TREATING HEART DISEASE IN MUSCULAR DYSTROPHY PATIENTS
20230047313 · 2023-02-16
Inventors
Cpc classification
A61P25/14
HUMAN NECESSITIES
A61P9/04
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
A61K31/437
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
International classification
A61K31/437
HUMAN NECESSITIES
Abstract
Methods of treating or reducing risk of developing cardiomyopathy or heart failure in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of NADPH oxidase 4 (Nox4).
Claims
1. A method of treating cardiomyopathy or heart failure in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of NADPH oxidase 4 (Nox4).
2. The method of claim 1, wherein the inhibitor is administered daily.
3. The method of claim 1, wherein the inhibitor is selected from the group consisting of GKT137831; GKT136901; GSK2795039; VAS2870; perhexiline; VAS3947; compound 87 (2-(2-chlorophenyl)-5-[(1-methylpyrazol-3-yl)methyl]-4-[[methyl(pyridin-3-ylmethyl)amino]methyl]-1H-pyrazolo[4,3-c]pyridine-3,6-dione); compound 7c (10-benzyl-2-(2-chlorophenyl)-7,8,9,11-tetrahydro-3H-pyrazolo[4,5]pyrido[5,6-a][1,4]diazepine-1,5-dione; APX-115; VAS2870; fulvene-5; grindelic acid; phenantridinones; fluvenazine; DPI; suramin; ebselen; perhexiline; perhenazine; fluphenazine; and tertiary sulfonylureas.
4. The method of claim 1, wherein the subject has a muscular dystrophy.
5. The method of claim 4, wherein the subject has Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy (XL-DCM).
6. The method of claim 1, wherein the subject has sinus tachycardia, atrial arrhythmias, including atrial fibrillation, atrial flutter, atrial tachycardias, and/or left ventricular dysfunction.
7. A method of reducing risk of development of cardiomyopathy or heart failure in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of NADPH oxidase 4 (Nox4).
8. The method of claim 7, wherein the inhibitor is administered daily.
9. The method of claim 7, wherein the inhibitor is selected from the group consisting of GKT137831; GKT136901; GSK2795039; VAS2870; perhexiline; VAS3947; compound 87 (2-(2-chlorophenyl)-5-[(1-methylpyrazol-3-yl)methyl]-4-[[methyl(pyridin-3-ylmethyl)amino]methyl]-1H-pyrazolo[4,3-c]pyridine-3,6-dione); compound 7c (10-benzyl-2-(2-chlorophenyl)-7,8,9,11-tetrahydro-3H-pyrazolo[4,5]pyrido[5,6-a][1,4]diazepine-1,5-dione; APX-115; VAS2870; fulvene-5; grindelic acid; phenantridinones; fluvenazine; DPI; suramin; ebselen; perhexiline; perhenazine; fluphenazine; and tertiary sulfonylureas.
10. The method of claim 7, wherein the subject has a muscular dystrophy.
11. The method of claim 10, wherein the subject has Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy (XL-DCM).
12. The method of claim 11, wherein the subject has DMD and is less than 10-12 years of age.
13. The method of claim 7, wherein the subject has left ventricular (LV) strain defects or myocardial fibrosis, but does not have left ventricular dysfuction.
14.-26. (canceled)
27. A method of treating a subject who has a muscular dystrophy, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of NADPH oxidase 4 (Nox4).
28. The method of claim 27, wherein the inhibitor is administered daily.
29. The method of claim 27, wherein the inhibitor is selected from the group consisting of GKT137831; GKT136901; GSK2795039; VAS2870; perhexiline; VAS3947; compound 87 (2-(2-chlorophenyl)-5-[(1-methylpyrazol-3-yl)methyl]-4-[[methyl(pyridin-3-ylmethyl)amino]methyl]-1H-pyrazolo[4,3-c]pyridine-3,6-dione); compound 7c (10-benzyl-2-(2-chlorophenyl)-7,8,9,11-tetrahydro-3H-pyrazolo[4,5]pyrido[5,6-a][1,4]diazepine-1,5-dione; APX-115; VAS2870; fulvene-5; grindelic acid; phenantridinones; fluvenazine; DPI; suramin; ebselen; perhexiline; perhenazine; fluphenazine; and tertiary sulfonylureas.
30. The method of claim 27, wherein the subject has Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy (XL-DCM).
31. The method of claim 30, wherein the subject has DMD and is less than 10-12 years of age.
32. The method of claim 6, wherein the left ventricular dysfunction comprises left ventricular ejection fraction (LVEF)<35%.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] We have previously identified CIP as a cardiac and skeletal muscle-specifically expressed protein.sup.11, an alternatively spliced isoform of a recently reported protein called MLIP.sup.12,13. We showed that CIP plays a key role in cardiac remodeling in response to pathophysiological stress.sup.14. Clinical investigation further revealed that mutation of the CIP gene was associated with dilated cardiomyopathy.sup.50. Although overexpression of CIP inhibited hypertrophic growth of cardiomyocytes.sup.11, whether CIP is able to inhibit or even reverse cardiac remodeling after cardiac disease has been established remains unanswered. In this study, we show how CIP expression is regulated in cardiomyocytes and diseased human hearts. Furthermore, we demonstrate that CIP inhibits cardiac remodeling and protects the heart from HF after cardiac hypertrophy has been established, providing a proof-of-concept for the clinical potential of CIP in the treatment of cardiac hypertrophy and HF. In addition, we report an important function of CIP in dystrophic cardiomyopathy. Genetic studies show that loss of CIP accelerates the progress of cardiomyopathy and heart failure in mouse models of DMD. Most importantly, overexpression of CIP protects the heart from the development of pathological dystrophic cardiomyopathy in mdx mice. In addition, we show that CIP is a novel regulator of nuclear positioning in mammalian skeletal muscle and plays an important role in skeletal muscle and muscular dystrophy.
[0030] Loss of dystrophin, an important structure protein on the cell membrane of cardiac and skeletal muscles, leading to an increase in the cell permeability, fibrosis and inflammatory response of myocytes, eventually results in loss of myocytes and a decrease of muscle contractility.sup.9, 10, 35-37. This creates substantial challenge for the potential treatment of muscular dystrophy.sup.3, 38, 39. Our study demonstrates that cardiac-expressed CIP ameliorates cardiac function in dystrophic heart, by modulating the expression and function of Nox4 and oxidative stress by regulating the calcineurin-NFAT pathway (
[0031] The pathophysiology and cell biology of muscular dystrophy, including that of cardiomyopathy and heart failure, has been extensively investigated and understood. However, the underlying molecular signature and mechanisms remain to be fully understood. Using unique animal models we have created that exhibit many features of dystrophic cardiomyopathy, our gene expression signature analyses revealed key molecular pathways that are closely associated with the conditions of dystrophic cardiomyopathy. Strikingly, genes related to extracellular matrix are among the most significantly changed in dystrophic hearts, consistent with the view that fibrosis is a “default” end point of dystrophic cardiomyopathy.sup.9, 23, 39, 41. Similarly, we found that genes related to calcium signature are tightly associated with the pathological condition of dystrophic hearts.sup.42. These results enable us to better understand the molecular nature of this disease and provides useful bio-markers for the early diagnosis of dystrophic cardiomyopathy.
[0032] Numerous prior studies have linked the oxidative stress pathway to cardiomyopathy. Increased expression of Nox4, which is a major resource of oxidative response.sup.24, and other oxidative pathway genes was found in Duchenne cardiomyopathy.sup.43-46. Altered Nox2 and Nox4 expression was also associated with other types of cardiomyopathy.sup.47, 48. During cardiac hypertrophy, increased Nox4 expression is associated with apoptosis and defects in mitochondria.sup.49. However, it remains unclear about how Nox4 expression is regulated in dystrophic cardiomyopathy. Our study suggests that mutation in both dystrophin and CIP triggered the calcineurin pathway, activating NFACT, resulting in an increase expression and function of Nox4. Our study also provided direct evidence to demonstrate ectopic overexpression of Nox4 in the heart activates the oxidative stress pathway and leads to cardiomyopathy.
[0033] Previous studies have suggested that in Duchenne muscular dystrophy patients, the pathophysiological mechanisms involved in cardiac myocytes seem to differ significantly from those in skeletal myofibers.sup.9, 10. Intriguingly, we also observed that a skeletal muscle-specific CIP isoform, skCIP, regulates myonuclear positioning in skeletal myoblasts and myotubes, thereby modulating skeletal muscle function and regeneration. Interestingly, we have found that loss of CIP in adult cardiomyocytes also affects the positioning of bi-nuclei, suggesting that CIP may also plays a role in myonuclei positioning in cardiomyocytes. Together, these studies indicate that CIP is a novel regulator of myocyte function, cardiomyopathy and muscular dystrophy. Therefore, our findings indicate that cardiac- and skeletal muscle-specific CIP isoforms participate in the regulation of myocyte function in the heart and skeletal muscle through different mechanisms. Given that a recent study found that human CIP was mutated in patients with dilated cardiomyopathy and heart failure.sup.50, CIP could be a novel target for therapeutic treatment of dystrophic cardiomyopathy.
[0034] As shown herein, deletion of CIP in mdx mouse, a mouse model of DMD disease, caused severe cardiac defects and resulted in severe muscular dystrophy. Conversely, transgenic overexpression of CIP in the heart and skeletal muscle protects the heart from the development of heart failure, demonstrating a beneficial role of CIP in DMD. We have also identified a skeletal much isoform of CIP (skCIP) and found that mutation of CIP leads to defects in myonuclear positioning in skeletal muscle. We identified Nox4 as an important downstream mediator of the CIP function in the heart. When applied Nox4 inhibitor GKT137831 to mdx/CIP-KO mice, we observed that this inhibitor potently prevents the development of heart failure. Together, these studies indicate: 1) CIP is an important regulator of dystrophic cardiomyopathy; 2) CIP is also important for skeletal muscle function; 3) Inhibition of Nox4 using chemical inhibitors could protect the heart from the development of heart failure in dystrophy patients.
[0035] Thus, provided herein are methods for treating or reducing risk of developing cardiomyopathy/heart failure. The methods include administering a therapeutically effective amount of a Nox4 inhibitor. The methods can be used in mammalian subjects, e.g., human or non-human veterinary subjects. In some embodiments, the subjects have muscular dystrophy, e.g., DMD. The methods can include treating subjects who are at risk of, but who do not yet have (e.g., have not yet been diagnosed with or have no symptoms or clinical signs of, e.g., have no or minimal left ventricular dysfunction), dystrophic cardiomyopathy. The methods can also be used to delay or reduce the risk of progression from cardiac hypertrophy to heart failure, i.e., in subjects who already have cardiac hypertrophy.
[0036] Also provided herein are methods for treating or reducing risk of developing skeletal muscle dysfunction, e.g., dystrophy. The methods include administering a therapeutically effective amount of a Nox4 inhibitor. The methods can be used in mammalian subjects, e.g., human or non-human veterinary subjects. In some embodiments, the subjects have muscular dystrophy, e.g., DMD. In some embodiments, the methods reduce weakness or improve strength, or reduce the rate or risk of developing muscle weakness.
[0037] In some embodiments, the methods can include using imaging methods such as echocardiography or cardiovascular magnetic resonance (CMR) to identify a subject who has the earliest signs of cardiac involvement, including left ventricular (LV) strain defects and myocardial fibrosis, which appear before the onset of LV systolic dysfunction (see, e.g., JAMA Cardiol. 2017; 2(2):199. doi:10.1001/jamacardio.2016.4910); Silva et al., JAMA Cardiol. doi:10.1001/jamacardio.2016.4801). In some embodiments, the subject has sinus tachycardia, atrial arrhythmias, including atrial fibrillation, atrial flutter, and atrial tachycardias, with left ventricular ejection fraction (LVEF)<35%. In some embodiments, the subject has cardiac hypertrophy. In some embodiments, the methods include identifying and/or selecting subjects for treatment with a method described herein based on the presence of cardiac involvement or muscular dystrophy.
Nox4 Inhibitors
[0038] The methods described herein include administration of one or more Nox4 inhibitors.
[0039] A number of Nox4 inhibitors are known in the art, including GKT137831 (Setanaxib, Genkyotex); GKT136901; GSK2795039; VAS2870; perhexiline; VAS3947; compound 87 (2-(2-chlorophenyl)-5-[(1-methylpyrazol-3-yl)methyl]-4-[[methyl(pyridin-3-ylmethyl)amino]methyl]-1H-pyrazolo[4,3-c]pyridine-3,6-dione; PMID 20942471); compound 7c (10-benzyl-2-(2-chlorophenyl)-7,8,9,11-tetrahydro-3H-pyrazolo[4,5]pyrido[5,6-a][1,4]diazepine-1,5-dione; Gaggini et al., Bioorg Med Chem. 2011 Dec. 1; 19(23):6989-99); APX-115; VAS2870; fulvene-5; grindelic acid; phenantridinones (Borbély et al., J Med Chem. 2010 Sep. 23; 53(18):6758-62); fluvenazine; DPI; suramin; ebselen; perhexiline; perhenazine; fluphenazine; and tertiary sulfonylureas (23-25) (Xu et al., Bioorg Med Chem. 2018 Mar. 1; 26(5):989-998). See also Reis et al., Redox Biol. 2020 May; 32: 101466; Xu et al., Bioorg Med Chem. 2018 Mar. 1; 26(5):989-998.
Pharmaceutical Compositions and Methods of Administration
[0040] The methods described herein include the use of pharmaceutical compositions comprising or consisting of a Nox4 inhibitor as an active ingredient.
[0041] Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions, in addition to the Nox4 inhibitor, in some embodiments, no other active ingredients are present or used in the compositions or methods described herein.
[0042] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
[0043] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0044] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0045] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0046] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0047] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798.
[0048] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0049] In one embodiment, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to selected cells with monoclonal antibodies to cellular antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0050] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
EXAMPLES
Example 1. Cardiac CIP Protein Ameliorates Dystrophic Cardiomyopathy Methods
[0051] The following materials and methods were used in the following example.
Mice. All experimental procedures involving animals in this study were reviewed and approved by the Institutional Animal Care and Use Committee at the Boston Children's Hospital. CIP-KO and CIP-KI-flox mice were described previously.sup.14 and bred with mdx mice.sup.15. To obtain CIP-OE mice, the CIP-KI-flox mice, which have a Rosa-CIP allele (containing a loxed stop codon) were bled with MCK-Cre mice.sup.16 to excise the stop codon and activate the CIP transgene in the heart and skeletal muscle. Calcineurin transgenic mice (CnA-tg).sup.17 were used in this study. Compound mutant mice on mixed genetic backgrounds were used and all comparisons used littermates as controls.
Measurement of cardiac function by echocardiography. Echocardiographic measurements were performed on mice using a Visual Sonics Vevo® 2100 Imaging System (Visual Sonics, Toronto, Canada) with a 40 MHz MicroScan transducer (model MS-550D). Mice were anesthetized with isoflurane (2.5% isoflurane for induction and 0.1% for maintenance). Heart rate and left ventricular (LV) dimensions, including diastolic and systolic wall thicknesses, LV end-diastolic and end-systolic chamber dimensions were measured from 2-D short-axis under M-mode tracings at the level of the papillary muscle. LV mass and functional parameters such as percentage of fractional shortening (FS %) and ejection fraction (EF %) were calculated using the above primary measurements and accompanying software.
Generation and administration of adeno-associated virus (serotype 9). GPF-tagged mouse CIP cDNA, Flag-tagged mouse Nox4 cDNA and GFP were separately cloned into ITR-containing AAV plasmid (Penn Vector Core P1967) harboring the chicken cardiac TNT promoter, to yield constructs, pAAV9-cTnT-CIP, pAAV9-cTnT-Nox4 and pAAV9-cTnT-GFP, respectively. AAV was packaged using AAV9:Rep-Cap and pAd:deltaF6 (Penn Vector Core) as described.sup.18. AAV9 was packaged in 293T cells with AAV9:Rep-Cap and pAd deltaF6, then purified and concentrated by gradient centrifugation. AAV9 titer was determined by quantitative PCR. AAV9 virus (4×10.sup.11 virus genome/animal) were injected into postnatal day 2 CnA-tg pups, mdx pups or their control littermates with subcutaneous injection. Hearts were harvest at the age of 4 weeks for CnA-tg mice and at the age of 2 months for mdx mice.
Haematoxylin and eosin staining and fast green/Sirius red collagen staining. Mouse heart tissues were dissected out, rinsed with PBS and fixed in 4% paraformaldehyde (pH 8.0) overnight. After dehydration through a series of ethanol baths, samples were embedded in paraffin wax according to standard laboratory procedures. Sections of 5 μm were stained with haematoxylin and eosin (H&E) for routine histological examination with light microscope. For Sirius red/fast green collagen staining sections were fixed with pre-warmed Bouins' solution, 55° C. for 1 hour then washed in running water. Sections were stained in 0.1% fast green solution for 10 minutes then washed with 1% acetic acid for 2 minutes. After rinsing in tape water, sections were stained in 0.1% Sirius resolution for 30 minutes. After staining, sections were dehydrated and cleared with xylene. The images were examined with light scope and quantified with ImageJ software.
Immunofluorescence. Mouse heart tissues were dissected out, collected and fixed in 4% PFA at 4° C. for 4 hours. After washing in PBS, samples were treated in 15% and 30% sucrose for 2 hours each and embedded in OCT. About 5-8 μm cryostat sections were collected on positively charged slides. Sections were washed in PBS, blocked in 5% serum/PBS, and subjected to immunostaining. Antibody sources were as follows: Anti-CIP (1:200, 21st Century Biochemical, customized); Anti-Dystrophin (1: 100, Developmental Studies Hybridoma Bank, MANDRA1-7A10) Anti-Flag (1:200, Sigma-Aldrich, F1804). Alexa-488 and 594 secondary antibodies (Life technologies). Fluorescently stained cells were counterstained with DAPI and imaged with an FV1000 confocal microscope (Olympus).
Isolation of cardiomyocytes from adult mice. Adult mouse cardiomyocytes were isolated using a previously described procedure.sup.19 with minor modifications. Briefly, following perfusion and digestion of the heart with collagenase II (Worthington Biochemical Corp, Lakewood, N.J.), dissociated cells (myocytes and non-myocytes) were sedimented by gravity. The bottom layer is rich in adult cardiomyocytes. Cardiomyocytes were then collected and fixed with 4% PFA for immunofluorescence.
Cardiomyocyte culture. Neonatal mouse and rat cardiomyocytes were prepared as previously described.sup.20. Briefly, neonatal cardiomyocytes were isolated by enzymatic disassociation of 1-day old neonatal mouse or rat heart with the Neonatal Cardiomyocyte Isolation System (Cellutron Life Technology). Cardiomyocytes were plated for 2 hours to remove fibroblasts. Cells were then plated on 1% gelatin-coated plates in medium containing 10% horse serum and 5% fetal calf serum (FCS). Eighteen hours after plating, cells were changed into serum-free medium and infected with adenovirus (25 MOI) for 24 hours. For the treatment of siRNA, fifty (50) nM of siRNA targeting CIP transcript (Si-CIP) and control siRNA (from Dharmacon) were transfected into cardiomyocyte by using Lipofectamine RNAiMAX transfection reagent. Six hours later, medium with transfection reagent were removed. Cells were then treated with phenylephrine (PE, 20 μM) or Angiotensin II (ANG II, 1 μM). Cells were harvested 24 hours after PE treatment for RNA isolation or 4 hours after ANG II treatment for measurement of GSH/GSSG ratio.
Quantitative RT-PCR and Western blot analysis. Total RNAs were isolated using Trizol Reagent (Life technologies) from cells and tissue samples. For quantitative RT-PCR, 2.0 μg RNA samples were reverse-transcribed to cDNA by using random hexamers and MMLV reverse transcriptase (Life technologies) in 20 μl reaction. In each analysis, 0.1 μl cDNA pool was used for quantitative PCR. The relative expression of interested genes is normalized to the expression of 18S rRNA or β-actin. For Western blot analyses, protein samples were cleared by 10,000×g centrifugation for 10 min. Samples were subsequently analyzed by SDS/PAGE and transferred to PVDF membranes that were incubated with Odyssey Blocking Buffer (LI-COR) and Anti-CIP (1:2,000, 21st Century Biochemical, customized); Anti-β-tubulin (1:10,000, Sigma-Aldrich, T0198); Anti-Flag (1:5,000, Sigma-Aldrich, F7425); Anti-Myc (1:5,000, Sigma-Aldrich, C3956); Anti-Lmo7 (1:1,000, Santa Cruz Biotechnology, sc-376807); Anti-HSPA9 (1:1,000, Santa Cruz Biotechnology, sc-133137); Anti-α-actinin (1:1,000, Sigma-Aldrich, A7811); Anti-NFAT4 (1:500, Santa Cruz Biotechnology, sc-8405); Anti-phospho-NFAT4 (1:500, Abcam, ab59204) or Anti-dystrophin (1:500, Developmental Studies Hybridoma Bank, MANDRA1-7A10) overnight at 4° C. and then washed three times with PBS buffer before adding IgG secondary antibody. Specific protein bands were visualized by Odyssey CLx imager (LI-COR).
Coimmunoprecipitation assays. HEK293 cells were transiently transfected with plasmids using Lipofectamine 3000 (Invitrogen). Cells were harvested 48 hours after transfection in lysis buffer composed of PBS containing 0.5% Triton X-100, 1 mM EDTA, 1 mM PMSF, and complete protease inhibitors (Roche). For heart tissue, neonatal CIP-KO and control hearts were lysed with above-mentioned lysis buffer. After a brief sonication and removal of debris by centrifugation, proteins were precipitated with Anti-Flag, Anti-Myc or Anti-CIP antibodies and protein A/G beads and analyzed by Western blotting with indicated antibodies.
In vitro GST protein-binding assays. Plasmids encoding a GST fusion with CIP were transformed into BL21 plus cells (Stratagene). The cells were grown at 37° C. in 2×YT medium to an optical density of 1.0. Isopropyl-β-D-thiogalactopyranoside (50 μM) was then added to the culture to induce protein expression. After being shaken at room temperature for 4 h, the cells were harvested and the GST protein was purified with glutathione beads. Glutathione beads conjugated with GST fusion protein were incubated with wild-type heart lysate at 4° C. for 6 hours in 500 μl of GST-binding buffer (20 mM Tris, pH 7.3/150 mM NaCl/0.5% Nonidet P-40/protease inhibitor/1 mM phenylmethylsulfonyl fluoride). The beads were washed three times with GST binding buffer. 25 μl of SDS loading buffer was then added to the beads. After boiling, 25 μl was loaded onto an SDS/PAGE gel to separate the CIP-binding proteins. Gel was then stained with Coomassie blue. Stained protein bands were cut out and followed by Mass spectrometry analysis.
Constructs, cell culture, and luciferase reporter assays. COS7 and HEK293T cells were cultured in DMEM supplemented with 10% FBS in a 5% CO2 atmosphere at 37° C. Firefly luciferase reporter constructs fused with the 3×NFAT binding sequence in the upstream region was purchased from Addgene. Transfections were performed with Lipofectamine 3000 (Invitrogen) reagents according to manufacturer's instruction. Cells were co-transfected with NFAT luciferase reporter, Renilla luciferase reporter (normalizing control) and other indicated plasmids. 48 hours after transfection, cell extracts were prepared and luciferase activity was determined. For luciferase assay, normalized luciferase activity from triplicate samples in 12-well plates relative to Renilla luciferase activity was calculated, and the results are expressed as fold activation over the value relative to the control (NFAT luciferase reporter and empty pcDNA). To determine the subcellular location of GFP-NFAT fusion protein, COS7 cells were co-transfected with GFP-tagged NFAT plasmid (Addgene) and other indicated plasmids. Cells were cultured for 24 hours before taking the live cell images.
GSH/GSSG measurement. Measurement of GSH/GSSG was performed with GSH/GSSG Ratio Detection Assay Kit (ab138881) according to manufacturer's instruction.
RNA-seq data analysis. Raw reads were mapped to UCSC mm9 using tophat 2.0 [1]. RNA fragment was counted by htseq-count [2]. RNA fragment was further normalized per kilobase of exon per million mapped fragment (FPKM). Differentially expressed gene was calculated using DE-seq [3], and fold change>0.5 and p-value<0.05 were used as parameter.
Heatmap of gene expression level. Log 2 fold change was calculated by fragments in treated groups over control groups. Positive value stands for higher expression level in treated groups and vice versa. Heatmap was clustered using hierarchy cluster method, and Euclidean distance, complete linkages were used as the parameter.
Principal component analysis. All expressed genes in the genome from RNA-seq analyses were used as the signature of each group. Principal component analysis (PCA) method was used to find top principal components among groups. We found that top 2 principal components were sufficient to reach a cumulative energy of 0.98. Principal component 1 and 2 were plotted as x-axis and y-axis in 2-D coordinates.
Statistics. Values are reported as means±STD unless indicated otherwise. An analysis of variance (ANOVA) analysis followed by Dunnett's Post-Hoc testing was used to evaluate the statistical significance for multiple-group comparisons. In addition, the 2-tailed Mann-Whitney U test was used for 2-group comparisons. Values of P<0.05 were considered statistically significant.
Results
Loss of CIP Accelerates the Development of Dystrophic Cardiomyopathy
[0052] To test the hypothesis that genetic interaction between CIP and dystrophin modulates muscular dystrophy, we crossed the CIP knockout (CIP-KO) mouse with the mdx mouse, which harbors a dystrophin mutation and represents a mouse model of human DMD, to generate a CIP-KO; mdx double knockout (dKO) mouse. CIP-KO mice appear normal without detectable cardiac defects up to 12 months of age.sup.14, and mdx mice only start to display mild cardiomyopathy at 10 months of age.sup.21, 22. Strikingly, we found that the dKO mice exhibit severe cardiomyopathy as early as 3 months of age. Echocardiographic measurements showed that left ventricular posterior wall is much thinner and left ventricular internal diameter is significantly enlarged in dKO mice, when compared with control groups (
[0053] We examined molecular markers for cardiomyopathy and heart failure, and found that the expression levels of ANF, BNP and Myh7 were all elevated in the hearts of dKO mice (
Transgenic Overexpression of CIP Protects the Heart from the Development of Dystrophic Cardiomyopathy
[0054] Next, we asked whether cardiac expression of CIP could protect dystrophic mice from developing cardiomyopathy. We bred CIP-overexpressing mice (CIP-OE), in which the CIP transgene is activated by MCK-Cre and overexpressed in heart and skeletal muscle, with mdx mice to create CIP-OE; mdx compound mice. CIP-OE mice appear normal, without detectable changes in cardiac function, under physiological conditions. Unlike human DMD patients, mdx mice develop mild, late onset cardiomyopathy.sup.21, 22. Our 1-year-old mdx mice exhibit obvious dilated cardiomyopathy (enlarged left ventricular chamber, thinner ventricular wall, and enhanced cardiac fibrosis) with 100% penetrance, consistent with prior reports.sup.18, 21. Cardiac function was preserved in 1-year-old CIP-OE; mdx mice compared to their control littermates (
Molecular Signature of Dystrophic Cardiomyopathy
[0055] To define the molecular signature and mechanisms of dystrophic cardiomyopathy, we performed unbiased transcriptome analysis. RNA-seq of 3-month-old dKO and control mdx hearts identified 1,891 transcripts that were differentially expressed in CIP-KO; mdx hearts, including 855 down- and 1,036 up-regulated genes (P<0.01). Gene Ontology (GO) term analysis revealed that up-regulated genes were enriched for functional annotations related to extracellular matrix organization, collagen formation, and integrin signaling. Among the most up-regulated genes were genes associated with cardiomyopathy and heart failure (Myh7, NPPA, NPPB and Acta1) and cardiac fibrosis (collagen genes, Postn, ELN and tgfb2), consistent with our prior qRT-PCR analyses (
[0056] Next, we performed RNA-seq on 1-year-old CIP-OE; mdx and littermate control mice. A total of 791 genes, including 356 up- and 435 down-regulated, were dysregulated in CIP-OE; mdx hearts when compared with mdx controls (P<0.05). Intriguingly, GO term analysis demonstrated that the up-regulated genes were enriched for functional annotations related to fatty acid catabolic process, fatty acid beta-oxidation, and oxidoreductase activity, while the down-regulated genes were enriched for functional annotations related to collagen formation, extracellular matrix organization and integrin signaling pathway (
[0057] The RNA-seq data from both young (3-month-old) and aged (1-year-old) mice with various genetic modifications to dystrophin and/or CIP, together with their distinctive pathological conditions, provide a unique opportunity to better understand the molecular signature of dystrophic cardiomyopathy progression. We performed an unbiased principal component analysis (PCA) using the whole transcriptome and found that 1-year-old CIP-OE; mdx hearts, which are phenotypically normal, are distant from 1-year-old mdx control hearts; instead, their transcriptome signature is similar to those of 3-month-old mdx controls and other littermate controls. Conversely, the transcriptome signature of 3-month-old CIP-KO; mdx hearts, which exhibit severe cardiomyopathy, is separate from that of 3-month-old mdx control hearts, instead grouping with 1-year-old mdx control hearts.
[0058] Next, we asked whether molecular signatures of dysregulated genes could be used to better define dystrophic cardiomyopathy phenotypes in these mice, in which dystrophic cardiomyopathy may or may not be present. Using unsupervised hierarchical clustering to analyze the 791 genes dysregulated in 1-year-old CIP-OE; mdx hearts as compared with age matched mdx controls, we found that all of the 1-year-old CIP-OE; mdx profiles were separate from 1-year-old mdx controls; instead, they were grouped with 3-month-old mdx controls and other littermate controls. These 791 genes grouped into five clusters. GO term analysis of these clusters showed that they were enriched for functional annotations related to Oxidoreductase, Membrane, Extracellular matrix, Calcium, and Glycoprotein. Similarly, unsupervised hierarchical clustering of the 3,236 genes dysregulated in 3 month-old CIP-KO; mdx hearts as compared with age matched mdx controls showed that that the 3-month-old CIP-KO; mdx hearts clustered with the 1-year-old mdx control hearts. Therefore, these analyses uncover an unique molecular signature of dystrophic cardiomyopathy and link the dysregulation of functional gene groups to the pathological condition of this disease.
CIP Controls Dystrophic Cardiomyopathy Through the Oxidative Stress Pathway
[0059] Among the most significantly dysregulated gene clusters in dystrophic cardiomyopathy were genes related to extracellular matrix (fibrosis) and the oxidative stress response. We reasoned that increased expression of fibrosis genes in dystrophic CIP-KO; mdx hearts and their reduced expression in healthy CIP-OE; mdx hearts may represent a consequence of cardiac remodeling. In contrast, we postulate that an increase in the oxidative stress response, as a result of reduced expression of oxidation-reduction process and oxidoreductase activity genes (
[0060] The above data suggest that CIP modulates cardiac oxidative stress in dystrophic hearts mainly by regulating the expression and function of Nox4. We asked whether overexpression of Nox4 in the hearts of young mdx mice would be able to induce oxidative stress, leading to dystrophic cardiomyopathy, similar to what we saw in the CIP-KO; mdx dKO mice. We achieved cardiac-specific Nox4 overexpression in mdx and control mice using an Adeno Associated Virus 9 (AAV9) delivery system (Suppl. online
CIP Interacts with Dystrophin and Calcineurin (CnA) to Regulate CnA-NFAT-Nox4 Signaling and Dystrophic Cardiomyopathy
[0061] In order to better understanding the molecular mechanism by which CIP regulates oxidative stress during dystrophic cardiomyopathy, we undertook an unbiased approach to identify CIP-interacting proteins in the heart. We used GST-CIP to pull down interacting proteins from heart extracts. Subsequent mass spectrometry identified multiple candidate CIP-interacting proteins, including LMO7, HSPA9, α-Actinin, β-Tubulin and calcineurin (CnA). Their interaction with CIP was confirmed by co-immunoprecipitation (co-IP) assays (Suppl. online
[0062] CnA is a protein phosphatase that regulates cardiac remodeling.sup.17, 28-30. We have previously reported that genetic and functional interactions between CnA and CIP modulate cardiac remodeling.sup.14. Interestingly, CnA has been linked to the expression and function of the Nox4 gene in the kidney.sup.31. We therefore hypothesized that the interplay of CIP, CnA, and dystrophin modulates downstream oxidative stress and thereby critically regulates the development of dystrophic cardiomyopathy. Co-IP assay showed that CIP interacts with CnA but not CnB or CIB1, a scaffold protein that interacts with CnB and the sarcolemma.sup.32 (
[0063] A previous study showed that the CnA-NFAT signaling cascade regulates the expression and function of oxidases Nox4 and Nox2 in the kidney.sup.31. We asked whether these oxidases are similarly regulated by CIP-CnA-NFAT signaling in cardiomyocytes. We overexpressed or knocked down CIP in neonatal rat ventricular myocytes (NRVM). Cells were treated with phenylephrine to activate CnA-NFAT signaling and induce cardiomyocyte hypertrophy.sup.33, 34. Knock down of CIP induces Nox4 expression, while CIP overexpression results in a reduced Nox4 level (
[0064] We examined the regulation of Nox4 and oxidative stress by CIP and CnA in vivo. AAV9-mediated cardiac overexpression of CIP markedly represses the level of Nox4, which is dramatically induced in the hearts of CnA transgenic mice (
Example 2. CIP, a Cardioprotective Factor, Inhibits the Transition from Cardiac Hypertrophy to Heart Failure
[0065] Heart failure is currently incurable and is characterized by the failure of the heart to pump enough blood to meet the body's needs and affects more than 100 million people globally. Little is known about how the transition from cardiac hypertrophy to heart failure is regulated. Previously, we identified a cardiomyocyte-enriched gene, CIP, which regulates cardiac homeostasis under pathological conditions. Here, we demonstrate that the promotor of the CIP gene contains binding sites for GATA4 and the expression of CIP is regulated by this cardiac transcription factor. We also determined that both CIP mRNA and protein decrease in diseased human hearts. In a mouse model of heart failure, induced cardiac-specific overexpression of CIP after the onset of hypertrophy was sufficient to prevent progression to heart failure. Transcriptome analyses with RNA-seq revealed that IGF, mTORC2, and TGFβ signaling pathways meditate the inhibitory function of CIP on pathological cardiac remodeling. Our study reveals the mechanism by which CIP gene expression is controlled in cardiomyocytes and underscores the clinical relevance of CIP in heart disease. More importantly, our investigation suggests that CIP is a key regulator of the transition from cardiac hypertrophy to heart failure. These results indicate the therapeutic potential of CIP for treating the failing heart.
Methods
[0066] The following materials and methods were used in this Example.
Human samples. Left ventricular (LV) tissues were taken from patients with terminal-stage heart failure indicated for heart transplantation performed in the First Affiliated Hospital, Sun Yat-sen University. In brief, the patient's heart was removed at the time of transplantation and LV tissue was subsequently dissected and snap-frozen. We used LV samples from not implanted healthy hearts to serve as controls. All the procedures followed the protocol approved by the First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China.
Mice. CIP-KI-flox mice were generated in previous study.sup.14. CIP-KI-flox mice, which have a Rosa-CIP allele (the stop codon is present and floxed) were bled with aMHC-Mer-Cre-Mer mice to obtain CIP-OE (CIP-KI-flox; aMHC-Mer-Cre-Mer) mice. Tamoxifen was administrated through intraperitoneal injection to activate the expression of Cre recombinase and the excision of the stop codon for the ectopic expression of CIP transgene in the heart in CIP-OE mice. CIP-KI-flox littermates were used as controls.
Measurement of cardiac function by echocardiography. Echocardiographic measurements were performed on mice using a Visual Sonics Vevo® 2100 Imaging System (Visual Sonics, Toronto, Canada) with a 40 MHz MicroScan transducer (model MS-550D). Mice were anesthetized with isoflurane (2.5% isoflurane for induction and 0.1% for maintenance). Heart rate and LV dimensions, including diastolic and systolic wall thicknesses, LV end-diastolic and end-systolic chamber dimensions were measured from 2-D short-axis under M-mode tracings at the level of the papillary muscle. LV mass and functional parameters such as percentage of fractional shortening (FS %) and ejection fraction (EF %) were calculated using the above primary measurements and accompanying software.
Transverse aortic constriction operation. Mice were anesthetized with isoflurane (3-4% isoflurane for induction, 1-2% isoflurane for maintenance). The chest was shaved and cleaned with alcohol. A suture was placed around the front upper incisors and pulled taut so that the neck was slightly extended. The tongue was retracted and held with forceps, and a 20-G catheter was inserted into the trachea. The catheter was then attached to the mouse ventilator via a Y-shaped connector. Ventilation was performed with a tidal volume of 220-240 μl for a 25-30 g mouse and a respiratory rate of 130-140 breaths per min. 100% oxygen was provided to the inflow of the ventilator. The chest was opened through a left 2.sup.nd intercostal thoracotomy. The 26-G needle without its sharp tip was put on the ascending aorta. They were tightly ligated together using 7-0 Nylon suture (Ethicon) at the position between brachiocephalic artery and left common carotid artery, and the 26-G needle was removed immediately after ligation. In the sham operation, no ligation was performed. Isoflurane was stopped, and the lungs were slightly overinflated to assist in removal of air in the pleural cavity. Dissected intercostal space and chest skin were closed using 6-0 silk suture (Ethicon). All manipulations were performed by an operator without knowledge of genotype
[0067] Haematoxylin and eosin staining and fast green/Sirius red collagen staining. Mouse heart tissues were dissected out, rinsed with PBS and fixed in 4% paraformaldehyde (pH 8.0) overnight. After dehydration through a series of ethanol baths, samples were embedded in paraffin wax according to standard laboratory procedures. Sections of 5 μm were stained with haematoxylin and eosin (H&E) for routine histological examination with light microscope. For Sirius red/fast green collagen staining sections were fixed with pre-warmed Bouins' solution, 55° C. for 1 hour then washed in running water. Sections were stained in 0.1% fast green solution for 10 minutes then washed with 1% Acetic acid for 2 minutes. After rinsing in tape water, sections were stained in 0.1% Sirius resolution for 30 minutes. After staining, sections were dehydrated and cleared with Xylene. The images were examined with light scope and quantified with ImageJ software.
Quantitative RT-PCR and Western blot analysis. Total RNAs were isolated using Trizol Reagent (Life technologies) from cells and tissue samples. For Quantitative RT-PCR, 2.0 μg RNA samples were reverse-transcribed to cDNA by using random hexamers and MMLV reverse transcriptase (Life technologies) in 20 μl reaction system. In each analysis, 0.1 μl cDNA pool was used for quantitative PCR. The relative expression of interested genes is normalized to the expression of ACTB or PRKG1. Primers used in this study are listed in the table below. For Western blot analyses, tissue homogenate were cleared by 10,000×g centrifugation for 10 min. Samples were subsequently analyzed by SDS/PAGE and transferred to PVDF membranes that were incubated with 5% non-fat dry milk in TBST and Anti-CIP (1:2000, 21st Century Biochemical) or Anti-GAPDH (1:5000, Proteintech) overnight at 4° C. and then washed three times with TBST buffer before adding IgG secondary antibody. Specific protein bands were visualized through chemiluminescent detection.
TABLE-US-00001 PRIMERS SEQ SEQ Gene ID ID name Forward primer (5′.fwdarw.3′) NO: Reverse primer (5′.fwdarw.3′) NO: NPPA CACAGATCTGATGGATTTCAAGA 1. CCTCATCTTCTACCGGCATC 2. NPPB GTCAGTCGTTTGGGCTGTAAC 3. AGACCCAGGCAGAGTCAGAA 4. FBN1 CCTTCCTGTGGCTCCAGAT 5. GCTGCCCCCATTCATACA 6. Acta1 GCCCATCTATGAGGGCTATG 7. AATCTCACGTTCAGCTGTGG 8. Tgfb1 AAGACTTCACCCCAAAGCTG 9. GAGAGAGGGTCCTGGGATG 10. Des GCGTGACAACCTGATAGACG 11. TGGATTTCCTCCTGTAGTTTGG 12. Bax GTGAGCGGCTGCTTGTCT 13. GTGGGGGTCCCGAAGTAG 14. Cebpa CGCTGGTGATCAAACAAGAG 15. GGTGGCTGGTAGGGGAAG 16. Cebpb TGATGCAATCCGGATCAA 17. CACGTGTGTTGCGTCAGTC 18. Cox6a2 GAGCGCCCAGAGTTCATC 19. TGTGGAAAAGCGTGTGGTT 20. Cox8b AGCCAAAACTCCCACTTCC 21. GAACCATGAAGCCAACGAC 22. Rictor GGTGATAACTACGTTCGTCGC 23. AAAGGTGTACGGGCAGGTAG 24. Bbc3 TTCTCCGGAGTGTTCATGC 25. TACAGCGGAGGGCATCAG 26. Ndufa1 TGATGGAACGCGATAGACG 27. GCCAGGAAAATGCTTCCTTA 28. Ndufb9 TTTCCAAGAGAGAGCAGTGGA 29. CTCCTGCAGCTGCTTAACCT 30. Uqcr10 ACTTCCACCTTTGCCCTCAC 31. TCCACAGTTTCCCCTCGTTG 32. Uqcr11 CCACAGGCCTCGATGGTA 33. GCAGCCCTAGTGTCTGTCAA 34. Cox5a TTAAATGAATTGGGAATCTCCAC 35. GTCCTTAGGAAGCCCATCG 36. Sod3 CTCTTGGGAGAGCCTGACA 37. GCCAGTAGCAAGCCGTAGAA 38. Junb CCACGGAGGGAGAGAAAATC 39. AGTTGGCAGCTGTGCGTAA 40. Fgfr1 GACCTACGTTCAAGCAGTTGG 41. TCCAGCGGTATGGACAGG 42. Smad7 ACCCCCATCACCTTAGTCG 43. GAAAATCCATTGGGTATCTGGA 44. Rhoc AAGGACCTGAGGCAAGATGA 45. AAGGCACTGATCCTGTTTGC 46. Pdgfb CGAGGGAGGAGGAGCCTA 47. GTCTTGCACTCGGCGATTA 48. Igfbp7 TGCCCTCCATGAAATACCAC 49. GGCTGTCTGAGAGCACCTTT 50. CIP TAGCTACTCGGCCCAAGTCT 51. ATCCCATGAGGAATTTCAGG 52. PRKG1 TCCAACATTCCAGAGCCTTC 53. TTTTCATAGTGGGTCTCTTCGAG 54. β-actin GATCTGGCACCACACCTTCT 55. GGGGTGTTGAAGGTCTCAAA 56.
Constructs, cell culture, and luciferase reporter assays. HEK293T cells were cultured in DMEM supplemented with 10% FBS in a 5% CO2 atmosphere at 37° C. Wildtype, mutant or truncated CIP promoter sequences were cloned into multiple cloning sites of the pGL3-Basic vector (Promega) to generate CIP-Luc reporters used in this study. An indicated combination of CIP-Luc reporter, pRL Renilla reporter (internal control) and GATA4 construct were transfected into HEK293T cells with PEI reagents. 48 hours after transfection, cell extracts were prepared and luciferase activity was determined. For dual-luciferase assay, normalized firefly luciferase expression from triplicate samples in 12-well plates relative to renilla luciferase expression was calculated.
Mouse heart RNA-seq data analyses. Total RNAs from mouse heart were used to perform RNA-seq in BGI Genomics (Wuhan, China). RNA-seq reads were mapped to mouse genome mm10 by STAR and reads counts were calculated with FeatureCounts. Expression analysis was run in RStudio. DESeq2 was employed to perform statistical analysis of differential gene expression. An adjusted P value of 0.05 were used as cutoff to identify differentially regulated genes. Volcano plot were performed with the ggplot2 library. Hierarchical clustering heatmap was made with the pheatmap library.
Human heart RNA-seq data collection and analyses. Human diseased heart RNA-seq data, including GSE57344, GSE71613, GSE116250, GSE46224, GSE108157, GSE55296, GSE120836, GSE130036, were downloaded from NCBI database. Gene-level quantification were calculated by featureCounts-v1.6.3. To perform strand-specific reads counting, the strand type (nonstrand, stranded, reversely stranded) of each sample was inferred from sorted bam file using infer_expriment.py (3.0.0). Then we can provide featureCounts with strand type information to calculate read counts of every gene in each sample and merged the quantification results together to make an expression matrix for differential gene expression analysis. Differential gene expression analysis was performed using DESeq2-1.24.0. The design matrix in DESeq2 model was written as “˜series+gender+phenotype” to adjust the differences between data series and gender. Only differential expressed genes with FDR<0.05 and log 2FoldChange>0.25 identified by DESeq2 were kept. Then, we applied the classic weighted correlation network analysis (WGCNA) algorithm for co-expression analysis. The R implementation of WGCNA (version: 1.68) was used in our study.
Statistics. Values are reported as means±SEM unless indicated otherwise. Statistical significance was determined with ANOVA. For multiple group comparisons, a post-hoc Tukey's test was performed when ANOVA reached significance. Values of P<0.05 were considered statistically significant.
Results.
Cardiac Transcription Factor GATA4 Binds to the Promotor of CIP and Regulates its Expression
[0068] CIP (Cardiac ISL1-interacting Protein).sup.14 or MLIP (Muscle-enriched A-type Lamin-Interacting Protein).sup.12 has been previously identified as a striated muscle-enriched gene. In the heart, CIP is predominantly expressed in cardiomyocytes; however, the transcription factors that control the expression of CIP in these cells have yet to be thoroughly investigated. Genome-wide binding sites for multiple cardiac transcriptional factors, including GATA4, Tbx5, Nkx2-5, Mef2A, and SRF, have been carefully investigated.sup.51. GATA4, Tbx5 and Nkx2-5 were found to bind to the promotor region of CIP (
Decreased Expression of CIP Correlated with Dysregulated Oxidative Phosphorylation (OXPHOS) in Multiple Human Heart Diseases
[0069] To further investigate the relevance of CIP to human cardiac diseases, we collected RNA-seq data from 194 human hearts using a public database, including 53 non-failing heart samples (NF), 28 hypertrophic cardiomyopathy samples (HCM), ischemic cardiomyopathy samples (ICM), and 73 dilated cardiomyopathy samples (DCM). After normalizing the data, we found the expression of CIP was significantly decreased in all diseased samples, while the cardiac disease markers, NPPA and NPPB, were dramatically upregulated (
Cardiac Overexpression of CIP Protects the Diseased Heart from Transitioning Toward Heart Failure
[0070] In a previous study, we reported that overexpression of CIP in the heart before cardiac stress inhibited maladaptive remodeling.sup.14. In order to further test the effect of CIP in treating the progression of adverse cardiac remodeling, we performed transverse aortic constriction (TAC) surgery, which induces ventricular pressure overload, on an inducible cardiac-specific CIP overexpressing mice (Rosa26-CIP-flox; Myh6-MerCreMer, CIP-OE mice). Mice were administered Tamoxifen to induce cardiac-specific overexpression of CIP 2 weeks after TAC surgery. Cardiac remodeling was confirmed 2 weeks after TAC by echocardiography of the left ventricular posterior wall (LVPW;
The Protective Function of CIP is Mediated by IGF and mTORC2 Signaling Pathways
[0071] To investigate the potential mechanism of protection by CIP, we carried out unbiased transcriptome profiling with hearts of CIP-OE mice at 8 weeks post-surgery using RNA-seq. In total, 444 genes, including CIP, were significantly up-regulated, while 792 gene were significantly down-regulated in CIP-KI hearts (fold change>1.5 and adjust p<0.05) (
Example 3. Control of Nuclear Positioning by Skeletal Muscle CIP
[0072] The appropriate arrangement of myonuclei within skeletal muscle myofibers is of critical importance for normal muscle function, and improper myonuclear localization has been linked to a variety of skeletal muscle diseases, such as centronuclear myopathy and muscular dystrophies. However, the molecules that govern myonuclear positioning remain elusive. Here we report that muscle-specific CIP (sk-CIP) is a novel regulator of nuclear positioning. Genetic deletion of sk-CIP in mice results in misalignment of myonuclei along the myofibers and at specialized structures such as the neuromuscular junctions (NMJs) and myotendinous junctions (MTJs) in vivo, impairing myonuclear positioning after muscle regeneration, leading to severe muscle dystrophy in mdx mice, a mouse model of Duchenne muscular dystrophy. sk-CIP is localized to the centrosome in myoblasts and relocates to the outer nuclear envelope in myotubes upon differentiation. Mechanistically, we found that sk-CIP directly interacts with the Linker of Nucleoskeleton and Cytoskeleton (LINC) complex and the centriole Microtubule Organizing Center (MTOC) proteins to control myonuclear positioning and alignment. These findings identify sk-CIP as a long-sought muscle-specific anchoring protein that controls myonuclear position. sk-CIP could be a therapeutic target for muscle related diseases such as muscular dystrophy.
CIP Regulates Myonuclear Position During Myogenic Differentiation
[0073] We and others have previously identified the CIP gene (Cardiac Islet-1 interaction Protein), also called Mlip (12, 11), and reported that CIP participates in the regulation of cardiac function in response to stress (14). The CIP gene encodes multiple splicing isoforms, and we discovered an alternatively spliced isoform in skeletal muscle, which we named skeletal muscle CIP (sk-CIP) (
[0074] To begin to assess the function of CIP in skeletal muscle, we first knocked down CIP using a pool of siRNAs in C2C12 cells; interestingly, we found that inhibition of CIP resulted in nuclear clustering within single myotubes without affecting myogenic differentiation gene expression (
CIP is Required for Myonuclear Positioning In Vivo
[0075] To test if CIP is indeed required for skeletal muscle myonuclear positioning in vivo, we turned to CIP-KO mice (11, 14). The CIP-KO mice were generated in a manner such that both cardiac and skeletal muscle isoforms were abolished (11). CIP-KO mice appear to be normal, without gross morphological defects in skeletal muscle (
[0076] Adult skeletal muscle can regenerate in response to damage, owing to the activation of satellite cells, endogenous myogenic stem cells which proliferate, differentiate, and fuse with residual muscle fibers (54, 55). We tested whether CIP is also involved in myonuclear positioning during muscle regeneration. Skeletal muscle from CIP-KO mice regenerates in a similar pattern as that of control mice after cardiotoxin injection-induced degeneration, consistent with the view that CIP does not affect the myogenic differentiation program per se; however, there is a profound clustering of centrally localized nuclei (CLN) in regenerated CIP-KO myofibers (
Loss of CIP and Dystrophin Results in Severe Muscular Dystrophy
[0077] Improperly positioned nuclei are hallmarks of numerous muscle disorders, including Duchenne muscular dystrophy and centronuclear myopathies. Patients suffering from many muscle diseases show a variety degree of muscle weakness with incorrectly localized myonuclei. However, it is unclear whether those incorrectly positioned nuclei contribute to the development of the pathology of such muscle diseases (Meinke et al., PLoS Genet 10, e1004605 (2014)). To investigate the pathological impact of CIP-dependent myonuclear positioning defects in muscle diseases, we bred CIP-KO mice with mdx mice, the most commonly used mouse model of Duchenne muscular dystrophy (Bulfield et al., Proc Natl Acad Sci USA 81, 1189-1192 (1984)). The CIP/mdx double knockout mice (DKO) are smaller than age matched mdx mice and show progressive muscular dystrophy as demonstrated by severe kyphosis (
Example 4. Inhibition of Nox4 Protects Against Dystrophic Cardiomyopathy In Vivo
[0078] To examine whether pharmacological inhibition of Nox4 protects against development of cardiomyopathy, we administered a Nox4 Inhibitor to two different mouse models of dystrophic cardiomyopathy.
Method: Oral Gavage of Nox4 Inhibitor
[0079] Nox4 inhibitor GKT 137831 was purchased from MilliporeSigma and dissolved in corn oil.
Male mutation mice for both CIP and dystrophin genes (CIP-KO/mdx dko) were divided into four groups: [0080] 1) group young control (3-month old mouse with corn oil); [0081] 2) group young inhibitor (3-month old mouse with nox4 inhibitor); [0082] 3) group old control (5-month old mouse with corn oil); [0083] 4) group Old inhibitor (5-month old mouse with nox4 inhibitor)
Male mutation mice for utrophin and dystrophin (c) were divided into two groups: [0084] 1) group C: control (3-month old mouse with corn oil); [0085] 2) group I: inhibitor (3-month old mouse with nox4 inhibitor);
For all the animals in the inhibitor treatment group, the Nox4 Inhibitor (GKT137831 (SIGMA) diluted 1:100 in corn oil) was applied at the dosage of 60 mg/kg/day daily; control group was treated with corn oil only.
[0086] Cardiac function was monitored using echocardiography before (pre-) and after Nox4 Inhibitor treatment at indicated times (weeks or months) and was presented as EF (ejection fraction) or FS % (fractional shortening), respectively. Utrn/mdx dko mice were sacrificed after final echocardiography measurement after 2 months. Histology was performed in the heart tissues and the expression of cardiac genes and fibronectin, a molecular marker for fibrosis, measured using real-time qPCR.
Results:
[0087] We treated CIP-KO:mdx and control Mdx mice with Nox4 inhibitor (GKT137831, 60 mg/kg/day) daily for 4 weeks (see
[0088] Similar results were seen in Utm/mdx dko mice, treated and evaluated as shown in
[0089] Histological analysis confirmed that Nox4 inhibitor treatment reduced the size of the left ventricle dimension; decreased the formation of cardiac fibrosis and the formation of scars (
REFERENCES
[0090] 1. Hoffman E P, Brown R H, Jr. and Kunkel L M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 1987; 51:919-28. [0091] 2. Monaco A P, Neve R L, Colletti-Feener C, Bertelson C J, Kurnit D M and Kunkel L M. Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature. 1986; 323:646-50. [0092] 3. Chamberlain J R and Chamberlain J S. Progress toward Gene Therapy for Duchenne Muscular Dystrophy. Molecular therapy: the journal of the American Society of Gene Therapy. 2017; 25:1125-1131. [0093] 4. Guiraud S and Davies K E. Pharmacological advances for treatment in Duchenne muscular dystrophy. Curr Opin Pharmacol. 2017; 34:36-48. [0094] 5. Long C, Amoasii L, Mireault A A, McAnally J R, Li H, Sanchez-Ortiz E, Bhattacharyya S, Shelton J M, Bassel-Duby R and Olson E N. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science. 2016; 351:400-3. [0095] 6. Long C, McAnally J R, Shelton J M, Mireault A A, Bassel-Duby R and Olson E N. Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA. Science. 2014; 345:1184-1188. [0096] 7. Min Y L, Bassel-Duby R and Olson E N. CRISPR Correction of Duchenne Muscular Dystrophy. Annu Rev Med. 2019; 70:239-255. [0097] 8. Amoasii L, Hildyard J C W, Li H, Sanchez-Ortiz E, Mireault A, Caballero D, Harron R, Stathopoulou T R, Massey C, Shelton J M, Bassel-Duby R, Piercy R J and Olson E N. Gene editing restores dystrophin expression in a canine model of Duchenne muscular dystrophy. Science. 2018; 362:86-91. [0098] 9. Kamdar F and Garry D J. Dystrophin-Deficient Cardiomyopathy. J Am Coll Cardiol. 2016; 67:2533-46. [0099] 10. McNally E M. New approaches in the therapy of cardiomyopathy in muscular dystrophy. Annu Rev Med. 2007; 58:75-88. [0100] 11. Huang Z P, Young Seok H, Zhou B, Chen J, Chen J F, Tao Y, Pu W T and Wang D Z. CIP, a cardiac Isl1-interacting protein, represses cardiomyocyte hypertrophy. Circ Res. 2012; 110:818-30. [0101] 12. Ahmady E, Deeke S A, Rabaa S, Kouri L, Kenney L, Stewart A F and Burgon P G. Identification of a novel muscle A-type lamin-interacting protein (MLIP). J Biol Chem. 2011; 286:19702-13. [0102] 13. Cattin M E, Wang J, Weldrick J J, Roeske C L, Mak E, Thom S L, DaSilva J N, Wang Y, Lusis A J and Burgon P G. Deletion of MLIP (muscle-enriched A-type lamin-interacting protein) leads to cardiac hyperactivation of Akt/mammalian target of rapamycin (mTOR) and impaired cardiac adaptation. J Biol Chem. 2015; 290:26699-714. [0103] 14. Huang Z P, Kataoka M, Chen J, Wu G, Ding J, Nie M, Lin Z, Liu J, Hu X, Ma L, Zhou B, Wakimoto H, Zeng C, Kyselovic J, Deng Z L, Seidman C E, Seidman J G, Pu W T and Wang D Z. Cardiomyocyte-enriched protein CIP protects against pathophysiological stresses and regulates cardiac homeostasis. J Clin Invest. 2015; 125:4122-34. [0104] 15. Bulfield G, Siller W G, Wight P A and Moore K J. X chromosome-linked muscular dystrophy (mdx) in the mouse. Proceedings of the National Academy of Sciences of the United States of America. 1984; 81:1189-92. [0105] 16. Bruning J C, Michael M D, Winnay J N, Hayashi T, Horsch D, Accili D, Goodyear L J and Kahn C R. A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell. 1998; 2:559-69. [0106] 17. Molkentin J D, Lu J R, Antos C L, Markham B, Richardson J, Robbins J, Grant S R and Olson E N. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998; 93:215-28. [0107] 18. Grieger J C, Choi V W and Samulski R J. Production and characterization of adeno-associated viral vectors. Nature protocols. 2006; 1:1412-28. [0108] 19. O'Connell T D, Swigart P M, Rodrigo M C, Ishizaka S, Joho S, Tumbull L, Tecott L H, Baker A J, Foster E, Grossman W and Simpson P C. Alphal-adrenergic receptors prevent a maladaptive cardiac response to pressure overload. J Clin Invest. 2006; 116:1005-15. [0109] 20. Xing W, Zhang T C, Cao D, Wang Z, Antos C L, Li S, Wang Y, Olson E N and Wang D Z. Myocardin induces cardiomyocyte hypertrophy. Circ Res. 2006; 98:1089-97. [0110] 21. Bridges L R. The association of cardiac muscle necrosis and inflammation with the degenerative and persistent myopathy of MDX mice. J Neurol Sci. 1986; 72:147-57. [0111] 22. Quinlan J G, Hahn H S, Wong B L, Lorenz J N, Wenisch A S and Levin L S. Evolution of the mdx mouse cardiomyopathy: physiological and morphological findings. Neuromuscul Disord. 2004; 14:491-6. [0112] 23. Walcher T, Steinbach P, Spiess J, Kunze M, Gradinger R, Walcher D and Bernhardt P. Detection of long-term progression of myocardial fibrosis in Duchenne muscular dystrophy in an affected family: a cardiovascular magnetic resonance study. Eur J Radiol. 2011; 80:115-9. [0113] 24. Kuroda J, Ago T, Matsushima S, Zhai P, Schneider M D and Sadoshima J. NADPH oxidase 4 (Nox4) is a major source of oxidative stress in the failing heart. Proc Natl Acad Sci USA. 2010; 107:15565-70. [0114] 25. Matsushima S, Kuroda J, Ago T, Zhai P, Park J Y, Xie L H, Tian B and Sadoshima J. Increased oxidative stress in the nucleus caused by Nox4 mediates oxidation of HDAC4 and cardiac hypertrophy. Circ Res. 2013; 112:651-63. [0115] 26. Matsushima S, Kuroda J, Zhai P, Liu T, Ikeda S, Nagaraj an N, Oka S, Yokota T, Kinugawa S, Hsu C P, Li H, Tsutsui H and Sadoshima J. Tyrosine kinase FYN negatively regulates NOX4 in cardiac remodeling. J Clin Invest. 2016; 126:3403-16. [0116] 27. Owen J B and Butterfield D A. Measurement of oxidized/reduced glutathione ratio. Methods Mol Biol. 2010; 648:269-77. [0117] 28. Wilkins B J, Dai Y S, Bueno O F, Parsons S A, Xu J, Plank D M, Jones F, Kimball T R and Molkentin J D. Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004; 94:110-8. [0118] 29. Ni Y G, Berenji K, Wang N, Oh M, Sachan N, Dey A, Cheng J, Lu G, Morris D J, Castrillon D H, Gerard R D, Rothermel B A and Hill J A. Foxo transcription factors blunt cardiac hypertrophy by inhibiting calcineurin signaling. Circulation. 2006; 114:1159-68. [0119] 30. Berry J M, Le V, Rotter D, Battiprolu P K, Grinsfelder B, Tannous P, Burchfield J S, Czubryt M, Backs J, Olson E N, Rothermel B A and Hill J A. Reversibility of adverse, calcineurin-dependent cardiac remodeling. Circ Res. 2011; 109:407-17. [0120] 31. Williams C R and Gooch J L. Calcineurin Abeta regulates NADPH oxidase (Nox) expression and activity via nuclear factor of activated T cells (NFAT) in response to high glucose. J Biol Chem. 2014; 289:4896-905. [0121] 32. Heineke J, Auger-Messier M, Correll R N, Xu J, Benard M J, Yuan W, Drexler H, Parise L V and Molkentin J D. CIB1 is a regulator of pathological cardiac hypertrophy. Nat Med. 2010; 16:872-9. [0122] 33. Taigen T, De Windt L J, Lim H W and Molkentin J D. Targeted inhibition of calcineurin prevents agonist-induced cardiomyocyte hypertrophy. Proc Natl Acad Sci USA. 2000; 97:1196-201. [0123] 34. Heineke J and Molkentin J D. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol. 2006; 7:589-600. [0124] 35. Serrano A L and Munoz-Canoves P. Fibrosis development in early-onset muscular dystrophies: Mechanisms and translational implications. Semin Cell Dev Biol. 2017; 64:181-190. [0125] 36. Moulin M and Ferreiro A. Muscle redox disturbances and oxidative stress as pathomechanisms and therapeutic targets in early-onset myopathies. Semin Cell Dev Biol. 2017; 64:213-223. [0126] 37. Allen D G, Whitehead N P and Froehner S C. Absence of Dystrophin Disrupts Skeletal Muscle Signaling: Roles of Ca2+, Reactive Oxygen Species, and Nitric Oxide in the Development of Muscular Dystrophy. Physiol Rev. 2016; 96:253-305. [0127] 38. Dombernowsky N W, Olmestig J N E, Witting N and Kruuse C. Role of neuronal nitric oxide synthase (nNOS) in Duchenne and Becker muscular dystrophies—Still a possible treatment modality? Neuromuscul Disord. 2018; 28:914-926. [0128] 39. Russo V, Papa A A, Williams E A, Rago A, Palladino A, Politano L and Nigro G. ACE inhibition to slow progression of myocardial fibrosis in muscular dystrophies. Trends Cardiovasc Med. 2018; 28:330-337. [0129] 40. Goldfine A B and Shoelson S E. Therapeutic approaches targeting inflammation for diabetes and associated cardiovascular risk. J Clin Invest. 2017; 127:83-93. [0130] 41. Spumey C F. Cardiomyopathy of Duchenne muscular dystrophy: current understanding and future directions. Muscle & nerve. 2011; 44:8-19. [0131] 42. Whitehead N P, Yeung E W and Allen D G. Muscle damage in mdx (dystrophic) mice: role of calcium and reactive oxygen species. Clin Exp Pharmacol Physiol. 2006; 33:657-62. [0132] 43. Betts C A, McClorey G, Healicon R, Hammond S M, Manzano R, Muses S, Ball V, Godfrey C, Merritt T M, van Westering T, O'Donovan L, Wells K E, Gait M J, Wells D J, Tyler D and Wood M J. Cmah-dystrophin deficient mdx mice display an accelerated cardiac phenotype that is improved following peptide-PMO exon skipping treatment. Hum Mol Genet. 2019; 28:396-406. [0133] 44. Spumey C F, Knoblach S, Pistilli E E, Nagaraju K, Martin G R and Hoffman E P. Dystrophin-deficient cardiomyopathy in mouse: expression of Nox4 and Lox are associated with fibrosis and altered functional parameters in the heart. Neuromuscul Disord. 2008; 18:371-81. [0134] 45. Kyrychenko V, Polakova E, Janicek R and Shirokova N. Mitochondrial dysfunctions during progression of dystrophic cardiomyopathy. Cell Calcium. 2015; 58:186-95. [0135] 46. Khouzami L, Bourin M C, Christov C, Damy T, Escoubet B, Caramelle P, Perier M, Wahbi K, Meune C, Pavoine C and Pecker F. Delayed cardiomyopathy in dystrophin deficient mdx mice relies on intrinsic glutathione resource. Am J Pathol. 2010; 177:1356-64. [0136] 47. Kyrychenko S, Kyrychenko V, Badr M A, Ikeda Y, Sadoshima J and Shirokova N. Pivotal role of miR-448 in the development of ROS-induced cardiomyopathy. Cardiovasc Res. 2015; 108:324-34. [0137] 48. Gonzalez D R, Treuer A V, Lamirault G, Mayo V, Cao Y, Dulce R A and Hare J M. NADPH oxidase-2 inhibition restores contractility and intracellular calcium handling and reduces arrhythmogenicity in dystrophic cardiomyopathy. Am J Physiol Heart Circ Physiol. 2014; 307:H710-21. [0138] 49. Ago T, Kuroda J, Pain J, Fu C, Li H and Sadoshima J. Upregulation of Nox4 by hypertrophic stimuli promotes apoptosis and mitochondrial dysfunction in cardiac myocytes. Circ Res. 2010; 106:1253-64. [0139] 50. Esslinger U, Gamier S, Komiat A, Proust C, Kararigas G, Muller-Nurasyid M, Empana J P, Morley M P, Perret C, Stark K, Bick A G, Prasad S K, Kriebel J, Li J, Tiret L, Strauch K, O'Regan D P, Marguiles K B, Seidman J G, Boutouyrie P, Lacolley P, Jouven X, Hengstenberg C, Komajda M, Hakonarson H, Isnard R, Arbustini E, Grallert H, Cook S A, Seidman C E, Regitz-Zagrosek V, Cappola T P, Charron P, Cambien F and Villard E. Exome-wide association study reveals novel susceptibility genes to sporadic dilated cardiomyopathy. PLoS One. 2017; 12:e0172995. [0140] 51. He A, Kong S W, Ma Q, Pu W T. Co-occupancy by multiple cardiac transcription factors identifies transcriptional enhancers active in heart. Proceedings of the National Academy of Sciences of the United States of America. 2011; 108:5632-5637 [0141] 52. R. Rudolf, M. R. Deschenes, M. Sandri, Neuromuscular junction degeneration in muscle wasting. Curr Opin Clin Nutr Metab Care 19, 177-181 (2016). [0142] 53. L. Li, W. C. Xiong, L. Mei, Neuromuscular Junction Formation, Aging, and Disorders. Annu Rev Physiol 80, 159-188 (2018). [0143] 54. S. D. Gopinath, T. A. Rando, Stem cell review series: aging of the skeletal muscle stem cell niche. Aging Cell 7, 590-598 (2008). [0144] 55. S. Kuang, M. A. Rudnicki, The emerging biology of satellite cells and their therapeutic potential. Trends Mol Med 14, 82-91 (2008).
OTHER EMBODIMENTS
[0145] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.