LENTIVIRAL VECTORS FOR HIGH-TITER TRANSDUCTION OF PRIMARY HUMAN CELLS

20210010031 ยท 2021-01-14

Assignee

Inventors

Cpc classification

International classification

Abstract

Aspects of the disclosure relate to packagable RNA constructs with minimal intervening viral sequences. These constructs can be used to generate lentiviral viruses encoding large genes capable of transducing primary human cells.

Claims

1. A construct comprising a nucleic acid encoding a promoter operably linked to transgene encoding a packagable vector RNA, the packagable vector RNA comprising 5- and 3-terminal repeats (TRs) that flank: i. a nucleocapsid protein packaging target site, ii. a heterologous nucleic acid insert, and iii. minimal intervening viral sequences.

2. The construct of claim 1, wherein the terminal repeats further flank i. a REV protein response element (RRE), and ii. a polypurine tract.

3. The construct of claim 1 or 2, wherein the terminal repeats further flank i. a sequence encoding a GAG protein.

4. The construct of any one of claims 1 to 3, wherein one or both of the 5- and 3-terminal repeats is a lentiviral long terminal repeat.

5. The construct of any one of claims 1 to 3, where one or both of the 5- and 3-terminal repeats is a truncated lentiviral long terminal repeat that comprise an R-element that directs reverse transcription and an integrase substrate element that directs integration.

6. The construct of any of claims 1 to 5, wherein the minimal intervening viral sequences are in total up to 350 base pairs in length.

7. A nucleic acid comprising a heterologous nucleic acid insert flanked by terminal repeats (TRs), wherein between a first terminal repeat and the heterologous nucleic acid sequence are present packaging and nuclear export sequences and minimal intervening viral sequences.

8. The nucleic acid of claim 7, wherein the minimal intervening viral sequences are up to a total of 350 base pairs in length.

9. The nucleic acid of any one of claims 1-8, wherein there is an internal promoter operably linked to the heterologous nucleic acid insert located between the nucleocapsid protein packaging target site and the second TR.

10. The nucleic acid of any one of claims 1-9, wherein the internal promoter is optionally spleen focus-forming virus (SFFV) promoter.

11. The nucleic acid of any one of claims 1-10, wherein the 5-TR is a RNA pol II promoter and comprises a repeat region and a U5 region.

12. The nucleic acid of claim 7 or 8, wherein the 3-TR is a transcription termination and comprises a repeat region and a U3 region.

13. The nucleic acid of any one of claims 1-12, wherein the packaging sequences comprise a psi () sequence and a polypurine tract sequence.

14. The nucleic acid of any one of claims 1-13, wherein the order of the packaging sequences is sequence followed by a polypurine tract sequence.

15. The nucleic acid of any one of claims 7-14, wherein the nuclear export sequence comprises a Rev Response Element (RRE).

16. The nucleic acid of any one of claim 2 to 6 or 15, wherein the RRE is located between the sequence and the polypurine tract sequence.

17. The nucleic acid of any one of claims 1-16, wherein the packagable nucleic acid size is 1,900 bases, plus the size of the heterologous nucleic acid insert.

18. The nucleic acid of any one of claims 1-17, wherein the heterologous nucleic acid insert is engineered to express a protein or a functional RNA.

19. The nucleic acid of claim 7, wherein a constitutive promoter is located upstream of the 5-TR, further wherein the constitutive promoter is CMV or SV40.

20. A plasmid that comprises the nucleic acid of any one of claims 1-19.

21. A method of delivering a plasmid to a cell, the method comprising delivering to the cell a plasmid of any one of claims 1-20.

22. A host cell comprising the nucleic acid of any one of claims 1-21.

23. The host cell of claim 22, wherein the host cell further comprises an RNA polymerase that selectively binds to the 5-TR of the nucleic acid.

24. The host cell of claim 22 or 23, wherein the host cell further comprises plasmids encoding nucleic acid sequences which facilitate encapsulating and enveloping of the transcribed nucleic acid.

25. The host cell of any one of claims 22-24, wherein the envelope sequence is vesicular stomatitis virus G glycoprotein (VSVG).

26. The host cell of any one of claims 22-25, wherein the encapsulating sequences encode GAG, Pol and Rev proteins.

27. A transcribed nucleic acid encoding a heterologous nucleic acid insert flanked by TRs, wherein between the first TR- and the heterologous nucleic acid sequence, there are sequences that aid in the packaging and nuclear export of the transcribed nucleic acid and minimal intervening viral sequences.

28. A host cell comprising the transcribed nucleic acid of claim 27.

29. A host cell comprising viral particles, wherein the transcribed nucleic acid of claim 27 is within the viral particles.

30. A method of infecting a host cell with the viral particles of claim 29.

31. A method of infecting a subject with the viral particles of claim 29.

32. A composition comprising a plurality of nucleic acids as described in any one of claims 1-19.

33. The composition of claim 32 further comprising a pharmaceutically acceptable carrier.

34. The nucleic acid of any one of claims 1-19, wherein the heterologous nucleic acid insert encodes an shRNA sequence.

35. The nucleic acid of claim 34, wherein there is a selectable marker gene upstream of the shRNA sequence.

36. The nucleic acid of claim 34, wherein there is a reporter gene upstream of the shRNA sequence.

37. The nucleic acid of any one of claims 1-19, wherein there heterologous nucleic acid insert encodes a Cas nuclease gene.

38. The nucleic acid of claim 37, wherein the Cas nuclease is Cas9 nuclease.

39. The nucleic acid of claim 38, wherein the Cas9 nuclease is from Streptococcus pyogenes, Neisseria meningitides, or Campylobacter jejuni.

40. A plasmid that comprises the nucleic acid of any one of claims 34-39.

41. A method of delivering a plasmid to a cell, the method comprising delivering to the cell a plasmid of any one of claims 34-39.

42. A host cell comprising the nucleic acid of any one of claims 34-39.

43. The host cell of claim 42, wherein the host cell further comprises an RNA polymerase that selectively binds to the 5-TR of the nucleic acid.

44. The host cell of claim 42 or 43, wherein the host cell further comprises plasmids encoding nucleic acid sequences that facilitate packaging of the transcribed nucleic acid.

45. The host cell of any one of claims 42-44, wherein the envelope sequence is vesicular stomatitis virus G glycoprotein (VSVG).

46. The host cell of any one of claims 42-45, wherein the packaging sequences encode GAG, Pol and Rev proteins.

47. A transcribed nucleic acid encoding a heterologous nucleic acid insert flanked by terminal repeats (TR), wherein between the first terminal repeat region and the heterologous nucleic acid sequence, there are sequences that aid in the packaging and nuclear export of the transcribed nucleic acid and minimal intervening viral sequences.

48. A host cell comprising the transcribed nucleic acid of claim 47.

49. A host cell comprising viral particles, wherein the transcribed nucleic acid of claim 47 is within the viral particles.

50. A method of infecting a host cell with the viral particles of claim 49.

51. A method of infecting a subject with the viral particles of claim 49.

52. A composition comprising a plurality of nucleic acids as described in any one of claims 34-39.

53. The composition comprising a nucleic acid as described in any one of claims 34-39 and a pharmaceutically acceptable carrier.

54. The host cell of claim 48 or 49, wherein the host cell is a primary human cell, optionally wherein the host cell is a dendritic cell.

55. A method for efficient gene knockdown, the method comprising infecting target cells with the viral particles of claim 49, wherein the viral particles enclose a transcribed nucleic acid of claim 37 or 38.

56. The method of claim 55, wherein the target cells are primary human cells.

57. The method of claim 56, wherein the primary human cells are dendritic cells.

58. A kit containing a plasmid of claim 20 and/or claim 40.

59. The kit of claim 58, wherein the kit also contains additional plasmids which contain nucleic acids that facilitate packaging and enveloping of the plasmid of claim 20 and/or 40.

60. A construct comprising a promoter operably linked to a nucleic acid encoding a packagable vector RNA, the packagable vector RNA comprising 5- and 3-terminal repeats (TRs) that flank: i. a nucleocapsid protein packaging target site, ii. a heterologous nucleic acid insert that encodes a microRNA, and iii. minimal intervening viral sequences.

61. The construct of claim 60, wherein the terminal repeats further flank: iv. a REV protein response element (RRE), and v. a polypurine tract.

62. The construct of claim 60 or 61, wherein the terminal repeats further flank: vi. a sequence encoding a GAG protein.

63. The construct of any one of claims 60-62, wherein the microRNA is processed into a shRNA in a cell.

64. The construct of any one of claims 60-63, wherein the microRNA targets AGO1, AGO2, AGO3, DNMT3A, HDAC1, HP1, SUV39H1, SUV39H2, PIWIL2, TRIM28, SETDB1, FAM208A, MPHOSPH8, PPHLN1, or MORC2.

65. The construct of any one of claims 60-64, wherein one or both of the 5- and 3-terminal repeats is a lentiviral long terminal repeat.

66. The construct of any one of claims 60-65, where one or both of the 5- and 3-terminal repeats is a truncated lentiviral long terminal repeat that comprise an R-element that directs reverse transcription and an integrase substrate element that directs integration.

67. The construct of any of claims 60-67, wherein the minimal intervening viral sequences are in total up to 350 base pairs in length.

68. A construct comprising a sequence as set forth in SEQ ID NO: 10.

69. A construct comprising a sequence as set forth in SEQ ID NO: 11.

70. A plasmid comprising the construct of any one of claims 60-69.

71. A host cell comprising the plasmid of claim 70.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0037] FIG. 1 is a schematic diagram of the lentiviral vector plasmids, showing only the vector elements.

[0038] FIG. 2 shows vector development from the standard vector to the first generation.

[0039] FIG. 3 shows the knockdown construct for testing the first generation vector.

[0040] FIG. 4 shows expression levels (fold change and fold reduction) with a regular lentiviral vector versus a first generation lentiviral vector.

[0041] FIG. 5 shows a schematic of single-cell sequencing with shRNA library screening as a further application of the vector development.

[0042] FIG. 6 shows further development of the lentiviral vector from first to second generation.

[0043] FIG. 7 compares the structures of the regular lentiviral vector and the second generation vector.

[0044] FIG. 8 shows the Cas9 construct for testing first and second generation vectors on human primary dendritic cells.

[0045] FIG. 9 shows transduction efficiency of the SpyCas9 construct.

[0046] FIG. 10 shows examples of Cas9 constructs.

[0047] FIG. 11 shows transduction efficiency of different Cas9 constructs.

[0048] FIG. 12 shows a schematic of the test of whether transduced Cas9s disrupt target gene expression in human primary dendritic cells.

[0049] FIG. 13 shows disruption of cell surface levels of the protein encoded by the target gene, DC-SIGN, with SpyCas9 transduction.

[0050] FIG. 14 shows the generations of packagable viral RNA constructs, including future planned generations wherein even more viral sequence has been eliminated.

[0051] FIG. 15 shows a map of one embodiment of a pTL packagable viral RNA construct, with the lengths of intervening viral sequences labeled.

[0052] FIGS. 16A to 16E show diverse primate immunodeficiency virus vpx and vpr orthologues activate provirus transcription, whether delivered before, during, or after reporter provirus integration. FIG. 16A shows a schematic of experimental protocol in FIG. 16B. FIG. 16B shows a flow cytometry plot showing percent GFP.sup.+ Jurkat cells after sequential transduction with the indicated lentivectors, followed by exposure to the indicated VLPs. FIGS. 16C and 16D show histograms of flow cytometry signal in Jurkat cells transduced with gfp-reporter virus, and either exposed to the indicated VLPs (FIG. 16C), or transduced with the indicated vectors (FIG. 16D). FIG. 16E shows a phylogenetic tree showing evolutionary relationship of Vpx and Vpr proteins. The transactivation activity of Jurkat reporter lines, tested as in FIG. 16D, and human SAMHD1 degradation activity, are indicated. indicates Vprs that were too toxic (G2 arrest) for assessment. All data shown is representative of at least three biological replicates.

[0053] FIGS. 17A to 17H show Vpx activates provirus transcription by degrading HUSH complex components. FIG. 17A shows Jurkat cells transduced with shRNA-puro.sup.R vectors targeting the indicated genes were selected with puromycin, transduced with Lenti 2-Avpx, and analyzed 5 days later. Plot depicts GFP signal in knockdown lines relative to Jurkats bearing SIV.sub.MAC251 vpx (meanS.E.M., n=3 shRNA target sites). *, P<0.05 as determined by 1-way ANOVA with Dunnett post-test, relative to luciferase knockdown control. FIG. 17B shows Jurkat cells were transduced with the indicated shRNA-puro.sup.R vectors and selected with puromycin. Resistant cells were transduced with vpx.sup.+ or vpx Lenti 2 vector, and analyzed for GFP expression 7 days later. FIG. 17C shows immunoblot analysis for components of the HUSH complex in Jurkat cells expressing shRNA constructs used in FIG. 17B. FIG. 17D shows CD4.sup.+ T cells were activated for 3 days with PHA and then transduced and assayed as in FIG. 17B. FIG. 17E shows immunoblot analysis of Jurkat lines transduced to express vpx from SIV.sub.MAC251, SIV.sub.RCMNG411, SIV.sub.MND25440, or control. FIG. 17F shows levels of HUSH components in FIG. 17E shown as shRNA treated condition relative to control. FIG. 17G shows FAM208A, DCAF1, and Actin immunoblot of Jurkat cells transduced with DCAF1 shRNA-puro.sup.R vector or control, that were treated with Vpx.sup.+ or Vpx VLPs for 18 hrs. FIG. 17H shows HEK293 cells were co-transfected with HA-FAM208A and the indicated FLAG-Vpx constructs. 18 hrs after transfection, cells were either exposed to proteasome inhibitor PR171 or left untreated. 8 hrs after inhibitor treatment cells were lysed, FLAG-Vpx was immunoprecipitated, and immunoblotted for FLAG-Vpx and HA-FAM208A. Immunoblotting of input lysates are shown below.

[0054] FIGS. 18A to 18F show the HIV-1 LTR is activated by Vpx or disruption of FAM208A. FIG. 18A shows a schematic of the HIV-1 minigenome integrated in the J-Lat A1 line. FIG. 18B shows J-Lat A1 cells were transduced with Lenti 1 encoding SIV.sub.MAC251 vpx or vpx control, or with lentivectors expressing shRNA targeting FAM208A or luciferase control. Transduced cells were selected with puromycin, and activated for 24 hrs with 10 ng/ml of TNF. Representative GFP signal by flow is shown. FIG. 18C shows quantification of results from FIG. 18B and additional replicates (meanS.E.M., n=3 independent experiments). *, P<0.02 FIG. 18D: Schematic of the LTR-gfp provirus used to analyze HIV-1 LTR driven gfp expression in pools of cells. FIG. 18E shows Jurkat cells transduced with LTR-gfp were kept in culture for 4 weeks and then transduced and assessed by flow cytometry, as in FIG. 18B. FIG. 18F shows quantification of results from FIG. 18E (meanS.E.M., n=4 independent experiments) *, P<0.02

[0055] FIGS. 19A to 19E show Vpx counteracts FAM208A restriction of HIV-1, SIV.sub.MAC239, or HIV-2.sub.GH, during spreading infection in CD4.sup.+ T cells. FIGS. 19A-19B show replication of HIV-1-ZsGreen in Jurkat cells transduced with SIV.sub.MAC251 vpx or control (FIG. 19A), or with lentivectors expressing shRNA targeting FAM208A or Luc control (FIG. 19B). Replication kinetics was measured by flow cytometry for ZsGreen.sup.+ cells. FIGS. 19C-19E show spreading infection of HIV-1-ZsGreen (FIG. 19C), SIV.sub.MAC239 or SIVMAc239vpx (FIG. 19D), and HIV-2.sub.GH or HIV-2.sub.GH vpx virus in CEMx174 cells transduced with FAM208A or Luc control shRNA. Spread of HIV-1-ZsGreen was assessed by flow cytometry, while spread of SIV.sub.mac239 (FIG. 19B) and HIV-2.sub.GH (FIG. 19C) was assessed by measuring the accumulation of reverse transcriptase (RT) activity in the supernatant. All data is representative of three repeat experiments.

[0056] FIGS. 20A to 20F show transcriptional activation of lentivector reporter genes by vpx and vpr. FIG. 20A shows a schematic of vpx.sup.+ and no vpx versions of Lenti 1 and Lenti 2 vectors used in FIGS. 16A to 16E and 17A to 17H. FIG. 20B shows representative live, singlet, lymphoid, GFP flow cytometry gating strategy. FIG. 20C shows quantification of results from FIG. 20B. Jurkat-vpx or Jurkat-puro.sup.R transduced with Lenti-2-vpx, or Lenti-2-no vpx, were treated with Vpx.sup.+ VLPs, Vpx VLPs, or no VLPs, and analyzed three days later. MFI was normalized for each group of VLP treated cells to untreated samples; meanS.E.M., n=3 independent experiments. Significance was determined by 1-way ANOVA with Dunnett post-test comparing treated to untreated samples in each group. *, P<0.016. FIG. 20D: Representative qPCR analysis of gfp expression after Lenti-gfp-blasti.sup.R cells were transduced with SIV.sub.MAC251 Vpx or empty vectors (meanS.E.M., n=3 replicates) *, P<0.02. FIG. 20E shows Jurkat cells transduced with Lenti-gfp-blasti.sup.R with GFP driven by EFla or TK promoters and Blasti.sup.R driven by CypA promoter. 3 days after selection cells were transduced with SIV.sub.MAC251 Vpx (white) or control puro.sup.R (red) vectors and selected with blasticidin. Untransduced cells are shown in grey. FIG. 20F shows transactivation of Lenti-gfp-blasti.sup.R reporter cells by the indicated vpx and vpr expression vectors. Line indicates 4-fold transactivation, which was used as a cutoff for activity.

[0057] FIGS. 21A to 21C show HUSH components inhibit provirus expression in primary CD4+ T cells; Vpx and Vpr from multiple lentiviral species deplete FAM208A. FIG. 21A shows quantification of results from FIG. 17D. CD4.sup.+ T cells were positively selected with magnetic beads, activated for 3 days with PHA, transduced with the indicated shRNA-puro.sup.R knockdown or control vectors, and selected with puromycin. Cells were then transduced with a lenti-gfp vector in the absence of vpx, and analyzed for GFP expression 7 days later (meanS.E.M., n=3 donors). FIG. 21B shows immunoblotting for FAM208A and Actin using lysate from Jurkat cells stably transduced with lentivectors producing the indicated Vpx proteins. FIG. 21C shows immunoblotting for FAM208A, FLAG-Vpx, and FLAG-Vpr in Jurkat cells stably transduced with lentivectors expressing the indicated 3FLAG tagged Vpx and Vpr constructs.

[0058] FIGS. 22A to 22C shows expression from the HIV-1 LTR is activated by diverse Vpx and Vpr proteins. FIG. 22A shows J-Lat A1 cells transduced with Lenti 1 encoding Vpx from SIV.sub.MAC251, SIV.sub.RCM02CM8081, or SIV.sub.MND25440, Vpr from SIV.sub.MND1GB1, or SIV.sub.AGMTAN1, or control no vpx Lenti 1. Transduced cells were selected with puromycin, activated for 24 hrs with 10 ng/ml of TNF, and GFP was assessed by flow cytometry. FIG. 22B shows Jurkat LTR-gfp cells were activated for 24 hrs with either 10 ng/ml TNF or 1 g/ml each of soluble -CD3 and -CD28 antibodies. GFP was then assessed by flow cytometry. FIG. 22C shows Jurkat LTR-gfp cells transduced with Lenti 1 vector encoding Vpx from SIV.sub.MAC251, SIV.sub.RCM02CM8081, or SIV.sub.MND25440, Vpr from SIV.sub.MND1GB1, or SIV.sub.AGMTAN1, or control no vpx Lenti 1, selected with puromycin, and activated for 24 hrs with 10 ng/ml TNF. GFP expression was assessed by flow cytometry.

DETAILED DESCRIPTION

[0059] Aspects of the disclosure are based on incorporation of viral sequences in constructs that are involved in integration of a nucleic acid insert (e.g., transgene) into a host cell chromosome. In some embodiments, minimization or elimination of these viral sequences permits larger nucleic acid inserts (e.g., transgenes encoding Cas nuclease) to be integrated into a host cell genome, as well as integration into cell types that are difficult to transfect and modify (e.g., dendritic cells).

Constructs

[0060] Aspects of the disclosure relate to nucleic acid constructs encoding packagable vector RNAs that are capable of delivering large heterologous nucleic acid inserts (e.g., transgenes) to cells. As used herein, a construct is an artificially generated segment of nucleic acid that is transplanted into a target subject, tissue, or a cell.

[0061] Constructs of the present disclosure comprise nucleic acids encoding a promoter operably linked to a transgene. A nucleic acid may be a DNA sequence or an RNA sequence. In some embodiments, the nucleic acids of the present disclosure are isolated. As used herein, the term isolated means artificially produced. As used herein with respect to nucleic acids, the term isolated means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5 and 3 restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art. As used herein with respect to proteins or peptides, the term isolated refers to a protein or peptide that has been isolated from its natural environment or artificially produced (e.g., by chemical synthesis, by recombinant DNA technology, etc.).

[0062] A promoter refers to a DNA sequence recognized by the synthetic machinery of a cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. Promoters of the present disclosure are operably linked to transgenes. As used herein, operably linked sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Thus, a promoter region would be operably linked to a nucleic acid sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide. Promoters that are native, constitutive, inducible, and/or tissue specific that are known in the art may be utilized. The phrases operatively positioned, under control, or under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid transgene to control RNA polymerase initiation.

[0063] In some embodiments, constructs as described herein comprise more than one promoter (e.g., 2, 3, 4, 5, or more promoters). In some embodiments, one or more of the promoters in a construct described herein is an internal promoter. As used herein, an internal promoter refers to a promoter that is encoded in the transgene encoding the packagable vector RNA. In some embodiments, a construct comprises a first promoter and a second promoter (e.g., an internal second promoter), where the second promoter is operably linked to the heterologous nucleic acid. The second promoter may be any promoter described below.

[0064] Examples of constitutive promoters include, without limitation, the spleen focus forming viral promoter (SFFV), the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen]. In some embodiments, a promoter is a P2 promoter. In some embodiments, a promoter is a chicken -actin (CBA) promoter. In some embodiments, a construct comprises two CBA promoters. In some embodiments, a construct comprises two CBA promoters separated by a CMV enhancer.

[0065] Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.

[0066] In some embodiments, the native promoter for the transgene will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli.

[0067] In another embodiments, a tissue-specific promoter will be used to promote transgene expression in a particular tissue in a subject. Non-limiting examples of tissue-specific promoters include a liver-specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a -myosin heavy chain (-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor -chain promoter, neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), among others which will be apparent to the skilled artisan.

[0068] Promoters of the present disclosure are operably linked to transgenes encoding packable vector RNA. A transgene, as used herein, refers to a gene that is artificially introduced into the genome of another organism. In the present disclosure, transgenes may comprise viral genes (e.g., retroviral genes). Transgenes of the present disclosure encode packagable vector RNA. As used herein, packagable vector RNA refers to RNA encoding any genetic element, such as a virus, virion, capsid, etc., that is capable of replication when associated with the proper control elements, and can be packaged into an appropriate capsules for delivery between and into cells.

[0069] Constructs of the present disclosure are utilized to infect host cells. In some embodiments, the packagable vector RNA of the present disclosure is packaged into capsids. A capsid as used herein, is the three-dimensional protein shell that encapsulates the genetic material (e.g., packagable vector RNA) of a virus. The capsid may also contain proteins that aid in the delivery of the packagable vector RNA to the surface of an into host cells.

[0070] In some embodiments, the packable vector RNA comprises 5 and 3 terminal repeats (TRs). Terminal repeats as used herein, are identical sequences of DNA or RNA that repeat hundreds or thousands of times. Terminal repeats of the present disclosure are utilized to mediate integration of viral nucleic acid (e.g., packable vector RNA) into another region of a host cell genome. Once integrated using the 5 and 3 TRs, the packagable vector RNA will be replicated by the host cell, thereby producing many packagable vector RNA molecules.

[0071] In some embodiments, the 5 and 3 TRs of the present disclosure are lentiviral long TRs. Lentivirus generally refers a family of retroviruses that cause chronic and severe infections in mammalian species. Lentiviruses infect and integrate their genomes into dividing and non-dividing cells (e.g., neurons). Nonlimiting examples of lentiviruses include human immunodeficiency virus, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), bovine immunodeficiency virus (BIV) and caprine arthritis encephalitis virus (CAEV). In some embodiments, lentiviral TRs are derived from HIV (e.g., share at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% nucleic acid sequence identity with an HIV TR).

[0072] Lentiviral long terminal repeats (LLTRs) are RNA sequences that are partially transcribed in a host cell, followed by reverse transcription into complementary (cDNA) prior to integration of the virally-derived cDNA into the host cell genome. The 5 and 3 LLTRs regulate transcription of the packagable vector RNA in the host cell and mediate integration of the virally-derived cDNA into the host cell genome. The 5 LLTR acts as a RNA polymerase II promoter upon integration into the host cell genome. In some embodiments, the 5 LLTR is fused with the promoter operably linked to the transgene. The 3 LLTR terminates transcription by adding a poly-A sequence at the 3 end of the transcribed sequence.

[0073] The 5 and 3 LLTRs each contain multiple sequences, including unique 3 (U3), repeat (R), unique 5 (U5), and integrase substrate element. The U3 sequence is unique from the U5 sequence and is necessary for the activation of viral genomic RNA transcription. The R-element contains a region that binds to a trans-activator to activate reverse transcription. The U5 sequence is unique from the U3 sequence. The integrase substrate element is a sequence that is recognized and bound by the integrase protein. Integrase is a viral enzyme that catalyzes the integration of virally-derived DNA into the host cell genome.

[0074] In some embodiments, the 5 and 3 TRs of the present disclosure are truncated. Truncated, as used herein, refers to shortened nucleotide or amino acid sequences that retain the function of the full-length sequence. A truncated sequence may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, or more nucleotides or amino acids shorter than the full length sequence from which it is derived. In some embodiments, the truncated sequences (e.g., truncated TR sequences) do not contain an R-element. In some embodiments, the truncated sequences (e.g., truncated TR sequences) do not contain an integrase substrate element. In some embodiments, the truncated sequences (e.g., truncated TR sequences) do not contain an R-element or an integrase substrate element. In some embodiments, the truncated sequences (e.g., truncated TR sequences) do not contain an R-element and an integrase substrate element. In some embodiments, the 5 TR of a construct described herein is truncated. In some embodiments, the 3 TR of a construct described herein is truncated. In some embodiments, the 5 TR and the 3 TR are truncated.

[0075] The 5 and 3 TRs of the present disclosure flank: a nucleocapsid protein packaging target site, a heterologous nucleic acid insert, and minimal intervening viral sequences. As used herein, the nucleocapsid protein packaging target site is a nucleic acid motif involved in regulating the packaging of a viral genome (e.g., packagable vector RNA) into a capsid. The nucleocapsid protein packaging target site, also referred to as packaging sequences, form secondary structures (e.g., stem-loop, bulges) that are recognized and bound by viral packaging proteins. Non-limiting examples of nucleocapsid protein packaging target sites include: psi () packaging element and infectious bronchitis virus packaging element.

[0076] A heterologous nucleic acid insert, as used herein, refers to a nucleic acid sequence to be inserted into a host cell genome that is not derived from the same species or cell type as the host cell. In some embodiments, the nucleic acid sequence is not derived from the same cell type as the host cell. In some embodiments, the nucleic acid sequence is not derived from the same species as the host cell. In some embodiments, the nucleic sequence is not derived from the cell type and the same species as the host cell.

[0077] The heterologous nucleic acid insert may encode a protein coding sequence or a non-protein coding sequence. Protein coding sequences are transcribed and translate into proteins or polypeptides. Non-protein coding sequences are transcribed and are not translated into proteins. Non-limiting examples of non-protein coding sequences include microRNAs (miRNAs), small interfering RNAs (siRNAs), artificial microRNAs (amiRNAs), long non-coding RNAs (lncRNAs), long intergenic non-coding RNAs (lincRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), enhancer RNAs, and super-enhancer RNAs. In some embodiments, non-protein coding sequences encode functional RNAs. As used herein, functional RNAs are RNAs that are not transcribed into proteins, but that fulfill a regulatory role in a cell. Non-limiting examples of functional RNAs include miRNAs, siRNAs, amiRNAs, lncRNAs, lincRNAs, rRNAs, and tRNAs.

[0078] Terminal repeats of the present disclosure flank minimal intervening viral sequences. As used herein, minimal intervening viral sequences are the shortest sequences derived from virus that allow the integration, replication, and packaging of the packagable vector RNA in a host cell. Non-limiting examples of virus from which the minimal intervening sequences may be derived include human immunodeficiency virus (HIV), infectious bronchitis virus (IBV), Moloney murine leukemia virus (MoMLV), and murine stem cell virus (MSCV).

[0079] In some embodiments, the minimal intervening viral sequences are in total up to 350 base pairs in length. In some embodiments, the minimal intervening viral sequences are in total between 200 and 400 base pairs in length. In some embodiments, the minimal intervening viral sequences are in total between 150 and 400 base pairs in length. In some embodiments, the minimal intervening viral sequences are in total between 100 and 350 base pairs in length. In some embodiments, the minimal intervening viral sequences are in total between 50 and 500 base pairs in length. In some embodiments, the packagable nucleic acid (e.g., packagable vector RNA) size is 1,900 bases, plus the size of the heterologous insert. In some embodiments, the packagable nucleic acid size is between 1,700 and 1,900 bases, plus the size of the heterologous insert. In some embodiments, the packagable nucleic acid size is between 1,000 and 2,000 bases, plus the size of the heterologous insert. In some embodiments, the packagable nucleic acid size is between 1,500 and 2,000 bases, plus the size of the heterologous insert.

[0080] In some embodiments, the TRs further flank a Rev protein response element (RRE). As used herein, a Rev protein response element is an RNA sequence bound by the Rev protein that allows the packagable vector RNA to be exported from the nucleus of the host after replication into the cytoplasm. The RRE forms multiple secondary structures (e.g., stems, loops, and bulges) that are recognized and bound by the Revl protein. In some embodiments, the sequence of the RRE and the Rev protein are derived from human immunodeficiency virus (HIV).

[0081] In some embodiments, the TRs further flank a polypurine tract. As used herein, a polypurine tract is a region containing numerous purine nucleotides (e.g., adenine, guanine), that is used as a primer for reverse transcription during viral replication. Reverse transcription of during viral replication is transcription of the viral RNA into DNA. In some embodiments, the polypurine tract contains only purines. In some embodiments, the polypurine tract contains the majority (e.g., over 50%) purines and some pyrimidines (e.g., cytosine, thymine, uracil). In some embodiments, the polypurine tract is located immediately adjacent to the 3 LTR. In some embodiments, the polypurine tract is located near (e.g., within 50 bases, within 100 bases, within 200 bases, within 300 bases, etc.). the 3 LTR.

[0082] In some embodiments, the TRs further flank a sequence encoding a group specific antigen (GAG) protein. The GAG proteins form the core of a viral capsid. The GAG protein contains numerous polypeptides, including matrix protein, capsid protein, space peptide 1, nucleocapsid protein, spacer peptide 2, and p6. The matrix (MA) protein comprises the N-terminus of GAG and is responsible for targeting GAG to the plasma membrane for release from an infected cell. The capsid protein (CA) is connected to the MA protein and forms the viral capsid. Spacer peptide 1 (SP1) is a short polypeptide connected to the CA protein that is cleaved upon production of the viral capsid. The nucleocapsid (NC) protein is connected to SP1 and forms the viral nucleocapsid. Spacer peptide 2 (SP2) is a short polypeptide that connects NC to the p6 polypeptide. The p6 polypeptide is at the C-terminus of the GAG polyprotein and recruits cellular proteins that promote virus capsid release from an infected cell.

[0083] In some embodiments, the present disclosure provides a construct comprising a sequence as set forth in SEQ ID NO: 10. In some embodiments, the present disclosure provides a construct comprising a sequence as set forth in SEQ ID NO: 11. In some embodiments, the construct is in a plasmid. In some embodiments, a construct comprising a sequence set forth in SEQ ID NO: 10 or 11 further comprises a heterologous nucleic acid insert, for example a heterologous nucleic acid insert that encodes one or more proteins or functional RNAs, such as a shRNA or miRNA, or a combination thereof.

Nucleic Acids

[0084] In some aspects, the present disclosure provides isolated nucleic acids. The isolated nucleic acids comprise a heterologous nucleic acid insert flanked by TRs, wherein between the first TR and the second TR are present packaging sequences, nuclear export sequences, and minimal intervening viral sequences. The first TR and the second TR may be any TRs described herein. In some embodiments, the first TR is the 5 TR and the second TR is the 3 TR. In some embodiments, the first TR is the 3 TR and the second TR is the 5 TR.

[0085] In some aspects, the present disclosure provides transcribed nucleic acids. As used herein, transcribed nucleic acids refers to nucleic acids that have been transcribed in a cell (e.g., not produced recombinantly). In some embodiments, a transcribed nucleic acid is produced in a host cell. In some embodiments, a transcribed nucleic acid is produced not in a host cell.

[0086] In some aspects, transcribed nucleic acids comprise a heterologous nucleic acid insert flanked by TRs, wherein between the first TR and the heterologous nucleic acid insert, there are sequences that aid in the packaging and nuclear export of the transcribed nucleic acid and minimal intervening viral sequences.

[0087] In some embodiments, the heterologous nucleic acid insert is located between the nucleocapsid protein packaging site and the second TR. The heterologous nucleic acid insert may be operably linked to a promoter (e.g., internal promoter). In some embodiments, the internal promoter operably linked to the heterologous nucleic acid insert is spleen focus-forming virus (SFFV) promoter.

[0088] As used herein, packaging sequences are nucleic acid (e.g., RNA) sequences that promote packaging of a viral genome into a capsid. In some embodiments, packaging sequences of the nucleic acids comprise a psi () sequence and a polypurine tract sequence as described herein. In some embodiments, the sequence precedes (is located 5 to) the polypurine tract sequence. In some embodiments, the polypurine tract sequence precedes the sequence.

[0089] As used herein a nuclear export sequence is a sequence that promotes the translocation of a replicated viral genome from the nucleus of a host cell to the cytoplasm for packaging. In some embodiments, a nuclear export sequence comprises the RRE. In some embodiments, the RRE is located between the sequence and the polypurine tract sequence. In some embodiments, the RRE is located upstream of the sequence and the polypurine tract sequence. In some embodiments, the RRE is located downstream of the sequence and the polypurine tract sequence.

[0090] The nucleic acid comprises minimal intervening viral sequences. In some embodiments, the minimal intervening viral sequences are up to a total of 350 base pairs in length. In some embodiments, the minimal intervening viral sequences are a total of 25-350 base pairs, 50-300 base pairs, 100-350 base pairs, 125-200 base pairs, or 10-250 base pairs in length.

[0091] In some embodiments, nucleic acid packagable size is 1,900 bases, plus the size of the heterologous nucleic acid insert. As used herein, nucleic acid packagable size refers to the total length (in bases) of nucleic acids that will be packaged into a capsid protein. In some embodiments, the nucleic acid packagable size is 1,000-7,000, 1,900-8,000 bases, 3,000-6,000 bases, 2,000-5,000 bases, or 4,000-8,000 bases, plus the size of the nucleic acid insert.

Heterologous Nucleic Acid Insert

[0092] The nucleic acids provided herein may contain a promoter that is located upstream of the 5 TR. A promoter may be any promoter as described herein (e.g., constitutive, induced, native). In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is CMV. In some embodiments, the constitutive promoter is SV40. In some embodiments, the constitutive promoter is a fusion of CMV and SV40.

[0093] The nucleic acids described herein contain heterologous nucleic acid inserts. The heterologous nucleic acid inserts may be any that are described herein. In some embodiments, the heterologous nucleic acid insert encodes a functional RNA. In some embodiments, the functional RNA is a shRNA. In some embodiments, there is a selectable marker gene or a reporter gene upstream of the shRNA sequence. As used herein, a selectable marker gene encodes a protein that can be used to screen for cells by artificial selection. Non-limiting examples of selectable marker genes include antibiotic resistance genes (e.g., puromycin, ampicillin, kanamycin) and amino acid synthesis genes (e.g., URA3, TRYP, LEU). A reporter gene encodes a protein that can be used to screen for cells expressing or not expressing the reporter gene. Non-limiting examples of reporter genes include fluorescent genes (e.g., ZsGreen, green fluorescent protein, red fluorescent protein, yellow fluorescent protein, cyan fluorescent protein) and enzymatic genes (e.g., chloramphenicol acetyltransferase).

[0094] The disclosure relates, in part, to constructs having a heterologous nucleic acid insert configured to express one or more gene editing proteins to a cell. In some embodiments, the heterologous nucleic acid insert encodes a protein-coding gene. In some embodiments, the heterologous nucleic acid insert encodes a Cas nuclease. As used herein, Cas nuclease refers to clustered a regularly interspaced palindromic repeat (CRISPR)-associated nuclease. Cas nucleases cut nucleic acid (e.g., DNA, RNA) specific sequences, known as the protospacer adjacent motifs (PAMs), close to a target sequence in the nucleic acid. A Cas nuclease may any Cas nuclease known in the art (See, e.g., U.S. Pat. No. 8,697,359). In some embodiments, the Cas nuclease is Cas9 nuclease. In some embodiments, the Cas9 nuclease is from Streptococcus pyogenes, Neisseria meningitides, or Campylobacter jejuni.

[0095] In some embodiments, the heterologous nucleic acid insert encodes a microRNA. As used herein, a microRNA is a non-coding RNA molecule the decreases expression of a target gene or genes after base-pairing with and silencing mRNA molecules. mRNA molecules bound by microRNAs (miRNAs) are silenced by cleavage of the mRNA strand into two pieces, destabilization of the mRNA by shortening of its polyA tail, and/or less efficient translation of the mRNA into proteins. miRNAs can be processed into short-hairpin RNAs (shRNAs) in cells by the enzyme Dicer. shRNAs decreased gene expression of a target gene after binding mRNA molecules and stimulating the cleavage of the mRNA.

[0096] MicroRNAs of the disclosure may decrease gene expression of any gene that is transcribed into a mRNA molecule. In some embodiments, microRNAs decrease gene expression of genes that promote transcription. In some embodiments, miRNAs of the present disclosure target AGO1, AGO2, AGO3, DNMT3, HDAC1, HP1, SUV39H1, SUV39H2, PIWIL2, TRIM28, SETDB1, FAM208A, MPHOSPH8, PPHLN1, and/or MORC2. In some embodiments, miRNAs of the disclosure specifically bind to (e.g., hybridize or have a region of complementarity with) at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of a gene encoding AGO1, AGO2, AGO3, DNMT3, HDAC1, HP1, SUV39H1, SUV39H2, PIWIL2, TRIM28, SETDB1, FAM208A, MPHOSPH8, PPHLN1, and/or MORC2.

Host Cells

[0097] Methods of the present disclosure comprise delivering the constructs or nucleic acids described herein to host cells. As used herein, a host cell is a cell the integrates a heterologous nucleic acid insert of the present disclosure into its genome after being contacted with a construct, nucleic acid, or composition of the present disclosure. The host cell replicates the heterologous nucleic acid insert, which can be packaged into capsids that are released from the host cell. Non-limiting host cells of the present disclosure include human cells, mouse cells, rat cells, monkey cells, dog cells, or cat cells. In some embodiments, host cells are human cells. In some embodiments, a host cell is a primary human cell. As used herein, a primary human cell is a cell isolated directly from a tissue in a living human (e.g., biopsy) and established for growth in vitro. In some embodiments, the primary human cell is a dendritic cell.

[0098] In order to integrate and replicate heterologous nucleic acids inserts of the present disclosure, host cells must contain RNA polymerase. The RNA polymerase binds the 5 TR and catalyzes transcription of the heterologous nucleic acid insert. In some embodiments, the RNA polymerase is endogenously expressed. In some embodiments, the RNA polymerase is exogenously expressed. As used herein, endogenously expressed refers to an RNA polymerase that is part of the genome of the host cell. As used herein, exogenously expressed refers to an RNA polymerase that is not part of the genome of the host cell. In some embodiments, the RNA polymerase is RNA polymerase II.

[0099] In order to package and release the heterologous nucleic acid insert, host cells of the present disclosure must express nucleic acid sequences that facilitate encapsulating and enveloping of the heterologous nucleic acid. To ensure that viruses do not reproduce spontaneously in host cells, the nucleic acid sequences that facilitate encapsulating and enveloping of the heterologous nucleic acid are contained in plasmids. As used herein, a plasmid is a small DNA molecule in a host cell that is physically separated from and replicates independent on the host cell genome. In some embodiments, the encapsulating and enveloping sequences are contained in (e.g., encoded by) the same plasmid. In some embodiments, the encapsulating and enveloping sequences are contained in (e.g., encoded by) separate plasmids.

[0100] Encapsulating nucleic acids encode genes for GAG, polymerase (pol), and Rev proteins. A GAG protein may be any GAG protein described herein. Pol protein contains both reverse transcriptase and integrase polypeptides. Reverse transcriptase is an enzyme that catalyzes the synthesis of complementary DNA (cDNA) from RNA (e.g., packagable vector RNA). Rev protein binds the RRE, as described previously. In some embodiments, the encapsulating sequences encode GAG, pol, and Rev proteins. In some embodiments, the encapsulating sequences encode GAG protein. In some embodiments, the encapsulating sequences encode pol proteins. In some embodiments, the encapsulating sequence encodes Rev proteins.

[0101] In some embodiments, the GAG, pol, and Rev encapsulating sequences are in (e.g., encoded by) the same plasmid. In some embodiments, the GAG, pol, and Rev encapsulating sequences are in (e.g., encoded by) 3 separate plasmids. In some embodiments, the GAG, pol, and Rev encapsulating sequences are in (e.g., encoded by) 2 separate plasmids.

[0102] Enveloping refers to the encapsulation of a capsid (e.g., viral capsid). Viral envelopes are derived from the host cell plasma membrane, and also contain viral glycoproteins. These viral glycoproteins bind receptor proteins on host cell membranes and help virus capsids to avoid the host immune system. In some embodiments, the viral envelope sequence encodes vesicular stomatitis virus G glycoprotein (VSVG). In some embodiments, the enveloping sequence is in the same plasmid of as the packaging sequences. In some embodiments, the enveloping sequence is in a separate plasmid from the packaging sequences.

[0103] In some embodiments, host cells of the present disclosure comprise viral particles. As used herein, viral particles, also known as virions, are viral nucleic acid (e.g., RNA) surrounded by a capsid protein. In some embodiments, the viral nucleic acid is transcribed nucleic acid, as described herein. In some embodiments, the viral nucleic acid is isolated nucleic acid, as described herein.

Methods of Use

[0104] In some aspects, the present disclosure provides methods for efficient gene knockdown comprising infecting target cells with viral particles. Target cells may be any cells in a mammalian subject. Non-limiting examples of target cells include human cells, non-human primate cells, mouse cells, rat cells, dog cells, cat cells, cow cells, pig cells, or chicken cells. In some embodiments, the target cells are human cells. In some embodiments, human cells are primary human cells. Non-limiting examples of human primary cells include dendritic cells, neurons, natural killer cells, T cells, B cells, myocytes, osteoclasts, osteoblasts, chondrocytes, chondroclasts, glial cells, hepatocytes, renal cells, and epithelial cells. In some embodiments, the primary human cells are dendritic cells.

[0105] The viral particles may be any viral particles as described herein (e.g., transcribed nucleic acids, isolated nucleic acids). Efficient gene knockdown, as used herein, refers to a 40% decrease, a 45% decrease, a 50% decrease, a 55% decrease, a 60% decrease, a 65% decrease, a 70% decrease, a 75% decrease, an 80% decrease, an 85% decrease, a 90% decrease, a 95% decrease, or a 95% decrease in expression of the target gene (e.g., relative to expression of the target gene in a cell or subject prior to administration of a construct described herein). Non-limiting examples of target genes include AGO1, AGO2, AGO3, DNMT3, HDAC1, HP1, SUV39H1, SUV39H2, PIWIL2, TRIM28, SETDB1, FAM208A, MPHOSPH8, PPHLN1, and MORC2.

[0106] In some aspects, the present disclosure provides methods of delivering plasmids to a cell. The plasmids may contain any constructs or nucleic acids described herein. Non-limiting methods of delivering plasmids to a cell include: viral delivery (e.g., retroviral, lentiviral, etc.), transfection, electroporation, heat shock, liposomes, nanoparticles, microinjection, sonoporation, photoporation, magetofection, and hydroporation.

[0107] In some aspects, the present disclosure provides methods of infecting a host cell with viral particles. The viral particles may encapsulate any nucleic acids (e.g., isolated, transcribed) as described herein. Viral particles may be RNA-based viral particles (e.g., lentiviral, oncoretroviral, human foamy virus). Viral particles may be DNA-based viral particles (e.g., adenovirus, adeno-associated virus, herpes simplex virus).

[0108] In some embodiments, the host cell is in a subject that is infected with the viral particles. A subject is any mammal, including, but not limited to, a human, a non-human primate, a mouse, a rat, a dog, a cat, a cow, a pig, or a chicken. Viral particles may be administered to a subject by any method known in the art. Non-limiting methods of administering viral particles include intramuscular injection, intravenous injection, intra-arterial injection, inhalation, and ingestion.

[0109] In some aspects, the present disclosure provides compositions comprising a plurality of nucleic acids. As used herein, a plurality may be 2 or more, 10 or more, hundreds or more, thousands or more, millions or more, billions or more, or trillions or more nucleic acids. In some embodiments, the nucleic acids in the compositions are the same nucleic acids. In some embodiments, the nucleic acids in the compositions are different nucleic acids.

[0110] In some embodiments, compositions comprise a pharmaceutically acceptable carrier. As used herein, carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial agents, antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase pharmaceutically acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.

Kits and Related Compositions

[0111] The agents described herein may, in some embodiments, be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit may include one or more containers housing the components of the disclosure and instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In certain embodiments agents in a kit may be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes may contain the components in appropriate concentrations or quantities for running various experiments.

[0112] In some embodiments, the instant disclosure relates to a kit for producing a packagable vector RNA, the kit comprising a container housing a nucleic acid encoding a promoter operably linked to a transgene encoding the packagable vector RNA. The packagable vector RNA may be any packagable vector RNA described herein. In some embodiments, the kit also comprises additional plasmids that contain nucleic acids that facilitate encapsulating and enveloping of the packagable vector RNA. In some embodiments, the plasmids encoding nucleic acids that facilitate encapsulating and enveloping are in separate plasmids. In some embodiments, the plasmids encoding nucleic acids that facilitate encapsulating and enveloping are in the same plasmid.

[0113] The kit may be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, instructions can define a component of instruction and/or promotion, and typically involve written instructions on or associated with packaging of the disclosure. Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions are to be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), Internet, and/or web-based communications, etc. The written instructions may be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflects approval by the agency of manufacture, use or sale for animal administration.

[0114] The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and/or isolating and mixing a sample and applying to a subject. The kit may include a container housing agents described herein. The agents may be in the form of a liquid, gel or solid (powder). The agents may be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively it may be housed in a vial or other container for storage. A second container may have other agents prepared sterilely. Alternatively the kit may include the active agents premixed and shipped in a syringe, vial, tube, or other container.

[0115] Exemplary embodiments of the invention will be described in more detail by the following examples. These embodiments are exemplary of the invention, which one skilled in the art will recognize is not limited to the exemplary embodiments.

EXAMPLES

Example 1: Vector Development

[0116] An overview schematic of lentiviral vector plasmids is shown in FIG. 1.

Standard Vector to First Generation

[0117] Certain components were deleted to make the lentiviral vector smaller. This increased vector titer in difficult to transduce cells, for transduction of large genes (e.g., CAS9), and for direct Illumina sequencing from the polyA (important for single cell RNA-Seq, for example). A schematic of the plasmids is shown in FIG. 2.

[0118] A first generation vector was tested using a knockdown construct on human primary dendritic cells. The vector expresses both ZsGreen (or Puromycin.sup.R) and DC-SIGN knockdown shRNA. After 6 days transduction (with puromycin selection if using Puromycin.sup.R), ZsGreen expression and DC-SIGN knockdown levels were checked by flow cytometry. A schematic of the text is shown in FIG. 3. Vector modification was found to enhance insert gene expression level. Higher protein expression levels and shRNA knockdown efficiency were achieved by modification (FIG. 4).

[0119] One application of the vector development is in single-cell sequencing with shRNA library screening. The single-cell RNA-Seq reads 100-300 base pair sequences from the 3 end to the polyA site (FIG. 5). The distance in the developed vector allows that single-cell RNA-Seq reads the shRNA sequence directly, which does not need additional barcode sequences in shRNA library screening. This facilitates library cloning, leads to cost and labor savings, and prevents potential recombination between barcode and lentiviral RNA sequences.

Further Development from First Generation to Second Generation Vector

[0120] Overview schematics of first generation versus second generation and regular versus second generation lentiviral vectors are shown in FIGS. 6 and 7, respectively. First and second generation vectors for Cas9 transduction were tested on human primary dendritic cells (FIG. 8). The vector expresses both SpyCas9 (Cas9 from Streptococcus pyogenes) and GFP. After 6 days transduction, the percentage of GFP positive cells was checked by flow cytometry. LentiCRISPRv2 (Addgene #52961; replaced puromycin.sup.R with GFP) was used as a control. The vectors were found to have increased transduction efficiency with Cas9 as test cargo (FIG. 9). Second generation vectors were tested for transduction of different Cas9 types on human primary dendritic cells (FIG. 10). The developed vector exhibited good transduction efficiencies on all Cas9 constructs (FIG. 11). The smaller insert construct showed higher transduction efficiency.

[0121] It was tested whether transduced Cas9s disrupt target gene expression in human primary dendritic cells (FIG. 12). The SpyCas9 construct and single gRNA construct targeting gene encoding the cell surface marker DC-SIGN were co-transduced. After 6 days transduction with puromycin selection, the percentage of GFP positive cells and DC-SIGN expression level were checked by flow cytometry. LentiCRISPRv2 (Addgene #52961; replaced puromycin.sup.R with GFP) was used as a control. Transduced SpyCas9 disrupts cell surface levels of the protein encoded by the target gene, DC-SIGN (FIG. 13).

[0122] A third generation lentiviral vector is depicted in FIG. 14.

TABLE-US-00001 Plasmidsequences pALPS (SEQIDNO:1) 1 gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctg 61 atgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagt 121 gcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatc 181 tgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgctgtg 241 gaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgca 301 aagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcagg 361 cagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactcc 421 gcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaat 481 tttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtg 541 aggaggcttttttggaggcctaggcttttgcaaaaagctttgacattgattattgactag 601 ttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgt 661 tacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgac 721 gtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatg 781 ggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaag 841 tacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacat 901 gaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccat 961 ggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatt 1021 tccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacggga 1081 ctttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacg 1141 gtgggaggtctatataagcagcgcgttttgcctgtactgggtctctctggttagaccaga 1201 tctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagct 1261 tgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagat 1321 ccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggactt 1381 gaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcg 1441 cacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggagg 1501 ctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcg 1561 atgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagt 1621 atgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcaga 1681 aggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaact 1741 tagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaa 1801 agacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgc 1861 acagcaagcggccggccgctgatcttcagacctggaggaggagatatgagggacaattgg 1921 agaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccacc 1981 aaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttc 2041 cttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggta 2101 caggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctatt 2161 gaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaaga 2221 atcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctct 2281 ggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctg 2341 gaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacaca 2401 agcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaa 2461 ttattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctg 2521 tggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagttttt 2581 gctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacc 2641 cacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagag 2701 agagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctg 2761 cagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacag 2821 tgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaa 2881 acaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttg 2941 gttaattaactgcagccccgataaaataaaagattttatttagtctccagaaaaaggggg 3001 gaatgaaagaccccacctgtaggtttggcaagctagctgcagtaacgccattttgcaagg 3061 catggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaat 3121 agctaacgttgggccaaacaggatatctgcggtgagcagtttcggccccggcccggggcc 3181 aagaacagatggtcaccgcagtttcggccccggcccgaggccaagaacagatggtcccca 3241 gatatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctcccccaa 3301 ggacctgaaatgaccctgcgccttatttgaattaaccaatcagcctgcttctcgcttctg 3361 ttcgcgcgcttctgcttcccgagctctataaaagagctcacaacccctcactcggcgcgc 3421 cagtcctccgacagactgagtcgcccgggggtctagaagcgctggatccgtttaaacgcg 3481 gccgcccagcacagtggctcgagccgcgggttaactggccagaattcacgcgtatcgata 3541 ccggtggcccctggggccgcgatcgctaatcaacctctggattacaaaatttgtgaaaga 3601 ttgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatg 3661 cctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcc 3721 tggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgc 3781 actgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctt 3841 tccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgcctt 3901 gcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcgggg 3961 aagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacg 4021 tccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctg 4081 ccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctt 4141 tgggccgcctccccgcttaatcgcgtcgagacctagaaaaacatggagcaatcacaagta 4201 gcaatacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggagg 4261 tgggttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgtag 4321 atcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaa 4381 gacaagatatccttgatctgtggatctaccacacacaaggctacttccctgattggcaga 4441 actacacaccagggccagggatcagatatccactgacctttggatggtgctacaagctag 4501 taccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttac 4561 accctgtgagcctgcatgggatggatgacccggagagagaagtattagagtggaggtttg 4621 acagccgcctagcatttcatcacatggcccgagagctgcatccggactgtactgggtctc 4681 tctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctta 4741 agcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgact 4801 ctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagggccc 4861 gtttcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctgg 4921 cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcaga 4981 ggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg 5041 tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgg 5101 gaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttc 5161 gctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccg 5221 gtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca 5281 ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggt 5341 ggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccag 5401 ttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcg 5461 gtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc 5521 ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattt 5581 tggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagtt 5641 ttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatca 5701 gtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccg 5761 tcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgatac 5821 cgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaaggg 5881 ccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgcc 5941 gggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta 6001 caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaac 6061 gatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtc 6121 ctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcac 6181 tgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtact 6241 caaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaa 6301 tacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgtt 6361 cttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaaccca 6421 ctcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaa 6481 aaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatac 6541 tcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcg 6601 gatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttcccc 6661 gaaaagtgccacctgac 3ModifiedpALPS(1stGenerationVector) (SEQIDNO:2) 1 gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctg 61 atgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagt 121 gcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatc 181 tgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgctgtg 241 gaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgca 301 aagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcagg 361 cagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactcc 421 gcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaat 481 tttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtg 541 aggaggcttttttggaggcctaggcttttgcaaaaagctttgacattgattattgactag 601 ttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgt 661 tacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgac 721 gtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatg 781 ggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaag 841 tacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacat 901 gaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccat 961 ggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatt 1021 tccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacggga 1081 ctttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacg 1141 gtgggaggtctatataagcagcgcgttttgcctgtactgggtctctctggttagaccaga 1201 tctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagct 1261 tgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagat 1321 ccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggactt 1381 gaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcg 1441 cacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggagg 1501 ctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcg 1561 atgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagt 1621 atgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcaga 1681 aggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaact 1741 tagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaa 1801 agacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgc 1861 acagcaagcggccggccgctgatcttcagacctggaggaggagatatgagggacaattgg 1921 agaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccacc 1981 aaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttc 2041 cttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggta 2101 caggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctatt 2161 gaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaaga 2221 atcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctct 2281 ggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctg 2341 gaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacaca 2401 agcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaa 2461 ttattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctg 2521 tggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagttttt 2581 gctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacc 2641 cacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagag 2701 agagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctg 2761 cagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacag 2821 tgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaa 2881 acaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttg 2941 gttaattaactgcagccccgataaaataaaagattttatttagtctccagaaaaaggggg 3001 gaatgaaagaccccacctgtaggtttggcaagctagctgcagtaacgccattttgcaagg 3061 catggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaaaat 3121 agctaacgttgggccaaacaggatatctgcggtgagcagtttcggccccggcccggggcc 3181 aagaacagatggtcaccgcagtttcggccccggcccgaggccaagaacagatggtcccca 3241 gatatggcccaaccctcagcagtttcttaagacccatcagatgtttccaggctcccccaa 3301 ggacctgaaatgaccctgcgccttatttgaattaaccaatcagcctgcttctcgcttctg 3361 ttcgcgcgcttctgcttcccgagctctataaaagagctcacaacccctcactcggcgcgc 3421 cagtcctccgacagactgagtcgcccgggggtctagaagcgctggatccgtttaaacgcg 3481 gccgcccagcacagtggctcgagccgcgggttaactggccagaattcacgcgtatcgata 3541 ccggtggcccctggggccgcgatcgccagctgtagatcttagccactttttaaaagaaaa 3601 ggggggactggaagggctaactgcatccggactgtactgggtctctctggttagaccaga 3661 tctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagct 3721 tgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagat 3781 ccctcagacccttttagtcagtgtggaaaatctctagcagggcccgtttcatgtgagcaa 3841 aaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggc 3901 tccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccga 3961 caggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttc 4021 cgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgcttt 4081 ctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggct 4141 gtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttg 4201 agtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggatta 4261 gcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggct 4321 acactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaa 4381 gagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgttt 4441 gcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttcta 4501 cggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattat 4561 caaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaa 4621 gtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatct 4681 cagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataacta 4741 cgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgct 4801 caccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtg 4861 gtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaa 4921 gtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgt 4981 cacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagtta 5041 catgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtca 5101 gaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctctta 5161 ctgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattct 5221 gagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccg 5281 cgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaac 5341 tctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaact 5401 gatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaa 5461 atgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttccttt 5521 ttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaat 5581 gtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctg 5641 ac pTL(2ndGenerationVector) (SEQIDNO:3) 1 gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctg 61 atgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagt 121 gcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatc 181 tgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgctgtg 241 gaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgca 301 aagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcagg 361 cagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactcc 421 gcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaat 481 tttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtg 541 aggaggcttttttggaggcctaggcttttgcaaaaagctttgacattgattattgactag 601 ttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgt 661 tacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgac 721 gtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatg 781 ggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaag 841 tacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacat 901 gaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccat 961 ggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatt 1021 tccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacggga 1081 ctttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacg 1141 gtgggaggtctatataagcagcgcgttttgcctgtactgggtctctctggttagaccaga 1201 tctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagct 1261 tgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagat 1321 ccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggactt 1381 gaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcg 1441 cacggcaagaggcgaggggcggcgactgacgagtacgccaaaaattttgactagcggagg 1501 ctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcg 1561 atgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagt 1621 atgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcaga 1681 aggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaact 1741 tagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaa 1801 agacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgc 1861 acagcaagcggccggccgctgaataggagctttgttccttgggttcttgggagcagcagg 1921 aagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctgg 1981 tatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgca 2041 actcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacct 2101 aaaggatcaacagctcctgggggtatacacaaatggcagtattcatccacaattttaaaa 2161 gaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacag 2221 acatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttatt 2281 acagggacagcagagatccagtttggttaattaactgcagccccgataaaataaaagatt 2341 ttatttagtctccagaaaaaggggggaatgaaagaccccacctgtaggtttggcaagcta 2401 gctgcagtaacgccattttgcaaggcatggaaaaataccaaaccaagaatagagaagttc 2461 agatcaagggcgggtacatgaaaatagctaacgttgggccaaacaggatatctgcggtga 2521 gcagtttcggccccggcccggggccaagaacagatggtcaccgcagtttcggccccggcc 2581 cgaggccaagaacagatggtccccagatatggcccaaccctcagcagtttcttaagaccc 2641 atcagatgtttccaggctcccccaaggacctgaaatgaccctgcgccttatttgaattaa 2701 ccaatcagcctgcttctcgcttctgttcgcgcgcttctgcttcccgagctctataaaaga 2761 gctcacaacccctcactcggcgcgccagtcctccgacagactgagtcgcccgggggtcta 2821 gaagcgctggatccgtttaaacgcggccgcccagcacagtggctcgagccgcgggttaac 2881 tggccagaattcacgcgtatcgataccggtggcccctggggccgcgatcgccagctgtag 2941 atcttagccactttttaaaagaaaaggggggactggaagggctaactgcatccggactgt 3001 actgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaac 3061 ccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctg 3121 ttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctct 3181 agcagggcccgtttcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggcc 3241 gcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgc 3301 tcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctgga 3361 agctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgccttt 3421 ctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtg 3481 taggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgc 3541 gccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactg 3601 gcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttc 3661 ttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctg 3721 ctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccacc 3781 gctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatct 3841 caagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgt 3901 taagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaa 3961 aaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaa 4021 tgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcc 4081 tgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgct 4141 gcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagcca 4201 gccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctatt 4261 aattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgtt 4321 gccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctcc 4381 ggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagc 4441 tccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggtt 4501 atggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgact 4561 ggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgc 4621 ccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcatt 4681 ggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcg 4741 atgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttct 4801 gggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaa 4861 tgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt 4921 ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgc 4981 acatttccccgaaaagtgccacctgac

Example 2: Primate Immunodeficiency Virus Vpx and Vpr Counteract Transcriptional Repression of Proviruses by the HUSH Complex

[0123] Drugs that inhibit HIV-1 replication and prevent progression to AIDS do not eliminate HIV-1 proviruses from the chromosomes of long-lived CD4.sup.+ memory T cells. To escape eradication by these antiviral drugs, or by the host immune system, HIV-1 exploits poorly defined host factors that silence provirus transcription. These same factors, though, must be overcome by all retroviruses, including HIV-1 and other primate immunodeficiency viruses, in order to activate provirus transcription and produce new virus. Here it is shown that Vpx and Vpr, proteins from a wide range of primate immunodeficiency viruses, activate provirus transcription in human CD4.sup.+ T cells. Provirus activation required the DCAF1 adaptor that links Vpx and Vpr to the CUL4A/B ubiquitin ligase complex, but did not require degradation of SAMHD1, a well-characterized target of Vpx and Vpr. A loss-of-function screen for transcription silencing factors that mimic the effect of Vpx on provirus silencing identified all components of the Human Silencing Hub (HUSH) complex, FAM208A (TASOR/RAP140), MPHOSPH8 (MPP8), PPHLN1 (PERIPHILIN), and MORC2. Vpx associated with the HUSH complex components and decreased steady-state levels of these proteins in a DCAF-dependent manner. Finally, vpx and FAM208A knockdown accelerated HIV-1 and SIV.sub.MAC replication kinetics in CD4.sup.+ T cells to a similar extent, though HIV-2 replication required either vpx or FAM208A disruption. These results demonstrate that the HUSH complex restricts HIV-1 transcription and thereby contributes to provirus latency. To counteract this restriction and activate provirus expression, primate immunodeficiency viruses encode Vpx and Vpr proteins that degrade HUSH complex components.

[0124] When provided in trans, many primate immunodeficiency virus Vpx and Vpr orthologues increase HIV-1 reverse transcription and transduction efficiency in dendritic cells, macrophages, and resting CD4.sup.+ T cells. As substrate adaptor proteins for the DCAF1-CUL4A/B E3 ubiquitin ligase, Vpx and Vpr increase the concentration of deoxynucleotide triphosphate (dNTP) levels in target cells by degrading the deoxynucleotidetriphosphate (dNTP) hydrolase SAMHD1. Nonetheless, Vpx and Vpr have additional effects on expression of transduced reporter genes that are not explained by SAMHD1 degradation or by increase in dNTP concentration.

[0125] To better understand the effect on provirus reporter gene expression, vpx was introduced before, during, or after transduction of a reporter gene (FIG. 16A). Jurkat CD4.sup.+ T cells were transduced with a dual-promoter, lentiviral vector that expresses codon-optimized SIV.sub.MAC251 vpx from the spleen focus forming virus (SFFV) promoter and puromycin acetyltransferase (puro.sup.R) from the PPIA (CypA) promoter (Lenti 1 in the FIG. 16A time-line, FIG. 20A and Table 1). A control Lenti 1 vector was used that lacks vpx (FIG. 20A). Puromycin was added to the culture on day three to select those cells that had been transduced with Lenti 1. On day seven, cells were transduced with a second lentivector bearing a codon-optimized gag-gfp reporter gene expressed from the SFFV promoter, as well as SIV.sub.MAC251 vpx expressed from the CypA promoter (Lenti 2 in the FIG. 16A timeline and FIG. 20A). A control Lenti 2 vector was used that lacks vpx (FIG. 20A). On day ten, virus-like particles (VLPs) containing Vpx protein were added to the twice-transduced cells. As controls, VLPs lacking Vpx were used, or no VLPs were added. On day fourteen, the percent GFP.sup.+ cells under each condition was assessed by flow cytometry using standard gating for viable, singlet, lymphoid cells (FIG. 20B). Vpx increased the percentage of GFP.sup.+ cells, whether vpx was transduced before, or concurrent with, reporter gene transduction, or if Vpx protein was delivered by VLPs after reporter gene transduction (FIG. 16B and FIG. 20C; n=3 biological replicates, p<0.02, 1-way ANOVA with Dunnett post-test). These results suggest that the transduced reporter gene was actively silenced and that vpx overcame reporter silencing.

[0126] To confirm that the findings in FIG. 16B were due to effects of vpx on transcriptional silencing of the reporter gene, and not due to effects on transduction efficiency, Jurkat T cells were first transduced with a vector in which the gag-gfp reporter gene was expressed from the SFFV promoter and blasticidin-S deaminase (blasti.sup.R) was expressed from the CypA promoter. Four days after transduction with the reporter vector and selection with blasticidin, cells were either challenged with Vpx.sup.+ VLPs, or transduced and selected with the dual-promoter lentivector encoding vpx and puroR (Lenti 1 in FIG. 20A). Four days later the GFP signal was at background levels unless Vpx was provided, either by VLPs (FIG. 16C) or by vpx transduction (FIG. 16D). The effect of vpx on reporter gene expression was confirmed by qRT-PCR for the reporter mRNA (FIG. 20D). Reporter gene silencing and reactivation by Vpx was not specific to the SFFV promoter since GFP signal was similar when the reporter gene was expressed from the human EEF1A1 (EF1) promoter or from the Herpes simplex virus type 1 thymidine kinase (TK) promoter (FIG. 20E). These results demonstrate that Vpx overcomes transcriptional silencing of the provirus.

[0127] To determine if the ability to activate transcription of silenced proviruses is peculiar to SIV.sub.MAC251 Vpx, representative Vpx and Vpr orthologues, selected from across the phylogeny of primate immunodeficiency viruses, were examined. All Vpx proteins tested, SIV.sub.DRLD3, SIV.sub.RCMNG411, SIV.sub.AGI00CM312, SIV.sub.RCM02CM8081, SIV.sub.MND25440, HIV-2.sub.ROD, SIV.sub.MAC251, and SIV.sub.MNE027, had transactivating activity in human cells (FIG. 16E and FIG. 20F). Conservation of this activity in human cells among such divergent SIV orthologues was surprising given that SIV.sub.RCMNG411 Vpx and SIV.sub.MND25440 Vpx do not degrade human SAMHD1, but they do degrade the SAMHD1 orthologue from their cognate primate host species.sup.8. Several Vprs from SIVs that lack Vpx, including SIV.sub.MUS2CM1246, SIV.sub.AGMVer9063, SIV.sub.AGMTAN1, SIV.sub.MND1GB1, and SIV.sub.LST524, also activated transcription of silent proviral reporters in human cells (FIG. 16E and FIG. 20F). Results could not be obtained from this experimental system concerning the activity of Vprs encoded by SIV.sub.CPZTAN3, HIV-1.sub.U14788 (Group P), SIV.sub.GORCP684con, HIV-1.sub.MVP5180 (Group O), HIV-1.sub.NL4-3 (Group M), SIV.sub.CPZLB7, and SIV.sub.RCM02CM8081, presumably because these orthologues caused cell cycle arrest and toxicity (indicated by in FIG. 16E). Vpx and Vpr sequence variability is among the highest observed for lentiviral coding sequences; the sequences shown in FIG. 16E have an average amino acid identity of only 27%. Such diversity likely reflects rapidly evolving, host-pathogen interfaces, and precluded activity predictions based on amino acid sequence conservation to guide the engineering of loss-of-function mutations.

[0128] A loss-of-function screen was performed focusing on genes reported to contribute to silencing of retroviruses and other transcriptional targets. Jurkat T cells were transduced with lentivectors that confer puromycin resistance and express shRNAs targeting either AGO1, AGO2, AGO3, DNMT3A, HDAC1, HP1, SUV39H1, SUV39H2, PIWIL2, TRIM28, SETDB1, FAM208A, MPHOSPH8, PPHLN1, or MORC2. After selection for five days with puromycin, cells were transduced with the Lenti 2 gag-gfp reporter vector without vpx (FIG. 20A). Four days later, the change in expression of the gfp reporter due to the knockdowns was calculated as a percentage of the activity observed in a separate population of Jurkat cells transduced to express vpx (FIG. 17A). A given gene was implicated as a transcriptional silencing factor for the provirus reporter gene if the three shRNA targets for that gene differed significantly from that of the luciferase knockdown control (p<0.05, 1-way ANOVA with Dunnett post-test). shRNAs targeting each of the three core components of the Human Silencing Hub (HUSH) complex, FAM208A, MPHOSPH8, and PPHLN1, increased reporter gene expression (FIG. 17A).

[0129] The effect on reporter gene expression in Jurkat T cells of the most effective shRNA target sequences for FAM208A, MPHOSPH8, and PPHLN1 is shown in FIG. 17B. The effectiveness of the knockdown of each of the HUSH complex components in Jurkat cells was confirmed by immunoblotting lysate from these cells with antibodies specific for FAM208A, PPHLN1, or MPHOSPH8 (FIG. 17C). As previously reported, knockdown of any individual HUSH complex component caused a decrease in the level of each of the other components. Similar results on reporter gene expression were obtained when FAM208A, MPHOSPH8, or PPHLN1 were knocked down in primary human CD4.sup.+ T cells (FIG. 17D). Knockdown of each of the HUSH complex components, then, had the same effect as vpx on lentiviral reporter gene expression (FIGS. 17B and 17D and FIG. 21A). These results demonstrate that the HUSH complex is critical for provirus silencing and raise the possibility that Vpx acts as a substrate adaptor targeting HUSH components to DCAF1 and the CUL4A/B E3 ubiquitin ligase complex for degradation, in the same way that Vpx targets SAMHD1.

[0130] To determine if Vpx promotes the degradation of HUSH complex components, lysate from cells transduced to express SIV.sub.MAC251, SIV.sub.MND25440, or SIV.sub.RCMNG411 vpx was immunoblotted with antibodies specific for FAM208A, PPHLN1, or MPHOSPH8. All three Vpx proteins reduced the steady-state level of all three core HUSH complex components (FIG. 17E). Among the three HUSH components, though, FAM208A protein levels were decreased more than the other two components (FIG. 17F) so ongoing experiments focused on the effect of Vpx on FAM208A. Indeed, in addition to the three Vpx proteins assessed in FIG. 17E, the other Vpx and Vpr orthologues shown to have transactivation activity in FIG. 16E and FIG. 20F (HIV-2.sub.ROD Vpx, SIV.sub.MNE027 Vpx, SIV.sub.DRLD3 Vpx, SIV.sub.AGMTAN1 Vpr, SIV.sub.MND1GB1 Vpr, and SIV.sub.LST524 Vpr) all decreased the levels of FAM208A (FIGS. 21B and 22C).

[0131] To assess whether disruption of FAM208A protein levels by Vpx was dependent upon the DCAF1 adaptor for the CUL4A/B ubiquitin ligase complex, as is the case for SAMHD1, Jurkat T cells were transduced with a lentivector that knocks down DCAF1, or with a control knockdown vector. After selection with puromycin the cells were exposed for 18 hrs to SIV VLPs bearing Vpx, control VLPs that lacked Vpx, or no VLPs. In the DCAF1 knockdown cells, FAM208A protein levels were unchanged by Vpx, indicating that FAM208A disruption by Vpx was dependent upon DCAF1 (FIG. 17G).

[0132] Degradation of SAMHD1 requires direct interaction with Vpx or Vpr. To determine if Vpx similarly associates with proteins of the HUSH complex, HA-tagged FAM208A was co-transfected into HEK293 cells with FLAG-tagged SIV.sub.MAC251 Vpx or SIV.sub.RCM02CM8081 Vpx. When anti-FLAG antibody was used to immunoprecipitate either of the two Vpx proteins from the soluble cell lysate, HA-FAM208A was detected in the immunoprecipitate (FIG. 17H). The strength of the FAM208A signal in the Vpx pull-out increased when the co-transfected HEK293 cells were incubated with the proteasome inhibitor PR171, or when wild-type SIV.sub.MAC251 Vpx was replaced in the transfection by a mutant (Q76A) that is incapable of binding DCAF1 (FIG. 17H and FIGS. 21D and 21E). These results demonstrate that FAM208A associates with Vpx and that the interaction results in proteasome-mediated degradation of FAM208A.

[0133] The experiments described above examined the effect of Vpx or Vpr on HIV-1 proviruses in which the reporter gene was transcribed by a heterologous promoter, either human EF1, HSV TK, or the SFFV LTR (FIGS. 16A to 16E and 17A to 17H and FIGS. 20A to 20F). To determine if Vpx is capable of activating a reporter gene driven by the HIV-1 LTR, the TNF-responsive, J-Lat A1 clonal cell line was used. In this experimental model of provirus latency, the HIV-1 LTR drives expression of a bicistronic mRNA encoding tat and gfp (FIG. 18A). Transduction with a lentivector expressing SIV.sub.mac251 Vpx, or knockdown of FAM208A, caused comparable increase in the percent GFP J-Lat A1 cells, whether the cells were stimulated with TNF or not (FIGS. 18B and 18C). Transduction of the J-Lat A1 cell line with lentivectors expressing vpx encoded by SIV.sub.RCM02CM8081 or SIV.sub.MND25440, as well as with vpr encoded by SIV.sub.MND1GB1 or SIV.sub.AGMTAN1, caused similar increase in expression of the LTR-driven reporter gene (FIG. 22A).

[0134] J-Lat A1 was selected to have a silent HIV-1 LTR-driven provirus with the ability to reactivate in response to TNF.sup.31. The unique provirus within a clone such as J-Lat A1 may be sensitive to position-dependent silencing effects and therefore may not accurately reflect the sensitivity of a population of HIV-1 proviruses to transcriptional activation by Vpx or to silencing by FAM208A. To address the effect of Vpx and FAM208A on a population of proviruses with diverse integration sites, Jurkat T cells were transduced with an HIV-1 LTR driven reporter vector (LTR-gfp) that retains complete LTRs, tat, and rev, but has a frameshift mutation in env, an ngfr reporter gene in place of nef, and gfp in place of gag, pol, vif, and vpr (FIG. 18D). Four weeks after transduction with LTR-GFP, the presence of latent proviruses within the pool of Jurkat cells was confirmed by reactivation with either TNF or TCR-stimulation (FIG. 22B). The Jurkat LTR-gfp cells were then transduced with vectors expressing SIV.sub.MAC251 Vpx or shRNA targeting FAM208A, and selected with puromycin. Compared with control cells, vpx or FAM208A knockdown increased the percentage of GFP cells, whether cells were treated with TNF or not (FIGS. 18E and 18F). Similar results were obtained in three independently generated biological replicate experiments, in which vpx was delivered or FAM208A was knocked down, from four to eight weeks after the first LTR-GFP transduction (FIG. 18F). Additionally, expression vectors for SIV.sub.MND25440 Vpx, SIV.sub.RCM02CM8081 Vpx, SIV.sub.MND1GB1 Vpr, or SIV.sub.AGMTAN1 Vpr all increased GFP expression in Jurkat LTR-gfp cells (FIG. 22C). Together, these experiments demonstrate that FAM208A contributes to the transcriptional repression of clonal or polyclonal LTR reporter lines, and that primate immunodeficiency viruses counteract this activity via their Vpx and Vpr proteins.

[0135] The effect of Vpx or FAM208A knockdown on spreading infection with replication-competent primate immunodeficiency viruses was tested next. Jurkat T cells transduced to express SIV.sub.MAC251 vpx, or cells transduced with control vector, were infected with HIV-1-ZsGreen, a replication-competent HIV-1.sub.NL4-3 clone, that encodes ZsGreen in place of nef (Table 1). Infection was monitored by determining the percent ZsGreen.sup.+ cells with flow cytometry, every two days for ten days. Compared with the control, HIV-1 replication kinetics was accelerated by vpx (FIG. 19A). In similar fashion, HIV-1 infection of Jurkat cells transduced with the FAM208A knockdown vector resulted in faster replication kinetics (FIG. 19B).

[0136] HIV-1 vpr has no detectable effect on HIV-1 replication in tissue culture spreading infections with dividing target cells. This is presumably related to the cell cycle arrest toxicity, and selection against vpr in tissue culture, since the effects of vpr on HIV-1 are evident when proviral expression is restricted to single cycle infection or cells are arrested with aphidicolin. Nonetheless, vpr offers a selective advantage in vivo since cloned vpr mutant virus was repaired when virus was injected into replication permissive chimps, or in an infected person.

[0137] SIV.sub.MAC239 does not replicate in Jurkat cells so CEMx174 cells were used to test the effect of FAM208A and vpx on replication of this virus. As in Jurkat cells, FAM208A knockdown increased HIV-1 replication kinetics in CEMx174 cells (FIG. 19C). Then, CEMx174 cells transduced with FAM208A or control knockdown vectors were challenged with SIV.sub.MAC239 or SIV.sub.MAC239-vpx and replication was assessed by measuring reverse transcriptase activity in the supernatant. In the absence of vpx, SIV.sub.MAC239 replicated slower than the wild-type virus in control knockdown CEMx174 cells (FIG. 19D). This delay in SIV.sub.MAC239-vpx replication kinetics was not observed when FAM208A was knocked down (FIG. 19D). Replication of HIV-2.sub.GHvpx was undetectable in control knockdown CEMx174 cells (FIG. 19E). However, FAM208A knockdown rescued the replication of HIV-2.sub.GHvpx to the level of wild-type HIV-2.sub.GH in control cells (FIG. 19E). These experiments indicate that FAM208A inhibits primate immunodeficiency virus replication and that Vpx antagonizes this restriction, resulting in expressionor increased expressionfrom integrated proviruses, permitting virus spread.

[0138] The experiments reported here demonstrated that vpx and vpr activate transcription from silenced proviruses and that this activity was mimicked by knockdown of each of the HUSH complex components. These two observations were then shown to be linked by the finding that Vpx associated with, and promoted degradation of HUSH complex protein FAM208A, in a DCAF1- and proteasome-dependent manner. Latent provirus activation and human FAM208A degradation were exhibited by a broader range of primate immunodeficiency vpx and vpr orthologues than are capable of degrading human SAMHD1, perhaps due to the greater conservation and essential nature of FAM208A. Vpx and FAM208A disruption were important for transcriptional activation of latent HIV-1 provirus pools and for the ability of HIV-1, HIV-2, and SIV.sub.MAC to effectively spread through cultured CD4.sup.+ T cells. Further understanding of the contributions of Vpx and Vpr and of the HUSH complex proteins, in concert with other transcriptional silencing mechanisms targeting HIV-1, is hoped to inform ongoing efforts to control or eliminate proviruses in HIV-1 infected patients.

Methods

Data Reporting

[0139] No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.

Plasmids

[0140] Sequences encoding 3FLAG N-terminal-tagged Vpx and Vpr proteins were ordered as codon-optimized, gBlocks Gene Fragments (Integrated DNA Technologies; <www.idtdna.com/>) and cloned into either the pscALPS vector for transduction, or into pcDNA3.1 for transfection. pAPM-D4 is a truncated derivative of the pAPM lentivector that expresses the puromycin acetyltransferase and miR30-based shRNA from the SFFV promoter. Table 1 lists all plasmids used here, with corresponding addgene accession numbers, target sites used in particular knockdown vectors, and accession numbers for all the Vpx and Vpr orthologues tested here.

Cell Culture

[0141] Cells were cultured at 37 C. in 5% CO.sub.2 humidified incubators and monitored for mycoplasma contamination using the Mycoplasma Detection kit (Lonza LT07-318). HEK293 cells (ATCC) were used for viral production and were maintained in DMEM supplemented with 10% FBS, 20 mM L-glutamine (ThermoFisher), 25 mM HEPES pH 7.2 (SigmaAldrich), 1 mM sodium pyruvate (ThermoFisher), and 1MEM non-essential amino acids (ThermoFisher). Jurkat and CEMx174 cells (ATCC) were cultured in RPMI-1640 supplemented with 10% heat inactivated FBS, 20 mM L-glutamine, 25 mM HEPES pH 7.2, 1 mM sodium pyruvate, 1MEM non-essential amino acids and Pen/Strep (ThermoFischer) (RPMI-FBS complete). J-Lat A1 cells.sup. (NIH AIDS Reagent Program, catalogue #9852, donated by Eric Verdin) were cultured in RPMI-FBS complete media.

[0142] Leukopaks were obtained from anonymous, healthy, blood bank donors (New York Biologics, Southhampton, N.Y.). As per NIH guidelines (<grants.nih.gov/grants/policy/hs/faqs_aps_definitions.htm>), experiments with these cells were declared non-human subjects research by the University of Massachusetts Medical School Institutional Review Board. PBMCs were isolated from leukopaks by gradient centrifugation on Histopaque-1077 (Sigma-Aldrich). CD4.sup.+ T cells were enriched from PBMCs using anti-CD4 microbeads (Miltenyi) and were >95% CD4.sup.+. CD4.sup.+ T cells were cultured in RPMI-FBS complete media in the presence of 50 U/mL hIL-2 (NIH AIDS Reagent Program, catalogue #136).

Vector Production

[0143] HEK293 cells were seeded at 75% confluency in 6-well plates and transfected with 6.25 L Transit LT1 lipid reagent (Mirus) in 250 L Opti-MEM (Gibco) with 2.25 g total plasmid DNA. Full replicating virus was produced by transfection of 2.25m of the indicated plasmid. Lenti-GFP reporters, LTR-GFP reporter, and shRNA lentivectors were produced by transfection of the lentivector, psPAX2 gagpol expression plasmid, and the pMD2.G VSV G expression plasmid, at a DNA ratio of 4:3:1. Vpx containing SIV-VLPs were produced by transfection at a 7:1 plasmid ratio of SIV3+ to pMD2.G, and Vpx SIV VLPs were produced the same way using SIV3+ Vpx plasmid. 12 hrs after transfection, media was changed to the specific media for the cells that were to be transduced. Viral supernatant was harvested 2 days later, filtered through a 0.45 m filter, and stored at 4 C.

Reverse Transcriptase Assay

[0144] Virions in the transfection supernatant were quantified by a PCR-based assay for reverse transcriptase activity.sup.30. 5 l transfection supernatant were lysed in 5 L 0.25% Triton X-100, 50 mM KCl, 100 mM Tris-HCl pH 7.4, and 0.4 U/l RNase inhibitor (RiboLock, ThermoFisher). Viral lysate was then diluted 1:100 in a buffer of 5 mM (NH.sub.4).sub.2SO.sub.4, 20 mM KCl, and 20 mM Tris-HCl pH 8.3. 10 L was then added to a single-step, RT PCR assay with 35 nM MS2 RNA (IDT) as template, 500 nM of each primer (5-TCCTGCTCAACTTCCTGTCGAG-3 (SEQ ID NO: 12) and 5-CACAGGTCAAACCTCCTAGGAATG-3 (SEQ ID NO: 13)), and hot-start Taq (Promega) in a buffer of 20 mM Tris-Cl pH 8.3, 5 mM (NH.sub.4).sub.2SO.sub.4, 20 mM KCl, 5 mM MgCl.sub.2, 0.1 mg/ml BSA, 1/20,000 SYBR Green I (Invitrogen), and 200 M dNTPs. The RT-PCR reaction was carried out in a Biorad CFX96 cycler with the following parameters: 42 C. 20 min, 95 C. 2 min, and 40 cycles [95 C. for 5 s, 60 C. 5 s, 72 C. for 15 s and acquisition at 80 C. for 5 s]. 3 part vector transfections typically yielded 10.sup.6 RT units/L.

Transductions

[0145] For generating pools of shRNA knockdown Jurkat and CEMx174 lines, cells were plated at 10.sup.6 cells/mL in RPMI-FBS complete and transduced with 10.sup.7 RT units of viral vector per 10.sup.6 cells, followed by selection with 1 g/ml puromycin (InvivoGen, cat #ant-pr-1). To generate stable gag-gfp expressing Jurkat cells, cells were transduced as for shRNA KD above, followed by selection with 5 g/mL blasticidin (InvivoGen, cat #ant-bl-1) at day 3 after transduction.

[0146] CD4.sup.+ T cells were stimulated in RPMI-FBS complete, with 50 U/ml IL-2 and 5 g/mL PHA-P (Sigma, cat #L-1668). After 3 days, T cells were washed and replated at 310.sup.6 cells/mL in RPMI-FBS complete, with 50 U/ml IL-2. Cells were transduced with 10.sup.8 RT units of viral vector per 10.sup.6 cells followed by selection in 2 g/mL puromycin. After selection, cells were re-plated in RPMI-FBS complete with 50 U/ml IL-2 at 310.sup.6 cells/mL in RPMI-FBS complete and transduced again with the indicated GFP vectors, 10.sup.8 RT units of viral vector per 10.sup.6 cells. Transduced T cells were analyzed 4-5 days after the 2nd transduction.

Lentiviral Infections

[0147] 510.sup.5 Jurkat or CEMx174 cells were incubated with 5107 RT units of HIV-1NL4.3, HIV-2GH, HIV-2GHvpx, SIVMAC239, or SIVMAC239vpx virus stocks produced in HEK-293 cells for 12 hrs in RPMI-FBS complete media, followed by a wash in media and replated in 1 mL of media. Cells were split every 2-3 days and analyzed. For monitoring of HIV-1 ZsGreen infection, when cells were split, aliquots were fixed in BD Cytofix followed by analysis of GFP+ cells by flow cytometry to determine infection levels. For monitoring of SIV and HIV-2 infections, 50 L aliquots of supernatant were analyzed for RT activity using the above described RT assay.

Re-Activation Assays

[0148] LTR-driven GFP re-activation assays were performed with 10 ng/ml hTNF (Invivogen, cat #rcyc-htnf), or with 1m/m1 soluble -CD3 and -CD28 antibody. -CD3 antibody (clone OKT3) and -CD28 antibody (clone CD28.2) were provided by Lisa Cavacini (MassBiologics, Mattapan, Mass.).

qRT-PCR

[0149] Total RNA was isolated from Jurkat cells using Trizol reagent followed by purification of RNA with RNeasy Plus Mini (Qiagen) with Turbo DNase (ThermoFisher) in order to limit DNA contamination. First-strand synthesis used Superscript III Vilo Master mix (Invitrogen) with random hexamers. qPCR was performed in 20 L using SYBR green reagent (Applied Biosystems) with primers designed against gag, gfp, and gapdh for normalization. Amplification was on a CFX96 Real Time Thermal Cycler (Bio-Rad) using the following program: 95 C. for 10 min, then 45 cycles of 95 C. for 15 s and 60 C. for 60 s. Cells not transduced with Lenti-GFP vector were used as negative control and the housekeeping gene GAPDH was used to normalize expression levels. The primer sequences used were:

TABLE-US-00002 gagprimers (Forward:5-GCTGGAAATGTGGAAAGGAA-3,SEQIDNO:4; Reverse:5-AGTCTCTTCGCCAAACCTGA-3,SEQIDNO:5), gfpprimers (Forward:5-GCAGAGGTGAAGTTCGAAGG-3,SEQIDNO:6; Reverse:5-CCAATTGGTGTGTTCTGCTG-3,SEQIDNO:7), gapdhprimers (Forward:5-AGGGCTGCTTTTAACTCTGGT-3, SEQIDNO:8; Reverse:5-CCCCACTTGATTTTGGAGGGA-3, SEQIDNO:9).

Flow Cytometry

[0150] Cells were fixed in BD Cytofix Buffer prior to data acquisition on a BD C6 Accuri. Data was analyzed in FlowJo.

Western Blot

[0151] Cells were washed in PBS, counted, normalized for cell number, and lysed directly in 1SDS-PAGE sample buffer. Samples were run on NuPage 4-12% Bis-Tris gels followed by blotting onto nitrocellulose membranes. Primary antibodies used: FAM208A (Atlas, HPA00875), MPHOSPH8 (Proteintech, 16796-1-AP), PPHLN1 (Sigma, HPA038902), SETDB1 (Proteintech 11231-1-AP), DCAF1 (Proteintech, 11612-1-AP), FLAG (Novus, NB600-345), FLAG (Sigma, F1804, used for IP), and HA (Biolegend, 901501).

Vpr and Vpx Phylogeny

[0152] The following Vpr and Vpx amino acid sequence alignments were obtained from the Los Alamos National Laboratories (LANL) HIV sequence database: 2016 HIV-1/SIV.sub.CPZ Vpr, 2016 HIV-2/SIVsmm Vpr, 2016 HIV-2/SIVsmm Vpx, 2016 other SIV Vpr, and 2016 other Vpx. Consensus sequences were generated for HIV-1 group M subtypes A, B, C, D, F, G, H, I, J, and those designated U in the LANL database, as well as group N. A master alignment was scaffolded from the above alignments and re-aligned by hand. Redundant SIV and HIV-2 Vpr and Vpx sequences were removed, and the sequences of individual HIV-1 isolates were replaced with the consensus sequences. This was used to generate a master phylogeny using RAxML 8.2.11, as implemented in Geneious with gamma LG substitution model and Rapid Bootstrapping with search for best scoring tree algorithm. This master tree was utilized to identify major relationships and identify a reduced number of sequences to retain while maintaining the overall phylogenic structure. Vpx and Vpr sequences from the following viral isolates were retained: HQ179987, L20571, M15390, AF208027, AB731738, KP890355, M15390, AF208027, AB731738, KP890355, U58991, M30931, L40990, KJ461715, AF301156, U42720, AY169968, DQ373065, DQ373064, DQ374658, FJ919724, AJ580407, KM378563, KM378563, FJ424871, M66437, AF468659, AF468658, AF188116, M76764, LC114462, M27470, AY159322, AY159322, U79412, U79412, AY340701, AY340700, EF070329, KF304707, FM165200, HM803690, HM803689, AF382829, AF349680, HM803690, HM803689, AF349680, U04005, JX860432, JX860430, JX860426, JX860432, M83293, M83293, AF131870, AY523867, AM182197, AM713177, U26942, and the HIV-1 group M Glade B consensus. These sequences were used to generate a phylogeny using the same method as above. Superfluous taxa were pruned from this phylogeny using Mesquite 3.4 and the resulting tree was visualized in FigTree v1.4.3.

Sampling

[0153] At least three biological replicates were performed for all experiments. The screen for factors mediating silencing of the Lenti-GFP vector utilized 3 target sequences for each candidate gene. Flow cytometry plots in the figures show representative data taken from experiments performed at the same time. HIV-1, HIV-2, and SIV spreading experiments were repeated 3 times each and representative data of one such experiment is shown.

Statistics

[0154] Information regarding the statistical tests utilized, and the n values, are found in the figure legends. Statistical analysis of the knockdown screen of factors involved in silencing of Lenti-GFP was analyzed by one-way ANOVA with Dunnett post test comparing 3 shRNA target sites to control knockdown conditions. All statistics presented were performed using PRISM 5.0 (GraphPAD Software, La Jolla, Calif.).

TABLE-US-00003 TABLE 1 Plasmids used. Plasmid Name Purpose Notes HIV1- Replication HIV-1 NL4-3 in pBluescript with flanking host sequences ZsGreen competent HIV-1 deleted. ZsGreen in place of nef SIV.sub.mac239 Replication Molecular clone of SIV.sub.MAC239 proviral DNA SpX competent SIV SIV.sub.mac239 SIV vpx Molecular clone of SIV.sub.MAC239vpx proviral DNA SpX Vpx pGL-AN Replication Molecular clone of HIV-2 competent HIV-2 pGL-St HIV-2 Vpx full Molecular clone of HIV-2 with disruption of vpx ORF length wt pMD2.G VSV G Pseudotype HIV-1 vectors with VSV Glycoprotein psPAX2 HIV-1 gag-pol Encodes gag structural proteins and pol enzymes to generate virion particles SIV3+ SIV.sub.MAC251 gag- Production of SIV VLPs containing Vpx protein pol/vpx SIV3+ vpx SIV.sub.MAC251 gag- Production of SIV VLPs without Vpx protein. pol/vpx pscALPS Lenti-gfp-blasti SFFV promoter expresses gag-gfp fusion with CypA gag-gfp/blasti promoter driving blasticidin resistance gene pscALPS Lenti-gfp-vpx SFFV promoter expresses gag-gfp fusion with CypA gag-gfp/vpx promoter driving expression of SIV.sub.MAC251 vpx pscALPS Lenti-gfp-vpx SFFV promoter expresses gag-gfp fusion with no ORF after gag-gfp/vpx CypA promoter pecALPS Lenti-gfp-blasti EIF1a promoter expresses gag-gfp fusion and CypA gag-gfp/blasti promoter expresses blasticidin resistance gene pkcALPS- Lenti-gfp-blasti TK promoter expresses gag-gfp fusion and CypA promoter gag-gfp/blasti expresses blasticidin resistance gene HIV-1 LTR- HIV-1 LTR-gfp HIV-1 LTR driven reporter vector that retains complete gfp LTRs, tat, and rev, but has a frameshift mutation in env, an ngfr reporter gene in place of nef, and gfp in place of gag, pol, vif, and vpr pscALPS- Lentivector Encodes codon optimized 3xFLAG-Vpx.sub.MAC251 and SIV.sub.MAC251 vpx expressing vpx puromycin resistance protein pscALPS Lentivector Encodes codon optimized 3xFLAG-SIV.sub.MND2 Vpx SIV.sub.MND2 vpx expressing vpx (AY159322) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.RCM Vpx SIV.sub.RCM vpx expressing vpx (AF349680) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.MNE Vpx (U79412) SIV.sub.MNE vpx expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.DRL Vpx SIV.sub.DRL vpx expressing vpx (KM378563) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.AGI Vpx SIV.sub.AGI vpx expressing vpx (HM803690) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-HIV2.sub.ROD Vpx HIV2.sub.ROD vpx expressing vpx (M15390) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.MND1 Vpr (M27470) SIV.sub.MND1 vpr expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.LST Vpr SIV.sub.LST vpr expressing vpx (AF188116) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.AGM Vpr (TAN1) SIV.sub.AGMTAN1 vpr expressing vpx (U58991) with repaired premature stop codon and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.TAL Vpr SIV.sub.TAL vpx expressing vpx (AM182197) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.SYK Vpr (L06042) SIV.sub.SYK vpx expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.SAB Vpr (U04005) SIV.sub.SAB vpx expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.DEB Vpr (FJ919724) SIV.sub.DEB vpx expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.ASC Vpr SIV.sub.ASC vpx expressing vpx (KJ461715) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.AGM Vpr (Ver SIV.sub.AGMVER9063 vpr expressing vpx 9063) (L40990) and Puro resistance marker pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.AGM Vpr (Ver SIV.sub.AGMVER expressing vpx AGM3) (M30931) and puromycin resistance protein AGM3 vpr pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.GRV Vpr (M66437) SIV.sub.GRV vpr expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.AGM Vpr SIV.sub.AGMMAL vpr expressing vpx (MAL_ZMB) (LC114462) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG SIV.sub.DEN Vpr SIV.sub.DEN vpr expressing vpx (AJ580407) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG SIV.sub.gsn-cn71 Vpr SIV.sub.GSNCN71 vpr expressing vpx (AF468658) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG SIV.sub.GSN-CN166 Vpr SIV.sub.GSNCN166 vpr expressing vpx (AF468659) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.SUN Vpr SIV.sub.SUN vpr expressing vpx (AF131870) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.CPZ-TAN3 Vpr SIV.sub.CPZTAN3 vpr expressing vpx (DQ374658) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.CPZ-LB7 Vpr SIV.sub.CPZLB7 vpr expressing vpx (DQ373064) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.GOR Vpr (FJ424871) SIV.sub.GOR -vpr expressing vpx and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-HIV1 Group O Vpr HIV-1 Group expressing vpx (L20571) and puromycin resistance protein O-vpr pscALPS- Lentivector Encodes codon optimized 3xFLAG-HIV1 Group P Vpr HIV-1 Group expressing vpx (HQ179987) and puromycin resistance protein P-vpr pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.RCM Vpr SIV.sub.RCM-vpr expressing vpx (HM803689) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.WRC Vpr SIV.sub.WRC-vpr expressing vpx (AM713177) and puromycin resistance protein pscALPS- Lentivector Encodes codon optimized 3xFLAG-SIV.sub.MUS21246 Vpr SIV.sub.MUS21246-vpr expressing vpx (EF070329) and puromycin resistance protein pcDNA3.1 Expression Encodes codon optimized FLAG tagged SIV.sub.MAC251-Vpx FLAG- plasmid SIV.sub.MAC251- Vpx pcDNA3.1 Expression Encodes codon optimized FLAG tagged SIV.sub.MAC251-Vpx- FLAG- plasmid Q76A mutant SIV.sub.MAC251- Vpx-Q76A pcDNA3.1 Expression Encodes codon optimized FLAG tagged SIV.sub.RCM-Vpx FLAG- plasmid SIV.sub.RCM-Vpx pcDNA3.1 Expression Encodes codon optimized HA tagged FAM208A HA- plasmid FAM208A

TABLE-US-00004 TABLE2 pAPM-D4Plasmidsused. Plasmid Name Purpose Notes pAPM-D4- Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-L1221 luciferase andmiR30-shRNAtargetsite:5- knockdown CTTGTCGATGAGAGCGTTTGT-3(SEQIDNO:14); negativecontrolforotherknockdowns pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- HDAC1 andmiR30-shRNAtargetsite:5- HDAC1ts1 knockdown TATGAGTCATGCGGATTCG-3(SEQIDNO:15) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- HDAC1 andmiR30-shRNAtargetsite:5- HDAC1ts2 knockdown TAAGAACGGGAAGAATGGG-3(SEQIDNO:16) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- HDAC1 andmiR30-shRNAtargetsite:5- HDAC1ts3 knockdown TTAATGTAGTCATCGCTGT-3(SEQIDNO:17) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO1 AGO1 andmiR30-shRNAtargetsite:5- ts1 knockdown TTCTGCTTGAAATACTGTG-3(SEQIDNO:18) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO1 AGO1 andmiR30-shRNAtargetsite:5- ts2 knockdown TGATATCAGAGATTTCTGG-3(SEQIDNO:19) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO1 AGO1 andmiR30-shRNAtargetsite:5- ts3 knockdown TTGACATTGATCTTGAGGC-3(SEQIDNO:20) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO2 AGO2 andmiR30-shRNAtargetsite:5- ts1 knockdown TAATACATCTTTGTCCTGC-3(SEQIDNO:21) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO2 AGO2 andmiR30-shRNAtargetsite:5- ts2 knockdown TCATCTGCACGCACTGCGT-3(SEQIDNO:22) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO2 AGO2 andmiR30-shRNAtargetsite:5- ts3 knockdown TTGCTAATCTCTTCTTGCC-3(SEQIDNO:23) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO3 AGO3 andmiR30-shRNAtargetsite:5- ts1 knockdown TGACTTGAACACATTGTGT-3(SEQIDNO:24) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO3 AGO3 andmiR30-shRNAtargetsite:5- ts2 knockdown TCTGAACTACAATGTAGGT-3(SEQIDNO:25) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30-AGO3 AGO3 andmiR30-shRNAtargetsite:5- ts3 knockdown TAGCTTCTTGATACATCGT-3(SEQIDNO:26) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SETDB1 andmiR30-shRNAtargetsite:5- SETDB1ts1 knockdown TTCGCATGCTGACTATCAG-3(SEQIDNO:27) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SETDB1 andmiR30-shRNAtargetsite:5- SETDB1ts2 knockdown ACACAATCCATCTTCTCCA-3(SEQIDNO:28) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SETDB1 andmiR30-shRNAtargetsite:5- SETDB1ts3 knockdown TTGTTGTCAAATTTCACCT-3(SEQIDNO:29) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- TRIM28 andmiR30-shRNAtargetsite:5- TRIM28ts1 knockdown AAGGTTGTAGTCCTCAGTG-3(SEQIDNO:30) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- TRIM28 andmiR30-shRNAtargetsite:5- TRIM28ts2 knockdown TCAATAACAATAAGGTTGT-3(SEQIDNO:31) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- TRIM28 andmiR30-shRNAtargetsite:5- TRIM28ts3 knockdown TGAGTAGGGATCATCTCCT-3(SEQIDNO:32) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- DNMT3a andmiR30-shRNAtargetsite:5- DNMT3ats1 knockdown TAATCTCCTTGACCTTGGG-3(SEQIDNO:33) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- DNMT3a andmiR30-shRNAtargetsite:5- DNMT3ats2 knockdown TATCATTCACAGTGGATGC-3(SEQIDNO:34) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- DNMT3a andmiR30-shRNAtargetsite:5- DNMT3ats3 knockdown AGAACTCAAAGAAGAGCCG-3(SEQIDNO:35) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- PIWIL2 andmiR30-shRNAtargetsite:5- PIWIL2ts1 knockdown CGAACATTGACAACCTGGG-3(SEQIDNO:36) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- PIWIL2 andmiR30-shRNAtargetsite:5- PIWIL2ts2 knockdown AGCAGACAAGCCTCGACCT-3(SEQIDNO:37) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- PIWIL2 andmiR30-shRNAtargetsite:5- PIWIL2ts3 knockdown AGATTAGTACTGATTTTCT-3(SEQIDNO:38) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- FAM208A andmiR30-shRNAtargetsite:5- FAM208A knockdown TTCTTCTACTGGTTCCCGG-3(SEQIDNO:39) ts1 pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- FAM208A andmiR30-shRNAtargetsite:5- FAM208A knockdown TGAATTGCTGTTCTCTCCT-3(SEQIDNO:40) ts2 pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- FAM208A andmiR30-shRNAtargetsite:5- FAM208A knockdown ATCTTAGCACCAGAATCGT-3(SEQIDNO:41) ts3 pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- MPHOSPH8 andmiR30-shRNAtargetsite:5- MPHOSPH8 knockdown AAATCTCTTATTTCACCCT-3(SEQIDNO:42) ts1 pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- MPHOSPH8 andmiR30-shRNAtargetsite:5- MPHOSPH8 knockdown TTGCTTCTGTCTTGATTCC-3(SEQIDNO:43) ts2 pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- MPHOSPH8 andmiR30-shRNAtargetsite:5- MPHOSPH8 knockdown TTCTCTTCTCTGCTGTCGG-3(SEQIDNO:44) ts3 pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- PPHLN1 andmiR30-shRNAtargetsite:5- PPHLN1ts1 knockdown TCATCTGATTTCTCTAGCT-3(SEQIDNO:45) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- PPHLN1 andmiR30-shRNAtargetsite:5- PPHLN1ts2 knockdown TTCATATTCATATCGTCCC-3(SEQIDNO:46) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- PPHLN1 andmiR30-shRNAtargetsite:5- PPHLN1ts3 knockdown TGAGTTCTTCAACACACCG-3(SEQIDNO:47) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h1 andmiR30-shRNAtargetsite:5- SUV39h1ts1 knockdown TGAGGATACGCACACACTT-3(SEQIDNO:48) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h1 andmiR30-shRNAtargetsite:5- SUV39h1ts2 knockdown AGAGCAGGTAGGAGCAGGT-3(SEQIDNO:49) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h1 andmiR30-shRNAtargetsite:5- SUV39h1ts3 knockdown CATTCTCTACAGTGATGCG-3(SEQIDNO:50) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h2 andmiR30-shRNAtargetsite:5- SUV39h2ts1 knockdown TCATCAGACTCATAGTCCA-3(SEQIDNO:51) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h2 andmiR30-shRNAtargetsite:5- SUV39h2ts2 knockdown TAAATTTCTTTATCATTGA-3(SEQIDNO:52) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h2 andmiR30-shRNAtargetsite:5- SUV39h2ts3 knockdown ACATTATCAGCTTAACGCT-3(SEQIDNO:53) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- SUV39h2 andmiR30-shRNAtargetsite:5- MORC2ts1 knockdown TGAGATTGAAGATGATCAC-3(SEQIDNO:54) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- MORC2 andmiR30-shRNAtargetsite:5- MORC2ts2 knockdown TTTTCCACAGAACTCAGCT-3(SEQIDNO:55) pAPM-D4 Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- MORC2 andmiR30-shRNAtargetsite:5- MORC2ts3 knockdown TGTCTGTGACAGGTTCCCG-3(SEQIDNO:56) pAPM- Lentivector SFFVpromoterexpressingpuromycinresistanceprotein miR30- DCAF1 andmiR30-shRNAtargetsite:5- DCAF1 knockdown AGCACTTCAGATTATCATCAAT-3(SEQIDNO:57)

TABLE-US-00005 pAPM-D4sequence(SEQIDNO:10),whereintheposition ofinserttargetsequencesisshownwith[N..N] GTCGACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCT CTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTG AGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGC ATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGA TATACGCGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCA GCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAA GTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAG CAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCG CCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCG CCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCT TTTGCAAAAAGCTTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGG GGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATG GCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTA CGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCT ATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTG ATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTT CCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCG TGTACGGTGGGAGGTCTATATAAGCAGCGCGTTTTGCCTGTACTGGGTCTCTCTGGT TAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAG CCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGAC TCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT GGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACG CAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTG AGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGA GCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGG CCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGC TAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAA ATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATT ATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACA CCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGC ACAGCAAGCGGCCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTA GCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGA ATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGC GTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGC AGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTC TGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGA TCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGT GCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGA CCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTA ATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAG ATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATA AAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTA CTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCAC CTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAG AGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCGGCACTGCGTGCGCCA ATTCTGCAGACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTG GGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAAC TAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGG ACAGCAGAGATCCAGTTTGGTTAATTAACTGCAGCCCCGATAAAATAAAAGATTTT ATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGC TAGCTGCAGTAACGCCATTTTGCAAGGCATGGAAAAATACCAAACCAAGAATAGAG AAGTTCAGATCAAGGGCGGGTACATGAAAATAGCTAACGTTGGGCCAAACAGGAT ATCTGCGGTGAGCAGTTTCGGCCCCGGCCCGGGGCCAAGAACAGATGGTCACCGCA GTTTCGGCCCCGGCCCGAGGCCAAGAACAGATGGTCCCCAGATATGGCCCAACCCT CAGCAGTTTCTTAAGACCCATCAGATGTTTCCAGGCTCCCCCAAGGACCTGAAATGA CCCTGCGCCTTATTTGAATTAACCAATCAGCCTGCTTCTCGCTTCTGTTCGCGCGCTT CTGCTTCCCGAGCTCTATAAAAGAGCTCACAACCCCTCACTCGGCGCGCCAGTCCTC CGACAGACTGAGTCGCCCGGGGGTCTAGAACGCGTGCCGCCATGACCGAATACAAA CCTACCGTGAGGCTGGCTACAAGAGATGATGTCCCAAGGGCTGTGAGAACACTGGC CGCCGCTTTTGCCGATTACCCTGCCACACGCCACACTGTGGACCCAGATCGGCATAT CGAGAGAGTGACTGAGCTGCAGGAACTGTTCCTGACCCGAGTGGGCCTGGACATTG GGAAGGTCTGGGTCGCAGACGATGGAGCAGCTGTGGCTGTCTGGACCACACCAGAG AGCGTGGAAGCCGGAGCTGTCTTTGCAGAGATCGGCCCTAGAATGGCAGAACTGAG CGGCTCCAGGCTGGCAGCACAGCAGCAGATGGAGGGACTGCTGGCCCCACACAGG CCTAAGGAACCAGCATGGTTCCTGGCTACCGTGGGGGTCTCTCCTGACCATCAGGG CAAAGGACTGGGAAGTGCTGTGGTCCTGCCAGGAGTGGAGGCTGCAGAACGAGCT GGAGTCCCTGCATTTCTGGAGACCTCTGCTCCACGAAACCTGCCCTTCTATGAACGG CTGGGCTTTACTGTGACCGCAGATGTGGAGGTCCCCGAAGGACCTAGGACCTGGTG CATGACACGCAAACCCGGCGCCTGAGCGATCGCCGCGGCCGCCTTCTTAACCCAAC AGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG[N..N]TAGTGAAGCCACA GATGTA[N..N]TGCCTACTGCCTCGGACTTCAAGGGGCTAGAATTCGGCAGCTGTAGA TCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAACTGCATCCGGAC TGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTA GGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGT GCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTG TGGAAAATCTCTAGCAGGGCCCGTTTCATGTGAGCAAAAGGCCAGCAAAAGGCCAG GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGA GCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAA AGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTG CCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAT AGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGT GTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTT GAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAG GATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA ACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTA CCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGC GGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGA AGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTA AGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTA CCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCAT AGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGG CCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAG CAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCC GCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTT AATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCG TTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCC CCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGT AAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACT GTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTC TGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAA TACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGG GGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTC GTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAA AAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTC ATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG CACATTTCCCCGAAAAGTGCCACCTGAC >pAPM-D4_(SEQIDNO:11)(+shRNA_targeting_Luciferase_gene) (targetingsequencesinbrackets) GTCGACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCT CTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTG AGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGC ATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGA TATACGCGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCA GCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAA GTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAG CAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCG CCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCG CCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCT TTTGCAAAAAGCTTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGG GGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATG GCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTA CGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCT ATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTG ATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTT CCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCG TGTACGGTGGGAGGTCTATATAAGCAGCGCGTTTTGCCTGTACTGGGTCTCTCTGGT TAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAG CCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGAC TCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT GGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACG CAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTG AGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGA GCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGG CCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGC TAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAA ATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATT ATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACA CCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGC ACAGCAAGCGGCCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTA GCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGA ATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGC GTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGC AGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTC TGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGA TCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGT GCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGA CCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTA ATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAG ATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATA AAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTA CTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCAC CTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAG AGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCGGCACTGCGTGCGCCA ATTCTGCAGACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTG GGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAAC TAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGG ACAGCAGAGATCCAGTTTGGTTAATTAACTGCAGCCCCGATAAAATAAAAGATTTT ATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGC TAGCTGCAGTAACGCCATTTTGCAAGGCATGGAAAAATACCAAACCAAGAATAGAG AAGTTCAGATCAAGGGCGGGTACATGAAAATAGCTAACGTTGGGCCAAACAGGAT ATCTGCGGTGAGCAGTTTCGGCCCCGGCCCGGGGCCAAGAACAGATGGTCACCGCA GTTTCGGCCCCGGCCCGAGGCCAAGAACAGATGGTCCCCAGATATGGCCCAACCCT CAGCAGTTTCTTAAGACCCATCAGATGTTTCCAGGCTCCCCCAAGGACCTGAAATGA CCCTGCGCCTTATTTGAATTAACCAATCAGCCTGCTTCTCGCTTCTGTTCGCGCGCTT CTGCTTCCCGAGCTCTATAAAAGAGCTCACAACCCCTCACTCGGCGCGCCAGTCCTC CGACAGACTGAGTCGCCCGGGGGTCTAGAACGCGTGCCGCCATGACCGAATACAAA CCTACCGTGAGGCTGGCTACAAGAGATGATGTCCCAAGGGCTGTGAGAACACTGGC CGCCGCTTTTGCCGATTACCCTGCCACACGCCACACTGTGGACCCAGATCGGCATAT CGAGAGAGTGACTGAGCTGCAGGAACTGTTCCTGACCCGAGTGGGCCTGGACATTG GGAAGGTCTGGGTCGCAGACGATGGAGCAGCTGTGGCTGTCTGGACCACACCAGAG AGCGTGGAAGCCGGAGCTGTCTTTGCAGAGATCGGCCCTAGAATGGCAGAACTGAG CGGCTCCAGGCTGGCAGCACAGCAGCAGATGGAGGGACTGCTGGCCCCACACAGG CCTAAGGAACCAGCATGGTTCCTGGCTACCGTGGGGGTCTCTCCTGACCATCAGGG CAAAGGACTGGGAAGTGCTGTGGTCCTGCCAGGAGTGGAGGCTGCAGAACGAGCT GGAGTCCCTGCATTTCTGGAGACCTCTGCTCCACGAAACCTGCCCTTCTATGAACGG CTGGGCTTTACTGTGACCGCAGATGTGGAGGTCCCCGAAGGACCTAGGACCTGGTG CATGACACGCAAACCCGGCGCCTGAGCGATCGCCGCGGCCGCCTTCTTAACCCAAC AGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG[CACAAACGCTCTCATCG ACAAG]TAGTGAAGCCACAGATGTA[CTTGTCGATGAGAGCGTTTGTA]TGCCTACTG CCTCGGACTTCAAGGGGCTAGAATTCGGCAGCTGTAGATCTTAGCCACTTTTTAAAA GAAAAGGGGGGACTGGAAGGGCTAACTGCATCCGGACTGTACTGGGTCTCTCTGGT TAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAG CCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGAC TCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGG GCCCGTTTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCG CGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGAC GCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCC CCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTG TCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTAT CTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGA CACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTA TGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAA GAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTG GTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCA AGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCT ACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAG ATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATC AATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGA GGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTC GTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCG GAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTA ATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTG TTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCA GCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAA GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTA TCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGA TGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGG CGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAG AACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGA TCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTT CAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAAT GCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCT TTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT GCCACCTGAC

EQUIVALENTS

[0155] While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and/or methods, if such features, systems, articles, materials, and/or methods are not mutually inconsistent, is included within the scope of the present invention.

[0156] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.

[0157] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0158] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0159] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0160] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

[0161] Use of ordinal terms such as first, second, third, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements.