CELLULAR TRANSPORT SYSTEM FOR TRANSFERRING A SULFONIC ACID CONSTRUCT CARRYING A CARGO INTO THE CYTOPLASM OF A CELL
20210009513 · 2021-01-14
Inventors
Cpc classification
C07C309/17
CHEMISTRY; METALLURGY
C07F9/65746
CHEMISTRY; METALLURGY
C07K2319/01
CHEMISTRY; METALLURGY
C07D239/47
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a cellular transport system for bringing a sulfonic acid construct which carries a cargo into a cell and releasing the cargo in the cell's cytoplasm, the cellular transport system comprising: (i) a sulfonate transporter located in the cytoplasm membrane of the cell wherein said sulfonate transporter is capable of transporting said sulfonic acid construct across the cytoplasm membrane into the cytoplasm; (ii) a -glutamyl transferase (GGT; EC 2.3.2.2) which is modified to be located in the cytoplasm of the cell, wherein said -glutamyl transferase is capable of hydrolyzing said sulfonic acid construct so as to release the cargo. Moreover, the present invention relates to the use of a cellular transport system for bringing a sulfonic acid construct which contains a cargo into a cell and releasing the cargo in the cell's cytoplasm. Further, the present invention relates to a -glutamyl transferase for hydrolyzing a sulfonic acid construct which contains a cargo.
Claims
1. A cellular transport system for bringing a sulfonic acid construct of the following formula (I) or a physiologically acceptable salt thereof ##STR00006## wherein: L.sup.1 is a group (CH.sub.2).sub.1-6, wherein said group (CH.sub.2).sub.1-6 is optionally substituted with one or more groups R.sup.L11, and further wherein one or more CH.sub.2 units comprised in said group (CH.sub.2).sub.1-6 are each optionally replaced by a group R.sup.L12; L.sup.2 is C(O) or C(S); X is a chemical moiety which is attached to L.sup.2 via a heteroatom comprised in said chemical moiety, wherein said heteroatom is selected from oxygen, sulfur, nitrogen and selenium; each R.sup.L11 is independently selected from C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, (C.sub.0-3 alkylene)-OH, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-OH, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-O(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SH, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-S(C.sub.1-5 alkylene)-SH, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkylene)-S(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NH.sub.2, (C.sub.0-3 alkylene)-NH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-halogen, (C.sub.0-3 alkylene)-(C.sub.1-5 haloalkyl), (C.sub.0-3 alkylene)-O(C.sub.1-5 haloalkyl), (C.sub.0-3 alkylene)-CF.sub.3, (C.sub.0-3 alkylene)-CN, (C.sub.0-3 alkylene)-NO.sub.2, (C.sub.0-3 alkylene)-CHO, (C.sub.0-3 alkylene)-CO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-COOH, (C.sub.0-3 alkylene)-COO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-OCO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-CONH.sub.2, (C.sub.0-3 alkylene)-CONH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-CON(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NHCO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)-CO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SO.sub.2NH.sub.2, (C.sub.0-3 alkylene)-SO.sub.2NH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SO.sub.2N(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NHSO.sub.2(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)-SO.sub.2(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-carbocyclyl, and (C.sub.0-3 alkylene)-heterocyclyl, wherein the carbocyclyl moiety comprised in said (C.sub.0-3 alkylene)-carbocyclyl and the heterocyclyl moiety comprised in said (C.sub.0-3 alkylene)-heterocyclyl are each optionally substituted with one or more groups R.sup.L15, and further wherein any two groups R.sup.L11 that are attached to different carbon atoms comprised in L.sup.1 may also be mutually linked to form together a group R.sup.L13, and wherein any two groups R.sup.L11 that are attached to the same carbon atom comprised in L.sup.1 may also be mutually linked to form, together with the carbon atom that they are attached to, a cycloalkyl or a heterocycloalkyl, wherein said cycloalkyl or said heterocycloalkyl is optionally substituted with one or more groups R.sup.L15; each R.sup.L12 is independently selected from O, CO, C(O)O, OC(O), N(R.sup.L14), N(R.sup.L14)CO, CON(R.sup.L14), SO, SO.sub.2, SO.sub.2N(R.sup.L14) and N(R.sup.L14)SO.sub.2; each R.sup.L13 is independently selected from C.sub.1-6 alkylene and C.sub.2-6 alkenylene, wherein said alkylene or said alkenylene is optionally substituted with one or more groups independently selected from C.sub.1-4 alkyl, OH, O(C.sub.1-4 alkyl), NH.sub.2, NH(C.sub.1-4 alkyl), N(C.sub.1-4 alkyl)(C.sub.1-4 alkyl), halogen, CF.sub.3, and CN, and further wherein one or more CH.sub.2 units comprised in said alkylene or in said alkenylene are each optionally replaced by a group independently selected from O, CO, NH, N(C.sub.1-5 alkyl)- and S; each R.sup.L14 is independently selected from hydrogen and C.sub.1-5 alkyl; and each R.sup.L15 is independently selected from C.sub.1-5 alkyl, C.sub.2-5 alkenyl, C.sub.2-5 alkynyl, (C.sub.0-3 alkylene)-OH, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-OH, (C.sub.0-3 alkylene)-O(C.sub.1-5 alkylene)-O(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SH, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-S(C.sub.1-5 alkylene)-SH, (C.sub.0-3 alkylene)-S(C.sub.1-5 alkylene)-S(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NH.sub.2, (C.sub.0-3 alkylene)-NH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-halogen, (C.sub.0-3 alkylene)-(C.sub.1-5 haloalkyl), (C.sub.0-3 alkylene)-O(C.sub.1-5 haloalkyl), (C.sub.0-3 alkylene)-CF.sub.3, (C.sub.0-3 alkylene)-CN, (C.sub.0-3 alkylene)-NO.sub.2, (C.sub.0-3 alkylene)-CHO, (C.sub.0-3 alkylene)-CO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-COOH, (C.sub.0-3 alkylene)-COO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-OCO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-CONH.sub.2, (C.sub.0-3 alkylene)-CONH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-CON(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NHCO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)-CO(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SO.sub.2NH.sub.2, (C.sub.0-3 alkylene)-SO.sub.2NH(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-SO.sub.2N(C.sub.1-5 alkyl)(C.sub.1-5 alkyl), (C.sub.0-3 alkylene)-NHSO.sub.2(C.sub.1-5 alkyl), and (C.sub.0-3 alkylene)-N(C.sub.1-5 alkyl)-SO.sub.2(C.sub.1-5 alkyl); into a cell and releasing a cargo from the sulfonic acid construct of formula (I) in the cell's cytoplasm, wherein said cargo is a compound HX wherein X is as defined in formula (I), and wherein the cellular transport system comprises: (i) a sulfonate transporter located in the membrane of the cell wherein said sulfonate transporter is capable of transporting the sulfonic acid construct of formula (I) across the cytoplasm membrane into the cytoplasm; (ii) a -glutamyl transferase (GGT; EC 2.3.2.2) which is modified to be located in the cytoplasm of the cell, wherein said -glutamyl transferase is capable of hydrolyzing the sulfonic acid construct of formula (I) to release the compound HX.
2. The cellular transport system according to claim 1, wherein L.sup.1 is (CH.sub.2).sub.3 and wherein L.sup.2 is C(O).
3. The cellular transport system according to claim 1, wherein the -glutamyl transferase (GGT) is modified to be located in the cytoplasm of the cell by a signal-peptide truncation.
4. The cellular transport system according to claim 1, wherein the -glutamyl transferase (GGT) has an amino acid sequence as shown in SEQ ID NO:1 or an amino acid sequence having at least 30% sequence identity to SEQ ID NO:1 and lacking at least 16 N-terminal amino acids, wherein the enzymatically active form of said -glutamyl transferase is capable of hydrolyzing said sulfonic acid construct of formula (I) to release the compound HX.
5. The cellular transport system according to claim 1, wherein the sulfonate transporter located in the cytoplasm membrane of the cell is a TauABC transporter or an SsuABC transporter derived from E. coli.
6. The cellular transport system according to claim 1, wherein the cell is a eukaryotic cell or a prokaryotic cell, preferably a yeast cell, a gram negative bacterial cell, more preferably an E. coli cell.
7. The cellular transport system according to claim 1, wherein X is selected from the group consisting of an amino acid, a sugar, a nucleobase, a nucleoside, a nucleotide, a phosphate containing organic group or a lipid.
8. The cellular transport system according to a claim 1, wherein the -glutamyl transferase has an amino acid sequence as shown in SEQ ID NO:1 or an amino acid sequence having at least 30% sequence identity to SEQ ID NO:1 in which the amino acid residue at position 433 in the amino acid sequence shown in SEQ ID NO:1 or at a position corresponding to this position is substituted with another amino acid residue.
9. The cellular transport system according to claim 1, wherein the -glutamyl transferase has an amino acid sequence as shown in SEQ ID NO:2 or an amino acid sequence having at least 30% sequence identity to SEQ ID NO:2 in which the amino acid residue at position 405 in the amino acid sequence shown in SEQ ID NO:2 or at a position corresponding to this position is substituted with another amino acid residue.
10. Use of the cellular transport system according to claim 1 for bringing a sulfonic acid construct of formula (I) into a cell and releasing the cargo HX in the cell's cytoplasm, wherein X is as defined in formula (I).
11. Use of a -glutamyl transferase of claim 1 for hydrolyzing a sulfonic acid construct of formula (I) so as to release a compound HX, wherein X is as defined in formula (I).
12. A method for transporting a cargo molecule into a cell comprising incubating a cell harbouring a transport system of claim 1 in a medium containing a sulfonic acid construct of formula (I) whereby said sulfonic acid construct is transported into the cell and is hydrolyzed within the cell by said GGT releasing in the cell from said sulfonic acid construct the cargo as HX, wherein X is as defined in formula (I).
13. A composition comprising: (a) a sulfonic acid construct of formula (I); and (b) a cell harbouring a cellular transport system of claim 1.
Description
[0315] In this specification, a number of documents including patent applications are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0316]
[0317]
[0318]
[0319]
[0320]
[0321]
[0322]
[0323]
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330]
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349] The invention will now be described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention.
EXAMPLES
1. Materials and Methods
1.1 Strains and Media
[0350] A list of all bacterial strains used in this study is provided in Table 1. For cloning purposes E. coli strains Top10 or DH5a pir were used. Growth experiments in selective medium were carried out in the leucine auxotrophic strains TK054 or TK054 pcnB. For the construction of TK054, the genes ggt, leuB and brnQ were replaced with disrupted versions by P1 phage transduction using respective donor strains from the KEIO collection (Baba et al., 2006; Thomason et al., 2007). The livFGHMK operon was inactivated by red recombination with a PCR fragment containing a kanamycin resistance gene amplified from pKD13 with the primers TK140 and TK141 (Datsenko and Wanner, 2000). To subsequently remove the kanamycin resistance gene, plasmid pCP20 was used (Cherepanov and Wackernagel, 1995). The gene pcnB was deleted by plasmid-based gene replacement (Martinez-Garcia and de Lorenzo, 2011; Martinez-Garcia and de Lorenzo, 2012). For this, 500 bp fragments upstream and downstream of pcnB (TS1 and TS2) were amplified, combined by PCR and cloned into plasmid pEMG via EcoRI and BamHI restriction sites. To integrate 6His_PnGGT N24 into the chromosome, the N-terminally tagged 6His_PnGGT N24 gene together with its promoter and the chloramphenicol resistance gene was amplified with the primers TK417 and TK418 using the plasmid as template. The PCR product was recombined with the E. coli chromosome in the intergenic region between yrhB and yhhA assisted by the red genes expressed from pKD46 (Datsenko and Wanner, 2000).
[0351] For the experiments relating to the sulfonate based synthetic transport system, growth experiments in selective medium were carried out in the leucine auxotrophic strains BW25113 leuB, BW25113 leuB ssuEADCB or BS25113 leuB ssuD. For the deletion of leuB and ssuD, the genes were replaced with disrupted versions by P1 phage transduction using respective donor strains from the KEIO collection (Baba et al., 2006; Thomason et al., 2007). The ssuEADCB operon was deleted by plasmid-based gene replacement (Martinez-Garcia and de Lorenzo, 2011; Martinez-Garcia and de Lorenzo, 2012). For this, 500 bp fragments upstream and downstream of the operon (TS1 and TS2) were amplified, combined by PCR and cloned into plasmid pEMG via EcoRI and BamHI restriction sites.
[0352] Additional growth experiments were carried out in the strains BW25113 leuB ssuEADCB tauD, BW25113 leuB ssuEADCB tauD hisB and BW25113 leuB ssuEADCB tauD nadAB. The genes hisB, nadA and tauD were replaced with disrupted versions by P1 phage transduction using respective donor strains from the KEIO collection (Baba et al., 2006; Thomason et al., 2007). The gene nadB was deleted by plasmid-based gene replacement (Martinez-Garcia and de Lorenzo, 2011; Martinez-Garcia and de Lorenzo, 2012). Flanking fragments were amplified with the primer pairs TK656/TK657 and TK658/TK659, combined via PCR using primers TK656/TK659 and cloned into pEMG via EcoRI and BamHI, yielding plasmid pEMG_nadB.
TABLE-US-00001 TABLE 1 Strains used in this study E. coli strain Description Reference Top10 F.sup. mcrA (mrr hsdRMS.sup.mcrBC) 80lacZM15 Life Technologies, lacX74 nupG recA1 araD139 (ara-leu)7697 Carlsbad, CA, USA galE15 galK16 rpsL(Str.sup.R) endA1 .sup. DH5 pir supE44, acU169, (80 lacZDM15), hsdR17, (rk.sup. (Platt et al., 2000) mk.sup.+), recA1, endA1, thi1, gyrA, relA, lysogenic pir JM101 glnV44 thi- 1 (lac-proAB) F[lacl.sup.qZM15 traD36 (Messing et al., 1981; proAB.sup.+] Yanisch-Perron et al., 1985) BW25113 F, (araD-araB)567, lacZ4787(::rrnB-3), .sup., Yale, CGSG rph-1, (rhaD-rhaB)568, hsdR514 (Datsenko and Wanner, 2000) JW3412 BW25113 ggt::kan Yale, CGSC (Baba et al., 2006) JW5807 BW25113 leuB::kan Yale, CGSC (Baba et al., 2006) JW0391 BW25113 brnQ::kan Yale, CGSC (Baba et al., 2006) TK054 JM101 leuB ggt liv brnQ This study TK054 ggt int TK054 with 6xHis_PnGGT N24 plasmid integrated This study in yrhB-yhhA intergenic region TK054 pcnB JM101 leuB ggt liv brnQ pcnB This study TK054 pcnB ggt int TK054 pcnB with 6xHis_PnGGT N24 plasmid This study integrated in yrhB-yhhA intergenic region BW25113 leuB BW25113 leuB This study BW25113 leuB ssuEADCB BW25113 leuB ssuEADCB This study BW25113 leuB ssuD BW25113 leuB ssuD This study JW0360 BW25113 tauD::kan Yale, CGSC (Baba et al., 2006) JW0733 BW25113 nadA::kan Yale, CGSC (Baba et al., 2006) JW2004 BW25113 hisB::kan Yale, CGSC (Baba et al., 2006) TK018 JM101 ggt This study TK082 BW25113 leuB ssuEADBC tauD This study TK088 BW25113 leuB ssuEADBC tauD hisB This study TK090 BW25113 leuB ssuEADBC tauD nadA nadB This study
[0353] LB Miller broth (Becton Dickinson, Sparks, Md., USA) was used as standard growth medium for bacterial cultures (Sambrook, 2001). For the preparation of competent cells, SOB medium was used (Hanahan, 1983). Unless stated otherwise, growth experiments in selective medium were carried out in M9 minimal medium (Sambrook, 2001) supplemented with 0.5% glucose, 1 g mL.sup.1 thiamine, 0.5 mM IPTG and 1 mM alanyl--glutamyl-leucine (>95% purity, custom synthesized by Pepscan, Lelystad, Netherlands). For growth experiments on solid medium Bacto Agar (Becton Dickinson) was added to a final concentration of 1.5%. Growth experiments in liquid medium were performed either in a Tecan Infinite 200 Pro plate reader (Tecan, Mannedorf, Switzerland) or in a Biolector Basic Microbiorector System (m2p-labs, Baesweiler, Germany). All growth experiments were performed at 37 C. For selection purposes, antibiotics were added to the following concentrations: kanamycin (50 g mL.sup.1); chloramphenicol (34 g mL.sup.1); carbenicillin (100 g mL.sup.1); gentamycin (10 g mL.sup.1).
[0354] For the experiments relating to the sulfonate based synthetic transport system, unless stated otherwise, growth experiments in selective medium were carried out in sulfur free MS minimal medium (4 mM citric acid, 1 mM MgCl.sub.2, 20 mM NH.sub.4Cl, 50 mM KH.sub.2PO.sub.4 and 1 NTA mix (10 M nitrilotriacetic acid, 3 M CaCl.sub.2, 3 M FeCl.sub.3, 1 M MnCl.sub.2, 0.3 M ZnCl.sub.2, 0.3 M H.sub.3B.sub.3, 0.3 M CrC.sub.3, 0.3 M COCl.sub.2, 0.3 M CuCl.sub.2, 0.3 M Ni.sub.2C, 0.3 M Na.sub.2MoO.sub.4, 0.3 M Na.sub.2SeO.sub.3)) supplemented with 0.5% glucose. MgSO.sub.4 (1 mM), MgCl.sub.2 (1 mM), L-leucine (0.4 mM), IPTG (0.5 mM), aTc (100 ng mL-1), nicotinic acid (various concentrations), 3-picolylamine (various concentrations) and sulfonates (various concentrations) as indicated in the text. Sulfobutanoyl-L-leucine (>98% purity) and sulfobutanoyl-L-histidine (>90% purity) were custom synthesized by Pepscan, (Lelystad, Netherlands). Synthesis schemes for sulfobutanoyl-p-nitroanilide and other sulfonates are given below.
1.2 DNA Constructs
[0355] The Pseudomonas nitroreducens PnGGT coding sequence (GenBank entry AB548627.1) was chemically synthesized (Thermo Fisher Scientific, Regensburg, Germany). The E. coli EcGGT gene was amplified from genomic DNA of strain JM101. For PCR amplification of DNA Phusion High Fidelity DNA Polymerase (New England BioLabs, Ipswich, Mass., USA) was used. To construct truncated variants of EcGGT and PnGGT, the length of the signal peptide was first predicted using the SignalP 4.0 algorithm (Petersen et al., 2011). Then, alternative forward primers were used to remove the first 16 or 24 amino acids. All plasmids were constructed by conventional cloning using restriction enzymes and Quick Ligation Kit (both New England BioLabs). All DNA constructs were verified by Sanger sequencing (Microsynth, Balgach, Switzerland) and are summarized in Table 2.
[0356] For the experiments relating to the sulfonate based synthetic transport system, D to N mutations in EcGGT and PnGGT were introduced by PCR using primer pairs TK269/TK270 and TK275/TK276, respectively (Wang and Malcolm, 1999). Mutations in PnGGT* were introduced using the same method, but with template pPnGGT* and primer pairs TK595/TK596 (R94X), TK603/TK604 (T381X N383X), TK599/TK600 (E402X D405X), TK593/TK594 (F416X), TK601/TK602 (S434X S435), TK605/TK606 (G455X G456X), TK640/TK641 (D385X), TK642/TK643 (R170X) and TK644/TK645 (Y167X Q168X). Ribosome binding site libraries of pPnGGT* were prepared as described previously using primer pair TK534/TK535 (Kuenzl et al., 2017). All constructs used in this study are listed in Table 2. Oligonucleotides are listed in Table 3.
TABLE-US-00002 TABLE 2 Plasmids used in this study Plasmid Description Reference pACT3 Expression vector; pLlacO1; p15A ori; Cm.sup.R, lacl.sup.q (Dykxhoorn et al., 1996) pSEVA271 MCS; pSC101 ori, Kan.sup.R (Martinez-Garcia et al., 2015) pKD46 Red recombination genes; araBp-gam-bet-exo; (Datsenko and Wanner, 2000) repA101 (ts); oriR101; Ap.sup.R pKD13 FRT-Kan.sup.R-FRT; oriR6K; Ap.sup.R (Datsenko and Wanner, 2000) pCP20 yeast Flp recombinase gene; p.sub.R Rep.sup.ts, (Cherepanov and Wackernagel, 1995) Ap.sup.R, Cm.sup.R pEMG Delivery vector for scarless deletion; oriR6K; (Martinez-Garcia and de Lorenzo, 2011) lacZ with two flanking l-Scel sites; Kan.sup.R pParal-Scel l-Scel gene under control of L-arabinose (Billerbeck and Panke, 2012) inducible promoter; p15A ori, Gm.sup.R pACT3/6xHis_EcGGT EcGGT gene with N-terminal MRGSHHHHHHGSAC This study (SEQ ID NO: 32) sequence cloned in pACT3 pACT3/EcGGT_6xHis EcGGT gene with C-terminal LEHHHHHH This study (SEQ ID NO: 33) sequence cloned in pACT3 pACT3/6xHis_EcGGT N16 EcGGT N16 gene with N-terminal MRGSHHHHHHGSACEL This study (SEQ ID NO: 34) sequence cloned in pACT3 pACT3/6xHis_EcGGT N24 (pEcGGT) EcGGT N24 gene with N-terminal MRGSHHHHHHGSACEL This study (SEQ ID NO: 35) sequence cloned in pACT3 pACT3/6xHis_PnGGT PnGGT gene with N-terminal MRGSHHHHHHGSAC This study (SEQ ID NO: 36) sequence cloned in pACT3 pACT3/6xHis_PnGGT N16 PnGGT N16 gene with N-terminal MRGSHHHHHHGSACEL This study (SEQ ID NO: 37) sequence cloned in pACT3 pACT3/6xHis_PnGGT N24 (pPnGGT) PnGGT N24 gene with N-terminal MRGSHHHHHHGSACEL This study (SEQ ID NO: 38) sequence cloned in pACT3 pACT3/6xHis_PnGGT N24 RBS 1 6xHis_PnGGT N24 with standard RBS replaced This study by RBS mutant 1 pACT3/6xHis_PnGGT N24 RBS 3 6xHis_PnGGT N24 with standard RBS replaced This study by RBS mutant 3 pACT3/6xHis_PnGGT N24 RBS 4 6xHis_PnGGT N24 with standard RBS replaced This study by RBS mutant 4 pACT3/6xHis_PnGGT N24 RBS 12 6xHis_PnGGT N24 with standard RBS replaced This study by RBS mutant 12 pACT3/6xHis_PnGGT N24 RBS 23 6xHis_PnGGT N24 with standard RBS replaced This study by RBS mutant 23 pEMG-pcnB pEMG bearing a 1.0 kb TS1-TS2 EcoRI-BamHI insert This study for deleting pcnB pACT3/EcGGT_N24_D433N EcGGT N24 D433N gene with N-terminal This study MRGSHHHHHHGSACEL sequence cloned in pACT3 pACT3/PnGGT_N24_D405N PnGGT N24 D405N gene with N-terminal This study MRGSHHHHHHGSACEL sequence cloned in pACT3 pEMG-ssu pEMG bearing a 1.0 kb TS1-TS2 EcoRI-BamHI insert This study for deleting ssu pAB92 pSEVA vector backbone; MCS; pBR322 ori, Amp.sup.R; Bosshart et al., 2015) P.sub.tet-P.sub.T7 fusion promoter pSEVA271_P.sub.tet P.sub.tet-P.sub.T7; MCS; pSC101 ori, Kan.sup.R This study pEMG_ssuEADCB pEMG bearing a 1.0 kb TS1-TS2 EcoRI-BamHI insert This study for deleting ssuEADCB pEMG_nadB pEMG bearing a 1.0 kb TS1-TS2 EcoRI-BamHI insert This study for deleting nadB pEcGGT_D433N pEcGGT with D433N mutation in ggt gene This study pPnGGT* (pPnGGT_D405N) pPnGGT with D405N mutation in ggt gene This study pSsuABC pSEVA271 backbone with P.sub.tet-P.sub.T7 fusion promoter This study from pAB92 and refactored ssuABC operon pPnGGT*_RBS1 pPnGGT* with RBS sequence replaced by CCAGGGGG This study pPnGGT*_RBS3 pPnGGT* with RBS sequence replaced by CGCGGGGG This study pPnGGT*_RBS4 pPnGGT* with RBS sequence replaced by AGGGGGGG This study pPnGGT*_RBS9 pPnGGT* with RBS sequence replaced by TACGGGGG This study pPnGGT*_D385Y pPnGGT* with D385Y mutation in ggt gene This study pPnGGT*_P505T pPnGGT* with P505T mutation in ggt gene This study pPnGGT*_Y167V_Q168P pPnGGT* with Y167V and Q168P mutation in ggt gene This study pPnGGT*_Y167H_Q168G pPnGGT* with Y167H and Q168G mutation in ggt gene This study pPnGGT*_Y169D_R170E pPnGGT* with Y169D and R170E mutation in ggt gene This study pPnGGT*_R170A pPnGGT* with R170A mutation in ggt gene This study
1.3 Protein Expression and Purification
[0357] For the expression of GGT variants, cells were grown to an approximate OD.sub.600 of 0.5 and induced with 0.5 mM IPTG. After 20 hours expression at 20 C., cells were harvested and lysed in lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, 1 mg mL.sup.1 lysozyme, pH 8.0) for 30 minutes on ice. After a freeze/thaw cycle, samples were centrifuged and the supernatant containing the soluble protein fraction was collected. Purification of 6His_EcGGT N24 and 6His_PnGGT N24 was performed according to previous reports (Van Dyke et al., 1992) using Ni-NTA Superflow (Qiagen, Hilden, Germany). For fractionation of E. coli cells into periplasmic and cytoplasmic fraction PeriPreps Periplasting Kit (Epicentre, Madison, Wis., USA) was used according to the instructions of the manufacturers. Purity of the fractions was analyzed by measuring the activities of the enzymes alkaline phosphatase (providing 5 mM 4-methylumbelliferyl-phosphate as the substrate, 50 mM Tris/HCl pH 10.0 as the buffer for the reaction, 5 L sample in 250 L of total volume) and -glucoronidase (5 mM 4-methylumbelliferyl-p-D-glucuronide, 50 mM Tris/HCl pH 7.5, 5 L sample in 250 L of total volume). In both cases, release of the fluorescent product 4-methylumbelliferone was measured using an excitation wavelength of 360 nm and emission wavelength of 449 nm.
[0358] Cell extracts and purified GGT variants were analyzed by SDS-PAGE as previously reported (Laemmli, 1970). For cell extracts, 10-20 g of protein was loaded per well. For western blots, proteins were transferred to an Amersham Protran 0.45 nitrocellulose membrane (GE Healthcare, Little Chalfont, UK) using a Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, Calif., USA) (Towbin et al., 1979). GGT variants fused to a 6His-tag were detected using a primary mouse anti-His Tag antibody (GenScript, Piscataway, N.J., USA) and fluorescence labeled secondary IRDye 800CW Goat anti-Mouse IgG or IRDye 680RD Goat anti-Mouse IgG antibodies (LI-COR, Lincoln, Nebr., USA).
[0359] For the experiments relating to the sulfonate based synthetic transport system, purification of PnGGT N24 and PnGGT N24 D405N containing an N-terminal 6His-tag was performed according to previous reports (Van Dyke et al., 1992) using Ni-NTA Superflow (Qiagen, Hilden, Germany). For kinetic studies, PnGGT variants were purified with the aid of the 6His-tag located at the N-terminal end of the large subunit following the same procedure. To exchange the buffer, purified proteins were dialyzed against 50 mM Tris/HCl (pH 7.0).
1.4 Enzymatic GGT Assay
[0360] Determination of GGT activity was performed as described previously with slight modifications (Orlowski and Meister, 1970; Suzuki et al., 1986). For better solubility, the substrate L-glutamic acid -(3-carboxy-4-nitroanilide) (Sigma-Aldrich, St. Louis, Mo., USA) was used and added to a final concentration of 4 mM to start the reaction. To determine transpeptidase activity, 20 mM glycyl-glycine (Sigma-Aldrich) was added to the reaction. For determination of hydrolase activity, glycyl-glycine was omitted. As reaction buffer 50 mM Tris-HCl (pH 9.0) was used. To determine enzyme kinetics, absorption at 410 nm was constantly measured at 37 C. in a Tecan Infinite 200 Pro plate reader (Tecan). One unit is defined as the amount of enzyme required to catalyze the formation of 1 mol of 3-carboxy-4-nitroaniline per minute.
[0361] For the experiments relating to the sulfonate based synthetic transport system, to determine the activity in whole cell lysates in 50 mM Tris-HCl (pH 9.0) the substrates L-glutamic acid -(3-carboxy-4-nitroanilide) (Sigma-Aldrich, St. Louis, Mo., USA) or sulfobutanoyl-p-nitroanilide were added to a final concentration of 4 mM to start the reaction. To determine enzyme activity, absorption at 410 nm was constantly measured at 37 C. in a Tecan Infinite 200 Pro plate reader (Tecan, Mannedorf, Switzerland). One unit is defined as the amount of enzyme required to catalyze the formation of 1 mol of 3-carboxy-4-nitroaniline or 4-nitroaniline per minute.
[0362] To determine the kinetic parameters of PnGGT N24 and PnGGT N24 D405N the purified enzymes were preincubated in 50 mM Tris-HCl (pH 9.0). To start the reaction, varying concentrations of the substrates L-glutamic acid -(3-carboxy-4-nitroanilide) or sulfobutanoyl-p-nitroanilide were added to the mixtures. The results were evaluated using GraphPad Prism (GraphPad Software, La Jolla, Calif., USA).
1.5 Generation of RedLibs RBS Library
[0363] To generate the reduced ribosome binding site (RBS) library, first an initial RBS library using RBS calculator version 1.1 was generated (Espah Borujeni et al., 2014; Salis et al., 2009). For this, the RBS sequence of pACT3/6His_PnGGT N24 was randomized from position 8 to 15 (relative to the ATG start codon) with the degenerated base N, resulting in a library containing a total number of 65,536 sequences. To remove a large fraction of very weak or non-functional RBS sequences, we ran the RedLibs algorithm to reduce the library size to 81 variants (Jeschek et al., 2016). To introduce this library, the parent plasmid pACT3/6His_PnGGT N24 was amplified with primers TK534 and TK535, introducing the randomized RBS sequence (IUPAC nomenclature) HVVGGVGG (20 cycles, 61 C. (0.2 C./cycle) annealing temperature, 8 minutes elongation time/cycle) (Wang and Malcolm, 1999). Subsequently, this PCR library was used to transform strain TK054 and plated on selective medium.
1.6 Genome Sequencing of Mutant Strains
[0364] Genomic DNA was isolated from the respective strains using High Pure PCR Template Preparation Kit (Roche Diagnositcs, Basel, Switzerland). Libraries for sequencing were prepared using TruSeq DNA Sample Preparation Kit v2 (Illumina, San Diego, Calif., USA). The libraries were then purified using 0.7 Vol Agencourt AMPure XP beads (Beckman Coulter, Pasadena, Calif., USA) to exclude very short library fragments. Purified libraries were sequenced on the MiSeq (Illumina) PE 2301 cycles using the 600-cycle v3 kit and converted to fastq files. For the alignment of reads the Bowtie 2 package was used (Langmead and Salzberg, 2012; Langmead et al., 2009). For analysis of sequences the deepSNV package (Gerstung et al., 2012; Gerstung et al., 2014) and Integrated Genome Viewer (Robinson et al., 2011; Thorvaldsdttir et al., 2013) were used.
1.7 Oligonucleotides Used
[0365] Table 3 shows the oligonucleotides used. The restriction sites are underlined.
TABLE-US-00003 TABLE3 Primer Sequence Description TK037 ATATGAGCTCAGGAGGATATACATATGAGAGGATCGCATCAC Forwardprimerforcloningof CATCACCATCACGGATCCGCATGCATAAAACCGACGTTTTTA 6xHis_EcGGT(SacI) CGCCGGG(SEQIDNO:12) TK040 ATATGAGCTCAGGAGGATATACATATGAGAGGATCGCATCAC Forwardprimerforcloningof CATCACCATCACGGATCCGCATGCGAACTCTCAGGAAGTTGT 6xHis_EcGGTN16(SacI) TTTAGCGCCGC(SEQIDNO:13) TK326 ATATGAGCTCAGGAGGATATACATATGAGAGGATCGCATCAC Forwardprimerforcloningof CATCACCATCACGGATCCGCATGCGAACTC 6xHis_EcGGTN24(SacI) GCCGCGCCTCCTG(SEQIDNO:14) TK038 ATATCTGCAGTCATCAGTACCCCGCCGTTAAATCATCCAC Reverseprimerforcloningof (SEQIDNO:15) 6xHis_EcGGT,6xHis_EcGGT NISand6xHis_EcGGTN24 (PstI) TK021 ATATGAGCTCAGGAGGATATACATATGATAAAACCGACGTTTT Forwardprimerforcloningof TACGCCGGG(SEQIDNO:16) EcGGT_6xHis(SacI) TK022 ATATCTGCAGTCATCAGTGGTGGTGGTGGTGGTGCTCGAGGT Reverseprimerforcloningof ACCCCGCCGTTAAATCATCCACCG(SEQIDNO:17) EcGGT_6xHis(PstI) TK053 ATATGAGCTCAGGAGGATATACATATGAGAGGATCGCATCAC Forwardprimerforcloningof CATCACCATCACGGATCCGCATGCATGCGCGTGTTCCACTTC 6xHis_PnGGT(SacI) AG(SEQIDNO:18) TK324 ATATGAGCTCAGGAGGATATACATATGAGAGGATCGCATCAC Forwardprimerforcloningof CATCACCATCACGGATCCGCATGCGAACTCGCGGCGAGTTC 6xHis_PnGGTN16(SacI) GTC(SEQIDNO:19) TK325 ATATGAGCTCAGGAGGATATACATATGAGAGGATCGCATCAC Forwardprimerforcloningof CATCACCATCACGGATCCGCATGCGAACTCACCCTCGACGG 6xHis_PnGGTN24(SacI) CG(SEQIDNO:20) TK054 ATATCTGCAGTCATCAGGGTTTGACCACCATCCCG(SEQID Reverseprimerforcloningof NO:21) 6xHis_PnGGT,6xHis_PnGGT N1Sand6xHis_PnGGTN24 TK140 AAAACAACATCACAACACACGTAATAACCAGAAGAATGGGGA Forwardprimerforamplification TTCTCAGGGTGTAGGCTGGAGCTGCTTC(SEQIDNO:22) oflivoperonknockoutfragment frompKD13 TK141 TGTCACCTGTCTCAAAGGAGTCTTTTGACTCCCTATCAATCAA Reverseprimerforamplification CGTGTTAATTCCGGGGATCCGTCGACC(SEQIDNO:23) oflivoperonknockoutfragment frompKD13 TK389 ATATGAATTCGGTCACGCAATTTACTGACCAGC(SEQID TS1Fprimerforscarless NO:24) deletionofpcnB(EcoRI) TK390 GGACGACGAGTACGACGACGAGCGGCTAATCATAGCTCAGC TS1Rprimerforscarless (SEQIDNO:25) deletionofpcnB TK391 GCTGAGCTATGATTAGCCGCTCGTCGTCGTACTCGTCGTCC TS2Rprimerforscarless (SEQIDNO:26) deletionofpcnB TK392 TATAGGATCCGACGCAACATCTCCCCATCAGG(SEQID TS2Rprimerforscarless NO:27) deletionofpcnB(BamHI) TK534 CACACAGGAAACAGAATTCGAGCTHVVGGVGGTATACATATG Forwardprimerforgenerationof AGAGGATCGCATCACC(SEQIDNO:28) pACT3/6xHis_PnGGTN24 RBSlibrary TK535 GGTGATGCGATCCTCTCATATGTATACCBCCBBDAGCTCGAA Reverseprimerforgeneration TTCTGTTTCCTGTGTG(SEQIDNO:29) ofpACT3/6xHis_PnGGTN24 RBSlibrary TK417 CGCGTATCCTCCTCTGAAGATATCCTTTAAGTTTACTCGCTTC Forwardprimerforamplification CCGACAAAACGATGATTAATTCAGAGTTGTTGATACCGGGAA ofpACT3/6xHis_PnGGTN24 GCCCTG(SEQIDNO:30) forgenomeintegration TK418 GAAATAAAAAAGGCTACCTTCGGCTTGCCCTGACAAAATAGC Reverseprimerforamplification CCTCTTCCCACGAAGAGGGCCGCTAACCCAGAGCAAGAGAT ofpACT3/6xHis_PnGGTN24 TACGCGCAG(SEQIDNO:31) forgenomeintegration TK269 AATAACCAGATGGATAATTTCTCCGCCAAACCGG(SEQID Forwardprimerforintroducing NO:54) D433NmutationinEcGGT TK270 CCGGTTTGGCGGAGAAATTATCCATCTGGTTATT(SEQID Reverseprimerforintroducing NO:55) D433NmutationinEcGGT TK275 CGACGAGATGGATAACTTCAGCTCCAAGC(SEQIDNO:56) Forwardprimerforintroducing D405NmutationinPnGGT TK276 GCTTGGAGCTGAAGTTATCCATCTCGTCG(SEQIDNO:57) Reverseprimerforintroducing D405NmutationinPnGGT TK485 ATATGAATTCTGGCACATCAATTTGCACGCC(SEQIDNO:58) TS1Fprimerforscarless deletionofssu(EcoRI) TK486 CCGAATGGCGGCAATAGCGCGGTCAGTCTGTCGGAGAGAC TS1Rprimerforscarless (SEQIDNO:59) deletionofssu TK487 GTCTCTCCGACAGACTGACCGCGCTATTGCCGCCATTCGG TS2Rprimerforscarless (SEQIDNO:60) deletionofssu TK488 TATAGGATCCGCTGGTGAGCAAGCAGTTCC(SEQIDNO:61) TS2Rprimerforscarless deletionofssu(BamHI) TK593 CGTGGCCAACGCCNNKGGCGTGGTGGGCAG(SEQIDNO:62) Forwardprimerfor randomizationofresidueF416 inPnGGT* TK594 CTGCCCACCACGCCMNNGGCGTTGGCCACG(SEQIDNO:63) Reverseprimerfor randomizationofresidueF416 inPnGGT* TK595 GTACTTCCTCGACTACNNKGAGATCGCGCCGAAGG(SEQID Forwardprimerfor NO:64) randomizationofresidueR94in PnGGT* TK596 CCTTCGGCGCGATCTCMNNGTAGTCGAGGAAGTAC(SEQID Reverseprimerfor NO:65) randomizationofresidueR94in PnGGT* TK599 GGCTTCCTGCTCAACGACNNKATGGATNNKTTCAGCTCCAAG Forwardprimerfor CCGGGC(SEQIDNO:66) randomizationofresidueE402 andD405inPnGGT* TK600 GCCCGGCTTGGAGCTGAAMNNATCCATMNNGTCGTTGAGCA Reverseprimerfor GGAAGCC(SEQIDNO:67) randomizationofresidueE402 andD405inPnGGT* TK601 CGGGCAAGCGCATGCTCNNKNNKATGAGCCCGAGCATCGTC Forwardprimerfor (SEQIDNO:68) randomizationofresidueS434 andS435inPnGGT* TK602 GACGATGCTCGGGCTCATMNNMNNGAGCATGCGCTTGCCCG Reverseprimerfor (SEQIDNO:69) randomizationofresidueS434 andS435inPnGGT* TK603 GCCGTCAGCAACACCTACNNKCTCNNKTGGGACTTCGGCAG Forwardprimerfor CGGC(SEQIDNO:70) randomizationofresidueT381 andN383inPnGGT* TK604 GCCGCTGCCGAAGTCCCAMNNGAGMNNGTAGGTGTTGCTGA Reverseprimerfor CGGC(SEQIDNO:71) randomizationofresidueT381 andN383inPnGGT* TK605 GGTGCTGGGCACGCCCNNKNNKTCGCGGATCTTCACTTCG Forwardprimerfor (SEQIDNO:72) randomizationofresidueG455 andG456inPnGGT* TK606 CGAAGTGAAGATCCGCGAMNNMNNGGGCGTGCCCAGCACC Reverseprimerfor (SEQIDNO:73) randomizationofresidueG455 andG456inPnGGT* TK621 CTATAGGGAGACCACAACGGTTTCCCTCTA Forwardprimerforamplification AGGRGSHHAAACATGCGTAACATCATTAAACTGGCGC(SEQ ofssuAwithanRBSlibrary IDNO:74) containing32variantsanda5 overhangforassemblywiththe pSEVA271_P.sub.tet-P.sub.T7backbone TK622 TCATAATTGTTTTCCTTCCAGTTGAGTGG(SEQIDNO:75) Reverseprimerforamplification ofssuA TK623 CCCACTCAACTGGAAGGAAAACAATTATGA Forwardprimerforamplification GGRGGWVBCGGAATGAATACTGCTCGTCTGAACCAG(SEQ ofssuBwithanRBSlibrary IDNO:76) containing32variantsanda5 overhangforassemblywith ssuA TK624 TTACCCCTGTTTTCTCAGGCGAG(SEQIDNO:77) Reverseprimerforamplification ofssuB TK625 TCTGAAACTCGCCTGAGAAAACAGGGGTAA Forwardprimerforamplification GGAGGDDNAAGGATGGCAACGCCAGTGAAGAAG(SEQID ofssuCwithanRBSlibrary NO:78) containing32variantsanda5 overhangforassemblywith ssuB TK626 TCATACCGTGGCCTCCTTCAAATG(SEQIDNO:79) Reverseprimerforamplification ofssuC TK627 CGGCTTATCATTTGAAGGAGGCCACGGTATGACCTCCTGTGT Forwardprimerforamplification GAAATTGTTATCCGC(SEQIDNO:80) ofthepSEVA271_P.sub.tet-P.sub.T7 backbonewitha5overhangfor assemblywithssuC TK628 TAGAGGGAAACCGTTGTGGTC(SEQIDNO:81) Reverseprimerforamplification ofthepSEVA271_P.sub.tet-P.sub.T7 backbone TK635 CTATAGGGAGACCACAACGGTTTCCCTCTA Forwardprimerforamplification NGGRRGDHAAACATGCGTAACATCATTAAACTGGCGC(SEQ ofssuAwithanRBSlibrary IDNO:82) containing144variantsanda5 overhangforassemblywiththe pSEVA271_P.sub.tet-P.sub.T7backbone TK636 CCCACTCAACTGGAAGGAAAACAATTATGA Forwardprimerforamplification GGRRGDNHCGGAATGAATACTGCTCGTCTGAACCAG(SEQ ofssuBwithanRBSlibrary IDNO:83) containing144variantsanda5 overhangforassemblywith ssuA TK637 TCTGAAACTCGCCTGAGAAAACAGGGGTAA Forwardprimerforamplification RGRGGDDNAAGGATGGCAACGCCAGTGAAGAAG(SEQID ofssuCwithanRBSlibrary NO:84) containing144variantsanda5 overhangforassemblywith ssuB TK640 CTACACCCTCAACTGGNNNTTCGGCAGCGGCGTGG(SEQID Forwardprimerfor NO:85) randomizationofresidueD385 inPnGGT* TK641 CCACGCCGCTGCCGAANNNCCAGTTGAGGGTGTAG(SEQID Reverseprimerfor NO86) randomizationofresidueD385 inPnGGT* TK642 CAGCAGTACCAGTACNNNCAGGACGCCATCGCG(SEQID Forwardprimerfor NO:87) randomizationofresidueR170 inPnGGT* TK643 CGCGATGGCGTCCTGNNNGTACTGGTACTGCTG(SEQID Reverseprimerfor NO:88) randomizationofresidueR170 inPnGGT* TK644 GGTCGCCGACCAGCAGNNKNNKTACCGCCAGGACGCC(SEQ Forwardprimerfor IDNO:89) randomizationofresiduesY167 andQ168inPnGGT* TK645 GGCGTCCTGGCGGTAMNNMNNCTGCTGGTCGGCGACC Reverseprimerfor (SEQIDNO:90) randomizationofresiduesY167 andQ168inPnGGT* TK656 ATATGAATTCCGGGAAACCAGACTCGC(SEQIDNO:91) TS1Fprimerforscarless deletionofnadB(EcoRI) TK657 CGCTGACCCAGGCTTTTTATCTG TS1Rprimerforscarless GTCACATGAATGTTCAGGGAGAG(SEQIDNO:92) deletionofnadB TK658 CTCTCCCTGAACATTCATGTGAC TS2Rprimerforscarless CAGATAAAAAGCCTGGGTCAGCG(SEQIDNO:93) deletionofnadB TK659 ATATGGATCCGGAAAGTGAAGCTGCCGC(SEQIDNO:94) TS2Rprimerforscarless deletionofnadB(BamHI)
1.8 Construction of pSsuABC
[0366] First, plasmid pSEVA271_P.sub.tet was constructed by cutting out the P.sub.tet-P.sub.T7 promoter together with the multiple cloning site (MCS) from pAB92 with the restriction enzymes Pacl and Spel (both New England Biolabs). The resulting fragment was ligated into the backbone of pSEVA271 that was digested with the same restriction enzymes. The reduced RBS libraries comprising either 36 or 144 variants were generated individually for each gene using the RedLibs algorithm (Jescheck et al., 2016). The single genes were amplified from the E. coli chromosome using forward primers encoding the respective RBS libraries and a 30 base pair sequence complementary to the upstream element in their 5-overhangs. To construct the plasmid libraries, the respective ssuA, ssuB and ssuC fragments were assembled with the backbone of plasmid pSEVA271_P.sub.tet by Gibson assembly (New England Biolabs).
1.9 In Vivo Hydrolysis of Sulfobutanoyl-p-Nitroanilide and Sulfobutanoyl-AMC
[0367] Strain TK082 was transformed with plasmids as indicated in the text and grown at 37 C. in MS minimal medium supplemented with 0.5% glucose, 1 mM MgSO.sub.4 and 0.4 mM L-leucine to an OD.sub.600 of 0.5. At that stage, the synthesis of PnGGT* and/or SsuABC was induced for 2 hours by adding 0.5 mM IPTG and 100 ng mL.sup.1 aTc. Following this synthesis period, cells were washed in the same medium to remove proteins that had been released into the medium by cell lysis. After an additional centrifugation step, cells were resuspended in MS minimal medium supplemented with 0.5% glucose, 1 mM MgSO.sub.4, 0.4 mM L-leucine, 0.5 mM IPTG, 100 ng mL.sup.1 aTc and 0.5 mM sulfobutanoyl-p-nitroanilide or sulfobutanoyl-AMC (see below for description of synthesis) and incubated in a Tecan Infinite 200 Pro plate reader at 37 C. To monitor cell density and the release of 4-nitroaniline, absorbance was constantly measured at 600 nm and 410 nm. The release of AMC was monitored by measuring the fluorescence at ex=350 nm and em=450 nm. To determine the influence of competition for the sulfonate transporter SsuABC, different concentrations of pentanesulfonate (Sigma Aldrich) were added to the medium.
1.10 Complementation of an NAD.sup.+ Auxotrophic Strain with N-Picolyl-Sulfobutyramide
[0368] Selection experiments with NAD.sup.+ auxotrophic strains are prone to contamination with unwanted NAD.sup.+ sources and therefore demand special preparation of the precultures and medium. For the precultures, all tested strains were incubated overnight in MS minimal medium supplemented with 0.5% glucose, 1 mM MgSO.sub.4, 0.4 mM L-leucine and 5 M nicotinic acid. To guarantee complete consumption of nicotinic acid, precultures were then diluted 100-fold in MS minimal medium supplemented only with 0.5% glucose, 1 mM MgSO.sub.4 and 0.4 mM L-leucine, but no additional NAD.sup.+ source. Following an overnight incubation period, NAD.sup.+-deprived cells were washed twice in the same medium and used for growth assays.
[0369] To prepare the medium for final growth assays, MS minimal medium was supplemented with 0.5% glucose, 1 mM MgSO.sub.4, 0.4 mM L-leucine and 25 M N-picolyl-sulfobutyramide (see below for description of synthesis). To remove all NAD.sup.+ contaminants, the medium was inoculated overnight with strain TK090, which can utilize free NAD.sup.+ precursors, but cannot take up or hydrolyze N-picolyl-sulfobutyramide due to the absence of SsuABC and PnGGT*. After an overnight incubation period, cells were separated from the medium by centrifugation and the supernatant was filtered using a Minisart 0.22 m High Flow Syringe Filter (Sartorius, Goettingen, Germany). The filtered supernatant was then supplemented with the respective antibiotics and inducers and used for growth assays.
1.11 Kinetics with Sulfobutanoyl-L-Leucine
[0370] The hydrolysis of sulfobutanoyl-L-leucine by PnGGT* variants was measured by quantifying the release of leucine by PnGGT* using a branched-chain amino acid (BCAA) kit (Sigma-Aldrich). For that, 50 L of the BCAA reaction mix containing 46 L BCAA assay buffer, 2 L BCAA enzyme mix and 2 L WST substrate mix were pre-incubated with 35 L BCAA assay buffer and 5 L purified PnGGT* (final concentration approximately 0.05 mg mL-1) at 37 C. The reaction was started by adding 10 L of sulfobutanoyl-L-leucine diluted in 50 mM Tris/HCl (pH 7.0) at different concentrations and absorbance at 450 nm was constantly measured at 37 C. in a Tecan Infinite 200 Pro plate reader. The reaction rate of PnGGT* variants was determined as the specific difference in absorption over time (A (450 nm) per minute per mg of purified protein).
1.12 Protein Modeling
[0371] A homology model of PnGGT was created with the SWISS-MODEL workspace (Guex et al., 2009; Arnold et al. 2006; Kiefer et al., 2009; Biasini et al., 2014) using the crystal structure of E. coli GGT bound to glutamate (PDB accession number: 2DBX) as template (Okada et al., 2006). YASARA Structure (YASARA Biosciences GmBH, Vienna, Austria) was used to introduce mutation D405N into the homology model and to change the glutamate ligand to sulfobutanoic acid. After all modifications, energy minimization was performed using the YASARA force field with default settings. To visualize the protein structures, YASARA and Chimera (Pettersen et al., 2004) were used.
1.13 Synthesis of Sulfobutyramide Analogues
[0372] The synthesis of sulfobutyramide analogues is schematically illustrated in
N-(3-Pyridinylmethyl)-4-[(triphenylmethyl)thio]-butyramide (4)
[0373] 4-[(Triphenylmethyl)thio]butanoic acid (2.00 g, 5.51 mmol), which was prepared from 4-bromobutyric acid according to a literature procedure (Qvit et al., 2008), and O-(benzotriazol-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate (HBTU, 2.51 g, 6.62 mmol) were dissolved in dry DMF (25 mL) under a nitrogen atmosphere. This solution was cooled to 0 C. and 3-(aminomethyl)pyridine 1 (0.66 g, 0.62 mL, 6.10 mmol) was then added, followed by N,N-diisopropylethylamine (DIPEA, 2.85 g, 3.84 mL, 22.0 mmol). The reaction mixture was stirred overnight at room temperature. It was then diluted with ethyl acetate and washed with saturated aq. NaHCO.sub.3, water, and a 1M solution of KHSO.sub.4. The organic layer was dried over MgSO.sub.4, filtered, and evaporated in vacuo to leave a crude residue that was purified by column chromatography (CH.sub.2Cl.sub.2:MeOH 95:5) to afford the title compound as a white solid (2.45 g, 98% yield). .sup.1H NMR (300 MHz, CDCl.sub.3): 8.49 (d, J=3.8 Hz, 1H, ArH, 8.45 (d, 1H, J=1.5 Hz, ArH, 7.57 (d, J=7.8 Hz, 1H, ArH, 7.43 (m, 6H, ArH, 7.30-7.19 (m, 10H, ArH, 6.25 (t, J=5.7 Hz, 1H, NH), 4.36 (d, J=5.9 Hz, 2H, NHCH.sub.2), 2.23 (t, J=7.0 Hz, 2H, CH.sub.2), 2.17 (t, J=7.3 Hz, 2H, CH.sub.2), 1.72 (quint, J=7.2 Hz, 2H, -CH.sub.2); .sup.13C NMR (75 MHz, CDCl.sub.3): 172.5, 149.4, 149.1, 145.1, 135.9, 134.4, 129.8, 128.2, 126.9, 123.9, 66.9, 41.2, 35.6, 31.7, 24.9; HRMS for C.sub.29H.sub.28N.sub.2O.sub.1S.sub.1 [M+H].sup.+ calcd.: 453.1994, found: 453.1996.
N-(3-Pyridinylmethyl)sulfobutyramide sodium salt (N-picolyl-sulfobutyramide; 6a)
[0374] Compound 4 (0.551 g, 1.22 mmol) was dissolved in CH.sub.2Cl.sub.2 (5 mL) and the resulting solution was cooled to 0 C. Trifluoroacetic acid (5 mL) was then added followed by triethylsilane (0.71 g, 0.98 mL, 6.09 mmol) and the mixture was stirred at room temperature for 1.5 h. After removal of all the volatiles in vacuo, the crude residue was quickly purified by column chromatography (CH.sub.2Cl.sub.2:MeOH 9:1) to give N-(3-pyridinylmethyl)-4-mercapto-butyramide 5 as a colourless oil (0.26 g; HRMS for C.sub.1H.sub.14N.sub.2O.sub.1S.sub.1 [M+H].sup.+ calcd.: 211.0899, found: 211.0898). To a stirred solution of 5 (0.357 g, 1.70 mmol) in THE (2 mL) cooled at 0 C. was added trifluoroacetic acid (1.66 mL) followed by the dropwise addition of a 35% aq. solution of hydrogen peroxide (0.98 mL). The ice-bath was removed and the reaction mixture was stirred at room temperature for 40 min. After removal of all the volatiles in vacuo, the crude residue was purified by reverse phase (C18) HPLC (H.sub.2O:CH.sub.3CN), the collected eluate was subsequently passed through a column containing the ion-exchanger Amberlite IR 120 Na.sup.+ form, and purified once more by reverse phase HPLC to afford the sodium salt of 6a as a white solid (34%). .sup.1H NMR (500 MHz, D.sub.2O): 8.62 (br s, 2H, ArH), 8.27 (d, J=8.1 Hz, 1H, ArH, 7.85-7.83 (m, 1H, ArH, 4.53 (s, 2H, NHCH.sub.2), 2.89 (t, J=7.6 Hz, 2H, CH.sub.2), 2.48 (t, J=7.5 Hz, 2H, CH.sub.2), 2.03 (quint, J=7.5 Hz, 2H, -CH.sub.2); .sup.13C NMR (125 MHz, D.sub.2O): 176.0, 142.6, 142.5, 142.4, 137.5, 126.3, 50.0, 40.2, 34.0, 20.6; HRMS for C.sub.10H.sub.14N.sub.2O.sub.4S.sub.1 [MH].sup. calcd.: 257.0601, found: 257.0602.
N-(4-Nitrophenyl)sulfobutyramide sodium salt (sulfobutanoyl-p-nitroanilide; 6b)
[0375] 4-Nitroaniline 2 (5.0 g, 36 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (100 mL) and cooled to 0 C. DIPEA (13 mL, 72 mmol) was then added, followed by the dropwise addition of 4-chlorobutyryl chloride (4.8 mL, 43 mmol), and the reaction mixture was stirred at room temperature overnight. After completion, a saturated aq. NaHCO.sub.3 solution was added and the solution was extracted with CH.sub.2Cl.sub.2. The organic layers were combined, dried over MgSO.sub.4, and evaporated in vacuo to give crude product 7a. Compound 7a was then dissolved in dry DMF (25 mL) and potassium thioacetate (12.3 g, 108 mmol) was added, and the reaction mixture was stirred at 40 C. overnight. After completion, the solvent was removed in vacuo, water was added and extracted with CH.sub.2C.sub.2. The organic layers were combined, dried over MgSO.sub.4, and evaporated in vacuo to afford compound 8a as a brown oil, which was used in the next step without further purification. Compound 8a was suspended in acetic acid and CH.sub.3COONa (11 g, 144 mmol) was then added. The reaction mixture was warmed to 40 C., 35% aq. H.sub.2O.sub.2 was then added dropwise, and the mixture was stirred overnight at 40 C. After disappearance of the starting material (TLC), the solvent was evaporated in vacuo and the resulting residue was treated with saturated aq. NaHCO.sub.3 and stirred for 2 h until the effervescence stopped. This aqueous solution was washed with diethyl ether and CH.sub.2Cl.sub.2, and the water layer was lyophilized to afford a yellow powder. The residue was purified by silica gel column chromatography using isopropanol and water as elution system to remove the excess of salts. The yellow solid thus obtained was redissolved in a minimum amount of water, purified by reverse phase (C-18) HPLC (H.sub.2O:CH.sub.3CN), and lyophilized to afford pure 6b as yellowish solid in 20% overall yield. .sup.1H NMR (300 MHz, D.sub.2O): 8.27 (2H, d, J=9.0 Hz, ArH), 7.81 (2H, d, J=9.0 Hz, ArH), 2.90 (2H, m, CH.sub.2), 2.56 (2H, m, CH.sub.2), 2.04 (2H, m, CH.sub.2), .sup.13C NMR (75 MHz, D.sub.2O): 175.8, 143.6, 142.7, 124.7, 119.6, 49.6, 33.4, 20.2: HRMS (ESI) for C.sub.10H.sub.11N.sub.2O.sub.6S [MH].sup. calcd.: 287.0343; found 287.0336.
N-(4-Methyl-2-oxo-2H-1-benzopyran-7-yl)chlorobutyramide (7b)
[0376] 7-Amino-4-methylcoumarin 3 (0.100 g, 0.57 mmol) was dissolved in a mixture of dry CH.sub.2Cl.sub.2 (10 mL) and DMF (2 mL) under an argon atmosphere, and then cooled to 0 C. in an ice-bath. Subsequently, dry pyridine (0.09 mL, 1.14 mmol) was added, followed by the dropwise addition of 4-chlorobutyryl chloride (0.08 mL, 0.86 mmol). The reaction mixture was then stirred overnight at 35 C. After partial removal of all the volatiles in vacuo, water was then added. The solid precipitate was washed repeatedly with water, collected by filtration through a Buchner funnel, and dried in vacuo to afford the title compound in the form of a white solid (0.135 g, 84% yield). .sup.1H NMR (300 MHz, DMSO): 10.4 (s, 1H, NH), 7.74 (s, 1H, H-8), 7.69 (d, J=8.7 Hz, 1H, H-5), 7.46 (d, J=8.5 Hz, 1H, H-6), 6.23 (s, 1H, H-3), 3.70 (t, J=6.4 Hz, 2H, -CH.sub.2), 3.32 (s, 3H, CH.sub.3), 2.53 (t, J=7.3 Hz, 2H, -CH.sub.2), 2.04 (t, J=6.93 Hz, 2H, 3-CH.sub.2); .sup.13C NMR (75 MHz, DMSO): 171.1, 160.2, 153.8, 153.2, 142.6, 126.0, 115.2, 115.0, 112.3, 105.7, 45.1, 33.7, 27.8, 18.1; HRMS for C.sub.14H.sub.14Cl.sub.1N.sub.1O.sub.3 [M+H].sup.+ calcd.: 280.0735, found: 280.0732.
N-(4-Methyl-2-oxo-2H-1-benzopyran-7-yl)sulfobutyramide (sulfobutanoyl-AMC; 6c)
[0377] Compound 7b (0.135 g, 0.48 mmol) was dissolved in dry DMF (5 mL) under an argon atmosphere, and then potassium thioacetate (0.066 g, 0.58 mmol) was added. The mixture was stirred at room temperature overnight. The solvent was then removed in vacuo to leave a crude residue, which was washed repeatedly with water. After filtration through a Buchner funnel, thioester 8b was isolated as a tanned solid (0.110 g; HRMS for C.sub.16H.sub.17N.sub.1O.sub.4S.sub.1 [MH].sup. calcd.: 318.0805, found: 318.0805), dried in vacuo, and used as such in the following step. To a stirred solution of thioester 8b (0.092 g, 0.29 mmol) in trifluoroacetic acid (0.28 mL) cooled at 0 C. was added dropwise a 35% aq. solution of hydrogen peroxide (0.16 mL). The ice-bath was removed and the reaction mixture was stirred at room temperature for 30 min. After removal of all the volatiles in vacuo, the crude residue was purified by reverse phase (C.sub.18) HPLC (H.sub.2O:CH.sub.3CN) to afford pure 3 as a white fluffy solid (0.048 g) in 38% yield over two steps. .sup.1H NMR (300 MHz, D.sub.2O): 7.31 (d, J=8.6 Hz, 1H, H-5), 7.17 (d, J=1.7 Hz, 1H, H-8), 7.01 (dd, J=8.4, 1.8 Hz, 1H, H-6), 5.97 (s, 1H, H-3), 2.91 (t, J=7.2 Hz, 2H, CH.sub.2), 2.48 (t, J=7.5 Hz, 2H, CH.sub.2), 2.12 (s, 3H, CH.sub.3), 1.98 (t, J=7.5 Hz, 2H, -CH.sub.2); .sup.13C NMR (75 MHz, D.sub.2O): 173.6, 163.7. 155.4, 152.5, 140.6, 125.3, 116.0, 115.6, 111.4, 106.4, 49.8, 34.8, 20.0, 17.4; HRMS for C.sub.14H.sub.15N.sub.1O.sub.6S.sub.1 [MH].sup. calcd.: 324.047, found: 324.0558.
2. Example 1: Comparison of E. coli and Pseudomonas nitroreducens GGT
[0378] In order to ensure efficient cargo release in the cytoplasm of E. coli, it was important to ensure (I) efficient expression in the cytoplasm of E. coli, (II) high hydrolytic and low transpeptidase activity even in the presence of a suitable peptide or amino acid acceptor, and (Ill) a high promiscuity regarding the -glutamyl substrate. As promising candidates the EcGGT from E. coli has been identified which is well-characterized (Suzuki and Kumagai, 2002; Suzuki et al., 1986) and for which a protein structure is available (Okada et al., 2006), and the PnGGT from P. nitroreducens, which was reported with a higher hydrolytic than transpeptidase activity and a broad substrate range (Imaoka et al., 2010).
[0379] First, the influence of the location of a hexahistidine tag (6His-tag) on expression and activity of both variants was investigated. To determine expression levels, western blot analysis with an antibody against the 6His-tag was performed. Activity was determined using the substrate L-glutamic acid -(3-carboxy-4-nitroanilide) under two conditions, either in the presence or absence of glycyl-glycine as a second substrate, allowing either hydrolytic and transpeptidase or only hydrolytic activity, respectively. Both activities lead to the formation of the yellow dye 3-carboxy-4-nitroaniline, but previous experiments (Suzuki et al., 1986) and own observations (data not shown) suggest that transpeptidase activity is revealed in this assay by an increase in product formation on top of the product release due to hydrolysis. In other words, identical product release rates in the presence and absence of glycyl-glycine indicate absence of transpeptidase activity.
[0380] Fusion of the 6His-tag to the C-terminus of EcGGT led to partial accumulation of the presumably inactive precursor polypeptide and reduced GGT activity in cell lysates compared to a variant with N-terminal 6His-tag (
[0381] To directly compare the activities of EcGGT and PnGGT, N-terminal 6His-tag fusion variants 6His_EcGGT N24 and 6His_PnGGT N24 (for description see below) were purified and specific activities were determined. For EcGGT, the product release rate was 3-fold higher in the presence of glycyl-glycine, suggesting a considerable transpeptidase activity. In contrast, similar activities were measured for PnGGT in the absence and presence of glycyl-glycine (
3. Example 2: Cytoplasmic Expression of PnGGT
[0382] For efficient intracellular cargo release, GGT has to operate in the cytoplasm instead of its natural reaction space, the periplasm. As suggested by a bioinformatics analysis (Petersen et al., 2011), the wild type gene encodes a 25 amino acid residues signal peptide at the 5 end of the gene, and previous work with EcGGT suggested interference of the His-tag with the secretion of GGT to the periplasmic space (Lo et al., 2008). The expression of PnGGT was tested with an N-terminal 6His-tag added in front of the signal peptide of the precursor. A high GGT activity was determined in cell lysates, but the large subunit, which in the case of retention in the cytoplasm could have been expected to remain attached to the His-tag via the signal peptide, was hardly detectable in western blot analysis (
[0383] To determine the cellular localization of PnGGT, the variants with and without signal peptide (6His_PnGGT and 6His_PnGGT N24, respectively) were expressed again in E. coli and the periplasmic protein fraction was separated from the cytoplasmic fraction by osmotic shock. To analyze the purity of the periplasmic and cytoplasmic fraction, activities of the periplasmic enzyme alkaline phosphatase and the cytoplasmic enzyme -glucoronidase were determined in both fractions, and the fractions were found to be around 80% (periplasmic) and 90% (cytoplasmic) pure. In a strain expressing 6His_PnGGT 78% of GGT activity was detected in the periplasmic fraction, consistent with the notion that an N-terminally 6His-tagged protein variant with the full signal peptide is indeed efficiently exported into the periplasmic space. However, in cells expressing 6His_PnGGT N24, 80% of the GGT activity was found in the cytoplasm, consistent with the notion that deletion of the signal peptide effectively prevents secretion to the periplasmic space (
4. Example 3: Applying 6His_PnGGT N24 in a Synthetic Transport System
[0384] The possibility to express 6His_PnGGT N24 in the cytoplasm of E. coli and the enzyme's relaxed substrate specificity (Imaoka et al., 2010) opened up the possibility to selectively hydrolyze -glutamyl compounds within the cytoplasm. To demonstrate the activity of 6His_PnGGT N24 in an in vivo situation, it was aimed at unloading of a cargo molecule from a -glutamyl peptide after uptake through a peptide transporter. As a cargo, leucine was chosen, whose successful release could be easily detected by restoring growth to a leucine auxotrophic strain. For this, E. coli strain JM101 was made leucine auxotrophic (leuB). Additional deletions were made in the chromosome of this strain, specifically in the ggt gene, to exclude effects caused by endogenous EcGGT, and in the leucine transporter genes brnQ and livFGHMK (Adams et al., 1990; Ohnishi et al., 1988). While deletion of these transporters reduces the uptake of free leucine from the medium, it is of note that it does not completely abolish it (
[0385] Interestingly, this initial growth experiment had produced a few colonies at the end of an extended incubation period of 5 days, raising the possibility that these cells had acquired a mutation that led to the improved growth phenotype. These colonies were re-isolated on the same medium and three isolates showed improved growth on selective medium with notable growth already after 2 days (
[0386] To verify that the beneficial effects to growth with Ala--Glu-Leu were caused by activity reducing mutations in pcnB, the entire gene was removed from the unmutated leucine auxotrophic selection strain, resulting in strain TK054 pcnB. On M9 minimal medium containing 0.5% glucose and 1 mM Ala--Glu-Leu as the only source of leucine, no growth of this strain was detected if the inducer IPTG was omitted (
[0387] Comparable results were obtained for growth in liquid medium (
5. Example 4: Investigation of the Effects of pcnB on the Synthetic Transport System
[0388] In E. coli, the pcnB-encoded enzyme PAP I is responsible for the polyadenylation of RNAs and was shown to contribute to the destabilization of mRNAs (Blum et al., 1999; Yehudai-Resheff and Schuster, 2000). A deletion of pcnB can therefore delay the onset of RNA degradation and thus result in increased mRNA half-life. The amino acid sequence of the E. coli pcnB-encoded enzyme PAP I is shown in SEQ ID NO:11. On the other hand, pcnB is also involved in copy number maintenance of ColE1 and p15A plasmids: As the replication of these plasmids is initiated by the small RNAII, a deletion of pcnB leads to an extended functional half-life of the antagonistic RNAI, resulting in decreased copy numbers of plasmids that replicate by this mechanism (Hershfield et al., 1974; Xu et al., 1993). Therefore, deletion of pcnB most likely results in upregulation of crucial players of the synthetic transport system like peptide transporters, peptidases or 6His_PnGGT N24 due to prolonged mRNA half-life, and/or in lower expression of 6His_PnGGT N24 due to reduced copy number due to the location of the gene on a p15A-type replicon. To differentiate between these two groups of influences, the effect of expressing GGT at reduced level was investigated in a pcnB.sup.+ background. The pertinent parts of the 6His_PnGGT N24 expression plasmid were integrated into the chromosome of strains TK054 and TK054 pcnB, resulting in strains TK054 ggt int and TK054 pcnB ggt int, respectively. Chromosomal integration of the GGT gene results in a single gene copy per genome in contrast to plasmids where it was expected to have between 16 and 22 copies per genome in a wild-type strain (Chang and Cohen, 1978). Indeed, reduced expression of 6His_PnGGT N24 showed beneficial effects on mineral medium supplemented with glucose and Ala--Glu-Leu as the sole source of leucine: As expected, neither TK054 nor TK054 pcnB grew if they were transformed with the empty plasmid pACT3. When the two strains were transformed with the plasmid pACT3/6His_PnGGT N24, only TK054 pcnB was able to grow, as observed in previous experiments. If, however, 6His_PnGGT N24 was expressed from the chromosome (
[0389] This interpretation was also supported by total activity data for the different strains. Cells were lysed after overnight expression in rich medium and GGT activity of whole cell lysates was measured. The highest GGT activity was detected when 6His_PnGGT N24 was expressed from a plasmid in a strain with a functional pcnB gene, a combination for which no growth was detected on selective medium. In the pcnB deletion strain transformed with the same plasmid, GGT activity dropped more than ten-fold, correlating with the reduction in plasmid copy number of the p15A-type expression plasmid (data not shown). If the gene for 6His_PnGGT N24 was integrated into the chromosome, equally low GGT activities were detected for strains with and without a functional pcnB copy, consistent with the notion that the gene copy number no longer depended on PcnB (
6. Example 5: Optimization of 6His_PnGGT N24 Expression from Plasmids
[0390] To construct an optimized strain for the synthetic transport system it was then aimed at identifying the optimal expression level of 6His_PnGGT N24. To maintain flexibility, the ggt gene was retained on a plasmid, the plasmid pACT3/6His_PnGGT N24 was used as starting point, and its ribosome binding site (RBS) was engineered to obtain a wide distribution of translation initiation rates (TIRs) (Espah Borujeni et al., 2014; Salis et al., 2009). By using the RedLibs algorithm (Jeschek et al., 2016), a reduced RBS library was generated of 81 variants (sequence HVVGGVGG, original sequence CAGGAGGA) covering a predicted translation range from 0.1 fold to 14 fold relative to the RBS of the parent construct (translation initiation ratios (TIRs) ranging from 3693 to 613384 arbitrary units, with the TIR of the wild type RBS predicted at 42646 (Espah Borujeni et al., 2014; Salis et al., 2009)) (
TABLE-US-00004 TABLE4 RBSsequenceandtranslationinitiation ratesofthe24fastestgrowingvariants Clone# Sequence TIR 17 ACAGGCGG 21171.47 (SEQIDNO:39) 18 ACAGGCGG 21171.47 (SEQIDNO:39) 20 ACAGGCGG 21171.47 (SEQIDNO:39) 21 ACAGGCGG 21171.47 (SEQIDNO:39) 23 ACAGGCGG 21171.47 (SEQIDNO:39) 1 CGGGGCGG 10974.66 (SEQIDNO:40) 7 CGGGGCGG 10974.66 (SEQIDNO:40) 3 ACGGGCGG 21171.47 (SEQIDNO:41) 16 ACGGGCGG 21171.47 (SEQIDNO:41) 4 CGCGGGGG 27985.38 (SEQIDNO:42) 8 CGCGGGGG 27985.38 (SEQIDNO:42) 12 TCGGGCGG 13620.97 (SEQIDNO:43) 15 TCGGGCGG 13620.97 (SEQIDNO:43) 2 TCCGGCGG 4421.58 (SEQIDNO:44) 5 TACGGCGG 10304.52 (SEQIDNO:45) 6 CCAGGCGG 20607.43 (SEQIDNO:46) 9 CAGGGAGG 130429.9 (SEQIDNO:47) 11 CAAGGCGG 31743.72 (SEQIDNO:48) 13 ACCGGCGG 10304.52 (SEQIDNO:49) 14 CAGGGCGG 17212.46 (SEQIDNO:50) 19 CGAGGCGG 26995.73 (SEQIDNO:51) 22 TGGGGCGG 6113.69 (SEQIDNO:52) 24 TGAGGCGG 19700.56 (SEQIDNO:53) 10
[0391] However, it should be noted that these predictions, while a useful tool to qualitatively estimate the strength of a TIR, are not a reliable predictor of the absolute TIR of any given RBS (Salis et al., 2009). Therefore, the fact that RBS's with a TIR prediction lower than wild type were strongly enriched among fast growing strains is another clear indication that a reduction of total cytoplasmic activity of GGT is beneficial. To corroborate the estimates with activity and protein level data, western blot and colorimetric activity analysis data after growth on rich medium were used again. The highest GGT levels were detected in the strain harboring the pACT3/6His_PnGGT N24 parent plasmid, while strains carrying a plasmid with one of the five most frequently isolated RBS variants led to significantly lower levels of the large subunit (
[0392] To conclude this section, the original proof-of-concept experiment for leucine portage that had only delivered poor growth when using the original pACT3/6His_PnGGT N24 parent plasmid was repeated. For this, strain TK054 was transformed with the parent plasmids and the five RBS variants and the resulting strains were grown again on solid selective medium containing 0.5% glucose, 1 mM Ala--Glu-Leu and 0.5 mM IPTG at 37 C. After two days, no growth was detectable where the strain had been transformed with the pACT3/6His_PnGGT N24 parent plasmid. In contrast, transformation of the same strain with plasmids containing the mutant RBS sequences led to dense and rapid growth over the same period (
7. Example 6: Toxicity of High Levels of Cytoplasmic GGT
[0393] From the results presented above, it becomes clear that high intracellular levels of GGT are not tolerated by E. coli on selective medium. This could be due to a variety of reasons. For example, GGT is known to hydrolyze glutamine to glutamate (Imaoka et al., 2010) and could thus establish a futile cycle of glutamine synthesis when expressed in the cytoplasm or simply a reduction of glutamine levels. It was also shown previously that supplementation of a medium with certain leucine containing peptides can be toxic for E. coli, because essential enzymes can be inhibited by too high concentrations of leucine (Gollop et al., 1982; Tavori et al., 1981). In order to investigate whether the beneficial effect of lower 6His_PnGGT N24 expression on viability is independent from the fact that we used leucine for auxotrophy complementation in this study, the leucine prototrophic strain JM101 was transformed with the pACT3/6His_PnGGT N24 parent plasmid and the five RBS mutant variants. These transformants were grown in minimal medium supplemented with 0.5% glucose and 0.5 mM IPTG (i.e. without the leucine-containing peptide as substrate) and compared the growth behavior of the different transformants. The strain harboring the pACT3/6His_PnGGT N24 parent plasmid exhibited a significantly increased lag phase of approximately 30 hours. All strains harboring a pACT3/6His_PnGGT N24 plasmid with mutated RBS sequence showed rapid growth after a significantly shorter lag phase (
8. Example 7: Exploring the Potential of GGT to Hydrolyze 4-Sulfobutanoyl Amides
[0394] To ensure efficient release of cargo molecules from a sulfobutanoyl transport vector in the cytoplasm of E. coli, it is essential to confirm enzymatic activity for the hydrolysis of sulfobutanoyl amides. As outlined above, a synthetic transport system was set up by recruiting the promiscuous enzyme GGT for the release of different cargo molecules from -glutamyl backbones. Interestingly, it was previously demonstrated that introducing an aspartate to asparagine mutation in a variant of the E. coli GGT (EcGGT D433N) endows the enzyme with glutaryl-7-aminocephalosporanic acid (GL-7-ACA) acylase activity (Suzuki et al., 2004; Yamada et al., 2008). Given the structural similarity between the glutaryl moiety of GL-7-ACA and the sulfobutanoyl moiety, EcGGT D433N was investigated as a starting point for generating an enzyme that is capable of hydrolyzing sulfobutanoyl amides.
[0395] To test for the desired activity a colorimetric enzyme assay was chosen and the substrate sulfobutanoyl-p-nitroanilide was synthesized for this purpose. Hydrolysis of this colorless substrate by a GGT variant into sulfobutanoic acid and the yellow dye 4-nitroaniline can be quantified photometrically at 410 nm. For that, cytoplasmic GGT variants containing an N-terminal 6His-tag were first expressed from E. coli (EcGGT N24) and Pseudomonas nitroreducens (PnGGT N24), as well as EcGGT N24 D433N and the corresponding mutant variant PnGGT N24 D405N. Position D405 of PnGGT was identified to fulfill the same function as position D433 of EcGGT by sequence alignment and homology modeling between EcGGT and PnGGT. Then the ability of whole cell lysates containing the respective enzymes was tested to hydrolyze L-glutamic acid -(3-carboxy-4-nitroanilide) or sulfobutanoyl-p-nitroanilide. As expected, EcGGT N24 and PnGGT N24 were both able to hydrolyze L-glutamic acid -(3-carboxy-4-nitroanilide), but showed no activity towards sulfobutanoyl-p-nitroanilide (
[0396] To further characterize the hydrolysis of -glutamyl-p-nitroanilide and sulfobutanoyl-p-nitroanilide by PnGGT N24 and PnGGT N24 D405N, the kinetic parameters of the two enzymes with both substrates was determined (Table 5,
TABLE-US-00005 TABLE 5 Kinetic parameters of PnGGT N24 and PnGGT N24 D405N PnGGT N24 PnGGT N24 D405N -Glu-p- sulfobutanoyl- -Glu-p- sulfobutanoyl- nitroanilide p-nitroanilide nitroanilide p-nitroanilide K.sub.M [M] 105 +/ 2 ND 6498 +/ 3212 767 +/ 40 V.sub.max [mol/min/mg] 34.94 +/ 0.47 ND 1.79 +/ 0.61 10.35 +/0.28 k.sub.cat [s.sup.1] 34.5 ND 1.8 10.2 k.sub.cat/K.sub.M [1/mM s.sup.1] 328.57 ND 0.28 13.30 ND = not determined
9. Example 8: Uptake of Sulfobutanoyl Amides by E. coli
[0397] The sulfonate transporters SsuABC and TauABC transport a wide variety of sulfonate compounds (Eichhorn et al., 2000) and can thus be exploited for the present synthetic transport system. As such, the uptake and utilization of sulfobutanoyl-L-leucine was assessed. The leucine auxotrophic strain BW25113 leuB was tested for growth in minimal medium supplemented with 0.5% glucose, 0.4 mM leucine, 0.4 mM isoleucine and 1 mM of a sulfur-containing compound as the sole sulfur source. It was observed that growth on sulfobutanoyl-L-leucine and sulfobutanoyl-p-nitroanilide was comparable to growth on other sulfonates like pentanesulfonate or hexanesulfonate and only slightly less efficient compared to growth on magnesium sulfate (
[0398] Next, it was identified which transport system is responsible for uptake of the sulfobutanoyl amides, and so similar growth experiments were carried out with a strain lacking the more promiscuous sulfonate transporter SsuABC and the alkanesulfonate monooxygenase SsuDE (BW25113 leuB ssuEADCB). Deletion of this broad specificity sulfonate transporter prevented growth on both sulfobutanoyl amides suggesting that uptake and desulfonation of the sulfobutanoyl amides is facilitated by these proteins.
10. Example 9: Intracellular Release of Leucine from Sulfobutanoyl-L-Leucine
[0399] It was then tested if sulfobutanoyl-L-leucine can also be hydrolyzed intracellularly by GGT*. Strains BW25113 leuB or BW25113 leuB ssuD were transformed either with the empty vector pACT3 or the expression plasmids pACT3/EcGGT_N24_D433N and pACT3/PnGGT_N24_D405N. All transformed strains were grown on plates containing minimal medium supplemented with 0.5% glucose, 0.4 mM isoleucine, 0.5 mM taurine, 0.5 mM IPTG and 2 mM sulfobutanoyl-L-leucine. Strain BW25113 leuB ssuD was tested in parallel to prevent desulfonation of sulfobutanoyl-L-leucine by SsuDE, which would render the substrate unavailable for hydrolysis by GGT*. In principle, sulfobutanoyl-L-leucine can be used by E. coli as leucine source through hydrolysis by GGT* and also as sulfur source through desulfonation of either sulfobutanoyl-L-leucine itself or the GGT* hydrolysis product sulfobutanoic acid by the enzymes SsuDE and/or TauD (
[0400] BW25113 leuB grows best on this medium when expressing PnGGT N24 D405N while expression of EcGGT N24 D433N leads to slower growth, which is in good agreement with the activity measurements of the two GGT* variants (
11. Example 10: Testing Other Sulfur Sources than Taurine
[0401] To further improve the system TauD is deleted in order to eliminate a potential sink for sulfobutanoyl-L-leucine.
[0402] Deletion TauD prevents the use of taurine as a sulfur source and as such another source will have to be identified. Unfortunately, most commonly used sulfur sources like sulfate, sulfite or cysteine cannot be used in this setting because they lead to a repression of the ssu operon, which would prevent the uptake of sulfobutanoyl-L-leucine into the cell. Therefore, a sulfur source is identified that can be rapidly utilized by E. coli, does not cause repression of the ssu operon and does not compete with sulfobutanoyl-L-leucine for the transporter SsuABC. Thiosulfate is expected to fulfill all the mentioned criteria which is further investigated.
12. Example 11: Increasing the Affinity of GGT* for Sulfobutanoyl-L-Leucine
[0403] Kinetic studies with PnGGT N24 D405N and sulfobutanoyl-L-leucine revealed that the affinity of the enzyme for the substrate is relatively low (K.sub.M of 734 M), which might be a limiting factor for the efficiency of the transport system. Therefore, the functionality of the transport system is improved by engineering GGT* with the goal to increase the affinity towards sulfobutanoyl amides. In a previous publication it was shown for EcGGT that mutations in several residues of the substrate binding pocket can lead to improved binding of glutaryl substrates (Yamada et al., 2008), opening up the possibility that mutations in these residues can also lead to improved binding of sulfobutanoyl substrates. To test this, saturation mutagenesis of 10 residues in the substrate binding pockets of EcGGT and PnGGT, respectively, is performed with the goal to identify a variant that allows faster growth on sulfobutanoyl-L-leucine (Table 6).
TABLE-US-00006 TABLE 6 Sites in EcGGT and PnGGT targeted for saturation mutagenesis EcGGT PnGGT R114 R94 T409 & N411 T381 & N383 Q430 & D433 E402 & D405 Y444 F416 S462 & S463 S434 & S435 G483 & G484 G455 & G456
13. Example 12: Improving the Affinity of the Synthetic Transport System by Whole Strain Mutagenesis
[0404] In order to further improve the functionality of the synthetic transport system a whole strain mutagenesis is performed. There is a possibility that the efficiency of the transport system suffers from toxic side products of sulfobutanoyl-L-leucine hydrolysis, like for example sulfobutanoic acid or 4-oxobutanoic acid. Another possibility is that the efficiency of the transport system is negatively influenced by regulatory processes, leading to reduced uptake or hydrolysis of sulfobutanoyl-L-leucine. To address these issues, the selection strain BW25113 leuB is converted into a temporary mutator strain by overexpressing an inactive variant of the DNA polymerase subunit DnaQ which is responsible for proofreading activity. The strain is then plated on medium with gradually decreasing concentrations of sulfobutanoyl-L-leucine and colonies that grow faster or at lower substrate concentration are then selected. Through genome sequencing mutations can be identified that improve the functionality of the synthetic transport system.
14. Example 13: Further Applications of the Synthetic Transport System
[0405] Complementation of a histidine auxotrophic strain is demonstrated by feeding sulfobutanoyl-L-histidine to the cells. Sulfobutanoyl amides containing the dyes 4-nitroaniline, 3-carboxy-4-nitronaniline, 7-amino-4-methyl-coumarin and 7-amino-4-acetyl-coumarin are further synthesized. These substrates allow to easily visualize the functionality of the transport system. Sulfobutanoyl-picolylamide (also termed herein N-picolyl-sulfobutyramide) is tested which results in the release of picolylamine, a precursor of nicotinamide. The successful release of this compound can be easily assayed by complementation of a suitable nictotinamide auxotrophy.
15. Example 14: Import: Refactoring the Ssu Operon
[0406] After ensuring efficient cargo release from sulfobutanoyl amides, the efficient import into E. coli cells was addressed. Growth assays in minimal medium showed that sulfobutanoyl amides were taken up with a similar efficiency as other sulfonates, presumably via the transporter SsuABC (
[0407] To identify variants with well-balanced transporter protein levels based on optimal leucine import, both plasmid libraries were used to transform strain TK082[pPnGGT*]. For selection purposes, approximately 100000 variants from each library were plated on MS minimal medium supplemented with glucose, MgSO.sub.4 (as sulfur source), IPTG (for synthesis of PnGGT*), anhydrotetracycline (aTc, for expression of ssuABC) and 0.5 mM sulfobutanoyl-L-eucine as the sole source of leucine. Growth on this medium is only possible if sulfobutanoyl-L-leucine is taken up via the transiently expressed SsuABC transporter and hydrolyzed intracellularly by PnGGT* to complement the leucine auxotrophy of strain TK082. After 2 days of incubation at 37 C., colonies of different sizes were obtained. Re-isolation of cells from the largest colonies resulted in strains that showed rapid growth, while a control strain carrying the empty plasmid pSEVA271 without ssuABC did not grow at all (
TABLE-US-00007 TABLE7 SummaryofpSsuABCvariants. ssuARBS TIR ssuBRBS TIR ssuCRBS TIR sequence [ssuA] sequence [ssuB] sequence [ssuC] cl.3 AGGGGC 2491 GGAGGT 83162 GGAGGTT 547 TT CT T cl.6 AGGGGC 2491 GGAGGT 83162 GGAGGTT 547 TT CT T cl.17 TGGAGG 4274 GGGAGG 11944 GGAGGTT 5481 GT AC C
[0408] The fastest growing clone 17, carrying a plasmid from here on called pSsuABC, originated from the larger library, indicating that this library might allow more accurate fine-tuning of the system, even though it has to be noted that the library was not exhaustively tested. The identical clones 3 and 6 were selected from the smaller library.
[0409] Experiments in liquid medium supplemented with sulfobutanoyl-L-eucine confirmed that the leucine auxotrophic strain TK082[pSsuABC] only grew when cells were synthesizing PnGGT* (
16. Example 15: Cargo Release: Optimizing the Expression of PnGGT*
[0410] As flux control can be distributed over multiple steps (Kacser & Burns, 1995), the next experiments focused on the PnGGT* expression for flux optimization.
[0411] In earlier experiments, low intracellular levels of the parent enzyme PnGGT had to be maintained when unloading cargo from -glutamyl amides, presumably to prevent the futile hydrolysis of glutamine to glutamate (Kuenzl, et al., 2017). As the variant enzyme PnGGT* no longer possesses significant reactivity to -glutamyl-p-nitroanilide (
[0412] To identify the optimal intracellular level of PnGGT*, another round of RBS engineering was performed, this time on the basis of plasmid pPnGGT*. An RBS library with 81 members was used to transform strain TK082[pSsuABC] and the fastest growing colonies were re-isolated on MS minimal medium containing 0.25 mM sulfobutanoyl-L-leucine as the sole leucine source. It is of note that the reduced concentration of the leucine source compared to the previous selections. Two of the isolated clones were confirmed to reliably grow faster in liquid medium than a strain carrying the parent plasmid pPnGGT* (
TABLE-US-00008 TABLE8 SummaryofPnGGT*_RBSvariants. RBS sequence TIR pPnGGT* TTAGCAGG 8009 RBS1 CCAGGGGG 63482 RBS3 CGCGGGGG 27985 RBS4 AGGGGGGG 66405 RBS9 TACGGGGG 83162
[0413] These data suggested an increased protein level which was confirmed by Western blotting and enzyme activity assays in cell free extracts using the substrate sulfobutanoyl-p-nitroanilide (
17. Example 16: Uptake of Non-Natural Cargo Molecules
[0414] To further illustrate the versatility of the synthetic transport system, it was tested for in vivo release of the colorimetric dye 4-nitroaniline and the fluorescent dye 7-amino-4-methyl coumarin (AMC) in the cytoplasm of E. coli. Therefore, the substrates sulfobutanoyl-p-nitroanilide and sulfobutanoyl-AMC were prepared, which only turn colorimetric or fluorescent once the cargo is released from the SBA moiety. In a growing E. coli culture containing strain TK082 with different plasmid combinations, 4-nitroaniline was only released from the SBA moiety when SsuABC and PnGGT* were simultaneously synthesized by the cells, while no release took place if one or both components were missing (
18. Example 17: Identification of Novel Metabolic Routes
[0415] To demonstrate the potential of the synthetic transport system for biotechnological applications, this Example aimed to implement an alternative route for the in vivo biosynthesis of the commercially interesting product nicotinic acid (11; vitamin B3). Synthesis of nicotinic acid in E. coli involves a 5 step reaction from aspartate to NAD.sup.+, and an additional 3 step reaction from the NAD salvage pathway to obtain nicotinic acid (Begley et al., 2001). To shortcut this reaction, we reasoned that the substrate 3-picolylamine (10) can potentially be converted to nicotinic acid in a two-step reaction involving a transamination and an oxidation step (
[0416] Initial growth experiments with the NAD.sup.+ auxotrophic strain TK090 revealed that E. coli indeed possesses the enzymatic machinery to convert 3-picolylamine into NAD.sup.+, but approximately 500 to 1000-fold higher concentrations of 3-picolylamine were necessary to complement the NAD.sup.+ auxotrophy when compared to growth with nicotinic acid (
19. Example 18: Engineering of PnGGT*
[0417] Initial growth experiments revealed that sulfobutanoyl-L-leucine and sulfobutanoyl-L-histidine were used as sulfur sources by E. coli with comparable efficiencies (
[0418] Further growth experiments with auxotrophic strains harboring the synthetic transport system, however, revealed that cells grown in the presence of sulfubutanoyl-L-histidine grew significantly faster and to higher cell densities compared to cells grown with the same concentration of sulfobutanoyl-L-leucine (
[0419] In a first round of engineering, several residues that lie in close proximity to the sulfobutanoyl moiety of sulfobutanoyl-L-leucine were randomized by site-directed mutagenesis, either individually (R94, F416) or in pairs of two (T381 N383, E402 D405, S434 S435, G455 G456). The libraries obtained with the template pPnGGT* were used to transform strain TK082[pSsuABC] and approximately 10000 to 100000 variants from each library were isolated on selective medium containing only 0.1 mM sulfobutanoyl-L-leucine as the only source of leucine. However, sequence analysis of isolated plasmids from the fastest growing variants revealed that none of them carried a mutation in a residue targeted by site-directed mutagenesis. Instead, several variants with either a random mutation from aspartate to tyrosine at position 385 or a proline to threonine mutation at position 505 were detected. In addition, various mutations in a loop formed by residue 167-170 were detected in the isolated variants.
[0420] Interestingly, the homology model of PnGGT* suggests that residue D385 and the loop formed by residue 167-170 are in spatial proximity and delineate a pocket where the cargo molecule is accommodated (
[0421] The homology model places residue P505 at quite a distance from the substrate binding site of PnGGT*. A mutation from proline to threonine led to improved utilization of sulfobutanoyl-L-leucine, while having a slightly negative effect on the utilization of sulfobutanoyl-L-histidine (
[0422] To further confirm that the faster growth of strains synthesizing mutated PnGGT* variants on sulfobutanoyl-L-leucine was indeed mediated by mutations in PnGGT*, the kinetic parameters of mutants P505T and D385Y were determined. For PnGGT* P505T, a lower K.sub.M and a slightly higher V.sub.max were measured with sulfobutanoyl-p-nitroanilide and sulfobutanoyl-L-leucine when compared to PnGGT* (
REFERENCES
[0423] Adams, M. D., Wagner, L. M., Graddis, T. J., Landick, R., Antonucci, T. K., Gibson, A. L., Oxender, D. L., 1990. Nucleotide sequence and genetic characterization reveal six essential genes for the LIV-1 and LS transport systems of Escherichia coli. J Biol Chem. 265, 11436-11443. [0424] Ames, B. N., Ames, G. F., Young, J. D., Tsuchiya, D., Lecocq, J., 1973. Illicit transport: the oligopeptide permease. Proc Natl Acad Sci USA. 70, 456-458. [0425] Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics. 22, 195-201. [0426] Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., Mori, H., 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2, 2006.0008. [0427] Begley, T. P., Kinsland, C., Mehl, R. A., Osterman, A. & Dorrestein, P. The biosynthesis of nicotinamide adenine dinucleotides in bacteria. Vitamins and hormones 61, 103-119 (2001). [0428] Bennett, B. D. et al. Absolute metabolite concentrations and implied enzyme active site occupancy in Escherichia coli. Nature chemical biology 5, 593-599 (2009). [0429] Biasini, M., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F., Gallo Cassarino, T., Bertoni, M., Bordoli, L., Schwede, T., 2004. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Res. 42, W252-258. [0430] Billerbeck, S., Panke, S., 2012. A genetic replacement system for selection-based engineering of essential proteins. Microb Cell Fact. 11, 110. [0431] Birmingham, W. R., Starbird, C. A., Panosian, T. D., Nannemann, D. P., Iverson, T. M., Bachmann, B. O., 2014. Bioretrosynthetic construction of a didanosine biosynthetic pathway. Nat Chem Biol. 10, 392-399. [0432] Blum, E., Carpousis, A. J., Higgins, C. F., 1999. Polyadenylation promotes degradation of 3-structured RNA by the Escherichia coli mRNA degradosome in vitro. J Biol Chem. 274, 4009-4016. [0433] Boehm, J. C., Kingsbury, W. D., Perry, D., Gilvarg, C., 1983. The use of cysteinyl peptides to effect portage transport of sulfhydryl-containing compounds in Escherichia coli. J Biol Chem. 258, 14850-14855. [0434] Bosshart, A., Hee, C. S., Bechtold, M., Schirmer, T., Panke, S. 2015. Directed divergent evolution of a thermostable D-tagatose epimerase towards improved activity for two hexose substrates. Chembiochem. 16, 592-601. [0435] Chang, A. C., Cohen, S. N., 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, 1141-1156. [0436] Cherepanov, P. P., Wackernagel, W., 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene. 158, 9-14. [0437] Cowan, S. W., Schirmer, T., Rummel, G., Steiert, M., Ghosh, R., Pauptit, R. A., Jansonius, J. N., Rosenbusch, J. P., 1992. Crystal structures explain functional properties of two E. coli porins. Nature. 358, 727-733. [0438] Datsenko, K. A., Wanner, B. L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 97, 6640-6645. [0439] Dunten, P., Mowbray, S. L., 1995. Crystal structure of the dipeptide binding protein from Escherichia coli involved in active transport and chemotaxis. Protein Sci. 4, 2327-2334. [0440] Dykxhoorn, D. M., St Pierre, R., Linn, T., 1996. A set of compatible tac promoter expression vectors. Gene. 177, 133-136. [0441] Eichhorn, E., van der Ploeg, J. R., Kertesz, M. A., Leisinger, T., 1997. Characterization of alpha-ketoglutarate-dependent taurine dioxygenase from Escherichia coli. The Journal of biological chemistry. 272, 23031-6. [0442] Eichhorn, E., van der Ploeg, J. R., Leisinger, T., 1999. Characterization of a two-component alkanesulfonate monooxygenase from Escherichia coli. The Journal of biological chemistry. 274, 26639-46. [0443] Eichhorn, E., van der Ploeg, J. R., Leisinger, T., 2000. Deletion analysis of the Escherichia coli taurine and alkanesulfonate transport systems. J Bacteriol. 182, 2687-95. [0444] Espah Borujeni, A., Channarasappa, A. S., Salis, H. M., 2014. Translation rate is controlled by coupled trade-offs between site accessibility, selective RNA unfolding and sliding at upstream standby sites. Nucleic Acids Res. 42, 2646-2659. [0445] Fickel, T. E., Gilvarg, C., 1973. Transport of impermeant substances in E. coli by way of oligopeptide permease. Nat New Biol. 241, 161-163. [0446] Finidori, J., Laperche, Y., Haguenauertsapis, R., Barouki, R., Guellaen, G., Hanoune, J., 1984. In vitro biosynthesis and membrane insertion of gamma-glutamyl transpeptidase. J Biol Chem. 259, 4687-4690. [0447] Freigassner, M., Pichler, H. & Glieder, A. Tuning microbial hosts for membrane protein production. Microbial cell factories 8, 69 (2009). [0448] Gerstung, M., Beisel, C., Rechsteiner, M., Wild, P., Schraml, P., Moch, H., Beerenwinkel, N., 2012. Reliable detection of subclonal single-nucleotide variants in tumour cell populations. Nat Commun. 3, 811. [0449] Gerstung, M., Papaemmanuil, E., Campbell, P. J., 2014. Subclonal variant calling with multiple samples and prior knowledge. Bioinformatics. 30, 1198-1204. [0450] Gollop, N., Tavori, H., Barak, Z., 1982. Acetohydroxy acid synthase is a target for leucine containing peptide toxicity in Escherichia coli. J Bacteriol. 149, 387-390. [0451] Guex, N., Peitsch, M. C., Schwede, T., 2009. Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: a historical perspective. Electrophoresis. 30, S162-173. [0452] Guyer, C. A., Morgan, D. G., Staros, J. V., 1986. Binding specificity of the periplasmic oligopeptide-binding protein from Escherichia coli. J Bacteriol. 168, 775-779. [0453] Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 166, 557-580. [0454] Hanigan, M. H., 2014. Gamma-glutamyl transpeptidase: redox regulation and drug resistance. Adv Cancer Res. 122, 103-141. [0455] Hershfield, V., Boyer, H. W., Yanofsky, C., Lovett, M. A., Helinski, D. R., 1974. Plasmid ColEI as a molecular vehicle for cloning and amplification of DNA. Proc Natl Acad Sci USA. 71, 3455-3459. [0456] Hong, N. J., Park, Y. T., 1993. Portage transport of toxophoric agent, N-hydroxyalanine, through oligopeptide permease in Escherichia coli. Bull Korean Chem Soc. 14, 674-678. [0457] Hwang, S. Y., Berges, D. A., Taggart, J. J., Gilvarg, C., 1989. Portage transport of sulfanilamide and sulfanilic acid. J Med Chem. 32, 694-698. [0458] Imaoka, M., Yano, S., Okumura, M., Hibi, T., Wakayama, M., 2010. Molecular cloning and characterization of gamma-glutamyltranspeptidase from Pseudomonas nitroreducens IFO12694. Biosci Biotechnol Biochem. 74, 1936-1939. [0459] Jeschek, M., Gerngross, D., Panke, S., 2016. Rationally reduced libraries for combinatorial pathway optimization minimizing experimental effort. Nat Commun. 7, 11163. [0460] Kacser, H. & Burns, J. A. The control of flux. Biochemical Society transactions 23, 341-366 (1995). [0461] Kaleta, C., Schauble, S., Rinas, U. & Schuster, S. Metabolic costs of amino acid and protein production in Escherichia coli. Biotechnology journal 8, 1105-1114 (2013). [0462] Kiefer, F., Arnold, K., Kunzli, M., Bordoli, L., Schwede, T., 2009. The SWISS-MODEL Repository and associated resources. Nucleic Acids Res. 37, D387-392. [0463] Kingsbury, W. D., Boehm, J. C., Perry, D., Gilvarg, C., 1984. Portage of various compounds into bacteria by attachment to glycine residues in peptides. Proc Natl Acad Sci USA. 81, 4573-4576. [0464] Klepsch, M. M., Kovermann, M., Low, C., Balbach, J., Permentier, H. P., Fusetti, F., de Gier, J. W., Slotboom, D. J., Berntsson, R. P., 2011. Escherichia coli peptide binding protein OppA has a preference for positively charged peptides. J Mol Biol. 414, 75-85. [0465] Krewinkel M, Dworeck T, Fioroni M. 2011. Engineering of an E. coli outer membrane protein FhuA with increased channel diameter. J Nanobiotechnology 9:33. [0466] Kuenzl T, Sroka M, Srivastava P, Herdewijn P, Marlire P, Panke S. Overcoming the membrane barrier: Recruitment of -glutamyl transferase for intracellular release of metabolic cargo from peptide vectors. Metabolic Engineering doi:http://dx.doi.org/10.1016/j.ymben.2016.10.016. [0467] Kuenzl T, Panke S. 2016. Potential applications of -glutamyl transferases in synthetic biology. New Biotechnology 33, Supplement:S186. [0468] Laemmli, U. K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, 680-685. [0469] Langmead, B., Salzberg, S. L., 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9, 357-359. [0470] Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L., 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25. [0471] Lo, H. F., Chou, W. M., Chen, P. J., Lin, L. L., 2008. Influence of signal-peptide truncations on the functional expression of Escherichia coli gamma-glutamyltranspeptidase. J Basic Microbiol. 48, 260-268. [0472] Lou K L, Saint N, Prilipov A, Rummel G, Benson S A, Rosenbusch J P, Schirmer T. 1996. Structural and functional characterization of OmpF porin mutants selected for larger pore size. I. Crystallographic analysis. J Biol Chem 271:20669-20675. [0473] Malyshev, D. A., Dhami, K., Lavergne, T., Chen, T., Dai, N., Foster, J. M., Correa, I. R., Jr., Romesberg, F. E., 2014. A semi-synthetic organism with an expanded genetic alphabet. Nature. 509, 385-388. [0474] Martinez-Garcia, E., Aparicio, T., Goni-Moreno, A., Fraile, S., de Lorenzo, V., 2015. SEVA 2.0: an update of the Standard European Vector Architecture for de-/re-construction of bacterial functionalities. Nucleic Acids Res. 43, 1183-1189. [0475] Martinez-Garcia, E., de Lorenzo, V., 2011. Engineering multiple genomic deletions in Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of Pseudomonas putida KT2440. Environ Microbiol. 13, 2702-2716. [0476] Martinez-Garcia, E., de Lorenzo, V., 2012. Transposon-based and plasmid-based genetic tools for editing genomes of gram-negative bacteria. Methods Mol Biol. 813, 267-283. [0477] Messing, J., Crea, R., Seeburg, P. H., 1981. A system for shotgun DNA sequencing. Nucleic Acids Res. 9, 309-321. [0478] Minami, H., Suzuki, H., Kumagai, H., 2003. Salt-tolerant gamma-glutamyltranspeptidase from Bacillus subtilis 168 with glutaminase activity. Enzyme Microb. Technol. 32, 431-438. [0479] Mohanty, B. K., Kushner, S. R., 1999. Analysis of the function of Escherichia coli poly(A) polymerase I in RNA metabolism. Mol Microbiol. 34, 1094-1108. [0480] Mohanty, B. K., Kushner, S. R., 2006. The majority of Escherichia coli mRNAs undergo post-transcriptional modification in exponentially growing cells. Nucleic Acids Res. 34, 5695-5704. [0481] Muhammad N, Dworeck T, Fioroni M, Schwaneberg U. 2011. Engineering of the E. coli outer membrane protein FhuA to overcome the hydrophobic mismatch in thick polymeric membranes. J Nanobiotechnology 9:8. Nickitenko, A. V., Trakhanov, S., Quiocho, F. A., 1995. 2 A resolution structure of DppA, a periplasmic dipeptide transport/chemosensory receptor. Biochemistry. 34, 16585-16595. [0482] Ohnishi, K., Hasegawa, A., Matsubara, K., Date, T., Okada, T., Kiritani, K., 1988. Cloning and nucleotide sequence of the brnQ gene, the structural gene for a membrane-associated component of the LIV-II transport system for branched-chain amino acids in Salmonella typhimurium. Jpn J Genet. 63, 343-357. [0483] Okada, T., Suzuki, H., Wada, K., Kumagai, H., Fukuyama, K., 2006. Crystal structures of gamma-glutamyltranspeptidase from Escherichia coli, a key enzyme in glutathione metabolism, and its reaction intermediate. Proc Natl Acad Sci USA. 103, 6471-6476. [0484] Orlowski, M., Meister, A., 1970. The gamma-glutamyl cycle: a possible transport system for amino acids. Proc Natl Acad Sci USA. 67, 1248-1255. [0485] Payne, J. W., Morley, J. S., Armitage, P., Payne, G. M., 1984. Transport and hydrolysis of antibacterial peptide analogues in Escherichia coli: backbone-modified aminoxy peptides. J Gen Microbiol. 130, 2253-2265. [0486] Perry, D., Gilvarg, C., 1984. Spectrophotometric determination of affinities of peptides for their transport systems in Escherichia coli. J Bacteriol. 160, 943-948. [0487] Petersen, T. N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods. 8, 785-786. [0488] Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., Ferrin, T. E., 2004. UCSF Chimeraa visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605-1612. [0489] Platt, R., Drescher, C., Park, S. K., Phillips, G. J., 2000. Genetic system for reversible integration of DNA constructs and lacZ gene fusions into the Escherichia coli chromosome. Plasmid. 43, 12-23. [0490] Qvit, N., Reuveni, H., Gazal, S., Zundelevich, A., Blum, G., Niv, M Y., Feldstein, A., Meushar, S., Shalev, D. E., Friedler, A., Gilon, C., 2008. Synthesis of a novel macrocyclic library: discovery of an IGF-1R inhibitor. J. Comb. Chem. 10, 256-266. [0491] Raynal, L. C., Carpousis, A. J., 1999. Poly(A) polymerase I of Escherichia coli: characterization of the catalytic domain, an RNA binding site and regions for the interaction with proteins involved in mRNA degradation. Mol Microbiol. 32, 765-775. [0492] Robinson, J. T., Thorvaldsdttir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G., Mesirov, J. P., 2011. Integrative Genomics Viewer. Nat Biotechnol. 29, 24-26. [0493] Saint N, Lou K L, Widmer C, Luckey M, Schirmer T, Rosenbusch J P. 1996. Structural and functional characterization of OmpF porin mutants selected for larger pore size. II. Functional characterization. J Biol Chem 271:20676-20680. [0494] Salis, H. M., Mirsky, E. A., Voigt, C. A., 2009. Automated Design of Synthetic Ribosome Binding Sites to Precisely Control Protein Expression. Nat Biotechnol. 27, 946-950. [0495] Sambrook, J., Russell, D. W., 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0496] Sievers, F. et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Bio/7, 539 (2011). [0497] Sleigh, S. H., Seavers, P. R., Wilkinson, A. J., Ladbury, J. E., Tame, J. R., 1999. Crystallographic and calorimetric analysis of peptide binding to OppA protein. J Mol Biol. 291, 393-415. [0498] Smith, M. W., Tyreman, D. R., Payne, G. M., Marshall, N. J., Payne, J. W., 1999. Substrate specificity of the periplasmic dipeptide-binding protein from Escherichia coli: experimental basis for the design of peptide prodrugs. Microbiology. 145, 2891-2901. [0499] Spahr, P. F. Amino acid composition of ribosomes from Escherichia coli. Journal of molecular biology 4, 395-406 (1962). [0500] Suzuki, H., Kumagai, H., 2002. Autocatalytic processing of gamma-glutamyltranspeptidase. J Biol Chem. 277, 43536-43543. [0501] Suzuki, H., Kumagai, H., Tochikura, T., 1986. Gamma-glutamyltranspeptidase from Escherichia coli K-12: purification and properties. J Bacteriol. 168, 1325-1331. [0502] Suzuki, H., Miwa, C., Ishihara, S., Kumagai, H., 2004. A single amino acid substitution converts gamma-glutamyltranspeptidase to a class IV cephalosporin acylase (glutaryl-7-aminocephalosporanic acid acylase). Applied and environmental microbiology. 70, 6324-8. [0503] Tame, J. R., Dodson, E. J., Murshudov, G., Higgins, C. F., Wilkinson, A. J., 1995. The crystal structures of the oligopeptide-binding protein OppA complexed with tripeptide and tetrapeptide ligands. Structure. 3, 1395-1406. [0504] Tavori, H., Kimmel, Y., Barak, Z., 1981. Toxicity of leucine-containing peptides in Escherichia coli caused by circumvention of leucine transport regulation. J Bacteriol. 146, 676-683. [0505] Thomason, L. C., Costantino, N., Court, D. L., 2007. E. coli genome manipulation by P1 transduction. Current protocols in molecular biology. Chapter 1, Unit 1.17. [0506] Thorvaldsdttir, H., Robinson, J. T., Mesirov, J. P., 2013. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 14, 178-192. [0507] Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA. 76, 4350-4354. [0508] van Der Ploeg, J. R., Iwanicka-Nowicka, R., Bykowski, T., Hryniewicz, M. M. & Leisinger, T. The Escherichia coli ssuEADCB gene cluster is required for the utilization of sulfur from aliphatic sulfonates and is regulated by the transcriptional activator Cbl. The Journal of biological chemistry 274, 29358-29365 (1999). [0509] Van Dyke, M. W., Sirito, M., Sawadogo, M., 1992. Single-step purification of bacterially expressed polypeptides containing an oligo-histidine domain. Gene. 111, 99-104. [0510] Van Gelder P, Dumas F, Bartoldus I, Saint N, Prilipov A, Winterhalter M, Wang Y, Philippsen A, Rosenbusch J P, 2002. Sugar Transport through Maltoporin of Escherichia coli: Role of the Greasy Slide. J Bacteriol 184:2994-2999. [0511] Van Gelder P, Dutzler R, Dumas F, Koebnik R, Schirmer T. 2001. Sucrose transport through maltoporin mutants of Escherichia coli. Protein Eng Des Sel 14:943-948. [0512] Wang, W., Malcolm, B. A., 1999. Two-stage PCR protocol allowing introduction of multiple mutations, deletions and insertions using QuikChange Site-Directed Mutagenesis. Biotechniques. 26, 680-682. [0513] Xu, F., Lin-Chao, S., Cohen, S. N., 1993. The Escherichia coli pcnB gene promotes adenylylation of antisense RNAI of ColE1-type plasmids in vivo and degradation of RNAI decay intermediates. Proc Natl Acad Sci USA. 90, 6756-6760. [0514] Yanisch-Perron, C., Vieira, J., Messing, J., 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene. 33, 103-119. [0515] Yamada, C., Kijima, K., Ishihara, S., Miwa, C., Wada, K., Okada, T., Fukuyama, K., Kumagai, H., Suzuki, H., 2008. Improvement of the glutaryl-7-aminocephalosporanic acid acylase activity of a bacterial gamma-glutamyltranspeptidase. Applied and environmental microbiology. 74, 3400-9. [0516] Yehudai-Resheff, S., Schuster, G., 2000. Characterization of the E. coli poly(A) polymerase: nucleotide specificity, RNA-binding affinities and RNA structure dependence. Nucleic Acids Res. 28, 1139-1144.