Method For Preparing Hexahydrofuro-Furanol Derivative, Intermediate Thereof And Preparation Method Thereof

Abstract

The invention relates to the field of pharmaceutical synthesis, in particular to a preparation method of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol derivatives and their intermediates. The preparation method is carried out starting from compound Formula A1.

##STR00001##

In the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol derivatives, the chirality was constructed by enzymatic method, and the products were prepared with high optical purity. The preparation method can be used to produce the key intermediates of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol of darunavir commercially, which is a very economical route suitable for industrial production.

Claims

1. A compound of Formula Cp or formula Cp with the following structures: ##STR00038## wherein R.sub.1, R.sub.2 are hydrogen or hydroxyl protective group, R.sub.2 is hydroxyl protective group.

2. The compound according to claim 1 is characterized in that the hydroxyl protective group are alkyl, silyl, acyl of C.sub.2-11, ring alkenyl of C.sub.4-9, aryl, aralkyl, aroyl, phenyl and substituted phenyl; the silyl is tetramethyl-silyl, trimethyl-silyl, triethyl-silyl, tri-butyl silyl and tert-butyl dimethyl silyl; the alkyl is alkyl of C.sub.1-C.sub.8, the aromatic groups are phenyl, furan, thiophenyl or indole group; the substituted phenyl group is alkyl substituted phenyl group, alkoxy alkyl substituted phenyl group, nitro alkyl substituted phenyl group or halogen substituted phenyl group; the alkyl substituted phenyl is benzyl, diphenyl methyl, triphenyl methyl group; the phenyl substituted by the alkoxy alkyl group is p-methoxybenzyl; the substituted phenyl group of the nitro alkyl group is p-nitro benzyl group; the phenyl substituted by the halogen is p-chlorophenyl group.

3. A preparation method of the intermediate compound of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, the chiral was constructed from compound formula (B) or compound formula (b-2) by enzymatic reduction reaction, ##STR00039## wherein R.sub.1 is hydrogen or protective group of hydroxyl group; the enzyme is aldehyde/ketone reductase, its amino acid sequence is the protein shown in SEQ ID NO: 1, or the protein with aldehyde/ketone reductase activity after the substitution, deletion or addition of one or more amino acid residues by SEQ ID NO: 1, or the protein with more than 80% homology with aldehyde/ketone reductase activity with the amino acid sequence shown in SEQ ID NO: 1; preferably R.sub.1 is a linear or branched acyl group of C.sub.2-11, a benzoyl group or a mono-substituted or multi-substituted benzoyl group on the benzene ring, and the mono-substituted or multi-substituted group is alkyl group, alkoxy group, nitro group or cyano group.

4. A preparation method of the intermediates of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol is constructed by enzymatic reduction reaction of compound formula B, and the hydroxyl group further is protected by protective group, ##STR00040## ##STR00041## wherein, R.sub.1 is defined as claim 3, R.sub.2 is a protective group of hydroxyl group, and the enzyme is the same as claim 3; preferably R.sub.1 is a linear or branched acyl group of C.sub.2-11, a benzoyl group or a mono-substituted or multi-substituted benzoyl group on the benzene ring, and the mono-substituted or multi-substituted group is alkyl group, alkoxy group, nitro group or cyano group.

5. (canceled)

6. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, is characterized in that the intermediate C prepared from claim 3, is prepared by further reduction and ring-closing reaction, ##STR00042## wherein the definition of R.sub.1 is same as claim 3.

7. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, is characterized in that the intermediate C-2 prepared from claim 3, is prepared by ring-closing reaction, ##STR00043## wherein the definition of R.sub.1 is same as claim 3.

8. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, is characterized in that the intermediate Cp prepared from claim 4, is prepared by further reduction and ring-closing reaction, ##STR00044## wherein the definition of R.sub.1 and R.sub.2 are same as claim 4.

9. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, is characterized in that the intermediate Cp-2 prepared from claim 4, is prepared by ring-closing reaction, ##STR00045## wherein the definition of R.sub.1 and R.sub.2 are same as claim 4.

10. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, is characterized in that the intermediate C-2 or prepared from claim 3, is prepared by further ring-closing reaction.

11. According to the preparation method mentioned in claim 3, its characteristic is that the compound formula B is prepared by acylation reaction of compound Formula A2, the reaction is shown as follows: ##STR00046## wherein R.sub.1 is a linear or branched acyl group of C.sub.2-11, benzoyl group or a mono-substituted or multi-substituted benzoyl group on the benzene ring, and the mono-substituted or multi-substituted group is an alkyl group, alkoxy group, nitro group or cyano group; preferably, the compound formula A2 is prepared by halogenation reaction of compound formula A1, the reaction is shown as follows: ##STR00047## wherein X is halogen.

12. (canceled)

13. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol is characterized by the preparation by halogenation reaction, acylation reaction, enzymatic reduction reaction, further reduction and ring-closing reaction, ##STR00048## wherein X is a halogen, the definition of R.sub.1 is same as claim 3, and the enzyme is defined as in claim 3.

14. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol is characterized by the preparation by halogenation reaction, acylation reaction, enzymatic reduction reaction, protection reaction, further reduction and ring-closing reaction, ##STR00049## wherein X is a halogen, the definition of R.sub.1 is same as claim 3, R.sub.2 is a protective group of hydroxyl group, and the enzyme is defined as in claim 3.

15. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol is characterized by the preparation by halogenation reaction, enzymatic reduction reaction, acylation reaction, protection reaction, reduction and ring-closing reaction, ##STR00050## wherein X is a halogen, the definition of R1 is same as claim 3.

16. According to the preparation method mentioned in claim 3, its characteristic is that the nucleotide sequence of the aldehyde/ketone reductase gene is SEQ ID NO: 2.

17. According to the preparation method mentioned in claim 3, it is characterized in that the aldehyde/ketone reductase is the total cell of genetically engineered bacteria, the liquid of crushing enzyme, the freeze-dried powder or the immobilized enzyme or immobilized cell.

18. According to the preparation method mentioned in claim 3, it is characterized in that the total cell input of the aldehyde/ketone reductase gene engineering bacteria in the reaction system is 10-100 g/L and the conversion temperature is 25-37 C.

19. According to the preparation method mentioned in claim 3, it is characterized in that the reaction takes place in the presence of a solvent.

20. According to the preparation method mentioned in claim 19, its characteristic is that the solvent is a mixed solvent consisting of water or buffer solution and organic solvent; preferably, the selection of the buffer solution from one or more of the phosphate buffer solution, carbonate buffer solution, Tri-HCl buffer solution, citrate buffer solution or MOPS buffer solution; preferably, the organic solvent is selected from one or more of DMSO, ethyl acetate, butyl acetate, isopropanol, DMF, TBME, dichloromethane and vinyl acetate.

21. (canceled)

22. (canceled)

23. A method for the preparation of (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol, is characterized in that the intermediate Cp-2 prepared from claim 4, is prepared by further ring-closing reaction.

24. According to the preparation method mentioned in claim 4, its characteristic is that the compound formula B is prepared by acylation reaction of compound Formula A2, the reaction is shown as follows: ##STR00051## wherein R.sub.1 is a linear or branched acyl group of C.sub.2-11, benzoyl group or a mono-substituted or multi-substituted benzoyl group on the benzene ring, and the mono-substituted or multi-substituted group is an alkyl group, alkoxy group, nitro group or cyano group; preferably, the compound formula A2 is prepared by halogenation reaction of compound formula A1, the reaction is shown as follows: ##STR00052## wherein X is halogen.

Description

EXAMPLES

[0048] In order to further understand the invention, the following is a detailed description of the preparation method, the intermediate and the preparation method of the (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-ol derivatives provided by the invention. It is to be understood that these embodiment descriptions are intended only to further specify the characteristics of the invention and not to limit the scope of the invention or the scope of the claim to the invention.

Example 1

[0049] ##STR00025##

[0050] Compound A1, dichloromethane, was added to the reaction bottle and cooled down. Bromide was weighed and diluted with dichloromethane. The diluted bromide was transferred to a drop hopper and slowly added to control the internal temperature. After dripping, keep the internal temperature of reaction constant. Add water, control temperature and separate. The organic phase is put into another reaction bottle, water is added, and the liquid is extracted and separated. The organic phase was put into another reaction bottle, and 5% NaHCO.sub.3 aqueous solution was added to extract and separate the liquid. The organic phase was put into another reaction bottle, and the upper aqueous phase was combined to add dichloromethane, which was extracted and separated. The abandoned water phase is combined with the organic phase, water is added, extracted, separated, abandoned water phase and the lower organic phase are concentrated in the rotary evaporator until no solvent is discharged, the yield is 90-95%.

Example 2

[0051] ##STR00026##

[0052] Add acetone, compound A2(X is bromine), benzoic acid to the reaction bottle, stirring and cooling. Add the triethylamine to the drop tank and start slowly to control the internal temperature. After dripping, heat up to room temperature and stir the reaction. After the reaction, filtration was performed. After filtration, filtrate was transferred to the distillation bottle for vacuum distillation. The temperature was controlled at 50-60 C. until the distillation bottle appeared solid paste. Supplying the distillation flask with ethyl acetate, stir well to dissolve, will shift the distillation of material liquid reaction in a bottle, the response of saturated salt water washing in the bottle, let stand, fluid, combined water layer, add the ethyl acetate extraction, let stand, layer, abandon water layer, combination of organic layer, anhydrous sodium sulfate was added to the organic layer stir to drying and suction filter. The filtrate was transferred to the reaction bottle for vacuum distillation, and the temperature was controlled at 50-60 C. until the reaction liquid turned into a solid paste. Then part of ethyl acetate was added and stirred to reflow to dissolve. The temperature was controlled at 50-60 C. Added n-heptane to the add tank. After cooling down slowly, keep stirring, filtration, drying target solid crude product, yield 70-75%.

Example 3

[0053] EntireCell Preparation of Aldehyde/Ketone Reductase GeneEngineered Bacteria

Recombinant aldehyde/ketone reductase gene engineering bacteria, the preparation method is: The aldehyde/ketone reductase gene sequence from Saccharomyces kudriavzevii was selected for artificial design. The artificially designed sequence was synthesized by entire gene synthesis (commissioned by GenScript co., LTD.), and cloned into the Nde I and Xho I cleavage sites of the expression vector pET28a to transform host bacteria E. coli BL21 (DE3) competent cells. After the positive inverters were selected and identified by sequencing, the recombinant expression was obtained. Recombinant expression vector was transferred into E. coli BL21 (DE3) to obtain recombinant aldehyde/ketone reductase gene engineering bacteria that could induce expression of recombinant aldehyde/ketone reductase.

[0054] The recombinant aldehyde/ketone reductase gene engineering bacteria were inoculated into LB medium containing kanamycin and cultured overnight at 37 C. to obtain the seed culture medium. The seed medium was inoculated with 1% of the volume of the medium containing kanamycin. Then, it was cultured at 37 C. for 2-5 h, and induced by sterile IPTG, so that the final concentration of IPTG reached 0.1 mM. Then, it was incubated at 25 C. for 20 h. Finally, entire cells of Saccharomyces kudriavzevii aldehyde/ketone reductase gene were obtained by high speed centrifugation. The entire cells of the genetically engineered bacteria were broken by ultrasonic method to obtain the enzyme solution of the entire cells of the genetically engineered bacteria from Saccharomyces kudriavzevii. Aldehyde/ketone reductase is a protein whose amino acid sequence is SEQ ID NO: 1, and the nucleotide sequence of aldosterone reductase gene is shown in the sequence table SEQ ID NO: 2.

[0055] After induction, there were obvious protein bands at 45 kDa, indicating that aldehyde/ketone reductase was highly expressed in recombinant bacteria. The enzyme activity of aldehyde/ketone reductase pure protein was measured in a reaction system of 0.25 ml, including Tris-hcl, NADPH (pH 8.0, 2 mmol/L), 0.1 mmol/L substrate

##STR00027##

and appropriate enzymes. The reduction in absorbance at 340 nm was measured. The enzyme activity unit (U) was defined as the enzyme required to catalyze the oxidation of lumol NADPH per minute under the above conditions.

[0056] The results showed that the aldehyde/ketone reductase activity of the recombinant gene-engineered aldehyde/ketone reductase was increased by more than 20% compared with that of the European patented (EP2634180A1) sequence, and by more than 50% compared with that of the unmutated aldehyde/ketone reductase sequence.

[0057] The aldehyde/ketone reductase gene engineering bacteria used in the embodiments of the invention are prepared by this method.

[0058] The glucose dehydrogenase used in the embodiment of the invention and in the control experiments are commercial enzymes purchased from sigma-aldrich.

[0059] The algorithm of ee value is shown as follows:

ee(syn)=([R,R][S,S])/([R,R]+[S,S])

ee(anti)=([R,S][S,R])/([R,S][S,R])

de={([R,S]+[S,R])([R,R]+[S,S])}/{([R,S]+[S,R])+([R,R]+[S,S])}

Enzymatic Reduction Reaction:

[0060] ##STR00028##

[0061] Step 1: the reaction was carried out in 1 L flask, the reaction system was controlled as 300 mL, and 260 mL of sterilized potassium phosphorus buffer solution was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell crushing enzyme solution in the flask. Glucose dehydrogenase was put in, and cells was broken by ultrasound for 50 min. And then adding 25 g of glucose, 0.42 g of NADP+, and then weighing 8 g of the reactant, and dissolving it in 40 mL of DMSO. The demilitarized DMSO solution with substrates was slowly poured into the shaking bottle, and after 2 h of the reaction, 12 g of glucose was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 75 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 37 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h. The conversion rate of the target product was 97.8%.

[0062] Step 2: The conversion liquid of the target product obtained in step 1 was purified. Add a constant volume of ethyl acetate to the reaction system, then extract at 37 C. for 15 min, repeat for 3 times, collect the ethyl acetate layer by centrifugation, add 5% anhydrous magnesium sulfate to the collected ethyl acetate layer and shake for 15 min, then filter to remove magnesium sulfate. Then the dehydrated ethyl acetate layer was concentrated at high temperature and reduced pressure, and the target product was 7.41 g, with a de value of 96.2% and an ee (anti) value of 99.5%.

Example 4

[0063] ##STR00029##

[0064] Adding compound B with a solid form (R.sub.1 is benzoyl) (20.00 g) to a 500 ml dry clean four-neck round bottle, then toluene was added, the reaction was stirred. Vacuum replacement under nitrogen protection and cooling under nitrogen protection. Toluene was added to the constant pressure drop funnel under nitrogen protection. 70% Red-A1 solution (26.50 g, 26.00 ml) was added to the constant pressure drop funnel under nitrogen protection. When the reaction solution cool to 1510 C., drop Red-A1 solution, control the temperature, after dripping to keep temperature. Add pure water and ethyl acetate to the four-neck round bottle of 1000 ml in turn. Add sulfuric acid to the four four-neck round bottle of 1000 ml in the stirring state, cool them down and keep them warm. Drop the reaction liquid into the sulfuric acid solution. Control the solution at 0-10 C., after dripping to add ethyl acetate to stir. Add 10% sodium bicarbonate solution to the clean 1000 ml four-neck round bottle, cool it down, stop stirring, the reaction liquid was layered statically, and the upper organic layer was transferred to 10% sodium bicarbonate solution for stirring. Lower water layer was added the ethyl acetate to extract, stand for layered, then water layer was abandoned. Secondary ethyl acetate layer together into 10% sodium bicarbonate in aqueous solution was mixed. Then stir, control the temperature and layered. The alkaline water layer was added the ethyl acetate to extract, stir and control the temperature. Treatment of the caustic wash organic layer of pure water with washing stir, control the temperature and layered. The water layer with ethyl acetate to continue to extract, stand for layered, abandon the water layer, combine the organic phase. Added sodium sulfate to dry, filtration of the suction, evaporation of ethyl acetate, giving 17 g of product, yield of 84.33%.

Example 5

[0065] ##STR00030##

[0066] Methanol (10.00 ml) and compound C (R.sub.1 is benzoyl) (1.00 g) were added to the reaction bottle in turn. The reaction solution was cooled to 155 C., and sodium hydroxide solution (10.00 ml) was dropped. After the addition, the mixture was kept at a constant temperature and stirred until the reaction was complete. Then 10% sulfuric acid solution (4.00 g) was added. After the dripping, the reaction continued for keeping temperature, and then saturated sodium carbonate solution was added to adjust the pH. After the reaction solution was heated and decompressed by distillation to remove methanol, methyl tert-butyl ether was added to extract the organic layer, and then sodium chloride was added. Then the water layer was extracted by dichloromethane. The water layer was separated for recovery, and the organic layer was reduced by vacuum distillation to remove dichloromethane. The product was obtained for 0.38 g and the yield was 73.77%.

Example 6

[0067] ##STR00031##

[0068] The preparation of the enzyme is the same as in example 3.

[0069] Step 1: the reaction was carried out in 5 L flask, the reaction system was controlled as 2 L, and 1.7 L of sterilized potassium phosphorus buffer solution was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell in the flask. Glucose dehydrogenase was put in, and cells was broken by ultrasound for 50 min. And then adding 25 g of glucose, 0.42 g of NADP+, and then weighing 80 g of the reactant, and dissolving it in 300 mL of DMSO. The demilitarized DMSO solution with substrates was slowly poured into the shaking bottle, and after 2 h of the reaction, 12 g of glucose was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 75 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 37 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h. The conversion rate of the target product was 97.8%.

[0070] Step 2: Purification of product from step 1 which contain intermediate compound of formula VIII. Purification steps refer to example 3. The target product was 77.1 g, with a de value of 95.3% and an ee(anti) value of 99.6%.

Example 7

[0071] ##STR00032##

[0072] Step 1: the reaction was carried out in 1 L flask, the reaction system was controlled as 300 mL, and 250 mL of deionized water was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell in the flask. glucose dehydrogenase was put in, And then adding 10 ml of glucose(2.5 mol/L), 0.26 g of NADP+, and then weighing 10 g of the reactant, and dissolving it in 30 mL of butyl acetate. The butyl acetate solution with substrates was slowly poured into the shaking bottle, and after 1 h of the reaction, 10 mL of glucose (2.5 mol/L) was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 75 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 37 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h. The conversion rate of the target product was 97.8%.

[0073] Step 2: The conversion liquid of the target product obtained in step 1 was purified. Add a constant volume of ethyl acetate to the reaction system, then extract at 37 C. for 15 min, repeat for 3 times, collect the ethyl acetate layer by centrifugation, add 5% anhydrous magnesium sulfate to the collected ethyl acetate layer and shake for 15 min, then filter to remove magnesium sulfate. Then the dehydrated ethyl acetate layer was concentrated at high temperature and reduced pressure, and the target product was 9.55 g, with a de value of 99.1% and an ee(anti) value of 99.7%. 1H NMR (600 MHz, CDCl.sub.3) 2.2692.301 (m, 1H, J=6 Hz), 2.3672.404 (m, 1H), 2.9542.993 (m, 1H, J=6 Hz), 3.4383.466 (m, 1H), 3.5203.549 (m, 1H), 4.2274.269 (m, 1H), 4.298 4.326 (m, 1H), 4.3914.420 (m, 1H). MS(ESI): m/z 210.03 [M+H].sup.+

Example 8

[0074] ##STR00033##

[0075] Step 1: the reaction was carried out in 5 L flask, the reaction system was controlled as 2 L, and 1.5 L of deionized water was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell in the flask. glucose dehydrogenase was put in, And then adding 10 ml of glucose(2.5 mol/L), 3 g of NADP+, and then weighing 100 g of the reactant, and dissolving it in 300 mL of butyl acetate. The butyl acetate solution with substrates was slowly poured into the shaking bottle, and after 1 h of the reaction, 100 mL of glucose (2.5 mol/L) was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 100 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 28 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h. The conversion rate of the target product was 97.8%.

[0076] Step 2: Purification of product from step 1 which contain intermediate compound of Formula VIII. Purification steps refer to example 3. The target product was 9.42 g, with a de value of 96.9% and an ee(anti) value of 99.4%.

Example 9

[0077] ##STR00034##

[0078] Step 1: the reaction was carried out in 1 L flask, the reaction system was controlled as 300 mL, and 250 mL of deionized water was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire in the flask. glucose dehydrogenase was put in, And then adding 10 ml of glucose(2.5 mol/L),0.26 g of NADP+, and then weighing 10 g of the reactant, and dissolving it in 30 mL of butyl acetate. The butyl acetate solution with substrates was slowly poured into the shaking bottle, and after 1 h of the reaction, 10 mL of glucose (2.5 mol/L) was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 75 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 37 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h. The conversion rate of the target product was 97.8%.

[0079] Step 2: Purification of product from step 1 which contain intermediate compound of Formula VIII. Purification steps refer to example 3. The target product was 9.37 g, with a de value of 97.1% and an ee(anti) value of 99.5%.

Example 10

[0080] ##STR00035##

[0081] Step 1: the reaction was carried out in 5 L flask, the reaction system was controlled as 2 L, and 1.6 L of deionized water was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell in the flask. glucose dehydrogenase was put in, And then adding 100 ml of glucose(2.5 mol/L),0.25 g of NADP+, and then weighing 100 g of the reactant, and dissolving it in 200 mL of butyl acetate. The butyl acetate solution with substrates was slowly poured into the shaking bottle, and after 1 h of the reaction, 100 mL of glucose (2.5 mol/L) was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 50 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 25 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h. The conversion rate of the target product was 97.8%.

[0082] Step 2: Purification of product from step 1 which contain intermediate compound of Formula VIII. Purification steps refer to example 3. The target product was 93.1 g, with a de value of 95.6% and an ee(anti) value of 99.6%.

Example 11: Control Experiment

[0083] ##STR00036##

[0084] Step 1: the reaction was carried out in 1 L flask, the reaction system was controlled as 300 mL, and 250 mL of deionized water was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell in the flask. The encoding sequence of aldehyde/ketone reductase gene used in the entire cell of the engineered bacteria is as shown in the sequence published in EP2634180 of the European patent (SEQ ID NO 12 in EP2634180 of the patent). The sequence was synthesized by total gene synthesis (commissioned by GenScript Co., Ltd.). Preparation steps refer to example 3. glucose dehydrogenase was put in, And then adding 10 ml of glucose(2.5 mol/L),0.26 g of NADP+, and then weighing 10 g of the reactant, and dissolving it in 30 mL of butyl acetate. The butyl acetate solution with substrates was slowly poured into the shaking bottle, and after 1 h of the reaction, 10 mL of glucose (2.5 mol/L) was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 75 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 37 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h.

[0085] Step 2: Purification steps refer to example 3. The target product was 8.11 g, with a de value of 85.1% and an ee(anti) value of 93.3%.

Example 12: Control Experiment

[0086] ##STR00037##

[0087] Step 1: the reaction was carried out in 1 L flask, the reaction system was controlled as 300 mL, and 250 mL of deionized water was used to suspended aldehyde/ketone reductase gene-engineered bacteria entire cell of Saccharomyces kudriavzevii in the flask. The encoding sequence of aldehyde/ketone reductase gene used in the entire cell of the engineered bacteria is as shown in the sequence published in SEQ ID NO 3. (The coding sequence of aldehyde/ketone reductase gene has not been artificially designed) The sequence was synthesized by total gene synthesis (commissioned by GenScript Co., Ltd.). Preparation steps refer to example 3. glucose dehydrogenase was put in, And then adding 10 ml of glucose(2.5 mol/L),0.26 g of NADP+, and then weighing 10 g of the reactant, and dissolving it in 30 mL of butyl acetate. The butyl acetate solution with substrates was slowly poured into the shaking bottle, and after 1 h of the reaction, 10 mL of glucose (2.5 mol/L) was added to the solution. The entire cell volume of aldehyde/ketone gene engineering bacteria was 75 g/L, and the input volume of glucose dehydrogenase was 25 mg/L. The temperature is 37 C.; The conversion reaction was carried out in a shaker, whose rotating speed was controlled at 200 r/min, and the conversion time was 12 h.

[0088] Step 2: Purification steps refer to example 3. The target product was 7.73 g, with a de value of 79.6% and an ee(anti) value of 88.7%.

TABLE-US-00001 NucleotideSequenceTable SerialnumberofSEQIDNO1are: MetSerAspLeuPheLysProAlaProGluProProThrGluLeuGly ArgLeuArgValLeuSerLysThrAlaGlyIleArgValSerProLeu IleLeuGlyGlyAlaSerIleGlyAspAlaTrpSerGlyPheMetGly SerMetAsnLysGluGlnAlaPheGluLeuLeuAspAlaPheTyrGlu AlaGlyGlyAsnCysValAspThrAlaAsnSerTyrGlnAsnGluGlu SerGluIleTrpIleGlyGluTrpMetLysSerArgLysLeuArgAsp GlnIleValIleAlaThrLysPheThrGlyAspTyrLysLysTyrGlu ValGlyGlyGlyLysSerAlaAsnTyrCysGlyAsnHisLysHisSer LeuHisValSerValArgAspSerLeuArgLysLeuGlnThrAspTrp IleAspIleLeuTyrValHisTrpTrpAspTyrMetSerSerIleGlu GluValMetAspSerLeuHisIleLeuIleGlnGlnGlyLysValLeu TyrLeuGlyValSerAspThrProAlaTrpValValSerAlaAlaAsn AsnTyrAlaThrSerHisGlyLysThrProPheSerIleTyrGlnGly LysTrpAsnValLeuAsnArgAspPheGluArgAspIleIleProMet AlaArgHisPheGlyMetAlaLeuAlaProTrpAspValMetGlyGly GlyLysPheGlnSerLysLysAlaMetGluGluTrpLysLysAsnGly GluGlyLeuArgThrAlaValGlyGlyProGluGlnThrGluLeuGlu ValLysIleSerGluAlaLeuAsnLysIleAlaGluGluHisGlyThr GluSerValThrAlaIleAlaIleAlaTyrValArgSerLysAlaLys AsnValPheProLeuValGlyGlyArgLysIleGluHisLeuLysGln AsnIleGluAlaLeuSerIleLysLeuThrProGluGlnIleGluTyr LeuGluSerIleValThrPheAspValGlyPheProLysSerAsnIle GlyAspAspProAlaValThrLysLysLeuSerProLeuThrSerMet SerAlaArgIleSerPheAspAsn SerialnumberofSEQIDNO2are: atgagcgatctgtttaaaccggcgccggaaccgccgaccgaactgggccgcctgcgcgtg60 ctgagcaaaaccgcgggcattcgcgtgagcccgctgattctgggcggcgcgagcattggc120 gatgcgtggagcggctttatgggcagcatgaacaaagaacaggcgtttgaactgctggat180 gcgttttatgaagcgggcggcaactgcgtggataccgcgaacagctatcagaacgaagaa240 agcgaaatttggattggcgaatggatgaaaagccgcaaactgcgcgatcagattgtgatt300 gcgaccaaatttaccggcgattataaaaaatatgaagtgggcggcggcaaaagcgcgaac360 tattgcggcaaccataaacatagcctgcatgtgagcgtgcgcgatagcctgcgcaaactg420 cagaccgattggattgatattctgtatgtgcattggtgggattatatgagcagcattgaa480 gaagtgatggatagcctgcatattctgattcagcagggcaaagtgctgtatctgggcgtg540 agcgataccccggcgtgggtggtgagcgcggcgaacaactatgcgaccagccatggcaaa600 accccgtttagcatttatcagggcaaatggaacgtgctgaaccgcgattttgaacgcgat660 attattccgatggcgcgccattttggcatggcgctggcgccgtgggatgtgatgggcggc720 ggcaaatttcagagcaaaaaagcgatggaagaatggaaaaaaaacggcgaaggcctgcgc780 accgcggtgggcggcccggaacagaccgaactggaagtgaaaattagcgaagcgctgaac840 aaaattgcggaagaacatggcaccgaaagcgtgaccgcgattgcgattgcgtatgtgcgc900 agcaaagcgaaaaacgtgtttccgctggtgggcggccgcaaaattgaacatctgaaacag960 aacattgaagcgctgagcattaaactgaccccggaacagattgaatatctggaaagcatt1020 gtgacctttgatgtgggctttccgaaaagcaacattggcgatgatccggcggtgaccaaa1080 aaactgagcccgctgaccagcatgagcgcgcgcattagctttgataactaa1131 SerialnumberofSEQIDNO3are: atgtctgatgtatttggacctgcacctgaaccacctaccgagttaggacgtctaagagtt60 ctctctaaaacagctggtataagagtctctccgctaatattgggaggtatgtcgattggt120 gacgcctggtcaggattcatggggtcaatgaacaaggagcgggcttttgagctgcttgat180 gccutttcgaggcaggtggaaacttcattgatactgcaaataattaccaaaatgaacag240 tcagaggcatggataggtgaatggatggtttcaagaaaattgcgtgaccaaattgttatt300 gccaccaaattcaccacagactataagaagtatgaagtgggcaagggcagaagtgccaac360 ttctgtggtaatcacaagcatagtttacacgtaagtgtgagagattctcttcgcaaattg420 cagactgattggattgacattctctatgttcactggtgggattatatgagttcgatcgag480 gaagttatggatagtctgcatattcttgtgcagcagggcaaggtcctctacctgggagta540 tctgatacacctgcatgggtcgtgtctgctgcaaattactacgctacctctcacgggaaa600 actcccttcagcatctatcaaggtaaatggaatctgttgaatagggactttgagcgtgaa660 attattccaatggctaggcattttggtatggctctcgctccatgggatgtcatgggaggg720 ggaagatttcagagcaaaaaagctttagaagaacggaagaagagtggagagggcctgcgt780 agctttgttggtacatctgaacagacggatgcagaggttaagatcagcgaggcattgtcg840 aaggttgctgaggaacatggcattgagtctgtcacagctattgccattgcctatgtccgc900 tccaaagcgaagcatgttttcccattggttggaggaaggaaaattgagcacctcaaacaa960 aatattgaggcgttgagtattaaattgacaccaggacagatagaatatctagaaagcatt1020 gtcccattcgatgttgggttccctagcaatttcatcggagatgatcctgcagttactaag1080 aaacttgcattccttccagcaatgtctgccaagattgcttttgacgattag1131