ID NO: 39)- Primer 2: GTCTATCTGGCGGTGCTCTC (SEQ ID NO: 40) Primer 3: GTCGAAGCAGCGTTGATTG (SEQ ID NO: 41) target: GyrA locus 34 Primer 1: TGTTCTTCACCACCCAGGGCCGGG (SEQ ID NO: 42)- Primer 2: TTGAGCGACAGCAGGTAGTCGTCGGCG (SEQ ID NO: 43) target: GyrB locus 45 Primer 1: TTGGTGCGCCGCAAGAGCGCAACCG (SEQ ID NO: 44)- Primer 2: ATTTCAGCTTGTACAGCGGTGGC (SEQ ID NO: 45) Reference : Thibault, et al (2007) Semret et al. (2006) and Castellanos et al. (2007)

[0211] Reaction conditions for LSP.sup.mps1 amplification. A panel of Map isolates described in Table 1 was tested for the presence or absence of the large sequences identified within the genes mps1 of K-10 compared to S397. This was done with a multiplex PCR approach (Semret et al., 2006) using a set of three primers: two primers (forward and reverse) designed towards the flanking regions (bridging primers) of the LSP and a third primer designed to recognize a sequence internal to the LSP (internal primer). The primers were designed such that the resulting PCR products would be of different sizes depending on the presence or absence of the LSP under study. Primer sequences are provided in Table 4. The PCR mixture comprised 2 μL of DNA solution added to a final volume of 25 μL containing 0.1 μL of GoTaq Flexi DNA polymerase (5 U/μL Promega), 2 mM (each) dATP, dCTP, dGTP, and dTTP (Promega); 5 μL of 5× PCR buffer supplied by the manufacturer; 1 μM of each primers; 1 μL of dimethyl sulfoxide (Sigma); 1.5 mM of MgCl.sub.2 and 5 μL of 5M betaine solution (Sigma). The reactions were carried out using a TC-512 thermal cycler (Techne). PCR conditions were as follows: 1 cycle of 5 min at 94° C.; 30 cycles of 30 s at 94° C., 30 s at 62° C., and 30 s at 72° C.; and 1 cycle of 7 min at 72° C. To detect presence or absence of each LSP, PCR products were analyzed by electrophoresis using 1.5% agarose gels.

[0212] Bioinformatic prediction of peptide composition from NRPS sequence. The peptide composition of the lipopeptides analyzed in this study were deduced from DNA sequence comparisons between K-10 and S397 strains as well as a bioinformatics approach using domain prediction software including the NCBI web tools ncbi. nlm. nih. gov/Structure/cdd/wrpsb. cgi and the web site of PKS/NRPS Analysis at nrps. igs. umaryland. edu/nrps. Peptide composition was determined using the web-based server NRPSpredictor2 (Rottig et al., 2011).

[0213] Chemical synthesis of the lipopeptides. The control lipopeptides (L3P and L5P) were synthesized on solid phase using the standard Fmoc chemistry protocol, as previously described (Biet et al., 2008). After cleavage from the resin, the crude L3P product was purified on a silica gel column using CH.sub.2Cl.sub.2/methanol as eluent (from 98:2 to 97:3 (vol/vol)), and 80 mg of the lipopeptide were obtained (yield 80% based on the net peptide content). The synthetic L3P was characterized by electrospray ionization MS (Q-Tof Micro Waters), quantitative amino acid analysis (AAA) (after hydrolysis with 6N HCl at 110° C. for 48 h and using a Beckman 6300 analyzer) and NMR (Bruker 400 MHz instrument).

[0214] MS: C.sub.39H.sub.67N.sub.3O.sub.5 (calcd 657.5081) m/z 658.5155 [M+H].sup.+, 680.4994 [M+Na].sup.+.

[0215] AAA: Ala 1 (1), Phe 0.96 (1), and an extra peak typical of N-Methyl-Val.

[0216] .sup.1H NMR (CDCl.sub.3): δ 0.60 (d, 3H, CHβ Val, J=6.68 Hz), 0.90 (t, 3H, CH.sub.3 lipid, J=7.05 Hz), 0.96 (d, 3H, CH.sub.3γ Val, J=6.41 Hz), 1.25-1.29 (m, 32H, 16 CH.sub.2 lipid), 1.35 (d, 3H, CH.sub.3β Ala, J=7.21 Hz), 1.53-1.59 (m, 2H, CH.sub.2CH.sub.2CO lipid), 2.15 (t, 3H, CH.sub.2CO lipid, J=7.60 Hz), 2.18-2.27 (m, 1H, CH.sub.2β Val), 2.93 (s, 3H, NCH.sub.3), 2.97 (dd, 1H, 1CH.sub.2β Phe, J.sub.1CH2β,CHα=8.16 Hz), 3.08 (dd, 1H, 1CH.sub.2β Phe, J.sub.1CH2β,CHα=8.04 Hz J.sub.1CH2β,1CH2β=13.36 Hz), 3.74 (s, 3H, OCH.sub.3), 4.45 (d, 1H, CHα Val, J=11.04 Hz), 4.5 (p, 1H, CHα Ala, J.sub.CHα,NH=7.2 Hz), 5.17-5.24 (dt, 1H, CHα Phe, J.sub.CHα,NH=6.09 Hz), 6.13 (bd, 1H, NH Phe), 6.59 (bd, 1H, NH Ala), 7.18-7.30 (5H, Ph).

[0217] .sup.13C NMR (CDCl.sub.3): δ 14.08 (CH.sub.3 lipid), 17.86 (CH.sub.3β Ala), 18.64, 19.65 (CH.sub.3γ Val), 22.67 (CH.sub.2 lipid), 25.53 (CH.sub.2CH.sub.2CO lipid), 25.84 (CHβ Val), 29.21, 29.34, 29.45, 29.64, 29.68 (CH.sub.2 lipid), 30.96 (NCH.sub.3), 31.91 (CH.sub.2 lipid), 36.44 (CH.sub.2CO lipid), 38.97 (CH.sub.2β Phe), 47.89 (CHα Ala), 50.38 (CHα Phe), 52.28 (OCH.sub.3), 63.12 (CHα Val), 127.11, 128.57, 129.33, 135.80 (Ph), 169.05 (CO Val), 172.55 (CO lipid), 172.94 (CO Ala), 173.41 (CO Phe).

[0218] Lipid extraction, 2-D TLC and 1-D TLC. The culture of the S-type strain of Map afforded 317 mg of cells (dry weight). Lipids were extracted with chloroform/methanol (1:2 then 2:1 (vol/vol)) resulting in 7.6 mg of product. For analytical purposes, 500 μg of this crude extract were loaded on 2-D TLC plates and eluted using chloroform/methanol (96:4 (vol/vol)) in the first dimension followed by toluene/acetone (80:20 (vol/vol)) in the second dimension. Control synthetic L3P was deposited at 15 μg in chloroform and served as a marker for each dimension. TLC plates were revealed by spraying 10% copper sulfate in 8% phosphoric acid, followed by charring.

[0219] For the L3P purification, 7 mg of the crude extract in 100 μL of CH.sub.2Cl.sub.2 were loaded on preparative silica gel 60 F.sub.254 2-D TLC (20×20 cm, thickness 0.5 mm) (Merck) and eluted using the same solvent systems as above. After scraping the spot of interest (˜7 mm diameter) off the silica plate, the L3P was eluted in batch with 4 times 500 μL of CH.sub.2Cl.sub.2/methanol 95:5 (vol/vol). The evaporation under argon afforded approximately 50 μg of purified native antigen. The adjacent silica gel zone below (˜6 mm diameter spot) was treated using the same procedure for the NMR control. This purified native L3P was analyzed by silica gel 60 F.sub.254 1-D TLC in comparison to both synthetic controls L3P and L5P (approximately 2 μg of each). The TLC was eluted with CH.sub.2Cl.sub.2/methanol 95:5 (vol/vol) and revealed as described above.

[0220] Surface-exposed material preparation. The surface-exposed material was recovered from mycobacteria treated with 10 g of glass beads as previously described (Ortalo-Magne et al., 1996). Chloroform and methanol were added to the filtrates derived from this treatment obtain a partition mixture composed of chloroform/methanol/water (3:4:3 (vol/vol/vol)), then the organic phases were washed with water and evaporated to dryness to yield the cell surface-exposed lipids. The treated bacteria were extracted as described above to yield the cell bound lipids. Presence of cord factor was monitored by TLC developed in chloroform/methanol (90:10 (vol/vol)) and revelation by spraying 0.2% anthrone in sulfuric acid, followed by charring.

[0221] Analytical Procedures.

[0222] MALDI-TOF/TOF-MS and MS/MS analyses were conducted in the positive ionization and reflectron mode by accumulating 10 spectra of 250 laser shots, using the 5800 MALDI TOF/TOF Analyser (Applied Biosystems/Absciex) equipped with a Nd:Yag laser (349 nm wavelength). For MS and MS/MS data acquisitions, uniform, continuous, and random stage motion was selected at a fixed laser intensity of 4000 (instrument-specific units) and 400 Hz pulse rate and 6000 (instrument-specific units) and 1000 Hz, respectively. For MS/MS data acquisition, the fragmentation of selected precursors ions was performed at a collision energy of 1 kV using air as collision gas. Lipid samples were dissolved in chloroform and were directly spotted onto the target plate as 0.5 μl droplets, followed by the addition of 0.5 μL of matrix solution (10 mg of 2,5-dihydroxybenzoic acid (Sigma-Aldrich).mL.sup.−1 in CHCl.sub.3/CH.sub.3OH, 1:1 (vol/vol)). Samples were allowed to crystallize at room temperature. Spectra were externally calibrated using lipid standards.

[0223] For comparative NMR analyses, 1-D .sup.1H and .sup.1H—COSY .sup.1H/.sup.1H (COrrelation SpectroscopY), compounds were dissolved in CDCl.sub.3/CD.sub.3OD (1:1 (vol/vol), 99.8% purity, Euriso-top, CEA Saclay, France). Experiments were conducted using a 600 MHz Bruker NMR spectrometer equipped with cryosonde. .sup.1H chemical shifts are given in parts/million (ppm) downfield from internal tetramethylsilane at 0 ppm. All experiments were recorded at 295° K without sample spinning. The Bruker pulse programs were used and optimized (pulse lengths and delays) for each 1-D or 2-D experiments. Data were analyzed using the TopSpin (Bruker BioSpin) software.

Example 2: Serological Results Using L5P Hydrosoluble Analogue and L3P to Detect Map

[0224] Materials and Methods: [0225] 1. Material and Methods

[0226] a. Chemical Synthesis of the Antigens.

[0227] The antigens were synthesized manually on solid phase using Fmoc chemistry.

[0228] The L3P lipopeptide was prepared using a 4-hydroxymethylbenzoyl resin (HMBA-AM resin, Novabiochem) as previously described (Biet et al., 2008). After cleavage from the resin, the crude L3P was purified on a silica gel column using CH.sub.2Cl.sub.2/methanol as eluent (from 98/2 to 97/3 v/v), and 80 mg of the lipopeptide were obtained (yield 80%).

[0229] The L5P.sup.H2O antigen was prepared by attaching N-(Fmoc-13-amino-4,7,10-trioxa-tridecayl)-diglycolic acid (Novabiochem) to a Wang resin using 1-(mesitylene-2-sulfonyl)-3-nitro-1,2,4-triazole and N-methylimidazole (B. Blankemeyer-Menge et al., 1990). The capping, coupling and deprotection steps were performed as previously described (Biet et al., 2008).

[0230] The product was cleaved from the resin with aqueous trifluoroacetic acid (TFA)/triisopropylsilane/H.sub.2O 95/2.5/2.5 v/v/v for 2 hours at room temperature. After filtration of the resin, the filtrate was concentrated, and diluted with CH.sub.2Cl.sub.2/H.sub.2O 50/50. The organic phase was extracted twice with H.sub.2O. The aqueous phases were pooled and lyophilized. The crude L5P.sup.H2O was purified by reverse-phase flash chromatography using a gradient of H.sub.2O+0.1% TFA/CH.sub.3CN+0.1% TFA from 70/30 to 50/50 and 126 mg of the peptide derivative were obtained (yield 88%).

[0231] The purified compounds L3P and L5P.sup.H2O were characterized by electrospray ionization MS (Q-Tof Micro Waters), quantitative amino acid analysis (AAA) (after hydrolysis with 6N HCl at 110° C. for 48 h and using a Beckman 6300 analyzer) and NMR (Bruker 400 MHz instrument).

[0232] L3P:

[0233] MS: C.sub.39H.sub.67N.sub.3O.sub.5 (calcd 657.5081) m/z 658.5155 [M+H].sup.+, 680.4994 [M+Na].sup.+.

[0234] AAA: Ala 1 (1), Phe 0.96 (1), and an extra peak typical of N-Methyl-Val.

[0235] .sup.1H NMR (CDCl.sub.3): δ 0.60 (d, 3H, CH.sub.3γ Val, J=6.68 Hz), 0.90 (t, 3H, CH.sub.3 lipid, J=7.05 Hz), 0.96 (d, 3H, CH.sub.3 γ Val, J=6.41 Hz), 1.25-1.29 (m, 32H, 16 CH.sub.2 lipid), 1.35 (d, 3H, CH.sub.3β Ala, J=7.21 Hz), 1.53-1.59 (m, 2H, CH.sub.2CH.sub.2CO lipid), 2.15 (t, 3H, CH.sub.2CO lipid, J=7.60 Hz), 2.18-2.27 (m, 1H, CHβ Val), 2.93 (s, 3H, NCH.sub.3), 2.97 (dd, 1H, 1CH.sub.2β Phe, J.sub.1CH2β,CHα=8.16 Hz), 3.08 (dd, 1H, 1CH.sub.2β Phe, J.sub.1CH2β,CHα=8.04 Hz J.sub.1CH2β,CHβ=13.36 Hz), 3.74 (s, 3H, OCH.sub.3), 4.45 (d, 1H, CHα Val, J=11.04 Hz), 4.5 (p, 1H, CHα Ala, J.sub.CHα,NH=7.2 Hz), 5.17-5.24 (dt, 1H, CHα Phe, J.sub.CHα,NH=6.09 Hz), 6.13 (bd, 1H, NH Phe), 6.59 (bd, 1H, NH Ala), 7.18-7.30 (5H, Ph).

[0236] .sup.13C NMR (CDCl.sub.3): 14.08 (CH.sub.3 lipid), 17.86 (CH.sub.3β Ala), 18.64, 19.65 (CH.sub.3 γ Val), 558 22.67 (CH.sub.2 lipid), 25.53 (CH.sub.2CH.sub.2CO lipid), 25.84 (CHβ Val), 29.21, 29.34, 29.45, 29.64, 29.68 (CH.sub.2 lipid), 30.96 (NCH.sub.3), 31.91 (CH.sub.2 lipid), 36.44 (CH.sub.2CO lipid), 38.97 (CH.sub.2β Phe), 47.89 (CHα Ala), 50.38 (CHα Phe), 52.28 (OCH.sub.3), 63.12 (CHα Val), 127.11, 128.57, 129.33, 135.80 (Ph), 169.05 (CO Val), 172.55 (CO lipid), 172.94 (CO Ala), 173.41 (CO Phe).

[0237] L5p.sup.H2O:

[0238] MS: C.sub.47H.sub.73N.sub.7O.sub.12 (calcd 927.5317) m/z 928.5383 [M+H].sup.+, 950.5099 [M+Na].sup.+.

[0239] AAA: Ala 1 (1), Phe 1.79 (2), Ile 0.90 (1), and an extra peak typical of N-Methyl-Val.

[0240] .sup.1H NMR (MeOD): δ 0.68 (d, 3H, CH.sub.3γ Val, J=6.56 Hz), 0.79 (d, 3H, CH.sub.3γ Val, J=6.64 Hz), 0.81 (d, 3H, CH.sub.3γ Ile, J=6.89 Hz), 0.85 (t, 3H, CH.sub.3δ Ile, J=7.38 Hz), 1.01-1.09 (m, 1H, 1CH.sub.2γ Ile), 1.30 (d, 3H, CH.sub.3β Ala, J=7.12 Hz), 1.45-1.51 (m, 1H, 1CH.sub.2γ Ile), 1.70-1.81 (m, 5H, CHβ Ile, CH.sub.2 D and K), 2.08-2.14 (m, 1H, CH.sub.2β Val), 2.92 (dd, 1H, 1CH.sub.2β Phe), 3.01 (dd, 1H, 1CH.sub.2β Phe), 3.05 (s, 3H, NCH.sub.3), 3.13 (dd, 1H, 1CH.sub.2β Phe), 3.20 (dd, 1H, 1CH.sub.2β Phe), 3.23 (t, 2H, CH.sub.2 C or L, J=6.86 Hz), 3.33 (t, 2H, CH.sub.2 C or L, J=6.84 Hz), 3.48-3.54 (m, 4H, CH.sub.2 E and J), 3.56-3.64 (m, 8H, CH.sub.2 F, G, H and I), 4.04 (s, 2H, CH.sub.2 B), 4.06-4.10 (m, 1H, CHα Ile), 4.18 (s, 2H, CH.sub.2 A), 4.23-4.28 (q, 1H, CHα Ala), 4.47 (d, 1H, CHα Val, J=10.96 Hz), 4.61 (dt, 1H, CHα Phe), 4.68 (dt, 1H, CHα Phe), 7.16-7.19 (m, 2H, NH PEG), 7.21-7.38 (m, 10H, 2Ph), 7.97 (d, NH Ile), 8.13 (d, NH Phe).

[0241] .sup.13C NMR (MeOD): δ 11.34 (CH.sub.3γ Ile), 15.75 (CH.sub.3γ Ile), 18.34 (CH.sub.3β Ala), 19.87, 20.00 (2CH.sub.3γ Val), 26.10 (CH.sub.2γ Ile), 28.50 (CHβ Val), 30.35, 30.38 (CH.sub.2 D and K), 32.05 (NCH.sub.3), 37.69, 37.90 (CH.sub.2 C and L), 38.14, 38.61 (2CH.sub.2β Phe), 50.56 (CHα Ala), 53.35, 55.93 (CHα Phe), 59.50 (CHα Ile), 64.94 (CHα Val), 69.22 (CH.sub.2 A), 69.82, 70.11 (CH.sub.2 E and J), 71.28, 71.31, 71.52, 71.58 (CH.sub.2 B, F, G, H, and I), 127.87, 129.08, 129.56, 130.27, 130.35, 130.59, 135.26, 138.28 (Ph), 171.06, 171.92, 172.20, 172.85, 173.25, 173.63, 174.43 (CO).

##STR00001##

[0242] b. Sera

[0243] The potential of L5P and L3P as Map diagnostic antigen was assessed by ELISA. To validate thoroughly the diagnostic value of these molecules with appropriate sample sizes, the inventors used collection of sera already extensively described (Leroy et al, Proteomics 2007) (Mercier et al., Veterinary Record(2010) (Schinköthe Jet al. J Comp Pathol. 2016 Aug-Oct;155(2-3):218-30) (Dukkipati VSVet Microbiol. 2016 Nov. 15; 195:136-143). They also used sera from animals infected by M. bovis form (JL Moyen Laboratoire Départemental d′Analyse & de Recherche de Dordogne).

[0244] c. Antibody ELISA Procedure

[0245] Preparation of antigen solution: The synthetic L5P lyophilized was carefully dissolved with ethanol or methanol. The required volume of ethanol to give a stock concentration of 1 mg/ml was added in the tube. The lyophilisate was then allowed to resuspend for at least 2 hours (gentle stirring). It is recommended to keep the working solution at room temperature taking care to avoid evaporation. L5P was used at a working concentration of 25 μg/mL in ethanol or methanol. 50 μL of antigen preparation were added in each well of the microplate Nunc Maxisorp and incubated for 18 hours at 4° C. with PPD or water-soluble variant. For the L5P coating plate were incubated 18 hours at 37° C. until total methanol evaporation (do not cover the plate). Plates were then washed three times with 200 μL of PBS containing 0.05% TWEEN 20 (Polyoxyethylenesorbitan monooleate) (PBS-T), and 50 μL Blocking Buffer PBS-TG (PBS-0.05% TWEEN 20 (Polyoxyethylenesorbitan monooleate), 0.5% Gelatin ref BIO-RAD 170-6537) were added to each well and incubated for 1 hour 30 min at 37° C.

[0246] After removing the blocking buffer 50 μL of primary antibody or serum diluted (1/100) in PBS-TG to each well were added and plates were incubated for 1 hour 30 at 37° C.

[0247] Plates were washed five times with 200 μL of PBS-T, and 50 μL of a solution of Recombinant Protein G Peroxidase Conjugated (reference 31499, Thermo Scientific) diluted at 0.5 μg/mL in PBS 0.05% TWEEN 20 (Polyoxyethylenesorbitan monooleate) were added to each well and plates were incubated for 1 hour at room temperature.

[0248] Plates were then washed five times with 200 μL of PBS-T, and HRP substrate were added. The plates were read photometrically at 414 nm.

[0249] d. Storage

[0250] Before solubilization, L5P can be conserved at 4° C. or −20° C., and after solubilization at room temperature less than 2 days.

[0251] Results:

[0252] L5P.sup.H2O is a Suitable Hydrosoluble Derivative of LSP:

[0253] The L5P is very hydrophobic and does behave very differently as compared to conventional proteic antigens which are hydrosoluble. It is soluble in DMSO, CHCl.sub.3, CH.sub.2Cl.sub.2, MeOH and EtOH (<1 mg/ml), but insoluble in water or aqueous buffers. Glass containers are thus to be used, and contacts with polypropylene/ependorf surface are to be minimized. Material handling like dilution and transfer steps is also to be minimized.

[0254] These properties of L5P are thus likely to cause difficulties in using a diagnostic test based on the L5P as antigen.

[0255] The inventors have thus developed a hydrosoluble derivative of LSP, named L5P.sup.H2O, in order to circumvent these potential difficulties. The structure of L5P and L5P.sup.H2O are illustrated in FIG. 9. FIG. 10 shows the performance of L5P and the hydrosoluble derivative L5P.sup.H2O on a panel of previously well-defined sera (Leroy et al, Proteomics 2007) including 60 positive sera from bovine infected by Map (MAP+) and 53 sera from healthy bovine (Controls). In ROC analysis of LSP, the area under the curve and its standard error were found equal to 0.97 (95% confidence interval, 0.94557 to 0.9955) and 0.01269, respectively. The L5P.sup.H2O was successfully evaluated whether in ethanol or in PBS. In ROC analysis, the area under the curve and its standard error were found equal to 0.9313 (95% confidence interval, 0.8843 to 0.9783) and 0.02398, and 0.9453 (95% confidence interval, 0.9064 to 0.9841) and 0.01981, respectively.

[0256] These results confirm that both L5P and L5P.sup.H2O have satisfying performance in the diagnosis of Map infection in bovine.

[0257] The inventors have moreover confirmed that the antibody response detected with sera of infected animals is not directed against the lipid moiety of LSP, as can be deduced from the results illustrated in FIG. 11.

[0258] It can thus be concluded that: [0259] L5P is a valuable biomarker to detect animal infected by Map. It was validated in ELISA using collections of sera from cattle. [0260] The ELISA detection relies on the L5P peptide since the lipid moiety does not discriminate control from infected animals [0261] A high quality hydrosoluble L5P derivative was synthesized. [0262] The hydrosoluble antigen L5P.sup.H2O is a satisfying synthetic mimic of L5P and can be advantageously used in a standard ELISA diagnostic test for detecting Map-infected animals.

[0263] L5P is Suitable to Discriminate Animals Infected by Map Versus M. bovis:

[0264] The inventors have then confirmed that L5P is an antigen specific for Map, absent from M. bovis and which does not cross-react with sera of animals infected by M. bovis. The corresponding results are illustrated in FIG. 12.

[0265] This antigen can therefore be used to discriminate animals infected with M. bovis from animals infected with Map. The same property is to be expected for the hydrosoluble analogue of L5P.

[0266] L5P is not Optimal as a Diagnostic Antigen in the Context of Ovine Paratuberculosis Induced by Map of S-Type:

[0267] The results illustrated in FIG. 13 show that less than half of the sheep sera do not appear to contain anti-L5P antibodies. In sheep the majority of strains of Map isolated are of type S and the inventors demonstrated (see example 1) that these strains do not produce the L5P, but rather the closely-related antigen called L3P (see FIG. 9 and example 1). This different antigenic composition of 5-type strains is in agreement with the ELISA results presented in FIG. 13.

[0268] In view of the high number of undetermined diagnoses as illustrated in FIG. 13, it can be deduced that L5P does not seem suitable as a diagnostic antigen in the context of ovine paratuberculosis induced by Map of S-strain.

[0269] Use of L3P in the Map Serodiagnosis:

[0270] The inventors have then used L3P in Elisa serodiagnosis test, using the same protocol as detailed above for L5P. The results are presented in FIG. 14. These results show that L3P is recognized by the antibodies of animals infected by Map of S-type.

[0271] Anti-Map antibodies present in the serum of animals infected with C-type strains cross react with the L3P. These results are not surprising given the structures of the antigens that share epitopes. These results suggest that L3P, together with L5P, could be used for specific diagnosis of sheep (or other animal) infected with strains of type S.

[0272] The L3P will thus improve the serological diagnosis of Map in a context of infection with type S strains. Technical optimization of the ELISA protocol, especially steps of coating and saturation is in progress. The comprehensive evaluation of infected animals with accurately characterized strains is also in progress using a large collection of sera.

[0273] It is to be noted that these results were performed with a limited number of reference sera from bovines infected by C-type strains and sera from ovines infected by S-type strains. They nevertheless show that S-type is detected with L3P as antigen in the ELISA.

Example 3: L3P Promotes a Cell-Mediated Immune Response Whereas L5P Promotes B Cell Responses

[0274] The present inventors have also confirmed that L3P elicits a cell mediated immune response as well as humoral response. By comparison with the immunoreactivity of L5P, they have moreover highlighted differences between L3P and L5P, namely they have demonstrated that there is a dose-dependent effect observed for L3P on upregulation of CD25+ CD8 T cells from infected cows, while L5P effects were static. In contrast, L5P demonstrated a significantly stronger induction of CD25+ B cells from infected animals compared to L3P.

[0275] Methods:

[0276] PBMC Isolation and Stimulation for Flow Cytometry and Cytokine Measurements.

[0277] Peripheral blood mononuclear cells (PBMCs) were isolated from control non-infected (n=4) and cattle naturally infected with C-type Map (n=4) to determine if lipoproteins, L3P and L5P (structures disclosed in FIG. 9), can elicit immunological responses. Sixty ml of blood was collected via jugular venipuncture into a syringe containing 2×acid-citrate-dextrose to obtain PBMCs.

[0278] PBMCs were resuspended at a final concentration of 8×10.sup.6/ml in complete medium consisting of RPMI-1640 with 2 mM 1-glutamine and 25 mM HEPES (Gibco, Grand Island, N.Y.) and supplemented with 10% fetal calf serum (Gibco), 100λ penicillin-streptomycin (Gibco). Cells were plated in 24-well culture plates and incubated for 24 hr at 39° C. in 5% CO.sub.2 in a humidified atmosphere with the following treatment groups, nonstimulated (NS; negative control), pokeweed mitogen (PWM, 10 μg/ml, positive control; Sigma, St. Louis, Mo.), and four antigens that included whole cell sonicated extracts of Map strains K-10 and S397 (10 μg/ml); lipoproteins L3P and L5P (1, 5, 10 μg/ml concentrations). The lipoproteins had to be solubilized in 100% methanol to 1 mg/ml concentrations and then diluted in the complete medium to final concentrations indicated above. This diluted solvent-lipopeptide mixture did not affect cell viability or response capabilities. After a 24-hr stimulation, the supernatants were harvested by centrifugation at 400×g for 5 min. Supernatants were removed without disturbing the cells in culture and stored at −20° C. until cytokine measurement. Cytokines IFN-γ, IL-1, IL-2, IL-4, IL-6 and TNF-α were all measured using Ciraplex bovine multiplex cytokine arrays (Aushon Biosystems, Billerica, Mass.).

[0279] For flow cytometry, PBMCs were cultured in replicate 48-well flat-bottom plates (Nunc Technologies, Rochester, N.Y.) as described above with the same culture conditions and in vitro treatments. After incubating for either 3 days (NS, PWM) or 6 days (NS, antigens), cell populations were defined by labeling with 50 μl of a cocktail of primary antibodies to CD4, CD8, gamma delta T cell receptor (γδ TCR), and B cells, along with a CD25 activation marker (Washington State University Monoclonal Antibody Center, Pullman, WA). After a 15-min incubation at room temperature (RT), plates were centrifuged for 2 min at 400×g, the supernatant was decanted, and 50 μl of a secondary antibody cocktail was added, which included APC/Cy7 anti-mouse IgG2a (Southern Biotech, Birmingham, Ala.), AF350 anti-mouse IgG2b (Invitrogen, Waltham, Mass.), and BUV395 anti-mouse IgG3 (BDBiosciences, San Diego, Calif.). Live/Dead populations were separated using Zombie Yellow™ Fixable Viability Dye (Biolegend, San Diego, Calif.). Cells were analyzed on a BDBiosciences LSRII Cytometer using FACSDiva V8.0.1 software. Further analysis was done using FlowJo® v10.2 (FLOWJO, LLC) software.

[0280] Results:

[0281] After 24 hr culture, there was a dose-dependent proliferation of CD25+ CD8 T cells from infected cows stimulated with L3P. By contrast, L5P stimulated cells remained static over the range of lipopeptide concentrations (FIG. 15A). S397, S-type Map strain, which contains L3P, produced a slightly stronger response than K-10 strain, which has LSP, although this difference was not significant (data not shown). In contrast, effects of lipopeptides on CD25+ B cells were reversed as L5P promoted a significantly (P<0.0002) stronger response compared to L3P (FIG. 15B). No significant differences were observed between L3P and L5P in CD25+ CD4 or CD25+γδ T cell populations (data not shown). Both L3P and L5P elicited cytokine responses to IFN-γ, IL-1β and TNF-α with no significant differences between the L3P or L5P treatments (FIG. 16). However, significant differences were observed between infected and control cells (P<0.0001 for IFN-γ and IL-1β, P<0.03 for TNF-α; FIG. 16). Interestingly, a dose-dependent effect (P<0.0006) of L5P concentration was observed on TNF-α secretion by PBMCs. IL-4 and IL-6 were not detected following stimulation with either lipopeptide (data not shown).

[0282] In the present study, L5P preferentially resulted in the upregulation of activated B cells (CD25+B cells), a finding that correlates with previous studies demonstrating this lipopentapeptide produces strong humoral responses in cattle and sheep (Biet et al., 2008). In contrast, L3P more distinctly upregulated T cell proliferation (CD25+CD8 T cells) in a dose-dependent manner, suggesting more of a Th1 immune response to this cell wall component. These results suggest that genomic differences between L3P and L5P may translate to antigenic differences that present immunological diversity within the infected host.

BIBLIOGRAPHIC REFERENCES

[0283] Alonso-Hearn, M., T. M. et al, (2010). Innate Immun 16: 235-247. [0284] Amonsin, A., L. L. et al, (2004). J. Clin. Microbiol. 42: 1694-1702. [0285] Bannantine, J. P., et al, (2014). Genome announcements 2. [0286] Bannantine, J. P. et al, (2012). BMC Genomics 13: 89. [0287] Bernut, A., J. L. et al, (2014). Proc. Natl. Acad. Sci. U.S.A 111: E943-952. [0288] Biet, F. et al, (2008). Vaccine 26: 257-268. [0289] Biet, F. et al, (2012). BMC Microbiol 12: 264. [0290] Blankemeyer-Menge B. et al. Tetrahedron Letters (1990) 31, 1701] [0291] Dohmann, K., B. et al, (2003). J. Clin. Microbiol. 41: 5215-5223. [0292] Eckstein, T. M., S. et al, (2006). J. Biol. Chem. 281: 5209-5215. [0293] Gaudelli, N. M., D. H. Long & C. A. Townsend, (2015). Nature 520: 383-387. [0294] Ghosh, P., C. et al, (2012). PLoS One 7: e31947. [0295] Gumber, S., D. L. et al, (2009). Vet. Microbiol. 133: 344-357. [0296] Gumber, S. & R. J. Whittington, (2009). Vet. Microbiol. 136: 82-90. [0297] Holbert, S., M. et al, (2015). Res. Vet. Sci. 102: 118-121. [0298] Howard, S. T., E. et al, (2006). Microbiology 152: 1581-1590. [0299] Janagama, H. K. et al, (2009). Microbiology 155: 3683-3690. [0300] Jimenez-Dalmaroni, M. J. et al, (2015). Innate Immun 21: 175-193. [0301] Kansal, R. G., R. Gomez-Flores & R. T. Mehta, (1998). Microb. Pathog. 25: 203-214. [0302] Lefrancois, L. H. et al, (2013). J. Bacteriol. 195: 4844-4853. [0303] Li, L., et al (2005). Proc. Natl. Acad. Sci. U.S.A 102: 12344-12349. [0304] Marsh, I., et al (1999). Mol. Cell. Probes 13: 115-126. [0305] Marsh, I. B., et al (2006). J. Bacteriol. 188: 2290-2293. [0306] Motiwala, A. S., et al (2006). Infect. Immun. 74: 6046-6056. [0307] NAHMS, (2008) Johne's disease on U.S. dairies, 1991-2007. USDA-APHIS—VS-CEAH Fort Collins, Colo. Center for Epidemiology and Animal Health: 1-4. [0308] Ortalo-Magne, A. et al, (1996). J. Bacteriol. 178: 456-461. [0309] Ripoll, F. et al, (2007). BMC Genomics 8: 114. [0310] Riviere, M. et al, (1996). Eur. J. Biochem. 241: 682-690. [0311] Rottig, M., et al, (2011). Nucleic Acids Res. 39: W362-367. [0312] Semret, M. et al, (2006). J. Clin. Microbiol. 44: 881-887. [0313] Sibley, J. A. et al, (2007). J. Wildl. Dis. 43: 775-779. [0314] Southern, E. M., (1975). J. Mol. Biol. 98: 503-517. [0315] Stevenson, K. et al, (2002). J. Clin. Microbiol. 40: 1798-1804. [0316] Thibault, V. C. et al, (2008). J. Clin. Microbiol. 46: 4091-4094. [0317] Turenne, C. Y. et al, (2006). J. Clin. Microbiol. 44: 433-440. [0318] van Soolingen, D. et al, (1994). Methods EnzymoL 235: 196-205. [0319] Verdier, J. et al (2013). PLoS One 8: e62780. [0320] Walsh, C. T. et al, (2013). Angewandte Chemie. International Ed. In English 52: 7098-7124. [0321] Wang, H. et al, (2014). Proc. Natl. Acad. Sci. U.S.A 111: 9259-9264. [0322] Whittington, R. J. et al, (2011). J. Clin. Microbiol. 49: 1822-1830. [0323] Wright, E. L. et al, (1996). J. Clin. Microbiol. 34: 2475-2478. [0324] Wu, C. W. et al, (2006). J. Bacteriol. 188: 711-723.