STRUCTURE AND TEMPERATURE-DEPENDENT FLAP ENDONUCLEASE SUBSTRATES

Abstract

5′ hairpin oligonucleotide substrates for reversible repression, e.g., by temperature shift, of cleavage by flap endonucleases, and methods using 5′ hairpin oligonucleotides.

Claims

1.-58. (canceled)

59. A composition comprising a 5′ hairpin invasive cleavage structure having a target cleavage site, the 5′ hairpin cleavage structure comprising a 5′ flap, a downstream duplex stem, and an upstream duplex stem that define an invasive cleavage structure, wherein the 5′ flap comprises a hairpin-forming region, and wherein formation of a hairpin in the hairpin-forming region suppresses FEN-1 endonuclease cleavage of the 5′ hairpin invasive cleavage structure at the target cleavage site.

60. The composition of claim 59, wherein the 5′ hairpin invasive cleavage structure is cleavable at the target cleavage site by Afu FEN-1 in a buffer comprising Mg.sup.++ flap assay buffer when cleavage is not suppressed by formation of a hairpin in the hairpin-forming region of the 5′ flap.

61. (canceled)

62. The composition of claim 59, wherein the 5′ hairpin invasive cleavage structure is selected from: i) an invasive cleavage structure comprising an invasive oligonucleotide, a 5′ hairpin probe oligonucleotide and a target nucleic acid, wherein the annealing of the 5′ hairpin probe oligonucleotide to the target nucleic acid forms the downstream duplex stem and annealing of the invasive oligonucleotide to the target nucleic acid forms the upstream duplex stem; ii) a structure comprising a 5′ hairpin reporter and a nucleic acid molecule, the 5′ hairpin reporter comprising the 5′ flap comprising a 5′ hairpin-forming region, a downstream duplex stem, and a 3′ portion complementary to a 3′ terminal portion of the nucleic acid molecule, wherein annealing of the 3′ terminal portion of the nucleic acid molecule to the 3′ portion of the 5′ hairpin reporter forms the upstream duplex of the invasive cleavage structure; and iii) an oligonucleotide 5′ hairpin test substrate, the oligonucleotide comprising a 5′ flap comprising a 5′ hairpin-forming region, a downstream duplex stem, and an upstream duplex stem that define an invasive cleavage structure.

63. The composition of claim 62, wherein: (i) the 5′ hairpin invasive cleavage structure is a structure comprising a 5′ hairpin reporter and a nucleic acid molecule wherein the nucleic acid molecule comprises a 5′ hairpin-forming region; ii) the 5′ hairpin invasive cleavage structure comprises a 5′ hairpin reporter wherein the downstream duplex stem is a hairpin stem comprising a loop; or iii) the 5′ hairpin invasive cleavage structure is a oligonucleotide 5′ hairpin test substrate wherein at least one of the upstream duplex stem and the downstream duplex stem is a hairpin stem comprising a loop.

64. The composition of claim 59, wherein the 5′ hairpin invasive cleavage structure comprises a FRET labeling system.

65. The composition of claim 64, wherein a first member of the FRET labeling system is attached at a first position on the 5′ hairpin invasive cleavage structure and a second member of the FRET labeling system is attached at a second position on the 5′ hairpin invasive cleavage structure, wherein the target cleavage site is between the first position and the second position.

66. The composition of claim 59, wherein the 5′ hairpin-forming region of the 5′ hairpin invasive cleavage structure is in the form of a hairpin when the composition is at room temperature.

67-68. (canceled)

69. The composition of claim 59, further comprising a buffer solution comprising Mg.sup.++.

70. (canceled)

71. The composition of claim 59, further comprising a flap endonuclease.

72. The composition of claim 71, wherein the flap endonuclease comprises a FEN-1 endonuclease from an Archaeal organism.

73. (canceled)

74. The composition of claim 59, further comprising one or more components selected from: a DNA polymerase; deoxynucleoside triphosphates; a flap oligonucleotide; and primers.

75. (canceled)

76. A method, comprising: i) providing a 5′ hairpin invasive cleavage structure having a target cleavage site, the 5′ hairpin cleavage structure comprising a 5′ flap, a downstream duplex stem, and an upstream duplex stem that define an invasive cleavage structure, wherein the 5′ flap comprises a hairpin-forming region, and wherein formation of a hairpin in the hairpin-forming region suppresses FEN-1 endonuclease cleavage of the 5′ hairpin invasive cleavage structure at the target cleavage site; ii) exposing the 5′ hairpin invasive cleavage structure to a flap endonuclease in a reaction mixture; and iii) detecting the presence or absence of cleavage of the 5′ hairpin invasive cleavage structure at the target cleavage site.

77. The method of claim 76, wherein the invasive cleavage structure is cleavable at the target cleavage site by Afu FEN-1 in a Mg.sup.++ flap assay buffer when the 5′ hairpin-forming region is not in the form of a hairpin.

78. The method of claim 76, wherein the 5′ hairpin-forming region of the 5′ hairpin invasive cleavage structure is in the form of a hairpin when the composition is at room temperature.

79. The method of claim 76, wherein the 5′ hairpin invasive cleavage structure is exposed to the flap endonuclease at a temperature at which the 5′ hairpin-forming region is not in the form of a hairpin.

80. The method of claim 76, wherein the 5′ hairpin invasive cleavage structure is selected from: i) an invasive cleavage structure comprising an invasive oligonucleotide, a 5′ hairpin probe oligonucleotide and a target nucleic acid, wherein the annealing of the 5′ hairpin probe oligonucleotide to the target nucleic acid forms the downstream duplex stem and annealing of the invasive oligonucleotide to the target nucleic acid forms the upstream duplex stem; ii) a structure comprising a 5′ hairpin reporter and a nucleic acid molecule, the 5′ hairpin reporter comprising the 5′ flap comprising the 5′ hairpin-forming region, a downstream duplex stem, and a 3′ portion complementary to a 3′ terminal portion of the nucleic acid molecule, wherein annealing of the 3′ terminal portion of the nucleic acid molecule to the 3′ portion of the 5′ hairpin reporter forms the upstream duplex of the invasive cleavage structure; and iii) an oligonucleotide 5′ hairpin test substrate, the oligonucleotide comprising a 5′ flap comprising a 5′ hairpin-forming region, a downstream duplex stem, and an upstream duplex stem that define an invasive cleavage structure.

81. The method of claim 80, wherein: i) the 5′ hairpin invasive cleavage structure is a structure comprising a 5′ hairpin reporter and a nucleic acid molecule wherein the nucleic acid molecule comprises a 5′ hairpin-forming region; ii) the 5′ hairpin invasive cleavage structure comprises a 5′ hairpin reporter wherein the downstream duplex stem is a hairpin stem comprising a loop; or iii) the 5′ hairpin invasive cleavage structure is a 5′ hairpin test substrate wherein at least one of the upstream duplex stem and the downstream duplex stem is a hairpin stem comprising a loop.

82. The method of claim 76, wherein the 5′ hairpin invasive cleavage structure comprises a FRET labeling system wherein a first member of the FRET labeling system is attached at a first position on the 5′ hairpin invasive cleavage structure and a second member of the FRET labeling system is attached at a second position on the 5′ hairpin invasive cleavage structure, wherein the target cleavage site is between the first position and the second position.

83. The method of claim 76, wherein the reaction mixture comprises a buffer solution comprising a Mg.sup.++.

84. The method of claim 76, wherein the flap endonuclease comprises a thermostable flap endonuclease.

85. The composition of claim 84, wherein the thermostable flap endonuclease comprises a FEN-1 endonuclease from an Archaeal organism.

Description

DESCRIPTION OF THE DRAWINGS

[0123] These and other features, aspects, and advantages of the present technology will become better understood with regard to the following drawings:

[0124] FIGS. 1A, 1B, and 1C provide schematic diagrams of invasive cleavage structures formed from three nucleic acid strands, two nucleic acid strands, or one nucleic acid strand, respectively.

[0125] FIG. 1D provides a schematic diagram of a combined PCR-invasive cleavage assay (“PCR-flap assay”), e.g., a QuARTS assay, comprising a FRET cassette reporter oligonucleotide

[0126] FIG. 2 shows nucleic acid sequences and schematic structures for an exemplary PCR-flap assay in which a flap is released by cleavage of a flap oligonucleotide, and the flap hybridizes to a 3′ region of a FRET cassette oligonucleotide to form a second cleavage structure. Cleavage of the flap-FRET cassette complex separates a fluorophore from a quencher moiety and results in an increase in detectable fluorescence from the fluorophore.

[0127] FIGS. 3A-3D illustrate three 5′ hairpin FRET reporter molecules. FIG. 3A shows the linear sequences for 5′ hairpin FRET reporter molecules 1, 2, and 3, and schematic representations of secondary structures showing a 5′ hairpin on each of the 5′ hairpin FRET reporter molecules are shown in FIGS. 3B, 3C, and 3D. The different stems used in the 5′ portion of 5′ hairpin FRET reporter molecules 1, 2, and 3 result in different calculated melting temperatures for these portions of the reporter molecules.

[0128] FIGS. 4A-4C provide schematic representations of 5′ hairpin FRET assay reporter molecules in cleavable and suppressed cleavage configurations. While not limiting the technology to any particular mechanism of action, a 5′ hairpin may form at low temperatures, thereby suppressing flap endonuclease cleavage at the reporting cleavage site between the fluorophore and quencher moieties when an assay reaction mixture is not at a preferred reaction temperature (as shown in FIGS. 4A-4B). At flap assay reaction temperatures, typically above the calculated melting temperature of the 5′ hairpin, flap endonuclease cleavage at the reporting cleavage site is not suppressed, and cleavage can occur to release the fluorophore from proximity to the quencher, resulting in an increase in fluorescence signal from the fluorophore (FIG. 4C).

[0129] FIG. 5 provides a schematic diagram of a PCR-flap assay, e.g., a QuARTS assay, incorporating a 5′ hairpin FRET assay reporter.

[0130] FIG. 6A provides a graph comparing background fluorescence from a standard FRET cassette and from two 5′ hairpin FRET reporters (hairpin 1 and hairpin 2) used in a serial invasive signal amplification reaction in the absence of target template.

[0131] FIG. 6B provides a graph comparing signal from a standard FRET cassette and from two 5′ hairpin FRET reporters (hairpin 1 and hairpin 2), used in a serial invasive signal amplification reaction in the presence of target template.

[0132] FIGS. 7A, 7B, 7C, and D provide graphs comparing signal from a standard FRET cassette (FIG. 7A) and from three 5′ hairpin FRET reporters (FIGS. 7B, 7C, and 7D, showing data for hairpins 1, 2, and 3, respectively) used in real-time PCR reactions combined with invasive cleavage chemistry (Long-probe Quantitative Amplified Signal, LQAS). FRET assay reporters were designed with and without a 5′ hairpin and tested in an assay design that demonstrated high background signal with a standard FRET cassette (FIG. 7A). The inclusion of the 5′ hairpin resulted in a reduction of background signal (FIGS. 7B, 7C, and 7D), resulting in cleaner amplification curves and improved signal to noise ratio.

[0133] FIGS. 8A and 8B provide schematic diagrams of a 5′ hairpin test substrate for flap endonucleases. In addition to a 5′ hairpin-forming region and a downstream duplex hairpin-forming region, the test substrate includes a 3′ hairpin-forming region configured to form an upstream duplex, to position the 3′ end of the substrate oligonucleotide to act as an invasive oligonucleotide in an invasive cleavage structure.

[0134] FIG. 9 provides a predicted secondary structure of an embodiment of a 5′ hairpin test substrate, with upstream and downstream duplexes, target cleavage site, and 5′ hairpin in a repressive 5′ flap indicated.

[0135] FIG. 10 provides a graph showing fluorescence using single molecule substrates with or without a repressive 5′ hairpin, incubated at 35° C.

[0136] FIGS. 11A and 11B provide graphs illustrating the ability of the 5′ hairpin structures to repress flap endonuclease cleavage at the reporting cleavage site (FIG. 11 B), compared to flap endonuclease activity measured on a substrate lacking a repressive 5′ hairpin (FIG. 11A).

[0137] FIG. 12 provides a graph showing fluorescent signal measured during a reaction as a direct measure of the amount of cleaved 5′ hairpin test substrate v3, as described below.

[0138] FIGS. 13A and 13B illustrate titration of a reference material (e.g., a 5′ hairpin test substrate) showing a differential response that results in a linear standard curve. This standard curve provides a means for determining relative performance of an unknown lot of enzyme. The rate of fluorescence increased over time (log[RFU/s]) for the linear portion of the reaction is graphed vs. enzyme concentration (log[FEN-1 (nM)]).

[0139] FIG. 14A illustrates an invasive cleavage structure formed on a target strand by hybridization of a probe oligonucleotide having a 5′ hairpin-forming region and an upstream invasive oligonucleotide. At flap assay reaction temperatures, typically above the calculated melting temperature of the 5′ hairpin, flap endonuclease cleavage at the target cleavage site is not suppressed, and cleavage can occur to release the 5′ flap arm from the probe oligonucleotide. The released flap can form invasive cleavage structures with both standard FRET cassette and 5′ hairpin FRET reported molecules, as illustrated in FIGS. 14B and 14C, respectively.

[0140] FIGS. 14B and 14C are schematic diagrams invasive cleavage structures formed with a released flap oligonucleotide either a standard FRET cassette (FIG. 14B) or a 5′ hairpin FRET reporter molecule (FIG. 14C).

[0141] FIGS. 15A-15P provide graphs comparing signal from serial invasive cleavage assays having different amounts of target DNA and using standard probes or 5′ hairpin probes, with either a standard FRET cassette or a 5′ hairpin FRET cassette, as shown schematically in FIGS. 14A, 14B, and 14C, as described in Example 3.

DETAILED DESCRIPTION OF THE INVENTION

[0142] The technology relates to structures cleavable by flap endonucleases. In particular, the technology relates to the formation of nucleic acid structures that can be manipulated, e.g., by changes in temperature, to modulate or suppress cleavage by flap endonucleases at a reporting cleavage site.

[0143] One aspect of designing nucleic acid detection assays is selecting reaction components and conditions that produce a minimum amount of background signal when a target analyte is not present, and that produce a distinctive reporting signal in the presence of the target analyte. In flap endonuclease assays, an aspect of signal generation is specific cleavage of flap oligonucleotides and of reporter molecules such FRET cassettes. Thus, an aspect of minimizing background in flap endonuclease assays is the use of reaction temperatures that are high enough that hybridization between nucleic acids from a test sample and the detection oligonucleotides of the assay (e.g., primers, flap oligonucleotides) is very specific. Typically, thermostable enzymes are used for such assays so that the assay reactions can be performed at reaction temperatures that minimize or eliminate non-specific binding of the assay oligonucleotides.

[0144] Assay reactions mixtures for high-temperature assays such as PCR and PCR-flap endonuclease assays are often assembled at temperatures well below the final reaction temperature, e.g., at room temperature or on ice. At these lower temperatures, cleavage of reporter oligonucleotides may occur in a non-specific fashion, e.g., by errant hybridization under the less stringent conditions.

[0145] In one aspect, the technology provides modified oligonucleotide substrates that repress flap endonuclease cleavage at a target or reporting cleavage site at low temperatures but that permit cleavage at the reporting cleavage site at a selected assay reaction temperature or range of temperatures. In some embodiments, a modified assay oligonucleotide, e.g., a flap oligonucleotide or FRET assay reporter, comprises a 5′ flap region that includes a structure or moiety that suppresses cleavage at the reporting cleavage site at a lower temperature, but that loses the structure or moiety at the temperature at which the assay is performed, such that cleavage at the reporting cleavage site can occur. In preferred embodiments, the modified assay oligonucleotide comprises a 5′ hairpin.

[0146] In some embodiments, the technology find use in flap endonuclease assays, including, e.g., PCR-flap assays such as the QuARTS assays described in U.S. Pat. Nos. 8,361,720; 8,715,937; and 8,916,344, and the amplification assays of U.S. Pat. No. 9,096,893. See, e.g., FIG. 1, which provides a schematic diagram of an embodiment of a PCR-flap assay. As shown, a target-specific probe is cleaved by a flap endonuclease to release a 5′ flap during amplification of a region of a target strand. In the secondary reaction, released 5′ flap serves as an invasive oligonucleotide on a fluorescence resonance energy transfer (FRET) cassette to again create the structure recognized by the flap endonuclease. When the fluorophore and quencher on a single FRET cassette are separated by cleavage, a detectable fluorescent signal above background fluorescence is produced. Consequently, cleavage of this second structure results in an increase in fluorescence, indicating the presence of the target nucleic acid. In embodiments in which multiple different targets are to be detected, the FRET cassettes may have a distinct label (e.g. resolvable by difference in emission or excitation wavelengths, or resolvable by time-resolved fluorescence detection) for each allele or locus to be detected, such that the different alleles or loci can be detected in a single reaction. In such embodiments, the flap assay oligonucleotides for multiple target sequences may be combined in a single reaction mixture, allowing comparison of the signals from each allele or locus in the same sample.

[0147] The technology herein provides modified substrates for flap endonucleases. In particular embodiments, assay oligonucleotides, e.g., a flap oligonucleotide or the FRET reporter comprise a hairpin structure, preferably a DNA hairpin, in a 5′ flap of the oligonucleotide to be cleaved in a flap assay reaction.

[0148] The present technology is readily contrasted from a standard FRET assay reporter by considering the number of hairpins present, as a standard FRET cassette generally contains a single hairpin (see, e.g., FIG. 2), while the 5′ hairpin molecules of the present technology generally comprise two or three hairpins.

TABLE-US-00001 Upstream duplex Downstream 5′ (Intrinsic or Structure duplex hairpin Foldback) Standard FRET cassette X 5′ hairpin FRET assay X X reporter 5′ hairpin test substrate X X X

[0149] While the technology is discussed herein by reference to embodiments in which the 5′ hairpin-containing molecules are labeled with a FRET system, the technology is not limited to such embodiments. Applications of the technology to unlabeled oligonucleotides and structures and to oligonucleotides and structures using different types of labels are also contemplated and are within the scope of this technology.

[0150] During development of the technology, it has been observed that the presence of a 5′ hairpin improves invasive cleavage chemistry by reducing background cleavage. The technology can be incorporated into flap cleavage substrates, e.g., into a FRET cassette structure, to improve signal-to-noise separation in flap assay reactions, including PCR-flap assay reactions. A FRET cassette modified to have a 5′ hairpin typically comprises two hairpins: the 5′ hairpin that modulates cleavage at the reporting cleavage site and the hairpin that forms the downstream duplex that is characteristic of an invasive cleavage structure, as is shown schematically in FIG. 4A. For convenience, such a modified FRET cassette may be referred to as a “5′ hairpin FRET reporter.”

[0151] The 5′ hairpin FRET reporter contains a sequence in a 5′ flap calculated to form a hairpin that has a melting temperature that is lower than the reaction incubation temperature. When this 5′ hairpin FRET reporter is mixed with the flap endonuclease enzyme at room temperature, cleavage is limited. While the technology is not limited to any particular mechanism of action, the data indicate that as the incubation temperature of the reaction increases beyond the melting point of the repressive hairpin, the hairpin melts, providing a single-stranded 5′ arm upon which a FEN enzyme can thread to access a reporting cleavage site between the moieties of the FRET labeling system. Thus, when the melting temperature of the repressive arm is reached or surpassed, the flap endonuclease can cleave the reporter molecule to separate the fluorophore from the portion of the substrate containing the quencher, resulting in a measurable increase in fluorescence signal.

[0152] The technology also finds use as part of an all-in-one test substrate comprising three hairpins that is useful for, e.g., characterizing flap endonuclease activities. FIG. 8A provides a schematic diagram of such a 3-hairpin test substrate. In preferred embodiments, a 3-hairpin substrate comprises a FRET labeling system in which a fluorophore and quencher are separable by flap endonuclease cleavage at a reporting cleavage site. As described above for flap endonuclease assays, when this 5′ hairpin-containing substrate is mixed with the flap endonuclease enzyme at low temperature, e.g., at room temperature, cleavage is suppressed. Cleavage can be initiated by elevation of the temperature of the reaction mixture. While not limiting the technology to any particular mechanism of action, the 5′ hairpin of the test substrate is calculated to melt at elevated reaction temperatures, such that the reporting cleavage site is made accessible to the flap endonuclease and the test substrate is cleaved at the reporting cleavage site. The 5′ hairpin test substrate thus permits precise initiation of cleavage assay reactions. Use of a FRET labeling system has a further advantage of permitting real-time detection of cleavage of the test substrate as it occurs in the reaction. In combination, the features of the 3-hairpin test substrate permit precise characterization of the enzyme's activity.

[0153] The technology also finds application in synchronizing initiation of multiple assays, e.g., in different reaction vessels or in different wells of a multi-well assay plate. In such embodiments, the reactions mixtures may be assembled at different times and may be initiated by elevating the temperature in all vessels essentially simultaneously. Such synchronized reaction initiation by temperature shift is useful, for example, when the process of pipetting of assay reagents makes simultaneous mixing of reagents for multiple different reaction mixtures impractical or impossible.

[0154] In some embodiments, different 5′ hairpin structures are used to provide different assay start times. For example, 5′ hairpin FRET reporters may be configured to contain 5′ hairpins that melt at different temperatures. Using FRET reporters with 5′ repressive hairpins that melt at 40° C., 50° C., and 60° C., a set of reactions may be assembled at a temperature below 40° C., then the different reactions may be initiated at will, by elevation of the temperature to 40° C., 50° C., then 60° C., at times defined to suit the needs of a particular experiment.

[0155] In some embodiments, 5′ hairpin modulation of cleavage activity is used to adjust cleavage rates for assays that exhibit different reaction rates. For example, use of different FRET labeling systems (e.g., different fluorophore-quencher combinations) may change cleavage activity exhibited by a flap endonuclease on different FRET reporters that otherwise have the same primary sequence and predicted secondary structure. It is contemplated that different 5′ hairpin modifications (e.g., hairpins having different lengths or stabilities) find use in normalizing rates of cleavage among different FRET reporters, e.g., FRET reporters having different fluorophores. This embodiment finds application, for example, in multiplexed assays in which multiple different dyes are used, and wherein it may be desirable for all FRET reporters to be cleaved at approximately the same rate.

Characterizing Flap Endonucleases

[0156] The technology also finds application in other types of assays, e.g., assays for characterizing flap endonuclease activities. Model nucleic acid structures composed of one or more oligonucleotides, typically synthetic oligonucleotides, may be used in assays designed to detect or measure flap endonuclease activity, e.g., in enzymes suspected of having such activity (e.g., DNA polymerases, repair nucleases) or in organisms suspected of producing such enzymes, and to measure flap endonuclease activity, e.g., under different assay conditions. For example, various synthetic flap structures have been used to characterize the activities and structure specificity of recombinant FEN-1 endonucleases (see, e.g., U.S. Pat. No. 7,122,364 to Lyamichev, et al., and Kaiser M. W., et al. J. Biol. Chem., 274:21387 (1999), each of which is incorporated herein by reference). The structures tested by Lyamichev and Kaiser did not comprise a 5′ hairpin structure of the present technology.

[0157] The technology herein provides a 3-hairpin substrate comprising an upstream duplex and a downstream duplex of an invasive cleavage structure, as shown in FIG. 8A, that finds use in characterizing the activities of flap endonucleases. While not limiting the technology to any particular mechanism of action, it is observed that the presence of a 5′ hairpin represses invasive cleavage at the preferred site in the downstream duplex, which is indicated as the reporting cleavage site in FIG. 8A. As the incubation temperature of the reaction increases and surpasses the calculated melting temperature of the repressive 5′ hairpin, the preferred structure for flap endonuclease cleavage is formed and the cleavage reaction is initiated (see FIG. 8B).

[0158] When a FRET labeling system is used, cleavage at the target cleavage site separates a fluorophore from a quencher, resulting in an increase in fluorescence. This signal can be monitored in real-time and corresponds to flap endonuclease cleavage activity in the reaction.

[0159] In some embodiments, 5′ hairpin reporters and test substrates may include a 5′ hairpin containing base analogs, spacers, (e.g., a 9-carbon spacer), and/or base analogs (e.g., non-standard bases, abasic sugars or linkers, etc.). In some embodiments, a 5′ arm may be configured to make use of an alternative means of blocking flap endonuclease access to a target cleavage site. For example, two-molecule approach in which a short oligonucleotide is annealed to a single stranded 5′-arm is contemplated, or the 5′ arm may be conjugated to a blocking moiety in a thermolabile manner, in which the conjugated blocker releases or is otherwise rendered neutral at elevated temperature.

EXPERIMENTAL EXAMPLES

[0160] The QuARTS and LQAS/TELQAS flap assay technologies combine a polymerase-based target DNA amplification process with an invasive cleavage-based signal amplification process. The QuARTS technology is described, e.g., in U.S. Pat. Nos. 8,361,720; 8,715,937; 8,916,344; and 9,212,392, and a flap assay using probe oligonucleotides having a longer target-specific region (Long probe Quantitative Amplified Signal, “LQAS”) is described in U.S. Pat. No. 10,648,025, each of which is incorporated herein by reference in its entirety for all purposes. In the QuARTS assays described herein, the flap oligonucleotides have a target specific region of 12 bases, while the LQAS assays use flap oligonucleotides have a target specific region of at least 13 bases, and use different thermal cycling procedures for amplification. Fluorescence signal generated by the QuARTS and LQAS reactions are monitored in a fashion similar to real-time PCR, permitting quantitation of the amount of a target nucleic acid in a sample.

[0161] An exemplary QuARTS PCR-flap assay reaction typically comprises approximately 200-600 nM (e.g., 500 nM) of each primer and detection probe, approximately 100 nM of the invasive oligonucleotide, approximately 600-700 nM of each FRET cassette (FAM, e.g., as supplied commercially by Hologic, Inc.; HEX, e.g., as supplied commercially by BioSearch Technologies; and Quasar 670, e.g., as supplied commercially by BioSearch Technologies, and comprising a “black hole” quencher, e.g., BHQ-1, BHQ-2, or BHQ-3, BioSearch Technologies), 6.675 ng/μL FEN-1 endonuclease (e.g., Cleavase® 2.0, Hologic, Inc.), 1 unit Taq DNA polymerase in a 30 μL reaction volume (e.g., GoTaq® DNA polymerase, Promega Corp., Madison, Wis.), 10 mM 3-(n-morpholino) propanesulfonic acid (MOPS), 7.5 mM MgCl.sub.2, and 250 μM of each dNTP.

[0162] Exemplary QuARTS cycling conditions are as shown below:

TABLE-US-00002 QuARTS Reaction Cycle: Number of Stage Temp/Time Cycles Acquisition Pre-incubation 95° C./3 min. 1 none Amplification 1 95° C./20 sec. 10 none 63° C./30 sec. none 70° C./30 sec. none Amplification 2 95° C./20 sec. 35 none 53° C./1 min. single 70° C./30 sec. none Cooling (hold) 40° C./30 sec. 1 none

[0163] An exemplary LQAS reaction typically comprises approximately 200-600 nmol/L of each primer, approximately 100 nmol/L of the invasive oligonucleotide, approximately 500 nmol/L of each flap oligonucleotide probe and FRET cassette. LQAS reactions may, for example, be subjected to the following thermocycling conditions:

TABLE-US-00003 Stage Temp/Time # of Cycles Denaturation 95° C./3′ 1 Amplification 95° C./20″ 40 63° C./1′ 70° C./30″ Cooling 40° C./30″ 1

Targeted Pre-Amplification

[0164] Pre-amplification is often done in multiplex form, i.e., multiple different target nucleic acids are amplified together. A pre-amplification is conducted, for example, in a reaction mixture containing 7.5 mM MgCl.sub.2, 10 mM MOPS, 0.3 mM Tris-HCl, pH 8.0, 0.8 mM KCl, 0.1 μg/μL BSA, 0.0001% Tween-20, 0.0001% IGEPAL CA-630, 250 μM each dNTP, oligonucleotide primers, (e.g., for 12 targets, 12 primer pairs/24 primers, in equimolar amounts (including but not limited to the ranges of, e.g., 200-500 nM each primer), or with individual primer concentrations adjusted to balance amplification efficiencies of the different target regions), 0.025 units/μL HotStart GoTaq concentration, and 20 to 50% by volume of bisulfite-treated target DNA (e.g., 10 μL of target DNA into a 50 μL reaction mixture, or 50 μL of target DNA into a 125 μL reaction mixture). Thermal cycling times and temperatures are selected to be appropriate for the volume of the reaction and the amplification vessel. For example, the reactions may be cycled as follows:

TABLE-US-00004 #of Stage Temp/Time Cycles Pre-incubation 95° C./5′ 1 Amplification 1 95° C./30″ 10-12 64° C./30″ 72° C./30″ Cooling 4° C./Hold 1

[0165] After thermal cycling, aliquots of the pre-amplification reaction (e.g., 10 μL) are diluted to 500 μL in 10 mM Tris, 0.1 mM EDTA, with or without fish DNA. Aliquots of the diluted pre-amplified DNA (e.g., 10 μL) are used in a QuARTS PCR-flap assay, e.g., as described above. See also U.S. Patent Appl. Ser. No. 62/249,097, filed Oct. 30, 2015; application Ser. No. 15/335,096, filed Oct. 26, 2016, and PCT/US16/58875, filed Oct. 26, 2016, each of which is incorporated herein by reference in its entirety for all purposes.

[0166] A combined pre-amplification and LQAS assay is referred to as the TELQAS assay (for “Target Enrichment Long probe Quantitative Amplified Signal”).

[0167] Using the pre-amplified sample, QuARTS and TELQAS reactions are set up as follows:

TABLE-US-00005 Volume per Mastermix (per reaction) reaction (μL) Water (mol. biol. grade) 15.50 10X Oligo Mix* 3.00 20X QuARTS/LQAS Enzyme 1.50 Mix** Total Mastermix volume 20.0 Reaction Mix Mastermix 20 Pre-amplified Sample 10 Final Reaction volume 10 *10X oligonucleotide mix = 2 μM each primer and 5 μM each probe and FRET oligonucleotide **20X enzyme mix contains 1 unit/μL GoTaq Hot start polymerase (Promega), 292 ng/μL Cleavase 2.0 flap endonuclease(Hologic).

[0168] As noted above, the flap oligonucleotides in the QuARTS assays have a target specific region of 12 bases, while the LQAS assays use flap oligonucleotides have a target specific region of at least 13 bases and are subjected to different thermal cycling conditions.

[0169] QuARTS reactions are subjected to the following thermocycling conditions:

TABLE-US-00006 QuARTS Assay Reaction Cycle: Ramp Rate Number Signal Stage Temp/Time (° C. per second) of Cycles Acquisition Pre-incubation 95° C./3 min 4.4 1 No Amplification 1 95° C./20 sec 4.4 5 No 63° C./30 sec 2.2 No 70° C./30 sec 4.4 No Amplification 2 95° C./20 sec 4.4 40 No 53° C./1 min 2.2 Yes 70° C./30 sec 4.4 No Cooling 40° C./30 sec 2.2 1 No
LQAS/TELQAS reactions are subjected to the following thermocycling conditions:

TABLE-US-00007 TELQAS Assay Reaction Cycle: Ramp Rate Number Signal Stage Temp/Time (° C. per second) of Cycles Acquisition Pre-incubation 95° C./3 min 4.4 1 No Amplification 95° C./20 sec 4.4 40 No 63° C./1 min 2.2 Yes 70° C./30 sec 4.4 No Cooling 40° C./30 sec 2.2 1 No

LQAS/TELQAS for RNA Detection (“RT-LQAS” or “RT-TELQAS”)

[0170] An exemplary RT-LQAS reaction contains 20 U of MMLV reverse transcriptase (MMLV-RT), 219 ng of Cleavase® 2.0, 1.5 U of GoTaq® DNA Polymerase, 200 nM of each primer, 500 nM each of probe and FRET oligonucleotides, 10 mM MOPS buffer, pH 7.5, 7.5 mM MgCl.sub.2, and 250 μM each nNTP. An exemplary protocol is as follows: [0171] 1. Remove the required oligonucleotide mixes needed from the −20° C. freezer and allow to thaw. [0172] 2. Thaw controls from the −80° C. for a brief time at room temperature, then place on ice. [0173] 3. Thaw sample plate from the −80° C. for a brief time at room temperature, then place on ice. [0174] 4. Prepare master mix for the oligo mixtures in an appropriately sized tube. [0175] 5. Dilute MMLV-RT 1:20 in H.sub.2O

TABLE-US-00008 mRNA Reverse Transcription 10X Master Mix Formulation Component μL/reaction Nuclease Free-H.sub.2O (Promega) 14.5 MMLV_RT Diluted in NF H.sub.2O 1.0 10X Oligo Mix 3.00 20X Enzyme Mix 1.5 Total Volume Master Mix (μL) 20.0 Sample Vol. (μL) 10 Final RT-LQAS Reaction Vol. (μL) 30 [0176] 6. Pipette 20 μL of master mix into a 96-well RT-LQAS plate, using a matrix pipet OR an eight-channel P20 pipet, per the plate layout. [0177] 7. Load 10 μL of samples (target nucleic acid), controls, calibrators (dilution series for calibration) (per plate layout). [0178] 8. Seal plate and briefly centrifuge. [0179] 9. Run plates with following reaction conditions on the

[0180] Reactions are typically run on a thermal cycler configured to collect fluorescence data in real time (e.g., continuously, or at the same point in some or all cycles). For example, a Roche LightCycler 480 instrument or an Applied Biosystem QuantStudioDX Real-Time PCR instrument may be used under the following conditions:

TABLE-US-00009 RT-LQAS Assay Reaction Cycle: Ramp Rate (° C. Number Signal Stage Temp/Time per second) of Cycles Acquisition Reverse 42° C./ 4.4 1 No Transcription 30 min Pre-incubation 95° C./3 min 4.4 1 No Amplification 95° C./20 sec 4.4 45 No 63° C./1 min 2.2 Single 70° C./30 sec 4.4 No Cooling 40° C./30 sec 2.2 1 No

[0181] In some embodiments, RT-LQAS assays may comprise a step of multiplex reverse transcription and pre-amplification, e.g., to pre-amplify 2, 5, 10, 12, or more targets in a sample (or any number of targets greater than 1 target), as described above, and may be referred to as “RT-TELQAS.” In preferred embodiments, an RT-pre-amplification is conducted in a reaction mixture containing, e.g., 20 U of MMLV reverse transcriptase, 1.5 U of GoTaq® DNA Polymerase, 10 mM MOPS buffer, pH7.5, 7.5 mM MgCl.sub.2, 250 μM each dNTP, and oligonucleotide primers, (e.g., for 12 targets, 12 primer pairs/24 primers, in equimolar amounts (e.g., 200 nM each primer), or with individual primer concentrations adjusted to balance amplification efficiencies of the different targets). Thermal cycling times and temperatures are selected to be appropriate for the volume of the reaction and the amplification vessel. For example, the reactions may be cycled as follows:

TABLE-US-00010 #of Stage Temp/Time Cycles RT 42° C./30′ 1 95° C./3′ 1 Amplification 95° C./20″ 10 63° C./30″ 70° C./30″ Cooling 4° C./Hold 1

[0182] After thermal cycling, aliquots of the RT-pre-amplification reaction (e.g., 10 μL) are diluted to 500 μL in 10 mM Tris, 0.1 mM EDTA, with or without fish DNA. Aliquots of the diluted pre-amplified DNA (e.g., 10 μL) are used in LQAS/TELQAS PCR-flap assays, as described above. In some embodiments, LQAS/TELQAS PCR flap assays are performed using additional amounts of the same primer pairs

Example 1

Comparison of Standard FRET Cassette to 5′ Hairpin FRET Reporters in Serial Invasive Cleavage and PCR-Flap Endonuclease Assays

[0183] A standard FRET cassette design (see FIG. 2, e.g.) was modified to include one of two different 5′ hairpins (see FIGS. 3A-3D). These two 5′ hairpin FRET reporters were tested alongside a standard FRET cassette (no 5′ hairpin) in a serial invasive cleavage assay in the presence or absence of a target DNA recognized by the assay oligonucleotides. Each 5′ hairpin assay reporter used FAM as a fluorophore and Black Hole Quencher® 1 (“BHQ1,” Biosearch Technologies) as a quencher, incorporated on T nucleotides as indicated in FIG. 3. Serial invasive cleavage assays were performed as described by Hall J G, et al., Proc Natl Acad Sci USA 97:8272-8277 (2000) and fluorescence signal was measured in real time. The results are shown in FIGS. 6A (no target control) and 6B (with target).

[0184] These data show that use of a FRET cassette without a 5′ hairpin resulted in higher fluorescence levels both without and with target DNA in the reaction. While the 5′ hairpin FRET reporters exhibited lower fluorescence signal in template-positive reactions, the separation between the negative and positive template reactions increased relative to the control FRET cassette. Signal-to-noise ratios were calculated for each FRET reporter to determine the separation between signals from positive (with target template) and negative (without target template) reactions, for each of the different FRET assay reporter designs.

[00001]$\mathrm{Signal}\mathrm{to}\mathrm{Noise}=\frac{\mathrm{Average}\left(\mathrm{RFU}\mathrm{sample}\right)}{\mathrm{Average}\left(\mathrm{RFU}\mathrm{negctrl}\right)}$

TABLE-US-00011 FRET Reporter Time (min) Signal to noise Control (standard FRET cassette) 225 5.45 5′ Hairpin 1 225 13.21 5′ Hairpin 2 225 13.60

[0185] These data show that use of the FRET reporter molecules containing a 5′ hairpin-forming sequence resulted in greater separation between signal and noise. The greater separation is largely due to a reduction in background signal generated in the negative (no target) sample sets.

PCR-Flap Assay Reactions

[0186] FRET cassettes used in real-time PCR-flap endonuclease assays (LQAS assays, as described above) were replaced with FRET assay reporters that include a 5′ hairpin. Primary structures for 5′ hairpin FRET reporters 1, 2, and 3 are shown in FIG. 3A, and secondary structures are shown in 3B-3D. The FRET assay reporters with and without 5′ hairpin-forming sequences were compared in PCR-flap assay reactions. These data are shown in FIGS. 7A (using a standard FRET cassette), 7B (using 5′ hairpin FRET reporter 1), 7C (using 5′ hairpin FRET reporter 2), and 7D (using 5′ hairpin FRET reporter 3). These data show a reduction in background slope for reactions that used any of the 5′ hairpin FRET reporters (FIGS. 7B-7D). The reduction in background slope resulted in improved signal-to-noise ratios when these reactions were compared to the no-template control reactions.

[0187] Shown below are the sequences of the three 5′ hairpin FRET reporter molecules tested in these flap assay reactions. These reporters comprised different 5′ hairpin designs having different calculated melting temperatures, as indicated below.

TABLE-US-00012 Tm (° C.) of hairpin, Oligo Name Sequence calculated 5′ hairpin-FRET-1 5′-CAGTTTTCTG-(T-FAM)-TCT-(T-BHQ-1)- 41.7 AGCCGGTTTTCCGGCTAAGACGTCCGTGGCCT-C6 3′ (SEQ ID NO: 7) 5′ hairpin-FRET-2 5′-CAACTTTTGTTG-(T-FAM)-TCT-(T-BHQ-1)- 51.4 AGCCGGTTTTCCGGCTAAGACGTCCGTGGCCT-C6 3′ (SEQ ID NO: 8) 5′ hairpin-FRET-3 5′-GCGTTTTCGC-(T-FAM)-TCT-(T-BHQ-1)- 59.2 AGCCGGTTTTCCGGCTAAGACGTCCGTGGCCT-C6 3′ (SEQ ID NO: 9)

Example 2

Single Molecule Flap Endonuclease Substrate

[0188] Cleavage reactions on single molecule substrates without and with cleavage-suppressing 5′ hairpins were compared. Each substrate comprised a fluorophore and a quencher, as shown schematically in FIG. 8. An example of a secondary structure for a single molecule test substrate is shown in FIG. 9. The linear sequence of this molecule is shown as ‘v3’ in table below. Other iterations of the design include a 5′ hairpin containing a 9-carbon spacer (C9), a set of abasic internal modifications (dS), or a two-molecule approach where a shorter oligo is annealed to a single stranded 5′-arm.

[0189] Real-time monitoring of fluorescence over time provides a direct indication of enzymatic activity. Identification of the linear portion of the reaction allows linear regression to assign an RFU/s value indicative of flap endonuclease activity (see FIG. 10).

[0190] Assays comprise one of the single molecule substrates, flap endonuclease enzyme, MgCl.sub.2 or MnCl.sub.2, and a buffering agent. A carrier protein, such as Bovine Serum Albumin (BSA) may also be used in the assay. To perform an assay, a reference lot of a flap endonuclease enzyme is diluted in a standard curve. An unknown enzyme (e.g., a FEN-1 endonuclease) is then diluted to target the center of the reference titration. Below is an example of the reaction concentrations that may be used.

TABLE-US-00013 TABLE 1 Flap Endonuclease Test Reaction Formulation Reagent Reaction Concentration Water NA MOPS, pH 7.5 10 mM MgCl2 7.5 mM Substrate 5 μM Enzyme 15-150 nM

[0191] The enzyme dilutions are mixed with substrate, buffer, and MgCl.sub.2. These reactions are then incubated at an isothermal temperature at which kinetic fluorescence is monitored. The detected rate that fluorescence increases over time is a direct indication of enzyme activity. As a result, the reference titration provides a differential response based on enzyme concentration that may be used to generate a standard curve (FIG. 12). This standard curve may be used to perform linear regression to determine a relative percent activity for an unknown lot of enzyme.

[0192] The table below provides the primary sequences of exemplary single molecule substrates: [0193] v1 (FAMS and FAML)=No Repressive Arm (no 5′ hairpin) [0194] v2 (dS)=5′ hairpin oligonucleotide with “dSpacer” internal modifications used for the loop of the 5′ hairpin. [0195] v2(C9)=5′ hairpin oligonucleotide with “Spacer9” internal modification used for the loop of the 5′ hairpin. [0196] v2 (HP)=5′ hairpin oligonucleotide with “T” used as the loop sequence in the 5′ hairpin.

TABLE-US-00014 TABLE 2 Single-molecule Invasive Cleavage Test Substrates Oligo Sequence (5′->3′) v1 (FAMS) 5′-FAM-TCT-T(BHQ1)-AGCCGGTTTTCCGGCTGAGACTCCGCTTTTGCGGAGG-3′ (SEQ ID NO: 10) v1 (FAML) 5′-FAM-TCT-T(BHQ1)- AGCCGGTTTTCCGGCTGAGACGTCCGTGGCCTTTTTAGGCCACGGACGG-3′ (SEQ ID NO: 11) v2 (HP) 5′-TCCTTATTACTTTTGTAATAAGGA-T(FAM)-TCT-T(BHQ1)- CAGCCGGTTTTCCGGCTGAAGACTCCGCTTTTGCGGAGG-3′ (SEQ ID NO: 12) v2 (C9) 5′-TCCTTATTAC-Spacer9-GTAATAAGGA-T(FAM)-TCT-T(BHQ1)- CAGCCGGTTTTCCGGCTGAAGACTCCGCTTTTGCGGAGG-3′ (SEQ ID NO: 13) v2 (dS) 5′-TCCTTATTAC-dSpacer-dSpacer-dSpacer-d-Spacer-GTAATAAGGA-T(FAM)-TCT- T(BHQ1)-CAGCCGGTTTTCCGGCTGAAGACTCCGCTTTTGCGGAGG-3′ (SEQ ID NO: 14) v3* 5′-GTCTTTTGAC-(T-FAM)-TCT-(T-BHQ1)- CAGCCGGTTTTCCGGCTGAAGACGCCGCTTTTGCGGCGG-3′ (SEQ ID NO: 15) v4 5′-GTCATTTTTGAC-(T-FAM)-TCT-(T-BHQ-1)- CAGCCGGTTTTCCGGCTGAAGACGCCGCTTTTGCGGCGG-3′ (SEQ ID NO: 16) V5 5′-GTCAC-(iSpacer9)-GTGAC-(T-FAM)-TCT-(T-BHQ1)- CAGCCGGTTTTCCGGCTGAAGACGCCGCTTTTGCGGCGG-3′ (SEQ ID NO: 17)

[0197] The graph in FIG. 10 shows fluorescence measured during incubation at a temperature of 35° C. using single substrates with or without a repressive 5′ arm. Tests were conducted using the v3 test substrate, above, or a control FRET cassette having the same sequence but lacking the 5′ hairpin portion, and using Cleavase® 2.0 (Hologic, Inc.) The oligonucleotides containing the repressive hairpins showed consistent low fluorescence throughout the incubation, while the substrate without the repressive arm showed higher initial fluorescence, indicative of cleavage occurring during transfer of the reaction mix to the reaction plate. These data also show fluorescence increasing over time for the substrate lacking the repressive arm, which suggests continuing cleavage occurring at this low incubation temperature.

[0198] The data in FIG. 11 illustrate the ability of the 5′ structures to repress enzymatic cleavage at the target cleavage site. Tests were conducted using the v3 test substrate, above, or the control FRET cassette lacking a 5′ hairpin described above. The graph shows fluorescence measured at an incubation temperature of 53° C. for reactions on single substrates without (FIG. 11A) or with (FIG. 11B) a repressive arm. The oligonucleotides containing the repressive 5′ hairpins showed low fluorescence at the start of data collection, suggesting successful repression of enzymatic cleavage during reaction setup, while the substrate without the repressive arm showed higher initial fluorescence, indicative of cleavage that occurred during the reaction setup. The 5′ repressive arm also resulted in better uniformity and separation of slope across a range of enzyme concentrations (0-40 nM).

[0199] FIG. 12 shows that fluorescent signal measured during the reaction is a direct measure of the amount of cleaved substrate (test substrate v3, above). Therefore, quantitation of fluorescence over time (RFU/s) is a direct measure of enzyme activity. Identification of the linear portion of the reaction allows an RFU/s value to be determined for a given reaction. In order to do this, raw fluorescence data from each reaction is used to determine the first derivative at each time point across the dataset. The first derivative provides a direct indication of the rate of change. The first derivative data is then used to identify the maximum for each reaction, which is used to express the derivative data as a % maximum value. A threshold is applied to the % max data to determine a linear subset of RFU data for each reaction that can be used in linear regression to determine an RFU/s activity for each reaction. FIG. 12 illustrates a reaction curve (blue crosses) plotted alongside % max first derivative (red circles). The highlighted portion of the reaction curve is used for linear regression.

[0200] FIG. 13 illustrates that performing a titration of a reference material shows a differential response that results in a linear standard curve. This standard curve provides a means for determining relative performance of an unknown lot of enzyme. The rate of fluorescence increased over time (RFU/s) for the linear portion of the reaction is graphed vs. enzyme concentration.

[0201] Use of a repressive 5′ modification, e.g., a 5′ hairpin, reduces cleavage at the target cleavage site at ambient temperature. Because the substrate used in the assay is a single molecule, there is no need for an annealing reaction, and equimolarity of the quencher and fluorophore is ensured. As a result, the assay using the 3-hairpin single molecule substrate with a FRET labeling system (e.g., as illustrated in FIGS. 8 and 9) provides a means of monitoring flap endonuclease activity in real-time, reduces background cleavage, and provides a user-friendly setup. Previous assays used to characterize flap endonuclease activity did not control the start of the reaction and monitor in real time without the need for hybridization. The present technology provides an assay that is reproducible and that provides greater sensitivity.

[0202] Testing was performed to determine whether the assay was capable of distinguishing between different activity levels of lots of flap endonuclease enzyme. Low, centered, and high performing lots of Afu FEN-1 endonuclease (as determined by QuARTS assay performance) were tested against a reference dilution series. The results are shown in the table below.

TABLE-US-00015 TABLE 3 Enzyme Performance Discrimination (on v3 test substrate, Table 2) Relative FEN1 Log Standard Curve Activity Rel FEN1 (nM) RFU/s (RFU/s) Slope Intercept R-Sq (nM) % Activity High 82.5 36674 4.56 0.719 3.122 0.998 102 123 Mid 82.5 32945 4.52 0.719 3.122 0.998 88 106 Low 82.5 23076 4.36 0.719 3.122 0.998 53 65

[0203] Results show that the assay using a 5′ repressive arm test substrate has the ability to distinguish between a high, centered, and low performing lots of enzyme using linear regression against a standard curve. Further characterization of the assay included a multi-site study involving multiple operators, instruments, and reagent lots showed the reproducibility of the assay to be excellent, with % CV across all runs of 7-8% (data not shown).

[0204] This assay provides a simple workflow that can be performed in under 60 minutes. Data collection and analysis is straightforward and minimizes variables that may impact results. For instance, there is no need for temperature cycling, oligo hybridization, or Taq polymerization. Additionally, the use of kinetic fluorescence for real-time detection of enzyme activity provides a more sensitive approach for activity assessment than end point technologies.

Example 3

[0205] 5′ Hairpin Flaps on Probe Oligonucleotides in Invasive Cleavage Structures

[0206] Serial invasive cleavage assays were tested using 5′ hairpins on the primary probe oligonucleotide, on the FRET reporter oligonucleotide, and on both. Also compared were primary probe oligonucleotides having 5′ hairpins of different thermal stabilities, i.e., having a calculated Tm of 59° C. (“high” temp) or of 51° C. (“low” temp). Serial invasive cleavage assays were performed as described by Hall J G, et al., Proc Natl Acad Sci USA 97:8272-8277 (2000) except that the reactions were first incubated at a temperature in which cleavage at a targeted cleavage site should be blocked, followed by a shift to a temperature at which the 5′ hairpin should unfold and cleavage at the targeted cleavage sites should occur. Fluorescence signal was measured in real time, at one-minute intervals.

[0207] In the experiments discussed below, the “probe” refers to the target-specific flap assay probe in a serial invasive cleavage reaction, sometimes referred to as a “primary probe.” Digested plasma DNA containing a region of the LASS4_4482 gene was used as target material in the assays.

[0208] Oligonucleotides used in the serial invasive cleavage assays were as follows:

TABLE-US-00016 Tm (° C.) of hairpin, Oligo Name Sequence (5′ to 3′) calculated Forward ACGGGTGTTCGAGGACG (SEQ ID NO: 18) N/A Primer/Invader Oligonucleotide for LASS4_4482 target DNA LASS4_4482_Probe AGGCCACGGACGGCGGTTGTGAAACGG/3C6/ (no HP) (SEQ ID NO: 19) LASS4_4482_Probe CAACTTTTGTTGAGGCCACGGACGGCGGTTGTGAAACGG/3C6/ 51.4 HP1 (″low″) (SEQ ID NO: 20) LASS4_4482 Pb CGAGTTTTCTCGAGGCCACGGACGGCGGTTGTGAAACGG/3C6/ 59.2 HP2 (″High″) (SEQ ID NO: 21) 5′ hairpin-FRET-1 5′-CAGTTTTCTG-(T-FAM)-TCT-(T-BHQ-1)- 41.7 AGCCGGTTTTCCGGCTAAGACGTCCGTGGCCT-C6 3′ (SEQ ID NO: 7)

[0209] Bench area was cleaned using 10% Bleach followed by a diH2O rinse and allowed to air dry. While air drying, pipettes were wiped down with 6% hydrogen peroxide. Oligonucleotides and reagents were removed from cold storage and allowed to equilibrate to room temperature for 30 minutes.

[0210] Reagents were prepared as follows: [0211] 1. Prepare a dilution of BSA:

TABLE-US-00017 Component Ci (mg/mL) Cf (mg/mL) Volume (uL) BSA 100 10 100 nuclease free H2O NA NA 900 Total (1:10 BSA) 1000 [0212] 2. Prepare a 1:10 dilution of the Forward Primer/Invasive oligonucleotide

TABLE-US-00018 Component Ci (uM) Cf (uM) Volume (uL) Invasive 100 10 10 oligonucleotide nuclease free H2O NA NA 90 Total (1:10 FP) 100 [0213] 3. Prepare a 10× Oligo Mix for each assay configuration to be tested:

TABLE-US-00019 Volume to Description Ci Cf 10X Units add (uL) Water, dispensed NA NA NA NA 612.50 Invasive 10 0.05 0.500 μM 35.00 oligonucleotide Probe 100 0.5 5.000 μM 35.00 FRET reporter 100 0.25 2.500 μM 17.50 Total 700 [0214] 4. The following combinations of oligonucleotides were tested: [0215] i. Control Mix−All standard components (no hairpins on FRET assay reporter or probe) [0216] ii. Hairpin FRET+Standard probe [0217] iii. Hairpin Probe+Standard FRET cassette [0218] iv. Hairpin FRET+Hairpin Probe

[0219] Serial invasive cleavage reactions were set up with a matrix of Standard or Hairpin FRETs (Arm 5 FAM) and Hairpin Probes. A control mix of a Standard Arm 7 FAM FRET and Arm 7 Probe was set up for comparison. The reactions were assembled as follows: [0220] 5. Make 10× reaction mix:

TABLE-US-00020 Volume to Description Ci Cf* Units 10× add (uL) Nuclease FreeWater NA NA NA NA 2741.25 1M MOPS pH 7.5 1000 10 mM 100 750 1M MgCl2 1000 7.5 mM 75 562.5 1M Tris-HCl, pH 8.0 1000 2 mM 20 150 1M KCl 1000 5 mM 50 375 1:10 BSA 10 0.002 mg/mL 0.02 15 20% Tween 20 20 0.05 % 0.5 187.5 10% Igepal CA-630 10 0.05 % 0.5 375 80% Glycerol 80 2.5 % 25 2343.75 Cleavase 4380 7.3 ng/uL 73 125.00 Total: 7500 [0221] 6. Make Serial invasive cleavage assay reaction mix:

TABLE-US-00021 Volume to Description Ci Cf* add (uL) 10× Reaction Mix 10 1 210 10× Oligo Mix 10 1 210 Nuclease Free H2O NA NA 980 Total NA NA 1400 Target NA NA 700 [0222] 7. Transfer 20 μL of master mixes to wells of a 96 well LightCycler Plate. [0223] 8. Transfer 10 μL of targets DNAs into plate wells. “no target” control reactions contained fish DNA diluent. [0224] 9. Seal plate and briefly spin in the plate spinner. [0225] 10. Run plate on the Quantstudio Dx per parameters below with reaction volume of 30 uL.

[0226] Cycling Conditions

TABLE-US-00022 Invader Reaction Cycle: Temp/ Ramp Number Stage Time Rate of Cycles Acquisition Preincubation 40° C., or 1.6 180 Single 50° C./1′ Denaturation 95 C./5′ 1.6 1 none Invader 63° C./1′ 1.6 240 Single Cooling 40° C./30″ 1.6 1 none

[0227] As described above, the assay plates were incubated at 40° C. or 50° C. for 180 minutes, with data collected every minute. This incubation period shows the efficacy of blocking cleavage of the probes and hairpin FRET assay reporters at temperatures in which 5′ hairpins are configured to block cleavage at the target cleavage sites. Plates were then incubated at 63° C. for 240 minutes, with data collected every minute. This incubation period shows the efficacy of the serial invasive cleavage assay reagents in generating signal in response to different amounts of the target DNA. “High” DNA reactions contained 2×10.sup.9 strands, “Med” DNA reactions contained 2×10.sup.8 strands, and “Low” DNA reactions contained 2×10′ strands of target DNA.

[0228] Amplification curves were assessed using MultiComponent Data. Linear fits (RFU/Cycle) were determined per well and compared across mixes. The results are shown in FIGS. 15A-15P, with the specification reaction configurations shown in each title bar. “Zoomed” figures are enlarged to show the transition between the 50° C. (repressed) incubations and the 63° C. (unrepressed) cleavage assay conditions. These data show that a 5′ hairpin on the primary probe suppresses background and does not inhibit the assay when the reactions are shifted to the higher “unrepressed” temperature.

REFERENCES

[0229] 1. Kaiser M, et al. J Biol Chem. 1999. Vol 274, No 30, 21387-21394. [0230] 2. Dorjsuren D, et al. Nucleic Acids Research. 2011. Vol 39, No 2 ell [0231] 3. Lyamichev V, et al. Biochemistry. 2000. 39, 9523-9532. [0232] 4. Tsutakawa S, et al. Cell. 2011. 145, 198-211. [0233] 5. Tumey N, et al. Bioorg & Med Chem Let. 2004. 15, 277-281. [0234] 6. Hall J G, et al. Proc Natl Acad Sci USA 2000; 97: 8272-8277. Sensitive detection of DNA polymorphisms by the serial invasive signal amplification reaction. [0235] 7. Allawi H T, et al. J of Clin Microbio 2006; vol 44, no. 9: 3443-3447. Invader Plus Method Detects Herpes Simplex Virus in Cerebrospinal Fluid and Simultaneously Differentiates Types 1 and 2.

[0236] All literature and similar materials cited in this application, including but not limited to, patents, patent applications, articles, books, treatises, and internet web pages are expressly incorporated by reference in their entirety for any purpose. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which the various embodiments described herein belongs. When definitions of terms in incorporated references appear to differ from the definitions provided in the present teachings, the definition provided in the present teachings shall control.

[0237] Various modifications and variations of the described compositions, methods, and uses of the technology will be apparent to those skilled in the art without departing from the scope and spirit of the technology as described. Although the technology has been described in connection with specific exemplary embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in pharmacology, biochemistry, medical science, or related fields are intended to be within the scope of the following claims.