METHOD AND KIT FOR WHOLE GENOME AMPLIFICATION AND ANALYSIS OF TARGET MOLECULES IN A BIOLOGICAL SAMPLE

Abstract

There is disclosed a method for whole genome amplification and analysis of multiple target molecules in a biological sample including genomic DNA and target molecules comprising the steps of contacting the biological sample with at least one binding agent, directed to at least one of the target molecules, conjugated with a tagged oligonucleotide, which comprises a binding-agent barcode sequence (BAB) and a unique molecular identifier sequence (UMI); carrying out a separating step to selectively remove unbound binding agent thus obtaining a labeled biological sample; simultaneously carrying out on the labeled biological sample a whole genome amplification and an amplification of the tagged oligonucleotide; preparing a massively parallel sequencing library from the amplified tagged oligonucleotide; sequencing the massively parallel sequencing library; retrieving the sequences of the BAB and UMI from each sequencing read; counting the number of distinct UMI for each binding agent.

Claims

1.-24. (canceled)

25. A method for whole genome amplification and analysis of multiple target molecules in a biological sample including genomic DNA and target molecules comprising the steps of: a) providing the biological sample; b) contacting the biological sample with at least one binding agent, which is directed to at least one of the target molecules, conjugated with a tagged oligonucleotide, the tagged oligonucleotide comprising: i) a payload sequence of nucleic acid (PL) comprising a binding-agent barcode sequence (BAB) and a unique molecular identifier sequence (UMI), and ii) at least one first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS); so that—when at least one target molecule is present in the biological sample—the at least one binding agent binds to the at least one target molecule; c) carrying out a separating step to selectively remove unbound binding agent thus obtaining a labeled biological sample; d) carrying out on the labeled biological sample: a whole genome amplification of said genomic DNA by: i) deterministic restriction-site whole genome amplification (DRS-WGA), or ii) Multiple Annealing and Looping Based Amplification Cycles whole genome amplification (MALBAC), and an amplification of the tagged oligonucleotide conjugated with the at least one binding agent, wherein whole genome amplification and amplification of the tagged oligonucleotide are carried out simultaneously; e) preparing a massively parallel sequencing library from the amplified tagged oligonucleotide; f) sequencing the massively parallel sequencing library; g) retrieving the sequences of the binding-agent barcode sequence (BAB) and unique molecular identifier sequence (UMI) from each sequencing read; h) counting the number of distinct unique molecular identifier sequences (UMI) for each binding agent.

26. The method according to claim 25, wherein the tagged oligonucleotide further comprises at least one second tagged oligonucleotide amplification sequence (3-TOS).

27. The method according to claim 25, wherein said unique molecular identifier sequence (UMI) is a degenerate or semi-degenerate sequence in the range from 10 to 30 nucleotides.

28. The method according to claim 25, wherein the method further comprises a step of isolating a single cell from the biological sample.

29. The method according to claim 28, wherein said step of isolating is performed by sorting cells.

30. The method according to claim 28, wherein said step of isolating is performed by partitioning cells into droplets.

31. The method according to claim 28, wherein said step of isolating is performed after step c) and before step d).

32. The method according to claim 25, further comprising a step of purifying the massively parallel sequencing library before step f).

33. The method according to claim 25, wherein the at least one binding agent is selected from the group consisting of: a) an antibody or fragment thereof, b) an aptamer, c) a small molecule, d) a peptide, and e) a protein.

34. The method according to claim 25, wherein the target molecule is selected from the group consisting of: a) a protein, b) a peptide, c) a glycoprotein, d) a carbohydrate, e) a lipid, and f) a combination thereof.

35. The method according to claim 26, wherein the tagged oligonucleotide comprises from 5′ to 3′ at least: a) the first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS), comprising in turn a 5′ whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH); b) the payload sequence (PL); c) the second tagged oligonucleotide amplification sequence of nucleic acid (3-TOS), comprising in turn a second amplification handle sequence of nucleic acid (2AH) and a 3′ whole genome amplification handle sequence (3-WGAH).

36. The method according to claim 25, wherein the whole genome amplification and the amplification of the tagged oligo are carried out using a single primer.

37. The method according to claim 25, wherein the tagged oligonucleotide comprises from 5′ to 3′ at least: a) the first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS), comprising in turn a 5′ whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH); b) the payload sequence (PL); c) optionally, an annealing sequence (AS); and wherein at least one primer is used for whole genome amplification and amplification of the tagged oligonucleotide and at least one oligonucleotide (E-p) is used for the extension of the tagged oligonucleotide, said at least one oligonucleotide (E-p) comprising from 5′ to 3′ at least: d) the 5′ whole genome amplification handle sequence (5-WGAH); e) spacer sequence (SS); f) a second amplification handle sequence (2AH); and g) a sequence reverse complementary to the annealing sequence (AS-RC) or a sequence reverse complementary to the binding-agent barcode sequence (BAB-RC).

38. The method according to claim 25, wherein the tagged oligonucleotide comprises from 5′ to 3′ at least: a) the first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS) corresponding to a first amplification handle sequence (1AH); b) the payload sequence (PL); c) the second tagged oligonucleotide amplification sequence of nucleic acid (3-TOS) corresponding to a second amplification handle sequence (2AH); and wherein at least one first primer is used for whole genome amplification and at least one second and one third primer are used for the amplification of the tagged oligonucleotides; the at least one second primer having a sequence identical to the first amplification handle sequence (1AH) and the at least one third primer having a sequence reverse complementary to the second amplification handle sequence (2AH-RC).

39. The method according to claim 38, wherein the at least one second primer and at least one third primer are added in step d).

40. The method according to claim 35, wherein said step e) of preparing a massively parallel sequencing library from the amplified tagged oligonucleotide is performed by a PCR reaction using at least one first library primer, comprising a 3′ sequence corresponding to the first amplification handle sequence (1AH), and at least one second library primer comprising a 3′ sequence corresponding to the sequence reverse complementary to the second amplification handle sequence (2AH-RC).

41. A kit for carrying out the method of claim 25 comprising: a) at least one binding agent directed to at least one target molecule in a biological sample conjugated with a tagged oligonucleotide, the tagged oligonucleotide comprising: i) a payload sequence of nucleic acid (PL) comprising a binding-agent barcode sequence (BAB) and a unique molecular identifier sequence (UMI), ii) at least one first tagged oligonucleotide amplification sequence (5-TOS); b) at least one primer for carrying out a whole genome amplification and at least one primer for carrying out an amplification of the tagged oligonucleotide, the at least one primer for carrying out a whole genome amplification and at least one primer for carrying out an amplification of the tagged oligonucleotide having the same sequence.

42. The kit according to claim 41, further comprising an oligonucleotide for extending the tagged oligonucleotide.

43. The kit according to claim 41, wherein the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO:1, the primers for carrying out the amplification of the tagged oligonucleotide are two and have respectively sequence SEQ ID NO:2 and SEQ ID NO:3.

44. The kit according to claim 41, further comprising one or more first library primer/s and one or more second library primer/s.

45. The kit according to claim 44, wherein said first library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:8 to SEQ ID NO:15 and said second library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:16 to SEQ ID NO:27.

46. The kit according to claim 41, wherein the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO:28, and the primer for carrying out the amplification of the tagged oligonucleotide is one and has a sequence corresponding to SEQ ID NO:29.

47. The kit according to claim 46, further comprising one or more first library primer/s and one or more second library primer/s.

48. The kit according to claim 47, wherein said first library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:30 to SEQ ID NO:37 and said second library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:38 to SEQ ID NO:49.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG. 1 shows the general structure of two possible embodiments of a tagged oligonucleotide without (FIG. 1A) or with (FIG. 1B) a 3′ tagged oligo sequence according to the invention. PL=payload sequence; 5-TOS=first tagged oligonucleotide amplification sequence; 3-TOS=second tagged oligonucleotide amplification sequence; UMI=unique molecular identifier sequence; BAB=binding agent barcode sequence.

[0027] FIG. 2 shows a graph that represents tagged oligonucleotide libraries from two distinct tagged oligos, one prone to intramolecular hairpin formation between 5-TOS and 3-TOS at different temperatures (“with hairpin”: Tm=67° C.; “without hairpin”: Tm=45° C.). On the x-axis the expected UMI count, on the y-axis the UMIs counted after sequencing.

[0028] FIG. 3 shows a graph that represents the amplification of oligo mixtures in different quantities with 27 PCR cycles. Each dilution was performed from three independent dilution replicates. On the x-axis the number of distinct UMIs expected to be observed, on the y-axis the experimentally observed UMIs.

[0029] FIG. 4 shows three graphs of amplification of four oligo mixtures with different BAB in different quantities. Each dilution has four data points, one for each oligo. FIG. 4A: performed 23 PCR cycles. FIG. 4B: performed 27 PCR cycles. FIG. 4C: performed 35 PCR cycles. On the x-axis the number of distinct UMIs expected to be observed, on the y-axis the experimentally observed UMIs.

[0030] FIG. 5 shows the structure of an embodiment according to the invention of the tagged oligo with one primer amplification. Additional captions: 5-WGAH=5′ WGA handle sequence; 3-WGAH=3′ WGA handle sequence; 1AH=first amplification handle sequence; 2AH=second amplification handle sequence.

[0031] FIG. 6 shows the structure of another embodiment according to the invention of the tagged oligo with at least a second primer amplification. FIG. 6A: structure of tagged oligo and relative extension oligonucleotide with annealing site corresponding to the BAB. FIG. 6B: structure of tagged oligo and relative extension oligonucleotide with annealing site not corresponding to the BAB. Additional captions: E-p=5′ extension oligonucleotide sequence; SS=spacer sequence; AS=annealing sequence; AS-RC=annealing sequence reverse complement.

[0032] FIG. 7 shows a graph of the in silico prediction of the melting temperature ([Na.sup.+]=150 mM; [Mg.sup.++]=4 mM) of a hairpin induced by 15 nt long complementary sequences located at the end of a ssDNA molecule as a function of molecule length.

[0033] FIG. 8 shows the structure of another embodiment according to the invention of the tagged oligo with an at least a three primer amplification.

[0034] FIG. 9 shows the general scheme for library generation. FIG. 9A: generation of library from tagged oligo according to the embodiment of FIG. 5. FIG. 9B: generation of library from tagged oligo according to the embodiment of FIG. 6A. FIG. 9C: generation of library from tagged oligo according to the embodiment of FIG. 8. Additional caption: 2AH-RC=second amplification handle sequence reverse complement.

[0035] FIG. 10 shows the design of P5-Synth oligo and corresponding library primers disclosed in Example 1.

[0036] FIG. 11 shows the scheme of NGS library generation of Oligo P5-Synth using library primers according to Example 1.

[0037] FIG. 12 shows a scatterplot of PBMC and SK-BR-3 cells stained with Ab-oligo and secondary fluorescent antibodies. On the x-axis the fluorescence levels in the APC channel, which is proportional to the quantity of Ab-oligo tag1, tag2 and tag4. On the y-axis the fluorescence levels in the PE channel, which is proportional to the quantity of Ab-oligo tag3.

[0038] FIG. 13 shows an electropherogram from a library generated from P5-synth tagged oligo from single cells according to Example 1.

[0039] FIG. 14 shows the protein quantification results from single cells processed according to the embodiment of FIG. 8 with tagged oligo amplification after WGA. UMI counts of cytokeratin (FIG. 8A), Her2 (FIG. 8B), CD45 (FIG. 8C) and IgG1 isotype control (FIG. 8D) quantification respectively. On the y-axis the number of UMI, on the x-axis the cell types isolated according to FIG. 9.

[0040] FIG. 15 shows the protein quantification results from single cells processed according to the embodiment of FIG. 8 with tagged oligo amplification during WGA. UMI counts of cytokeratin (FIG. 8A), Her2 (FIG. 8B), CD45 (FIG. 8C) and IgG1 isotype control (FIG. 8D) quantification respectively. On the y-axis the number of UMI, on the x-axis the cell types isolated according to FIG. 9.

[0041] FIG. 16 shows the design of P5-Lib1 oligo and corresponding library primers disclosed in Example 3.

[0042] FIG. 17 shows the scheme of NGS library generation of P5-Lib1 oligo using library primers.

[0043] FIG. 18 shows examples of LowPass profiles for CNA analysis obtained from a single cell. FIG. 18A: single cell CNA profiles that was spiked with P5-Lib1 oligo and processed according to the embodiment of FIG. 5. FIG. 18B: single cell CNA profiles that was spiked with P5-Synth oligo and processed according to the embodiment of FIG. 8. FIG. 18C: single cell CNA profiles without tagged oligo spiking. All profiles correspond to SK-BR-3 cell with typical gain and losses. Small variations are due to single cell genomic heterogeneity.

[0044] FIG. 19 shows a graph representing tagged oligo libraries obtained from single cells spiking with P5-Synth and P5-Lib1. On the x-axis the expected UMI count, in the y-axis the UMIs counted after sequencing.

DEFINITIONS

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although many methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, preferred methods and materials are described below. Unless mentioned otherwise, the techniques described herein for use with the invention are standard methodologies well known to persons of ordinary skill in the art.

[0046] By “ab-oligo mix” there is intended a solution containing all ab-oligos that target a cell's internal (namely “internal ab-oligo mix”) and/or external (namely “external ab-oligo mix”) epitopes and/or isotypic control ab-oligos.

[0047] By “antibody-oligonucleotide conjugate” or “ab-oligo conjugate” or “ab-oligo” there are intended synthetic molecules derived by the chemical conjugation of an antibody molecule with ssDNA oligonucleotide molecules. Chemical conjugation is usually performed using specific chemical reactions that enable the linking of the two molecules in a covalent manner. The antibody:oligonucleotide stoichiometry can be controlled in order to have a specified ratio. During WGA initial steps, the antibody moiety is usually digested and only the oligonucleotide part remains. For the sake of simplicity, in the description these molecules will still be referred to as ab-oligo molecules or ab-oligo amplicons.

[0048] By the acronym “APC” there is intended the fluorophore allophycocyanin.

[0049] By “binding agent barcode sequence (BAB)” there is intended a unique DNA oligonucleotide sequence that identifies the binding agent.

[0050] By “balanced PCR amplification” there is intended the feature of a PCR to perform an amplification of multiple targets whereby, in each PCR cycle, substantially every target molecule is amplified.

[0051] By “binding agent” there is intended a molecule (such as, byway of a non-limiting example, antibodies, affibodies, ligands, aptamers, synthetic binding proteins, small molecules) able to specifically bind designated target molecules, for example proteins or glycosylated proteins or phosphorylated proteins.

[0052] By “CITE-Seq” or “Cellular Indexing of Transcriptomes and Epitopes by Sequencing” there is intended the method developed by Stoeckius et al. for simultaneous protein quantification and mRNA sequencing in single-cells.

[0053] By “CyTOF” or “cytometry by time of flight” there is intended an equipment carrying out mass-cytometry technique, enabling the quantification of proteins in single cells using mass spectrometry in combination with cytometry. Cells are stained with binding agents conjugated with heavy metal isotopes.

[0054] By the term “conjugate” there is intended a molecule obtained from the covalent conjugation of a binding agent and a tagged oligonucleotide.

[0055] By “copy number alteration (CNA)” there is intended a somatic change in copy-numbers of a genomic region, defined in general with respect to the same individual genome.

[0056] By “DNA library purification” there is intended a process whereby the DNA library material is separated from unwanted reaction components such as enzymes, dNTPs, salts and/or other molecules which are not part of the desired DNA library. Examples of DNA library purification processes are purification with Agencourt AMPure, or Merck Millipore Amicon spin-columns or solid-phase reversible immobilization (SPRI)-beads such as from Beckman Coulter.

[0057] By “DNA library quantification” there is intended a process whereby the DNA library material is quantified. Example of DNA library quantification processes are quantification using QuBit technology, electrophoretic assays (Agilent Bioanalyzer 2100, Perkin Elmer LabChip technologies) or RT-PCR PicoGreen system (Kapa Biosystems).

[0058] By “dynamic range” there is intended the ratio between the largest and smallest values that a certain quantity can assume.

[0059] By “library primers” there is intended ssDNA molecules that act as primers in order to generate massively-parallel sequenceable libraries from tagged oligonucleotides.

[0060] By “low-pass whole genome sequencing” or “lowpass sequencing” there is intended a whole genome sequencing at mean sequencing depth lower than 1.

[0061] By “massive-parallel sequencing” or “next generation sequencing (NGS)” there is intended a method of sequencing DNA comprising the creation of a library of DNA molecules spatially and/or time separated, clonally sequenced (with or without prior clonal amplification). Examples include Illumina platform (Illumina Inc), IonTorrent platform (ThermoFisher Scientific Inc), Pacific Biosciences platform, MinIon (Oxford Nanopore Technologies Ltd).

[0062] By “Multiple Annealing and Looping Based Amplification Cycles (MALBAC)” there is intended a quasilinear whole genome amplification method (Zong et al., 2012, Genome-wide detection of single-nucleotide and copy-number variations of a single human cell, Science. December 21; 338(6114):1622-6. doi: 10.1126/science.1229164.). MALBAC primers have an 8 nucleotide 3′ random sequence to hybridize to the template, and a 27 nucleotides 5′ common sequence (GTG AGT GAT GGT TGA GGT AGT GTG GAG). After first extension, semiamplicons are used as templates for another extension yielding a full amplicon which has complementary 5′ and 3′ ends. Following few cycles of quasi-linear amplification, full amplicon can be exponentially amplified with subsequent PCR cycles.

[0063] By the term “oligonucleotide” or “oligo” there is intended an oligomeric molecule comprising a sequence of nucleotides such as, by way of non-limiting example, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), locked nucleic acid (LNA), peptide nucleic acid (PNA).

[0064] By “tagged oligonucleotide” or “tagged oligo” there is intended an oligonucleotide molecule (e.g. ssDNA molecule) that is directly conjugated to a binding agent (e.g. a primary antibody). The tagged oligo is used for indirect quantification of the target-molecule (e.g. a protein) which is a ligand for the binding agent.

[0065] By the acronym “PE” there is intended the fluorophore phycoerythrin.

[0066] By “PFA 2%” there is intended a solution at 2% w/v of paraformaldehyde in phosphate buffer saline.

[0067] By “primary WGA DNA library (pWGAlib)” there is intended a DNA library obtained from a WGA reaction.

[0068] By the term “re-amplification” or “re-amp” there is intended a PCR reaction where all or a substantial portion of the primary WGA DNA library is further amplified.

[0069] By “residues” there are intended the amino acid residues present in polypeptide chains in proteins.

[0070] By “sequencing barcode” there is intended a polynucleotide sequence which, when sequenced within one sequencer read, allows to assign that read to a specific sample associated with that barcode.

[0071] By “UMI” or “Unique Molecular Identifier sequence” there is intended degenerate or partially-degenerate (i.e. random or semi-random) oligonucleotide sequences which are virtually unique for each ssDNA or dsDNA molecule.

[0072] By “universal WGA-primer” or “WGA PCR Primer” there is intended the additional oligonucleotide ligated to each fragment generated by the action of the restriction enzyme. Universal WGA-primer are used in DRS-WGA such as Ampli1™ WGA

DETAILED DESCRIPTION OF THE INVENTION

[0073] The method for whole genome amplification and analysis of multiple target molecules in a biological sample including genomic DNA and target molecules according to the present invention comprises the following steps.

[0074] In step a), the biological sample is provided. The biological sample is preferably a single cell, but can also be a sample comprising several cells.

[0075] In step b), the biological sample is contacted with at least one binding agent, which is directed to at least one of the target molecules, conjugated with a tagged oligonucleotide, so that—when at least one target molecule is present in the biological sample—the at least one binding agent binds to the at least one target molecule.

[0076] The binding agent is preferably selected from the group consisting of an antibody or fragment thereof, an aptamer, a small molecule, a peptide, and a protein. The target molecule is preferably selected from the group consisting of a protein, a peptide, a glycoprotein, a carbohydrate, a lipid, and a combination thereof. More preferably, the binding agent is an antibody. Binding agents bind target molecules with specific stoichiometry such as monoclonal antibodies or enzyme substrates, or with unspecified stoichiometry such as polyclonal antibodies or small molecules. The former enable a better quantification of the target with respect to the latter. Binding agents are chemically conjugated to tagged oligos via covalent bond interactions or non-covalent interactions. In the former case, both oligos and binding agents possess reactive moieties which enable reciprocal binding. Binding agent:oligo stoichiometry can be controlled during conjugation procedures.

[0077] A non limiting list of examples of binding-agent/target molecules is reported in the following Table 1.

TABLE-US-00001 TABLE 1 Binding agent(s) Target molecule(s) Antibody or fragment of Antigen, post-translationally antibody such as nanobody or modified proteins, such as Fab phospho-proteins (e.g. pAKT), or acetylated proteins (e.g. Histones) Aptamer Antigen Small molecule a drug Cell surface receptor, channel Peptide protein, enzymes Protein Protein, DNA, RNA

[0078] Oligonucleotides used as tagged oligonucleotides are preferably ssDNA or dsDNA molecules with a chemical modification on the 5′ or 3′ end. This modification is used for the covalent conjugation with the relative binding agent.

[0079] Conjugates formed by the tagged oligos conjugated with the binding agents may target both extra-cellular and intracellular epitopes. “External” and “internal” conjugates can be applied to the biological sample as two separate mixes containing the conjugates at their final staining concentration. Firstly, an external mix is applied to label external epitopes. Secondly, cells are permeabilized using detergents or similar means and an internal mix is applied to the sample to label internal epitopes. Alternatively, external and internal conjugates can be mixed together as well to perform a one-step staining. The final staining concentration varies for each binding agent and must be determined experimentally.

[0080] The tagged oligo sequence is preferably shorter than 300 bases, more preferably shorter than 120 bases to facilitate conjugation with the binding agent and to reduce cost. In a preferred embodiment, the tagged oligo sequence is between 60-80 nucleotides.

[0081] With reference to FIG. 1A, the tagged oligonucleotide comprises: [0082] i) a payload sequence of nucleic acid (PL) comprising a binding-agent barcode sequence (BAB) and a unique molecular identifier sequence (UMI), and [0083] ii) at least one first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS).

[0084] The payload sequence contains the necessary information for target counting.

[0085] The unique molecular identifier sequence (UMI) is preferably a degenerate or semi-degenerate sequence in the range from 10 to 30 nucleotides. Preferably the UMI has a length of at least 10 bases, corresponding to a theoretical 4{circumflex over ( )}10=1,048,576 different combinations, which is enough for most target molecules. For highly abundant target molecules, a longer UMI may be used to increase the possible combinations, such as 12 bases. Using semi-degenerate bases, the possible combination decrease and the UMI length is preferably increased, for example up to 20 or 30 bases. Semi-degenerate UMIs may be advantageously used for introducing reference points which can be used in the read-out to re-align the sequence preventing an overestimation of the distinct UMIs present. The UMI sequence may be located at either the 5′ or the 3′ of the BAB. The UMI sequence is preferentially located just after the Read 1 sequencing primer annealing site to increase the complexity of the first sequenced bases. This is advantageous for Illumina sequencing platforms as initial sequencing steps require high complexity for cluster discrimination. BAB is a fixed sequence for each conjugate molecule. BAB are designed in order to avoid features which may interfere with primary PCR amplification and sequencing steps, such as homopolymers, hairpins, and/or heteroduplex formation [Frank, D. N., 2009, BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing. BMC Bioinformatics, 10, 362. http://doi.org/10.1186/1471-2105-10-362] and are selected from the pool of all possible BAB sequences of a defined length in order to maximize their relative Hamming distance, thus minimizing the possibility that any PCR or sequencing error might lead to an incorrect assignment of the sequenced read. BAB length must be selected based on the number of target molecules to be detected. Preferably the BAB has a length of at least 10 nucleotides, corresponding to theoretical 4{circumflex over ( )}10=1,048,576 different combinations which are reduced to about 2000 possible BAB sequences after applying filters on GC content (for example: [30% . . . 70%]), absence of homopolymers, absence of hairpins and minimum hamming distance (preferably ≥3 nt).

[0086] The first tagged oligonucleotide amplification sequence (5-TOS) is located at the 5′ of the tagged oligo. This sequence is required for tagged oligo amplification and subsequent library generation. Tagged oligo amplification is necessary to avoid any bias due to loss of molecules while processing samples which may hamper proper UMI counting.

[0087] With reference to FIG. 1B, the target oligonucleotide preferably further comprises at least one second tagged oligonucleotide amplification sequence (3-TOS). This sequence is located at the 3′ of the tagged oligo. This sequence is required for tagged oligo amplification and subsequent library generation. Tagged oligo amplification is necessary to avoid any bias due to loss of molecules while processing samples which may hamper proper UMI counting.

[0088] In a preferred embodiment 5-TOS and 3-TOS sequences are designed to avoid the formation of hairpins and other intramolecular stable secondary structures within the amplification temperature range, as they may hamper tagged oligo amplification. FIG. 2 shows a graph that represents tagged oligonucleotide libraries from two distinct tagged oligos, one prone to intramolecular hairpin formation between 5-TOS and 3-TOS at different temperatures (“with hairpin”: Tm=67° C., SEQ ID NO:50, ΔG=−11.15 kcal/mol; “without hairpin”: Tm=45° C., SEQ ID NO:51, ΔG=−1.52 kcal/mol). On the x-axis the expected UMI count, on the y-axis the UMIs counted after sequencing.

[0089] Tagged oligos and their amplification primers are optimized to achieve high sensitivity, extensive dynamic range, balanced PCR amplification and reproducibility.

[0090] In preferred embodiments of the present invention the UMI sequence length was selected (n=10) to quantify targets in the range of 0 to ˜10.sup.6 molecules.

[0091] Dynamic range was characterized by amplification of tagged oligos with a concentration spanning four orders of magnitude (from 10.sup.2 to 10.sup.6 molecules). FIG. 3 shows a graph representing the amplification of oligo mixtures in different quantities with 27 PCR cycles. Each dilution was performed from three independent dilution replicates. On the x-axis the number of distinct UMIs expected to be observed, on the y-axis the experimentally observed UMIs. A highly linear correlation in the range of 10.sup.2 to 10.sup.6 number of molecules between the observed UMIs and expected UMIs prior amplification can be observed.

[0092] Balanced PCR amplification was characterized by performing different cycles of amplification on the same starting sample. As shown in FIGS. 4A and 4B, amplification of the same pool of tagged oligos with a different number of total PCR cycles (respectively 23 and 27 PCR cycles) did not result in a difference in UMIs observed, indicating that the number of PCR cycles does not affect UMI counting.

[0093] Sensitivity was characterized by amplification of a pool of tagged oligos in different quantities (down to 40 molecules). As shown in FIG. 4C, it is possible to quantify down to 10.sup.2 tagged oligo molecules. It should be noted that serial diluted solution experiments are prone to sampling biases due to highly heterogeneous distribution of molecules within the volume and this is especially relevant with very diluted solutions. Thus the limit of quantification observed might be an underestimate related to the experimental setup rather than the limitations of the assay.

[0094] In step c) of the method according to the invention, a separating step is carried out to selectively remove unbound binding agent, thus obtaining a labeled biological sample. The separating step is typically carried out by washing in a suitable buffer solution and collecting the labelled biological sample by centrifugation.

[0095] In step d), a whole genome amplification of said genomic DNA and an amplification of the tagged oligonucleotide conjugated with the at least one binding agent are carried out simultaneously on the labeled biological sample. The whole genome amplification of the genomic DNA is carried out by either deterministic restriction-site whole genome amplification (DRS-WGA), or by Multiple Annealing and Looping Based Amplification Cycles whole genome amplification (MALBAC).

[0096] In step e) a massively parallel sequencing library is prepared from the amplified tagged oligonucleotide. In step f), the massively parallel sequencing library is sequenced.

[0097] In step g), the sequences of the binding-agent barcode sequence (BAB) and unique molecular identifier sequence (UMI) are retrieved from each sequencing read.

[0098] In step h), the number of distinct unique molecular identifier sequences (UMI) is counted for each binding agent.

[0099] Steps e), f), g) and h) will be disclosed in greater detail with reference to specific embodiments later on in the description.

[0100] The above-disclosed method preferably further comprises a step of isolating a single cell from the biological sample. Isolation may be carried out by sorting cells, in particular e.g. using a cell sorter such as DEPArray® NxT (Menarini Silicon Biosystems S.p.A.), or—as an alternative—by partitioning cells into droplets. The step of isolating is preferably performed after step c) and before step d).

[0101] The above-disclosed method preferably comprises a step of purifying the massively parallel sequencing library before step f).

[0102] In more specific terms but with no intent to limit the scope of the present description, the above-disclosed method, also designated as Ampli1 Protein (A1-P), allows the quantification of proteins and whole genome genetic characterization of single cells. Single or multiple proteins quantification in single-cells is achieved using a panel of binding agents (in particular, antibodies (Ab)) conjugated with tagged oligonucleotides. These oligonucleotides are designed to unambiguously identify the conjugated antibody by means of a DNA barcode sequence and to quantify the abundance of the epitope of interest by means of a random or partially degenerate sequence, namely Unique Molecular Identifiers (UMI), which is used for epitope quantification. Biological samples are labeled with one or more Ab-oligo conjugates, each with a unique DNA barcode sequence. Subsequently, single cells or pools of cells can be isolated by different means (i.e DEPArraym N×T system) and their genomic content can be amplified by whole genome amplification (i.e Ampli1™ Whole-Genome-Amplification kit). During the latter step o right after it, tagged oligonucleotides are pre-amplified to avoid any downsampling during NGS library preparation procedure. Specific primers, namely “library primers” are used to generate NGS (Illumina) libraries ready to be sequenced. Tagged Oligonucleotides are designed to be compatible with the Ampli1™ WGA (A1-WGA) workflow, enabling single-cell genetic analyses (for example Ampli1™ LowPass) in parallel with protein quantification using A1-P.

[0103] In the following, three specific embodiments of the present invention are disclosed, which respectively employ a different number of primers for tagged oligo amplification and whole genome amplification.

[0104] In a first preferred embodiment and with reference to FIG. 5, the tagged oligonucleotide comprises from 5′ to 3′ at least:

[0105] a) the first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS), comprising in turn a 5′ whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH);

[0106] b) the payload sequence (PL);

[0107] c) the second tagged oligonucleotide amplification sequence of nucleic acid (3-TOS), comprising in turn a second amplification handle sequence of nucleic acid (2AH) and a 3′ whole genome amplification handle sequence (3-WGAH).

[0108] The 3-WGAH is the reverse complementary sequence of 5-WGAH enabling simultaneous amplification of gDNA and tagged oligonucleotides during whole genome amplification. The 1AH and the 2AH are located at the 5′ and 3′ ends of the payload sequence, respectively, and are used for subsequent library generation. The 1AH and 2AH are preferably designed to avoid stable intramolecular secondary structures, such as hairpins, which may inhibit tagged oligo amplification. Between each aforementioned sequence, fixed sequences may be present.

[0109] The whole genome amplification and the amplification of the tagged oligo are preferably carried out using a single primer.

[0110] In a second preferred embodiment and with reference to FIGS. 6A and 6B, the tagged oligonucleotide comprises from 5′ to 3′ at least:

[0111] a) the first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS), comprising in turn a 5′ whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH);

[0112] b) the payload sequence (PL);

[0113] c) optionally, an annealing sequence (AS).

[0114] At least one primer is used for whole genome amplification and amplification of the tagged oligonucleotide and at least one oligonucleotide (E-p) is used

for the extension of the tagged oligonucleotide, said at least one oligonucleotide (E-p) comprising from 5′ to 3′ at least:

[0115] d) the 5′ whole genome amplification handle sequence (5-WGAH);

[0116] e) a spacer sequence (SS);

[0117] f) a second amplification handle sequence (2AH); and

[0118] g) a sequence reverse complementary to the annealing sequence (AS-RC) or a sequence reverse complementary to the binding-agent barcode sequence (BAB-RC).

[0119] In other words, amplification of the tagged oligo occurs by annealing of E-p to AS located at the 3′ of the tagged oligo (FIG. 6A), by means of an annealing sequence reverse complement (AS-RC), located at the 3′ end of E-p, thus causing within the reaction a 3′ extension of both the tagged oligo and the E-p, generating in turn WGA-primer amplifiable molecules. Alternatively, AS can coincide with the BAB sequence and E-p anneals to the BAB sequence via BAB reverse complement sequence (BAB-RC) as indicated in FIG. 6B. The first option (annealing to AS) has the advantage that a single E-p can be used with any BAB, thus reducing manufacturing costs and protocol complexity. The second option (annealing to BAB) may be advantageously used to normalize the signal deriving from targets having large differences in abundance. This may be achieved, as non-limiting example, by using limiting amounts of primer for potentially highly abundant targets, or using different BAB annealing temperatures, to reduce the amplification of highly abundant tagged oligos. The annealing temperature may be tuned by the BAB length and/or composition.

[0120] After the extension of the tagged oligo and E-p, the WGA primer will perform the amplification of tagged oligos, within the resulting larger molecule. The spacer sequence (SS) increases the length of the amplicons generated by the tagged oligos. The increased fragment length destabilizes intramolecular secondary structures, such as hairpins induced by the fragment's complementary ends, thus decreasing their melting temperature (FIG. 7), favoring the tagged oligo amplification along with the other WGA fragments (M. Zuker. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13), 3406-15, (2003)). The extension oligonucleotide (E-p) sequence length is preferably within the range 60-300 bases. More preferably the extension oligonucleotide (E-p) sequence length is within the range 120-200 bases.

[0121] In a third preferred embodiment and with reference to FIG. 8, the tagged oligonucleotide comprises from 5′ to 3′ at least: [0122] a) the first tagged oligonucleotide amplification sequence of nucleic acid (5-TOS) corresponding to a first amplification handle sequence (1AH); [0123] b) the payload sequence (PL); [0124] c) the second tagged oligonucleotide amplification sequence of nucleic acid (3-TOS) corresponding to a second amplification handle sequence (2AH).

[0125] At least one first primer is used for whole genome amplification and at least one second and one third primer are used for the amplification of the tagged oligonucleotides, the at least one second primer having a sequence identical to the first amplification handle sequence (1AH) and the at least one third primer having a sequence reverse complementary to the second amplification handle sequence (2AH-RC).

[0126] Tagged oligo amplification primers are designed to have a melting temperature that is compatible with at least the first 10-15 cycles of the WGA PCR thermal profile.

[0127] Preferably, the at least one second primer and at least third primer are added in step d).

[0128] Step e) of preparing a massively parallel sequencing library from the amplified tagged oligonucleotide is preferably performed by a PCR reaction using at least one first library primer, comprising a 3′ sequence corresponding to the first amplification handle sequence (1AH) and at least one second library primer comprising a 3′ sequence corresponding to the sequence reverse complementary to the second amplification handle sequence (2AH-RC).

[0129] Library primers are therefore advantageously used to generate NGS libraries for binding agent quantification analysis with a single PCR step. The specific examples of library primers reported in the present description are used to generate libraries compatible with the Illumina sequencing platform, without this intending to limit the scope of invention of the present invention.

[0130] In a preferred embodiment forward and reverse primers are designed on the basis of Illumina adapters (Illumina), comprising from 5′ to 3′:

[0131] 1) an Illumina adapter sequence (IA): required for Illumina sequencing; [0132] an Index sequencing primer/flow cell binding sequence: this region is required for flow cell binding, as well as annealing sequence for i5/i7 index sequencing primers; [0133] i5/i7 indexes: indexes used for NGS multiplexing reaction; [0134] a Read 1/read 2 sequencing primer: annealing sequence for Illumina sequencing primers, as well as for the amplification of the library from tagged oligos.

[0135] 2) A first amplification handle sequence (1AH) or a sequence reverse complementary to the second amplification handle sequence (2AH-RC): these sequences anneal with the reverse complement of the first amplification handle sequence and with the second amplification handle sequence, respectively, on the tagged oligo, which are double stranded following tagged oligo amplification.

[0136] FIG. 9 shows the structure of the library primers used for the generation of a massively parallel sequencing library from the amplified tagged oligonucleotides respectively in the embodiment according to FIG. 5 (FIG. 9A), FIG. 6A (FIG. 9B) and FIG. 8 (FIG. 9C).

[0137] After the generation of the library, at least one purification step is preferably performed, followed by library quantification and pooling necessary for the subsequent sequencing procedure. Sequencing is preferentially performed as paired-end sequencing and two reads, each deriving from a strand of the library DNA molecule, are generated.

[0138] The same approach can be used to produce NGS libraries for other sequencing platforms, such as for example Ion Torrent.

[0139] Analysis of the paired-end read sequences generated from the NGS libraries are analysed according to the following steps:

[0140] 1. sub-sequences extraction. Sub-sequences corresponding to UMI, BAB and amplification handle sequence/s (1AH and/or 2AH) are extracted from both sequencing reads for each tagged oligo molecule.

[0141] 2. Read re-alignment. In case sub-sequences of BAB and/or amplification handle sequence/s do not match reference sequences (with a tolerance of 0.5-2 mismatches every 5 bases), sub-sequences position is offset by a variable amount, ranging from −n to +n, where n is the maximum offset allowed (for example n=8) and sub-sequences are re-extracted. For each iteration the Hamming distance from reference sequences is calculated and the offset returning the lowest distance is selected and all sub-sequences (UMI, BAB, amplification handle sequences) are extracted.

[0142] 3. Reads filtering. Reads the BAB and/or handle sub-sequences of which differ from reference sequences more than a defined amount of bases are discarded as low quality reads.

[0143] 4. UMI determination. UMI sequences from read pairs are expected to be perfectly complementary in the absence of sequencing errors. In the presence of any differences between the first strand UMI and second strand complementary UMI sequences:

[0144] a. the read pair may be discarded as low confidence or

[0145] b. a consensus between the two sequences can be calculated by selecting, for each position of the UMI, the base, among the sequences from the two sequencing reads, which have the highest base calling score as reported by the sequencer base caller.

[0146] It should be noted that the first method (a) is less prone to lead to an overestimation of target molecules due to sequencing biases but may lose true binding events between the binding agent and the target molecule, which are instead recovered with the second method (b).

[0147] 5. Target molecules quantification. Counting of target molecules is performed by determining the number of distinct UMI sequences for each BAB sequence, representing a specific binding agent, in the analyzed sample.

[0148] A kit according to the present invention comprises:

[0149] a) at least one binding agent directed to at least one target molecule in a biological sample conjugated with a tagged oligonucleotide, the tagged oligonucleotide comprising: [0150] i) a payload sequence of nucleic acid (PL) comprising a binding-agent barcode sequence (BAB) and a unique molecular identifier sequence (UMI), [0151] ii) at least one first tagged oligonucleotide amplification sequence (5-TOS);

[0152] b) at least one primer for carrying out a whole genome amplification and at least one primer for carrying out an amplification of the tagged oligonucleotide, the at least one primer for carrying out a whole genome amplification and at least one primer for carrying out an amplification of the tagged oligonucleotide either having the same sequence or having different sequence.

[0153] In a preferred embodiment, the kit comprises an oligonucleotide for extending the tagged oligonucleotide.

[0154] In a preferred embodiment, the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO:1, the primers for carrying out the amplification of the tagged oligonucleotide are two and have respectively sequence SEQ ID NO:2 and SEQ ID NO:3. The kit further preferably comprises one or more first library primer/s and one or more second library primer/s. More preferably, said first library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:8 to SEQ ID NO:15 and said second library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:16 to SEQ ID NO:27.

[0155] In another preferred embodiment, the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO:28, and the oligonucleotide for carrying out the extension of the tagged oligonucleotide is one and has a sequence corresponding to SEQ ID NO:29. The kit preferably further comprises one or more first library primer/s and one or more second library primer/s. More preferably, said first library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:30 to SEQ ID NO:37 and said second library primer/s has/have a sequence selected from the group consisting of SEQ ID NO:38 to SEQ ID NO:49.

EXAMPLES

Example 1

[0156] In this example tagged oligos were designed to perform amplification with the set-up according to FIG. 8, after WGA. The tagged oligos, named “P5-Synth” (SEQ ID NO:1, FIG. 10, NNNNNNNNNN: UMI sequence), were designed to be compatible with the Ampli1™ WGA kit (Menarini Silicon Biosystems). The first amplification handle sequence (1AE) was identical to the last 19 bases of Index 2 (i5) Adapters from Illumina TruSeq DNA and RNA CD Indexes. The second amplification handle sequence (2AH) was generated in silico so as to avoid any intramolecular secondary structures and possible matches on the human genome. The melting temperatures of both amplification handle sequences were designed in order to be similar to that of the WGA primer. Tagged oligo amplification primers (SEQ ID NO:2 and SEQ ID NO:3) were designed according to first and second amplification handle sequences.

[0157] As shown in FIG. 10, the forward library primer was identical to Index 2 (i5) Adapters (Illumina), whereas the reverse library primer was identical to Index 1 (i7) Adapters with the addition of a reverse complementary sequence of second amplification handle sequence. More in detail, FIG. 10 shows the design of P5-Synth oligo and corresponding library primers.

[0158] Oligo P5-Synth (SEQ ID NO:1): the white box indicates the internal domain with the UMI and Binding agent barcode. Grey boxes with black border indicate the first and second amplification handle sequences.

[0159] P5 library primer (SEQ ID NO:8): the forward primer used for NGS library generation. In the grey box the annealing site with Oligo P5-Synth. In the short dashed box the sequencing primer site; in dashed-dotted box the i5 index used for multiplexing sequencing reactions; in the long dashed box the index sequencing primer/flow cell adapter sequence.

[0160] Synth library primer (SEQ ID NO:16): the reverse primer used for NGS library generation. In the grey box the annealing site with Oligo P5-Synth. In the short dashed box the sequencing primer site; in dashed-dotted box the i5 index used for multiplexing sequencing reactions; in the long dashed box the index sequencing primer/flow cell adapter sequence.

[0161] As can be seen in FIG. 11, during library generation the Illumina Index 1 and 2 Adapters are added to the 5′ and 3′ of the tagged oligo respectively.

[0162] In this example tagged oligos were conjugated via a 5′ amino modifier. A C6 or C12 spacer was present between the amine moiety and the 5′ of the oligo to avoid any steric hindrance inhibition effects on subsequent PCR reactions. Antibodies were covalently bound to tagged oligos using amines normally present in the antibody from lysine, glutamine, arginine and asparagine residues, through an amino-reactive reagent. Four Ab-oligos (Table 2) have been generated with the tagged oligos and antibody oligo conjugation was performed by Expedeon Ltd (25 Norman Way, Over, Cambridge CB24 5QE, United Kingdom) with an antibody:tagged oligo stoichiometry of 1:2. Epitope localization: indicates the position respect to the cell membrane.

TABLE-US-00002 TABLE 2 Antibody BindingAgent Epitope Name Antibody Isotype name Barcode localization Ab- anti Pan- Mouse antiCK TACTCATGCT (SEQ Internal oligo Cytokeratin IgG1 ID NO: 4) tag1 Ab- anti Her2 Mouse antiHer2 AGATAGCGCA (SEQ Internal oligo IgG1 ID NO: 5) tag2 Ab- anti CD45 Mouse antiCD45 TCTCTCGCTG (SEQ External oligo IgG2a ID NO: 6) tag3 Ab- IgG1 Mouse IgGlisotype CTGAGTCAGA (SEQ — oligo isotype IgG1 ID NO: 7) tag4 control

[0163] Ab-oligos were used to stain two different types of cell lines. The first cell type was SK-BR-3 cells which are a breast tumor derived cell line which overexpresses cytokeratin and the Her2 protein. The second cell type was Peripheral Blood Mononuclear Cells (PBMCs) which are white blood cells extracted from whole blood which express CD45 and negligible levels of cytokeratin and Her2.

[0164] SK-BR-3 cells (ATCC® HTB-30m, ATCC) were grown in culture according to the manufacturer's procedure. PBMCs were extracted from human blood samples. Both cell types were fixed using PFA 2% according to a customised protocol.

[0165] Cell staining with Ab-oligos was performed on 100,000−50,000 previously fixed and permeabilised cells. Cells were collected by centrifugation at 1000×g, for 5 minutes at RT. Cells were washed with at least 1 mL of Running Buffer (autoMACS Running Buffer, ref. 130-091-221, Miltenyi Biotec) and collected by centrifugation. This last step was repeated two times. External Ab-oligos and their isotype Ab-oligo controls are diluted in 100 μl of Running Buffer down to their working concentration. External Ab-oligo mix (Ab-oligo tag3) was added to cells and incubated 15 minutes at RT. Sample was subsequently washed twice with 1 mL of Running Buffer and collected by centrifugation. Goat anti Mouse IgG2a—PE antibody in 500 μl of Running Buffer was added and incubated for 30 minutes at +4° C. This step enabled the staining of PBMC cells in PE. The sample was washed twice with Running Buffer. Internal Ab-oligos and their isotype Ab-oligo controls are diluted in 200 μl of Inside Perm Buffer (Inside Stain Kit, Ref. 130-090-477, Miltenyi Biotec) down to their working concentrations. Internal Ab-oligo mix (Ab-oligo tag1, 2 and 4) was added to cells and incubated for 10 minutes at RT. Sample was washed twice with 1 mL of Inside Perm Buffer and collected by centrifugation. A mix of Hoechst and Goat anti Mouse IgG1—APC antibody in 500 μl of Inside Perm Buffer was added and incubated for 30 minutes at +4° C. This step enabled the staining of SK-BR-3 cells in PE and all cell nuclei. The sample was washed twice with Running Buffer.

[0166] The addition of secondary antibodies conjugated to fluorophores enabled the identification of SK-BR-3 cells (APC channel) and PBMCs (PE channel) by fluorescence. Moreover the fluorescence levels reflect the relative abundance of Ab-oligo. Single-cells were purified using DEPArray™ N×T system (Menarini Silicon Biosystems) based on their immunofluorescent labeling (FIG. 12).

[0167] Specifically, FIG. 12 shows a scatterplot of the PBMC and SK-BR-3 cells stained with Ab-oligo and secondary fluorescent antibodies. On the x-axis the fluoresce levels in the APC channel, which is proportional to the quantity of Ab-oligo tag1, tag2 and tag4. On the y-axis the fluorescence levels in the PE channel, which is proportional to the quantity of Ab-oligo tag3. The scatterplot has been divided into four quadrants each containing a specific cell type based on their immunofluorescence levels: 1) PBMCs (high level of CD45 and low levels of CK, Her2); 2) double positive cells (high levels of CD45, CK, Her2); 3) double negative cells (low levels of CD45, CK, Her2); 4) SK-BR-3 cells (low level of CD45 and high levels of CK, Her2). Single cells highlighted with empty/filled square/circles were isolated and used for library generation.

[0168] Alternatively, to perform tagged oligo amplification after WGA a customized reaction mix of forward/reverse primers and Ampli1™ PCR kit reagents were prepared according to Table 3, left inset. Added 15 μl of the reaction mix to each tube containing WGA products. Each sample was incubated according to thermal profile indicated in Table 3, right inset.

TABLE-US-00003 TABLE 3 Ampli1 ™ PCR kit Volume reagent name [μl] Stage Temp. Time Cycles PCR reaction buffer 6.5 1 95° C.  3 min 1 (10X) 2 95° C. 30 sec 3 Forward primer (1 μM) 1.3 58° C. 30 sec Reverse primer (1 μM) 1.3 72° C. 10 sec dNTPs 1.3 3 95° C. 30 sec 7 BSA 1.3 60° C. 30 sec Polymerase 0.6 72° C. 10 sec Water 2.7 4 72° C.  1 min 1 5  4° C. ∞ 1

[0169] Left inset: reaction mixture composition of tagged oligo amplification reaction. Right inset: thermal cycling program for the tagged oligo amplification.

[0170] Library preparation was performed by taking an aliquot of 1 μl of WGA containing Ab-oligo amplicons amplified using Ampli1™ PCR kit using P5 and Lib1 library primers at a final concentration of 0.5 μm. PCR thermal cycling profile is indicated in Table 5. Each sample had a different combination of NGS library primers for dual indexing in order to demultiplex data during bioinformatic analysis. The list of the library primers used is reported in Table 4. P5 library primers are forward primers that can be used with tagged oligo P5-Synth.

TABLE-US-00004 TABLE 4 Sequence P5 library primers (5′->3′) [i5] index number SEQ ID NO: AATGATACGGCGACCACCGAGATCTACAC TATAGCCT D501  8 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC ATAGAGGC D502  9 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC CCTATCCT D503 10 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC GGCTCTGA D504 11 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC AGGCGAAG D505 12 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTAGAC TAATCTTA D506 13 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC CAGGACGT D507 14 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC GTACTGAC D508 15 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Sequence Synth library primers (5′->3′) [i7] index number SEQ ID NO: CAAGCAGAAGACGGCATACGAGAT CGAGTAAT D701 16 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT TCTCCGGA D702 17 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT AATGAGCG D703 18 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT GGAATCTC D704 19 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT TTCTGAAT D705 20 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT ACGAATTC D706 21 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT AGCTTCAG D707 22 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT GCGCATTA D708 23 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT CATAGCCG D709 24 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT TTCGCGGA D710 25 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT GCGCGAGA D711 26 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG CAAGCAGAAGACGGCATACGAGAT CTATCGCT D712 27 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG

TABLE-US-00005 TABLE 5 Stage Temperature Time Cycles 1 95° C.  3 min 1 2 95° C. 30 sec 3 60° C. 30 sec 72° C. 10 sec 3 95° C. 30 sec 23-30 65° C. 30 sec 72° C. 10 sec 4 72° C.  1 min 1 5  4° C. ∞ 1

[0171] Thermal cycling profile for NGS library generation. The number of cycles during step 3 vary depending on the number of cells that have been recovered and the effective quantity of total Ab-oligos in cells. Usually 27 amplification cycles at stage 3 resulted in sufficient amplicon quantity from a single cell.

[0172] Library samples were purified using Agencourt AmPure XP beads (Beckman-Coulter). NGS DNA quantification was performed using KARA SYBR® FAST qPCR kit (Kapa Biosystems). Each NGS library was checked using Agilent Bioanalyzer 2100 (Agilent) showing a library electropherogram that was typically composed of a single peak at 185 bp (FIG. 13).

[0173] Samples were pooled together and sequencing was performed on MiSeq system (Illumina) using MiSeq Reagent Kit v3 150-cycle (Ref. MS-102-3001, Illumina). Data analysis was performed using a custom software developed in Python. Quantification of protein targets according to UMIs counting is reported in FIG. 14. As expected SK-BR-3 cells showed high expression of cytokeratin and Her2 and lower levels of CD45, while PBMC showed the opposite behaviour. Protein expression levels were high in double positive cells, especially isotype controls, indicating that such cells were more prone to non specific staining. Conversely double negative cells had lower levels for all four targets.

Example 2

[0174] In this example tagged oligos were designed to perform amplification with the set-up according to FIG. 8, during WGA. The experimental procedure is identical to Example 1 except for the following. Tagged oligo amplification primers were added directly to primary PCR reaction mix at a final concentration of 0.02 μm. Library generation and data analysis were performed as indicated in Example 1.

[0175] Quantification of protein targets according to UMIs counting is reported in FIG. 15. As expected SK-BR-3 cells showed high expression of cytokeratin and Her2 and very low levels of CD45, while PBMC showed the opposite behaviour. Protein expression levels were high in double positive cells, especially isotype controls, indicating that such cells were more prone to non specific staining. Conversely double negative cells had lower levels for all four targets. According to the results from Example 1 it can be inferred that the amplification of tagged oligo is feasible both during or after WGA. However, it has to be noted that the absolute UMI count differs significantly between the two procedures. Differences between the two cell types are more in line to what expected for CD45 target that has lower expression compared to CK, when tagged oligo amplification is performed during WGA.

Example 3

[0176] In this example, tagged oligos were added directly in single cells. The tagged oligos, namely “P5-Lib1” (SEQ ID NO: 28), were designed to be amplifiable by Ampli1™ WGA kit (Menarini Silicon Biosystems). The tagged oligo amplification primer has sequence SEQ ID NO: 29 (forward and reverse primers are identical, sharing the sequence of Ampli1 WGA Lib1 primer). Specifically the 5′-WGA handle sequence was identical to the Lib1 WGA primer, while the 3′-WGA handle sequence was the reverse-complement sequence of the Lib1 WGA primer. The first amplification handle sequences are identical to those described in Example 1. The second amplification handle sequence consists of a 3′-WGA handle sequence and an additional 5 bp sequence at the 5′ end of it (FIG. 16).

[0177] More in detail, FIG. 16 shows the design of P5-Synth oligo and corresponding library primers.

[0178] Oligo P5-Lib1: The white filled box with thick borders indicates the internal domain with the UMI and Binding agent barcode. Grey filled boxes with thick borders indicate the annealing sites for the two library primers. The grey boxes with thin borders are the WGA handle sequences (Lib1).

[0179] P5 library primer: the forward primer used for NGS library generation. In the grey filled box the annealing site with tagged oligo P5-Lib1. In the short dashed box the sequencing primer site; in dashed-dotted box the i5 index used for multiplexing sequencing reactions; in the long dashed box the index sequencing primer/flow cell adapter sequence.

[0180] Lib1 library primer: the reverse primer used for NGS library generation. In the grey filled box the annealing site with tagged oligo P5-Lib1: this sequence is composed of a part of Lib1 reverse complement sequence and a small tail (ACCAC) enabling annealing only to the 3′ end of the Oligo P5-Lib1. In the short dashed box the sequencing primer site; in dashed-dotted box the i5 index used for multiplexing sequencing reactions; in the long dashed box the index sequencing primer/flow cell adapter sequence.

[0181] The forward library primer was identical to Index 2 (i5) Adapters (Illumina), whereas the reverse library primer was identical to Index 1 (i7) Adapters with the addition of a reverse complementary sequence of the second amplification handle sequence (FIG. 16). Therefore, during library generation the Illumina Index 1 and 2 Adapters are added to the 5′ and 3′ of the tagged oligo respectively (FIG. 17).

[0182] SK-BR-3 cells (ATCC® HTB-30™, ATCC) were grown in culture according to the manufacturer's procedure and were fixed using PFA 2% according to a customized protocol. Single-cells were purified using DEPArray™ N×T system (Menarini Silicon Biosystems) based on their morphology. P5-Lib1 and P5-Synth tagged oligos were added directly inside tubes containing single cells. Different quantities of each oligo were added within each single cell and performed Ampli1™ WGA. Samples containing P5-Synth tagged oligos were amplified as in Example 1.

[0183] Tagged oligos library generation was performed by taking an aliquot of 1 μl of WGA containing Ab-oligo amplicons was amplified using Ampli1™ PCR kit using P5 and Lib1 library primers at a final concentration of 0.5 μm. PCR thermal cycling profile is indicated in Table 5. Each sample had a different combination of NGS library primers for dual indexing in order to demultiplex data during bioinformatic analysis. The list of the library primers used is reported in Table 6.

TABLE-US-00006 TABLE 6 Sequence P5 library primers (5′->3′) [i5] index number SEQ ID NO: AATGATACGGCGACCACCGAGATCTACAC TATAGCCT D501 30 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC ATAGAGGC D502 31 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC CCTATCCT D503 32 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC GGCTCTGA D504 33 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC AGGCGAAG D505 34 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTAGAC TAATCTTA D506 35 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC CAGGACGT D507 36 ACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGATACGGCGACCACCGAGATCTACAC GTACTGAC D508 37 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Sequence lib1 library primers (5′->3′) [i7] index number SEQ ID NO: CAAGCAGAAGACGGCATACGAGAT CGAGTAAT D701 38 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC GGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT TCTCCGGA D702 39 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT AATGAGCG D703 40 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT GGAATCTC D704 41 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT TTCTGAAT D705 42 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT ACGAATTC D706 43 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT AGCTTCAG D707 44 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT GCGCATTA D708 45 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT CATAGCCG D709 46 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT TTCGCGGA D710 47 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT GCGCGAGA D711 48 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC CAAGCAGAAGACGGCATACGAGAT CTATCGCT D712 49 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC

[0184] An aliquot of 10 μl WGA samples were purified with SPRI beads (Beckmann Coulter) and subsequently processed with Ampli1™ LowPass kit to generate NGS libraries for CNA analysis. Spiking of tagged oligos in single cell before WGA procedure did not affect downstream genetic analyses (FIG. 18). Tagged oligo that have been designed to fit workflows shown in FIG. 5 and FIG. 8 did not affect or interfere with the WGA procedure. Moreover, it was still possible to obtain NGS libraries from tagged oligonucleotides in both conditions. Both tagged oligonucleotides could be quantified correctly, indicating the robustness of both methodologies, as well as tagged oligo design (FIG. 19).

[0185] Advantages

[0186] The method for whole genome amplification and analysis of multiple target molecules in a biological sample according to the present invention allows to obtain simultaneously analysis of genome-wide copy-number profiles/genome sequence and protein expression on the same single cells.

[0187] The method of the present invention enables to perform whole genome amplification of genomic DNA, useful to enable further analysis such as genome-wide copy number profiling by low-pass sequencing or targeted sequencing of panels of genes of interest, and to detect and perform a digital quantification of a panel of multiple proteins down to single-cell resolution, using very few samples, as it may be the case where only few (down to a single one) circulating tumour cells (CTCs) are available. This is particularly advantageous over measuring each molecular type in different cells in a genetically heterogeneous sample where differences in genotype, phenotype and environment may confound and completely prevent the correlation of genotype (copy number of sequence alterations) with phenotype (protein expression).

[0188] The method according to the invention surprisingly advances the state of the art with performances previously thought unachievable by the skilled in the art, in one or more of the following dimensions, given by way of non-limiting example: [0189] digital quantification of proteins in a single-cell down to hundreds of copies per cell. [0190] thanks to the use of an inherent WGA in the process, the above points are obtained with the further possibility to obtain additional genetic material for investigation of other characteristics of said single-cell, as well as the possibility to reliably reanalyse a single cell for verification, which is not possible with droplet-based approaches such as that proposed by 10× Genomics.

[0191] The primary field of application of the method is oncology, but the method can be applied to other fields such as mosaic disorders such as dermatological or overgrowth phenotypes.