Bacteria-based protein delivery
10889823 · 2021-01-12
Assignee
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
G01N2333/24
PHYSICS
C12Q1/025
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07K14/24
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C07K2319/035
CHEMISTRY; METALLURGY
International classification
C12N15/74
CHEMISTRY; METALLURGY
C07K14/24
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to recombinant Gram-negative bacterial strains and the use thereof for delivery of heterologous proteins into eukaryotic cells.
Claims
1. A recombinant Gram-negative bacterial strain transformed with a vector which comprises in the 5 to 3 direction: a promoter; a first nucleic acid comprising a first DNA sequence encoding a delivery signal from a bacterial T3SS effector protein, operably linked to said promoter; and a second nucleic acid comprising a second DNA sequence encoding a heterologous protein, which is a protein or part thereof which does not belong to the entire natural protein complement of the recombinant Gram-negative bacterial strain, wherein the second DNA sequence is fused in frame to the 3 end of said first DNA sequence, wherein the heterologous protein is a protein or a part thereof involved in apoptosis or apoptosis regulation, and wherein the recombinant Gram-negative bacterial strain is a Yersinia strain and the delivery signal comprises the YopE effector protein or an N-terminal part thereof, or wherein the recombinant Gram-negative bacterial strain is a Salmonella strain and the delivery signal comprises the SopE or the SteA effector protein or an N-terminal part thereof, and wherein the heterologous protein or part thereof involved in apoptosis or apoptosis regulation is selected from the group consisting of FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, Noxa, Bim, Bax, Bak, Nbk/Bik, ASC, TRAF2, TRADD, Apaf1, Caspase 10, Caspase 8, Caspase 1, Bcl-2, Puma, RIP, z-Bid, z-t-Bid, z-BIM, Ink4A, Ink4B, Ink4C, TEVsite-Flag-Ink4C, TEVsite-Ink4C, Ubiquitin-Flag-Ink4C-MycHis, and Pleckstrin homology domain from human Akt.
2. The recombinant Gram-negative bacterial strain of claim 1, wherein the vector comprises a third nucleic acid encoding a third DNA sequence encoding a protease cleavage site, wherein the third nucleic acid is located between the 3 end of the first nucleic acid and the 5 end of the second nucleic acid and wherein the third sequence is fused in frame to the 3 end of said first DNA sequence.
3. The recombinant Gram-negative bacterial strain of claim 1, wherein the recombinant Gram-negative bacterial strain is a Yersinia strain and wherein said Yersinia strain is wild type or deficient in the production of at least one T3SS effector protein and wherein the delivery signal from the bacterial T3SS effector protein comprises the N-terminal 138 amino acids of the Y. enterocolitica YopE effector protein.
4. The recombinant Gram-negative bacterial strain of claim 1, wherein the Gram-negative bacterial strain is deficient to produce adhesion proteins binding to a eukaryotic cell surface or extracellular matrix.
5. A vector which comprises in the 5 to 3 direction: a promoter; a first nucleic acid comprising a first DNA sequence encoding a delivery signal from a YopE effector protein or an N-terminal part thereof, or a delivery signal from a SopE or a SteA effector protein or an N-terminal part thereof, operably linked to said promoter; a second nucleic acid comprising a second DNA sequence encoding a heterologous protein, which is a protein or part thereof which does not belong to the entire natural protein complement of a recombinant Gram-negative bacterial strain, wherein the second DNA sequence is fused in frame to the 3 end of said first DNA sequence, and wherein the heterologous protein is a protein or a part thereof involved in apoptosis or apoptosis regulation, and wherein the protein or a part thereof involved in apoptosis or apoptosis regulation is selected from the group consisting of or a part thereof FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, Noxa, Bim, Bax, Bak, Nbk/Bik, ASC, TRAF2, TRADD, Apaf1, Caspase 10, Caspase 8, Caspase 1, Bc1-2, Puma, RIP, z-Bid, z-t-Bid, z-BIM, Ink4A, Ink4B, Ink4C, TEVsite-Flag-Ink4C, TEVsite-Ink4C, Ubiquitin-Flag-Ink4C-MycHis, and Pleckstrin homology domain from human Akt.
6. The recombinant Gram-negative bacterial strain of claim 1, wherein the proteins or a part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, Noxa, Bim, Bax, ASC, TRAF2, TRADD, Apaf1, Caspase 10, Caspase 1, Puma, or RIP.
7. The recombinant Gram-negative bacterial strain of claim 1, wherein the vector comprises two second DNA sequences encoding the identical heterologous proteins fused independently from each other in frame to the 3 end of said first DNA sequence, wherein both heterologous proteins are proteins involved in apoptosis or apoptosis regulation.
8. The recombinant Gram-negative bacterial strain of claim 1, wherein the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises the bacterial T3SS effector protein or an N-terminal part thereof, wherein the N-terminal part thereof includes at least the first 10 amino acids of the bacterial T3SS effector protein.
9. A method for delivering a heterologous protein into a eukaryotic cell comprising the following steps: i) culturing the Gram-negative bacterial strain of claim 1; and ii) contacting a eukaryotic cell with the Gram-negative bacterial strain of i), wherein a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein and the heterologous protein is expressed by the Gram-negative bacterial strain and is translocated into the eukaryotic cell.
10. A method of purifying a heterologous protein comprising: culturing the Gram-negative bacterial strain of claim 1 so that a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein and the heterologous protein is expressed and secreted into the supernatant of the culture.
11. The recombinant Gram-negative bacterial strain of claim 1 formulated for the delivery of a heterologous protein as a medicament or as a vaccine to a subject.
12. The vector of claim 5, wherein the vector comprises a third nucleic acid comprising a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3 end of the first DNA sequence and the 5 end of the second DNA sequence and is fused in frame to the 3 end of the first DNA sequence.
13. A composition comprising: a eukaryotic cell; and the recombinant Gram-negative bacterial strain of claim 1.
14. The recombinant Gram-negative bacterial strain of claim 6, wherein the protein or a part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Noxa, Bim, Bax, ASC, TRAF2, Apaf1, Caspase 10, Caspase 1, Puma, or RIP.
15. The recombinant Gram-negative bacterial strain of claim 6, wherein the protein or part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, Noxa, Bim, Bax, ASC, TRAF2, Caspase 10, Caspase 1, or RIP.
16. The recombinant Gram-negative bacterial strain of claim 1, wherein the protein or part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, z-Bid, z-t-Bid, z-BIM, Ink4A, Ink4B, Ink4C, TEVsite-Flag-Ink4C, TEVsite-Ink4C, Ubiquitin-Flag-Ink4C-MycHis, or Pleckstrin homology domain from human Akt.
17. The vector of claim 5, wherein the protein or a part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, Noxa, Bim, Bax, ASC, TRAF2, TRADD, Apaf1, Caspase 10, Caspase 1, Puma, or RIP.
18. The vector of claim 17, wherein the protein or a part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Noxa, Bim, Bax, ASC, TRAF2, Apaf1, Caspase 10, Caspase 1, Puma, or RIP.
19. The vector of claim 17, wherein the protein or part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, Noxa, Bim, Bax, ASC, TRAF2, Caspase 10, Caspase 1, or RIP.
20. The vector of claim 5, wherein the protein or part thereof involved in apoptosis or apoptosis regulation comprises FADD, Bad, Bid, t-Bid, Caspase 3, Caspase 3 p17, Caspase 3 p10/12, Bid BH3, Bax BH3, z-Bid, z-t-Bid, z-BIM, Ink4A, Ink4B, Ink4C, TEVsite-Flag-Ink4C, TEVsite-Ink4C, Ubiquitin-Flag-Ink4C-MycHis, or Pleckstrin homology domain from human Akt.
21. The recombinant Gram-negative bacterial strain of claim 1, wherein the recombinant Gram-negative bacterial strain is a Salmonella strain and wherein said Salmonella strain is wild type or deficient in the production of at least one T3SS effector protein and wherein the SteA delivery signal from the bacterial T3SS effector protein comprises the Salmonella enterica SteA effector protein and wherein the SopE delivery signal from the bacterial T3SS effector protein comprises the N-terminal 81 or 105 amino acids of the Salmonella enterica SopE effector protein.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DETAILED DESCRIPTION OF THE INVENTION
(24) The present invention provides recombinant Gram-negative bacterial strains and the use thereof for delivery of heterologous proteins into eukaryotic cells.
(25) For the purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
(26) The term Gram-negative bacterial strain as used herein includes the following bacteria: Aeromonas salmonicida, Aeromonas hydrophile, Aeromonas veronii, Anaeromyxobacter dehalogenans, Bordetella bronchiseptica, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Chlamydia muridarum, Chlamydia trachmoatis, Chlamydophila abortus, Chlamydophila pneumoniae, Chromobacterium violaceum, Citrobacter rodentium, Desulfovibrio vulgaris, Edwardsiella tarda, Endozoicomonas elysicola, Erwinia amylovora, Escherichia albertii, Escherichia coli, Lawsonia intracellularis, Mesorhizobium loti, Myxococcus xanthus, Pantoea agglomerans, Photobacterium damselae, Photorhabdus luminescens, Photorabdus temperate, Pseudoalteromonas spongiae, Pseudomonas aeruginosa, Pseudomonas plecoglossicida, Pseudomonas syringae, Ralstonia solanacearum, Rhizobium sp, Salmonella enterica and other Salmonella sp, Shigella flexneri and other Shigella sp, Sodalis glossinidius, Vibrio alginolyticus, Vibrio azureus, Vibrio campellii, Vibrio caribbenthicus, Vibrio harvey, Vibrio parahaemolyticus, Vibrio tasmaniensis, Vibrio tubiashii, Xanthomonas axonopodis, Xanthomonas campestris, Xanthomonas oryzae, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis. Preferred Gram-negative bacterial strains of the invention are Gram-negative bacterial strains comprised by the family of Enterobacteriaceae and Pseudomonadaceae. The Gram-negative bacterial strain of the present invention is normally used for delivery of heterologous proteins by the bacterial T3SS into eukaryotic cells in vitro and in vivo.
(27) The term recombinant Gram-negative bacterial strain used herein refers to a Gram-negative bacterial strain genetically transformed with a vector. A useful vector of the present invention is e.g an expression vector, a vector for chromosomal or virulence plasmid insertion or a DNA fragment for chromosomal or virulence plasmid insertion.
(28) The terms Gram-negative bacterial strain deficient to produce an amino acid essential for growth and auxotroph mutant are used herein interchangeably and refer to Gram-negative bacterial strains which can not grow in the absence of at least one exogenously provided essential amino acid or a precursor thereof. The amino acid the strain is deficient to produce is e.g. aspartate, meso-2,6-diaminopimelic acid, aromatic amino acids or leucine-arginine [23]. Such a strain can be generated by e.g. deletion of the aspartate-beta-semialdehyde dehydrogenase gene (asd). Such an auxotroph mutant cannot grow in absence of exogenous meso-2,6-diaminopimelic acid [24]. The mutation, e.g. deletion of the aspartate-beta-semialdehyde dehydrogenase gene is preferred herein for a Gram-negative bacterial strain deficient to produce an amino acid essential for growth of the present invention.
(29) The term Gram-negative bacterial strain deficient to produce adhesion proteins binding to the eukaryotic cell surface or extracellular matrix refers to mutant Gram-negative bacterial strains which do not express at least one adhesion protein compared to the adhesion proteins expressed by the corresponding wild type strain. Adhesion proteins may include e.g. extended polymeric adhesion molecules like pili/fimbriae or non-fimbrial adhesins. Fimbrial adhesins include type-1 pili (such as E. coli Fim-pili with the FimH adhesin), P-pili (such as Pap-pili with the PapG adhesin from E. coli), type 4 pili (as pilin protein from e.g. P. aeruginosa) or curli (Csg proteins with the CsgA adhesin from S. enterica). Non-fimbrial adhesions include trimeric autotransporter adhesins such as YadA from Y. enterocolitica, BpaA (B. pseudomallei), Hia (H. influenzae), BadA (B. henselae), NadA (N. meningitidis) or UspA1 (M. catarrhalis) as well as other autotransporter adhesins such as AIDA-1 (E. coli) as well as other adhesins/invasins such as InvA from Y. enterocolitica or Intimin (E. coli) or members of the Dr-family or Afa-family (E. coli). The terms YadA and InvA as used herein refer to proteins from Y. enterocolitica. The autotransporter YadA [25, 26] binds to different froms of collagen as well as fibronectin, while the invasin InvA [27-29] binds to -integrins in the eukaryotic cell membrane. If the Gram-negative bacterial strain is a Y. enterocolitica strain the strain is preferably deficient in InvA and/or YadA.
(30) As used herein, the term family of Enterobacteriaceae comprises a family of gram-negative, rod-shaped, facultatively anaerobic bacteria found in soil, water, plants, and animals, which frequently occur as pathogens in vertebrates. The bacteria of this family share a similar physiology and demonstrate a conservation within functional elements and genes of the respective genomes. As well as being oxidase negative, all members of this family are glucose fermenters and most are nitrate reducers.
(31) Enterobacteriaceae bacteria of the invention may be any bacteria from that family, and specifically includes, but is not limited to, bacteria of the following genera: Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter, Serratia, Proteus, Erwinia, Morganella, Providencia, or Yersinia. In more specific embodiments, the bacterium is of the Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermanii, Escherichia vuneris, Salmonella enterica, Salmonella bongori, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Enterobacter aerogenes, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter cloacae, Enterobacter agglomerans, Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens, Yersinia pseudotuberculosis, Yersinia pestis, Yersinia enterocolitica, Erwinia amylovora, Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus hauseri, Providencia alcalifaciens, or Morganella morganii species. Preferably the Gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella, Shigella, Pseudomonas, Chlamydia, Erwinia, Pantoea, Vibrio, Burkholderia, Ralstonia, Xanthomonas, Chromobacterium, Sodalis, Citrobacter, Edwardsiella, Rhizobiae, Aeromonas, Photorhabdus, Bordetella and Desulfovibrio, more preferably from the group consisting of the genera Yersinia, Escherichia, Salmonella, and Pseudomonas, most preferably from the group consisting of the genera Yersinia and Salmonella.
(32) The term Yersinia as used herein includes all species of Yersinia, including Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis. Preferred is Yersinia enterocolitica.
(33) The term Salmonella as used herein includes all species of Salmonella, including Salmonella enterica and S. bongori. Preferred is Salmonella enterica.
(34) Promoter as used herein refers to a nucleic acid sequence that regulates expression of a transcriptional unit. A promoter region is a regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3 direction) coding sequence. Within the promoter region will be found a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase such as the putative 35 region and the Pribnow box. The term operably linked when describing the relationship between two DNA regions simply means that they are functionally related to each other and they are located on the same nucleic acid fragment. A promoter is operably linked to a structural gene if it controls the transcription of the gene and it is located on the same nucleic acid fragment as the gene. Usually the promoter is functional in said Gram-negative bacterial strain, i.e. the promoter is capable of expressing the fusion protein of the present invention, i.e. the promoter is capable of expressing the fusion protein of the present invention without further genetic engineering or expression of further proteins. Furthermore, a functional promoter must not be naturally counter-regulated to the bacterial T3SS.
(35) The term delivery used herein refers to the transportation of a protein from a recombinant Gram-negative bacterial strain to a eukaryotic cell, including the steps of expressing the heterologous protein in the recombinant Gram-negative bacterial strain, secreting the expressed protein(s) from such Gram-negative bacterial strain and translocating the secreted protein(s) by such Gram-negative bacterial strain into the cytosol of the eukaryotic cell. Accordingly, the terms delivery signal or secretion signal which are used interchangeably herein refer to a polypeptide sequence which can be recognized by the secretion and translocation system of the Gram-negative bacterial strain and directs the delivery of a protein from the Gram-negative bacterial strain to eukaryotic cells.
(36) As used herein, the secretion of a protein refers to the transportation of a heterologous protein outward across the cell membrane of a recombinant Gram-negative bacterial strain. The translocation of a protein refers to the transportation of a heterologous protein from a recombinant Gram-negative bacterial strain across the plasma membrane of a eukaryotic cell into the cytosol of such eukaryotic cell.
(37) The term eukaryotic cells as used herein includes e.g. the following eukaryotic cells: Hi-5, HeLa, Hek, HUVECs, 3T3, CHO, Jurkat, Sf-9, HepG2, Vero, MDCK, Mefs, THP-1, J774, RAW, Caco2, NCI60, DU145, Lncap, MCF-7, MDA-MB-438, PC3, T47D, A549, U87, SHSY5Y, Ea.Hy926, Saos-2, 4T1, D2A1, B16F10, and primary human hepatocytes. Eukaryotic cells as used herein, are also referred to as target cells or target eukaryotic cells.
(38) The term T3SS effector protein as used herein refers to proteins which are naturally injected by T3S systems into the cytosol of eukaryotic cells and to proteins which are naturally secreted by T3S systems that might e.g form the translocation pore into the eukaryotic membrane (including pore-forming tranlocators (as Yersinia YopB and YopD) and tip-proteins like Yersinia LcrV). Preferably proteins which are naturally injected by T3S systems into the cytosol of eukaryotic cells are used. These virulence factors will paralyze or reprogram the eukaryotic cell to the benefit of the pathogen. T3S effectors display a large repertoire of biochemical activities and modulate the function of crucial host regulatory molecules [5, 30] and include AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrD1, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA family of proteins, HopAB2, HopAO1, HopI1, HopM1, HopN1, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, HopU1, HsvB, IcsB, IpaA, IpaB, IpaC, IpaH, IpaH7.8, IpaH9.8, IpgB1, IpgB2, IpgD, LcrV, Map, OspC1, OspE2, OspF, OspG, OspI, PipB, PipB2, PopB, PopP2, PthXol, PthXo6, PthXo7, SifA, SifB, SipA/SspA, SipB, SipC/SspC, SipD/SspD, SIrP, SopA, SopB/SigD, SopD, SopE, SopE2, SpiC/SsaB, SptP, SpvB, SpvC, SrfH, SrfJ, Sse, SseB, SseC, SseD, SseF, SseG, Ssel/SrfH, SseJ, SseK1, SseK2, SseK3, SseL, SspH1, SspH2, SteA, SteB, SteC, SteD, SteE, TccP2, Tir, VirA, VirPphA, VopF, XopD, YopB, YopD YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA.
(39) T3SS effector genes of Yersinia have been cloned from e.g. Y. enterocolitica which are YopE, YopH, YopM, YopO, YopP/YopJ, and YopT [31]. The respective effector genes can be cloned from Shigella flexneri (e.g. OspF, IpgD, IpgB1), Salmonella enterica (e.g. SopE, SopB, SptP), P. aeruginosa (e.g ExoS, ExoT, ExoU, ExoY) or E. coli (e.g. Tir, Map, EspF, EspG, EspH, EspZ). The nucleic acid sequences of these genes are available to those skilled in the art, e.g., in the Genebank Database (yopH, yopO, yopE, yopP, yopM, yopT from NC_002120 GI:10955536; S. flexneri effector proteins from AF386526.1 GI:18462515; S. enterica effectors from NC_016810.1 GI:378697983 or FQ312003.1 GI:301156631; P. aeruginosa effectors from AE004091.2 GI:110227054 or CP000438.1 GI:115583796 and E. coli effector proteins from NC_011601.1 GI:215485161).
(40) For the purpose of the present invention, genes are denoted by letters of lower case and italicized to be distinguished from proteins. In case the genes (denoted by letters of lower case and italicized) are following a bacterial species name (like E. coli), they refer to a mutation of the corresponding gene in the corresponding bacterial species. For example, YopE refers to the effector protein encoded by the yopE gene. Y. enterocolitica yopE represents a Y. enterocolitica having a mutation in the yopE gene.
(41) As used herein, the terms polypeptide, peptide, protein, polypeptidic and peptidic are used interchangeably to designate a series of amino acid residues connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. Preferred are proteins which have an amino acid sequence comprising at least 10 amino acids, more preferably at least 20 amino acids.
(42) According to the present invention, a heterologous protein includes naturally occurring proteins or parts thereof and also includes artificially engineered proteins or parts thereof. As used herein, the term heterologous protein refers to a protein or a part thereof other than the T3SS effector protein or N-terminal fragment thereof to which it can be fused. In particular the heterologous protein as used herein refers to a protein or a part thereof, which do not belong to the proteome, i.e. the entire natural protein complement of the specific recombinant Gram-negative bacterial strain provided and used by the invention, e.g. which do not belong to the proteome, i.e. the entire natural protein complement of a specific bacterial strain of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Usually the heterologous protein is of animal origin including human origin. Preferably the heterologous protein is a human protein. More preferably the heterologous protein is selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins. Particular preferably the heterologous protein is selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR related proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins. Even more particular preferred are heterologous proteins selected from the group consisting of proteins involved in apoptosis or apoptosis regulation, cell cycle regulators, and ankyrin repeat proteins. Most preferred are proteins involved in apoptosis or apoptosis regulation, like animal, preferably human heterologous proteins involved in apoptosis or apoptosis regulation
(43) In some embodiments the vector of the Gram-negative bacterial strain of the present invention comprises two second DNA sequences encoding the identical or two different heterologous proteins fused independently from each other in frame to the 3 end of said first DNA sequence.
(44) In some embodiments the vector of the Gram-negative bacterial strain of the present invention comprises three second DNA sequences encoding the identical or three different heterologous proteins fused independently from each other in frame to the 3 end of said first DNA sequence.
(45) The heterologous protein expressed by the recombinant Gram-negative bacterial strain has usually a molecular weight of between 1 and 150 kD, preferably between 1 and 120 kD, more preferably between land 100 kDa, most preferably between 15 and 100 kDa.
(46) According to the present invention proteins involved in apoptosis or apoptosis regulation include, but are not limited to, Bad, Bcl2, Bak, Bmt, Bax, Puma, Noxa, Bim, Bcl-xL, Apaf1, Caspase 9, Caspase 3, Caspase 6, Caspase 7, Caspase 10, DFFA, DFFB, ROCK1, APP, CAD, ICAD, CAD, EndoG, AIF, HtrA2, Smac/Diablo, Arts, ATM, ATR, Bok/Mtd, Bmf, Mcl-1(S), IAP family, LC8, PP2B, 14-3-3 proteins, PKA, PKC, PI3K, Erk1/2, p90RSK, TRAF2, TRADD, FADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, MKK7, INK, FLIPs, FKHR, GSK3, CDKs and their inhibitors like the INK4-family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)), and the Cip1/Waf1/Kip1-2-family (p21(Cip1/Waf1), p27(Kip1), p57(Kip2). Preferably Bad, Bmt, Bcl2, Bak, Bax, Puma, Noxa, Bim, Bcl-xL, Caspase9, Caspase3, Caspase6, Caspase7, Smac/Diablo, Bok/Mtd, Bmf, Mcl-1(S), LC8, PP2B, TRADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, FKHR, CDKs and their inhibitors like the INK4-family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)), most preferably BIM, Bid, truncated Bid, FADD, Caspase 3 (and subunits thereof), Bax, Bad, Akt, CDKs and their inhibitors like the INK4-family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)) are used [32-34]. Additionally proteins involved in apoptosis or apoptosis regulation include DIVA, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bid and tBid, Egl-1, Bcl-Gs, Cytochrome C, Beclin, CED-13, BNIP1, BNIP3, Bcl-B, Bcl-W, Ced-9, A1, NR13, Bfl-1, Caspase 1, Caspase 2, Caspase 4, Caspase 5, Caspase 8. Proteins involved in apoptosis or apoptosis regulation are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of apoptosis-prevention pathways and inhibitors of pro-survival signalling or pathways. Pro-apoptotic proteins comprise proteins selected form the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apaf1, Smac/Diablo, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD, the Caspase family, and CDKs and their inhibitors like the INK4-family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)) or selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf1, Smac/Diablo, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD, and the Caspase family. Preferred are Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apaf1, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Smac/Diablo, FADD, the Caspase family, CDKs and their inhibitors like the INK4-family (p16(Ink4a), p15(Ink4b), p18(Ink4c), p19(Ink4d)). Equally preferred are Bax, Bak, Diva, Bcl-Xs, Nbk/Bik, Hrk/Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apaf1, BNIP1, BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Smac/Diablo, FADD, the Caspase family.
(47) Anti-apoptotic proteins comprise proteins selected form the group consisting of Bcl-2, Bcl-Xl, Bcl-B, Bcl-W, Mcl-1, Ced-9, A1, NR13, IAP family and Bfl-1. Preferred are Bcl-2, Bcl-Xl, Bcl-B, Bcl-W, Mcl-1, Ced-9, A1, NR13 and Bfl-1.
(48) Inhibitors of apoptosis-prevention pathways comprise proteins selected form the group consisting of Bad, Noxa and Cdc25A. Preferred are Bad and Noxa.
(49) Inhibitors of pro-survival signalling or pathways comprise proteins selected form the group consisting of PTEN, ROCK, PP2A, PHLPP, JNK, p38. Preferred are PTEN, ROCK, PP2A and PHLPP.
(50) In some embodiments the heterologous proteins involved in apoptosis or apoptosis regulation are selected from the group consisting of BH3-only proteins, caspases and intracellular signalling proteins of death receptor control of apoptosis.
(51) BH3-only proteins comprise proteins selected form the group consisting of Bad, BIM, Bid and tBid, Puma, Bik/Nbk, Bod, Hrk/Dp5, BNIP1, BNIP3, Bmf, Noxa, Mcl-1, Bcl-Gs, Beclin 1, Egl-1 and CED-13. Preferred are Bad, BIM, Bid and tBid.
(52) Caspases comprise proteins selected form the group consisting of Caspase 1, Caspase 2, Caspase 3, Caspase 4, Caspase 5, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Caspase 10.
(53) Preferred are Caspase 3, Caspase 8 and Caspase9.
(54) Intracellular signalling proteins of death receptor control of apoptosis comprise proteins selected form the group consisting of FADD, TRADD, ASC, BAP31, GULP1/CED-6, CIDEA, MFG-E8, CIDEC, RIPK1/RIP1, CRADD, RIPK3/RIP3, Crk, SHB, CrkL, DAXX, the 14-3-3 family, FLIP, DFF40 and 45, PEA-15, SODD. Preferred are FADD and TRADD.
(55) In some embodiments two heterologous proteins involved in apoptosis or apoptosis regulation are comprised by the vector of the Gram-negative bacterial strain of the present invention, wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of apoptosis-prevention pathways or wherein one protein is a pro-apoptotic protein and the other protein is an inhibitor of pro-survival signalling or pathways.
(56) Pro-apoptotic proteins encompassed by the present invention have usually an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and usually comprise at least one of BH1, BH2, BH3 or BH4 domains, preferably comprise at least one BH3 domain. Usually pro-apoptotic proteins encompassed by the present invention have no enzymatic activity.
(57) The term protease cleavage site as used herein refers to a specific amino acid motif within an amino acid sequence e.g. within an amino acid sequence of a protein or a fusion protein, which is cleaved by a specific protease, which recognizes the amino acid motif. For review see [35]. Examples of protease cleavage sites are amino acid motifs, which are cleaved by a protease selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease (HRV 3C), TEV protease, TVMV protease, FactorXa protease and thrombin.
(58) The following amino acid motif is recognized by the respective protease: Asp-Asp-Asp-Asp-Lys: Enterokinase (light chain)/Enteropeptidase Leu-Glu-Val-Leu-Phe-Gln/Gly-Pro: PreScission Protease/human Rhinovirus protease (HRV 3C) Glu-Asn-Leu-Tyr-Phe-Gln-Ser and modified motifs based on the Glu-X-X-Tyr-X-Gln-Gly/Ser (where X is any amino acid) recognized by TEV protease (tobacco etch virus) Glu-Thr-Val-Arg-Phe-Gln-Ser: TVMV protease Ile-(Glu or Asp)-Gly-Arg: FactorXa protease Leu-Val-Pro-Arg/Gly-Ser: Thrombin.
(59) Encompassed by the protease cleavage sites as used herein is ubiquitin. Thus in some preferred embodiments ubiquitin is used as protease cleavage site, i.e. the third DNA sequence encodes ubiquitin as protease cleavage site, which can be cleaved by a specific ubiquitin processing proteases at the N-terminal site, e.g. which can be cleaved by a specific ubiquitin processing proteases called Deubiquitinating enzymes at the N-terminal site endogenously in the cell where the fusion protein has been delivered to. Ubiquitin is processed at its C-terminus by a group of endogenous Ubiquitin-specific C-terminal proteases (Deubiquitinating enzymes, DUBs). The cleavage of Ubiquitin by DUBs is supposed to happen at the very C-terminus of Ubiquitin (after G76).
(60) An individual, subject or patient is a vertebrate. In certain embodiments, the vertebrate is a mammal. Mammals include, but are not limited to, primates (including human and non-human primates) and rodents (e.g., mice and rats). In certain embodiments, a mammal is a human.
(61) The term mutation is used herein as a general term and includes changes of both single base pair and multiple base pairs. Such mutations may include substitutions, frame-shift mutations, deletions, insertions and truncations.
(62) The term labelling molecule or an acceptor site for a labelling molecule as used herein refers to a small chemical compound binding to a specific amino acid sequence resulting in fluorescence of the bound chemical compound, preferably coumarine ligase/coumarine acceptor site (and derivates thereof), resorufin ligase/resorufin acceptor site (and derivates thereof) and the tetra-Cysteine motif (as Cys-Cys-Pro-Gly-Cys-Cys and derivates thereof) in use with FlAsH/ReAsH dye (life technologies) or a fluorescent protein as Enhanced Green Fluorescent Protein (EGFP).
(63) The term nuclear localization signal as used herein refers to an amino acid sequence that marks a protein for import into the nucleus of a eukaryotic cell and includes preferably a viral nuclear localization signal such as the SV40 large T-antigen derived NLS (PPKKKRKV).
(64) The term multiple cloning site as used herein refers to a short DNA sequence containing several restriction sites for cleavage by restriction endonucleases such as AclI, HindIII, SspI, MluCI, Tsp509I, PciI, AgeI, BspMI, BfuAI, SexAI, MluI, BceAI, HpyCH4IV, HpyCH4III, BaeI, BsaXI, AflIII, SpeI, BsrI, BmrI, BglII, AfeI, AluI, StuI, ScaI, ClaI, BspDI, PI-SceI, NsiI, AseI, SwaI, CspCI, MfeI, BssSI, BmgBI, PmlI, DraIII, AleI, EcoP15I, PvuII, AlwNI, BtsIMutI, TspRI, NdeI, NlaIII, CviAII, FatI, MslI, FspEI, XcmI, BstXI, PflMI, BccI, NcoI, BseYI, FauI, SmaI, XmaI, TspMI, Nt.CviPII, LpnPI, AciI, SacII, BsrBI, MspI, HpaII, ScrFI, BssKI, StyD4I, BsaJI, BslI, BtgI, NciI, AvrII, MnlI, BbvCI, Nb.BbvCI, Nt.BbvCI, SbfI, Bpu10I, Bsu36I, EcoNI, HpyAV, BstNI, PspGI, Styl, BcgI, PvuI, BstUI, EagI, RsrII, BsiEI, BsiWI, BsmBI, Hpy99I, MspA1I, MspJI, SgrAI, BfaI, BspCNI, XhoI, EarI, AcuI, PstI, BpmI, DdeI, SfcI, AflII, BpuEI, SmlI, AvaI, BsoBI, MboII, BbsI, XmnI, BsmI, Nb.BsmI, EcoRI, HgaI, AatII, ZraI, Tth111I PflFI, PshAI, AhdI, DrdI, Eco53kI, SacI, BseRI, PleI, Nt.BstNBI, MlyI, HinfI, EcoRV, MboI, Sau3AI, DpnII BfuCI, DpnI, BsaBI, TfiI, BsrDI, Nb.BsrDI, BbvI, BtsI, Nb.BtsI, BstAPI, SfaNI, SphI, NmeAIII, NaeI, NgoMIV, BglI, AsiSI, BtgZI, HinP1I, HhaI, BssHII, NotI, Fnu4HI, Cac8I, MwoI, NheI, BmtI, SapI, BspQI, Nt.BspQI, BlpI, TseI, ApeKI, Bsp1286I, AlwI, Nt.AlwI, BamHI, FokI, BtsCI, HaeIII, PhoI, FseI, SfiI, NarI, KasI, SfoI, PluTI, AscI, EciI, BsmFI, ApaI, PspOMI, Sau96I, NlaIV, KpnI, Acc65I, BsaI, HphI, BstEII, AvaII, BanI, BaeGI, BsaHI, BanII, RsaI, CviQI, BstZ171, BciVI, SalI, Nt.BsmAI, BsmAI, BcoDI, ApaLI, BsgI, AccI, Hpyl66II, Tsp45I, HpaI, PmeI, Hindi, BsiHKAI, ApoI, NspI, BsrFI, BstYI, HaeII, CviKI-1, EcoO109I, PpuMI, I-CeuI, SnaBI, I-SceI, BspHI, BspEI, MmeI, TaqI, NruI, Hpyl88I, Hpyl88III, XbaI, BelI, HpyCH4V, FspI, PI-PspI, MscI, BsrGI, MseI, Pad, PsiI, BstBI, DraI, PspXI, BsaWI, BsaAI, EaeI, preferably XhoI, XbaI, HindIII, NcoI, NotI, EcoRI, EcoRV, BamHI, NheI, SacI, SalI, BstBI. The term multiple cloning site as used herein further refers to a short DNA sequence used for recombination events as e.g in Gateway cloning strategy or for methods such as Gibbson assembly or topo cloning.
(65) The term Yersinia wild type strain as used herein refers to a naturally occurring variant (as Y. enterocolitica E40) or a naturally occurring variant containing genetic modifications allowing the use of vectors, such as deletion mutations in restriction endonucleases or antibiotic resistance genes (as Y. enterocolitica MRS40, the Ampicillin sensitive derivate of Y. enterocolitica E40) These strains contain chromosomal DNA as well as an unmodified virulence plasmid (called pYV).
(66) The term comprise is generally used in the sense of include, that is to say permitting the presence of one or more features or components.
(67) In one embodiment the present invention provides a recombinant Gram-negative bacterial strain, wherein the Gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas. In one embodiment the present invention provides a recombinant Gram-negative bacterial strain, wherein the Gram-negative bacterial strain is selected from the group consisting of the genera Yersinia and Salmonella. Preferably the Gram-negative bacterial strain is a Yersinia strain, more preferably a Yersinia enterocolitica strain. Most preferred is Yersinia enterocolitica E40 [13] or Ampicilline sensitive derivates thereof as Y. enterocolitica MRS40 as described in [36]. Also preferably the Gram-negative bacterial strain is a Salmonella strain, more preferably a Salmonella enterica strain. Most preferred is Salmonella enterica Serovar Typhimurium SL1344 as described by the Public health England culture collection (NCTC 13347).
(68) In one embodiment of the present invention the delivery signal from a bacterial T3SS effector protein comprises a bacterial T3SS effector protein or a N-terminal fragment thereof wherein the T3SS effector protein or a N-terminal fragment thereof may comprise a chaperone binding site. A T3SS effector protein or a N-terminal fragment thereof which comprises a chaperone binding site is particular useful as delivery signal in the present invention. Preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SopE2, SptP, YopE, ExoS, SipA, SipB, SipD, SopA, SopB, SopD, IpgB1, IpgD, SipC, SifA, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, SspH1,VopF, ExoS, ExoT, HopAB2, XopD, AvrRpt2, HopAO1, HopPtoD2, HopU1, GALA family of proteins, AvrBs2, AvrD1, AvrBS3, YopO, YopP, YopE, YopM, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspC1, OspE2, IpaH9.8, IpaH7.8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD, and AvrXv3. More preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, YopE, ExoS, SopB, IpgB1, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopM, YopT, whereof most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of IpgB1, SopE, SopB, SptP, OspF, IpgD, YopH, YopO, YopP, YopE, YopM, YopT, in particular YopE or an N-terminal fragment thereof.
(69) Equally preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SopE2, SptP, SteA, SipA, SipB, SipD, SopA, SopB, SopD, IpgB1, IpgD, SipC, SifA, SifB, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, VopF, ExoS, ExoT, HopAB2, AvrRpt2, HopAO1, HopU1, GALA family of proteins, AvrBs2, AvrD1, YopO, YopP, YopE, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspC1, OspE2, IpaH9.8, IpaH7.8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD, and AvrXv3. Equally more preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, SteA, SifB, SopB, IpgB1, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopT, whereof equally most preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of IpgB1, SopE, SopB, SptP, SteA, SifB, OspF, IpgD, YopH, YopO, YopP, YopE, and YopT, in particular SopE, SteA, or YopE or an N-terminal fragment thereof, more particular SteA or YopE or an N-terminal fragment thereof, most particular YopE or an N-terminal fragment thereof.
(70) In some embodiments the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises the bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the N-terminal fragment thereof includes at least the first 10, preferably at least the first 20, more preferably at least the first 100 amino acids of the bacterial T3SS effector protein.
(71) In some embodiments the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises the bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the bacterial T3SS effector protein or the N-terminal fragment thereof comprises a chaperone binding site.
(72) Preferred T3SS effector proteins or a N-terminal fragment thereof, which comprise a chaperone binding site comprise the following combinations of chaperone binding site and T3SS effector protein or N-terminal fragment thereof: SycE-YopE, InvB-SopE, SicP-SptP, SycT-YopT, SycO-YopO, SycN/YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF, SycD-YopB, SycD-YopD. More preferred are SycE-YopE, InvB-SopE, SycT-YopT, SycO-YopO, SycN/YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF. Most preferred is a YopE or an N-terminal fragment thereof comprising the SycE chaperone binding site such as an N-terminal fragment of a YopE effector protein containing the N-terminal 138 amino acids of the YopE effector protein designated herein as YopE.sub.1-138 and as shown in SEQ ID NO. 2 or a SopE or an N-terminal fragment thereof comprising the InvB chaperone binding site as such an N-terminal fragment of a SopE effector protein containing the N-terminal 81 or 105 amino acids of the SopE effector protein designated herein as SopE.sub.1-81 or SopE.sub.1-105 respectively, and as shown in SEQ ID NO. 142 or 143.
(73) In one embodiment of the present invention the recombinant Gram-negative bacterial strain is a Yersinia strain and the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises a YopE effector protein or an N-terminal part, preferably the Y. enterocolitica YopE effector protein or an N-terminal part thereof. Preferably the SycE binding site is comprised within the N-terminal part of the YopE effector protein. In this connection an N-terminal fragment of a YopE effector protein may comprise the N-terminal 12, 16, 18, 52, 53, 80 or 138 amino acids [10, 37, 38]. Most preferred is an N-terminal fragment of a YopE effector protein containing the N-terminal 138 amino acids of the YopE effector protein e.g. as described in Forsberg and Wolf-Watz [39] designated herein as YopE.sub.1-138 and as shown in SEQ ID NO. 2.
(74) In one embodiment of the present invention the recombinant Gram-negative bacterial strain is a Salmonella strain and the delivery signal from the bacterial T3SS effector protein encoded by the first DNA sequence comprises a SopE or SteA effector protein or an N-terminal part thereof, preferably the Salmonella enterica SopE or SteA effector protein or an N-terminal part thereof. Preferably the chaperon binding site is comprised within the N-terminal part of the SopE effector protein. In this connection an N-terminal fragment of a SopE effector protein protein may comprise the N-terminal 81 or 105 amino acids. Most preferred is the full length SteA and an N-terminal fragment of a SopE effector protein containing the N-terminal 105 amino acids of the effector protein e.g. as described in SEQ ID NO. 142 or 143.
(75) One skilled in the art is familiar with methods for identifying the polypeptide sequences of an effector protein that are capable of delivering a protein. For example, one such method is described by Sory et al. [13]. Briefly, polypeptide sequences from e.g. various portions of the Yop proteins can be fused in-frame to a reporter enzyme such as the calmodulin-activated adenylate cyclase domain (or Cya) of the Bordetella pertussis cyclolysin. Delivery of a Yop-Cya hybrid protein into the cytosol of eukaryotic cells is indicated by the appearance of cyclase activity in the infected eukaryotic cells that leads to the accumulation of cAMP. By employing such an approach, one skilled in the art can determine, if desired, the minimal sequence requirement, i.e., a contiguous amino acid sequence of the shortest length, that is capable of delivering a protein, see, e.g. [13]. Accordingly, preferred delivery signals of the present invention consists of at least the minimal sequence of amino acids of a T3SS effector protein that is capable of delivering a protein.
(76) In one embodiment the present invention provides mutant recombinant Gram-negative bacterial strains in particular recombinant Gram-negative bacterial strains which are deficient in producing at least one T3SS functional effector protein.
(77) According to the present invention, such a mutant Gram-negative bacterial strain e.g. such a mutant Yersinia strain can be generated by introducing at least one mutation into at least one effector-encoding gene. Preferably, such effector-encoding genes include YopE, YopH, YopO/YpkA, YopM, YopP/YopJ and YopT as far as a Yersinia strain is concerned.
(78) Preferably, such effector-encoding genes include AvrA, CigR, GogB, GtgA, GtgE, PipB, SifB, SipA/SspA, SipB, SipC/SspC, SipD/SspD, SlrP, SopB/SigD, SopA, SpiC/SsaB, SseB, SseC, SseD, SseF, SseG, Ssel/SrfH, SopD, SopE, SopE2, SspH1, SspH2, PipB2, SifA, SopD2, SseJ, SseK1, SseK2, SseK3, SseL, SteC, SteA, SteB, SteD, SteE, SpvB, SpvC, SpvD, SrfJ, SptP, as far as a Salmonella strain is concerned. Most preferably, all effector-encoding genes are deleted. The skilled artisan may employ any number of standard techniques to generate mutations in these T3SS effector genes. Sambrook et al. describe in general such techniques. See Sambrook et al. [40].
(79) In accordance with the present invention, the mutation can be generated in the promoter region of an effector-encoding gene so that the expression of such effector gene is abolished. The mutation can also be generated in the coding region of an effector-encoding gene such that the catalytic activity of the encoded effector protein is abolished. The catalytic activity of an effector protein refers normally to the anti-target cell function of an effector protein, i.e., toxicity. Such activity is governed by the catalytic motifs in the catalytic domain of an effector protein. The approaches for identifying the catalytic domain and/or the catalytic motifs of an effector protein are well known by those skilled in the art. See, for example, [41, 42]. Accordingly, one preferred mutation of the present invention is a deletion of the entire catalytic domain. Another preferred mutation is a frameshift mutation in an effector-encoding gene such that the catalytic domain is not present in the protein product expressed from such frameshifted gene. A most preferred mutation is a mutation with the deletion of the entire coding region of the effector protein. Other mutations are also contemplated by the present invention, such as small deletions or base pair substitutions, which are generated in the catalytic motifs of an effector protein leading to destruction of the catalytic activity of a given effector protein.
(80) The mutations that are generated in the genes of the T3SS functional effector proteins may be introduced into the particular strain by a number of methods. One such method involves cloning a mutated gene into a suicide vector which is capable of introducing the mutated sequence into the strain via allelic exchange. An example of such a suicide vector is described by [43].
(81) In this manner, mutations generated in multiple genes may be introduced successively into a Gram-negative bacterial strain giving rise to polymutant, e.g a sixtuple mutant recombinant strain. The order in which these mutated sequences are introduced is not important. Under some circumstances, it may be desired to mutate only some but not all of the effector genes. Accordingly, the present invention further contemplates polymutant Yersinia other than sixtuple-mutant Yersinia, e.g., double-mutant, triple-mutant, quadruple-mutant and quintuple-mutant strains. For the purpose of delivering proteins, the secretion and translocation system of the instant mutant strain needs to be intact.
(82) A preferred recombinant Gram-negative bacterial strain of the present invention is a sixtuple-mutant Yersinia strain in which all the effector-encoding genes are mutated such that the resulting Yersinia no longer produce any functional effector proteins. Such sixtuple-mutant Yersinia strain is designated as yopH.sub.2O,P,E,M,T for Y. enterocolitica. As an example such a sixtuple-mutant can be produced from the Y. enterocolitica MRS40 strain giving rise to Y. enterocolitica MRS40 yopH.sub.2O,P,E,M,T, which is preferred.
(83) A further aspect of the present invention is directed to a vector for use in combination with the recombinant Gram-negative bacterial strains to deliver a desired protein into eukaryotic cells, wherein the vector comprises in the 5 to 3 direction:
(84) a promoter;
(85) a first DNA sequence encoding a delivery signal from a bacterial T3SS effector protein, operably linked to said promoter;
(86) a second DNA sequence encoding a heterologous protein fused in frame to the 3 end of said first DNA sequence; and alternatively
(87) a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3 end of said first DNA sequence and the 5 end of said second DNA sequence.
(88) Promoter, heterologous protein and protease cleavage site as described supra can be used for the vector of the Gram-negative bacterial strain.
(89) Vectors which can be used according to the invention depend on the Gram-negative bacterial strains used as known to the skilled person. Vectors which can be used according to the invention include expression vectors, vectors for chromosomal or virulence plasmid insertion and DNA fragments for chromosomal or virulence plasmid insertion. Expression vectors which are useful in e.g. Yersinia, Escherichia, Salmonella or Pseudomonas strain are e.g pUC, pBad, pACYC, pUCP20 and pET plasmids. Vectors for chromosomal or virulence plasmid insertion which are useful in e.g. Yersinia, Escherichia, Salmonella or Pseudomonas strain are e.g pKNG101. DNA fragments for chromosomal or virulence plasmid insertion refer to methods used in e.g. Yersinia, Escherichia, Salmonella or Pseudomonas strain as e.g. lambda-red genetic engineering. Vectors for chromosomal or virulence plasmid insertion or DNA fragments for chromosomal or virulence plasmid insertion may insert the first, second and/or third DNA sequence of the present invention so that the first, second and/or third DNA sequence is operably linked to an endogenous promoter of the recombinant Gram-negative bacterial strain. Thus if a vector for chromosomal or virulence plasmid insertion or a DNA fragment for chromosomal or virulence plasmid insertion is used, an endogenous promoter can be encoded on the endogenous bacterial DNA (chromosomal or plasmid DNA) and only the first and second DNA sequence will be provided by the engineered vector for chromosomal or virulence plasmid insertion or DNA fragment for chromosomal or virulence plasmid insertion. Thus a promoter is not necessarily needed to be comprised by the vector used for transformation of the recombinant Gram-negative bacterial strains i.e. the recombinant Gram-negative bacterial strains of the present invention may be transformed with a vector which dose not comprise a promoter. Preferably an expression vector is used. The vector of the present invention is normally used for delivery of the heterologous proteins by the bacterial T3SS into eukaryotic cells in vitro and in vivo.
(90) A preferred expression vector for Yersinia is selected from the group consisting of pBad_Si_1 and pBad_Si_2. pBad_Si2 was constructed by cloning of the SycE-YopE.sub.1-138 fragment containing endogenous promoters for YopE and SycE from purified pYV40 into KpnI/HindIII site of pBad-MycHisA (Invitrogen). Additional modifications include removal of the NcoI/BglII fragment of pBad-MycHisA by digest, Klenow fragment treatment and religation. Further at the 3 end of YopE.sub.1-138 the following cleavage sites were added: XbaI-XhoI-BstBI-(HindIII). pBad_Si1 is equal to pBad_Si2 but encodes EGFP amplified from pEGFP-C1 (Clontech) in the NcoI/BglII site under the Arabinose inducible promoter.
(91) A preferred expression vector for Salmonella is selected from the group consisting of pSi_266, pSi_267, pSi_268 and pSi_269. Plasmids pSi_266, pSi_267, pSi_268 and pSi_269 containing the corresponding endogenous promoter and the SteA.sub.1-20 fragment (pSi_266), the full length SteA sequence (pSi_267), the SopE.sub.1-81 fragment (pSi_268) or the SopE.sub.1-105 fragment (pSi_269) were amplified from S. enterica SL1344 genomic DNA and cloned into NcoI/KpnI site of pBad-MycHisA (Invitrogen).
(92) The vectors of the instant invention may include other sequence elements such as a 3 termination sequence (including a stop codon and a poly A sequence), or a gene conferring a drug resistance which allows the selection of transformants having received the instant vector. The vectors of the present invention may be transformed by a number of known methods into the recombinant Gram-negative bacterial strains. For the purpose of the present invention, the methods of transformation for introducing a vector include, but are not limited to, electroporation, calcium phosphate mediated transformation, conjugation, or combinations thereof. For example, a vector can be transformed into a first bacteria strain by a standard electroporation procedure. Subsequently, such a vector can be transferred from the first bacteria strain into the desired strain by conjugation, a process also called mobilization. Transformant (i.e., Gram-negative bacterial strains having taken up the vector) may be selected, e.g., with antibiotics. These techniques are well known in the art. See, for example, [13].
(93) In accordance with the present invention, the promoter of the expression vector of the recombinant Gram-negative bacterial strain of the invention can be a native promoter of a T3SS effector protein of the respective strain or a compatible bacterial strain or a promoter used in expression vectors which are useful in e.g. Yersinia, Escherichia, Salmonella or Pseudomonas strain e.g pUC and pBad. Such promoters are the T7 promoter, Plac promoter or Ara-bad promoter.
(94) If the recombinant Gram-negative bacterial strain is a Yersinia strain the promoter can be from a Yersinia virulon gene. A Yersinia virulon gene refers to genes on the Yersinia pYV plasmid, the expression of which is controlled both by temperature and by contact with a target cell. Such genes include genes coding for elements of the secretion machinery (the Ysc genes), genes coding for translocators (YopB, YopD, and LcrV), genes coding for the control elements (YopN, TyeA and LcrG), genes coding for T3SS effector chaperones (SycD, SycE, SycH, SycN, SycO and SycT), and genes coding for effectors (YopE, YopH, YopO/YpkA, YopM, YopT and YopP/YopJ) as well as other pYV encoded proteins as VirF and YadA. In a preferred embodiment of the present invention, the promoter is the native promoter of a T3SS functional effector encoding gene. If the recombinant Gram-negative bacterial strain is a Yersinia strain the promoter is selected from any one of YopE, YopH, YopO/YpkA, YopM and YopP/YopJ. More preferably, the promoter is from YopE or SycE.
(95) If the recombinant Gram-negative bacterial strain is a Salmonella strain the promoter can be from SpiI or SpiII pathogenicity island or from an effector protein elsewhere encoded. Such genes include genes coding for elements of the secretion machinery, genes coding for translocators, genes coding for the control elements, genes coding for T3SS effector chaperones, and genes coding for effectors as well as other proteins encoded by SPI-1 or SPI-2. In a preferred embodiment of the present invention, the promoter is the native promoter of a T3SS functional effector encoding gene. If the recombinant Gram-negative bacterial strain is a Salmonella strain the promoter is selected from any one of the effector proteins. More preferably, the promoter is from SopE, InvB or SteA.
(96) In a preferred embodiment the expression vector comprises a DNA sequence encoding a protease cleavage site. Generation of a functional and generally applicable cleavage site allows cleaving off the delivery signal after translocation. As the delivery signal can interfere with correct localization and/or function of the translocated protein within the target cells the introduction of a protease cleavage site between the delivery signal and the protein of interest provides for the first time delivery of almost native proteins into eukaryotic cells. Preferably the protease cleavage site is an amino acid motif which is cleaved by a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease 3C, TEV protease, TVMV protease, FactorXa protease and thrombin, more preferably an amino acid motif which is cleaved by TEV protease. Equally preferable the protease cleavage site is an amino acid motif which is cleaved by a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, prescission protease, human rhinovirus protease 3C, TEV protease, TVMV protease, FactorXa protease, ubiquitin processing protease, called Deubiquitinating enzymes, and thrombin. Most preferred is an amino acid motif which is cleaved by TEV protease or by an ubiquitin processing protease. Thus in a further embodiment of the present invention, the heterologous protein is cleaved from the delivery signal from a bacterial T3SS effector protein by a protease. Preferred methods of cleavage are methods wherein:
(97) a) the protease is translocated into the eukaryotic cell by a recombinant Gram-negative bacterial strain as described herein which expresses a fusion protein which comprises the delivery signal from the bacterial T3SS effector protein and the protease as heterologous protein; or
b) the protease is expressed constitutively or transiently in the eukaryotic cell.
(98) Usually the recombinant Gram-negative bacterial strain used to deliver a desired protein into a eukaryotic cell and the recombinant Gram-negative bacterial strain translocating the protease into the eukaryotic cell are different.
(99) In one embodiment of the present invention the vector comprises a further DNA sequence encoding a labelling molecule or an acceptor site for a labelling molecule. The further DNA sequence encoding a labelling molecule or an acceptor site for a labelling molecule is usually fused to the 5 end or to the 3 end of the second DNA sequence. A preferred labelling molecule or an acceptor site for a labelling molecule is selected from the group consisting of enhanced green fluorescent protein (EGFP), coumarin, coumarin ligase acceptor site, resorufin, resurofin ligase acceptor site, the tetra-Cysteine motif in use with FlAsH/ReAsH dye (life technologies). Most preferred is resorufin and a resurofin ligase acceptor site or EGFP. The use of a labelling molecule or an acceptor site for a labelling molecule will lead to the attachment of a labelling molecule to the heterologous protein of interest, which will then be delivered as such into the eukaryotic cell and enables tracking of the protein by e.g. live cell microscopy.
(100) In one embodiment of the present invention the vector comprises a further DNA sequence encoding a peptide tag. The further DNA sequence encoding a peptide tag is usually fused to the 5 end or to the 3 end of the second DNA sequence. A preferred peptide tag is selected from the group consisting of Myc-tag, His-tag, Flag-tag, HA tag, Strep tag or V5 tag or a combination of two or more tags out of these groups. Most preferred is Myc-tag, Flag-tag, His-tag and combined Myc- and His-tags. The use of a peptide tag will lead to traceability of the tagged protein e.g by immunofluorescence or Western blotting using anti-tag antibodies. Further, the use of a peptide tag allows affinity purification of the desired protein either after secretion into the culture supernatant or after translocation into eukaryotic cells, in both cases using a purification method suiting the corresponding tag (e.g. metal-chelate affinity purification in use with a His-tag or anti-Flag antibody based purification in use with the Flag-tag).
(101) In one embodiment of the present invention the vector comprises a further DNA sequence encoding a nuclear localization signal (NLS). The further DNA sequence encoding a nuclear localization signal (NLS) is usually fused to the 5 end or to the 3 end of the second DNA sequence wherein said further DNA sequence encodes a nuclear localization signal (NLS). A preferred NLS is selected from the group consisting of SV40 large T-antigen NLS and derivates thereof [44] as well as other viral NLS. Most preferred is SV40 large T-antigen NLS and derivates thereof.
(102) In one embodiment of the present invention the vector comprises a multiple cloning site. The multiple cloning site is usually located at the 3 end of the first DNA sequence and/or at the 5 end or 3 end of the second DNA sequence. One or more than one multiple cloning sites can be comprised by the vector. A preferred multiple cloning site is selected from the group of restriction enzymes consisting of XhoI, XbaI, HindIII, NcoI, NotI, EcoRI, EcoRV, BamHI, NheI, SacI, SalI, BstBI. Most preferred is XbaI, XhoI, BstBI and HindIII.
(103) The protein expressed from the fused first and second and optional third DNA sequences of the vector is also termed as a fusion protein or a hybrid protein, i.e., a fused protein or hybrid of delivery signal and a heterologous protein. The fusion protein can also comprise e.g. a delivery signal and two or more different heterologous proteins.
(104) The present invention contemplates a method for delivering heterologous proteins as hereinabove described into eukaryotic cells in cell culture as well as in-vivo.
(105) Thus in one embodiment the method for delivering heterologous proteins comprises
(106) i) culturing the Gram-negative bacterial strain as described herein;
(107) ii) contacting a eukaryotic cell with the Gram-negative bacterial strain of i) wherein a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein and the heterologous protein is expressed by the Gram-negative bacterial strain and is translocated into the eukaryotic cell; and optionally
iii) cleaving the fusion protein so that the heterologous protein is cleaved from the delivery signal from the bacterial T3SS effector protein.
(108) In some embodiments at least two fusion proteins which comprises each a delivery signal from a bacterial T3SS effector protein and a heterologous protein are expressed by the Gram-negative bacterial strain and are translocated into the eukaryotic cell by the methods of the present inventions.
(109) The recombinant Gram-negative bacterial strain can be cultured so that a fusion protein is expressed which comprises the delivery signal from the bacterial T3SS effector protein and the heterologous protein according to methods known in the art (e.g. FDA, Bacteriological Analytical Manual (BAM), chapter 8: Yersinia enterocolitica). Preferably the recombinant Gram-negative bacterial strain can be cultured in Brain Heart infusion broth e.g. at 28 C. For induction of expression of T3SS and e.g. YopE/SycE promoter dependent genes, bacteria can be grown at 37 C.
(110) In a preferred embodiment, the eukaryotic cell is contacted with two Gram-negative bacterial strains of i), wherein the first Gram-negative bacterial strain expresses a first fusion protein which comprises the delivery signal from the bacterial T3SS effector protein and a first heterologous protein and the second Gram-negative bacterial strain expresses a second fusion protein which comprises the delivery signal from the bacterial T3SS effector protein and a second heterologous protein, so that the first and the second fusion protein are translocated into the eukaryotic cell. This embodiment provided for co-infection of e.g eukaryotic cells with two bacterial strains as a valid method to deliver e.g. two different hybrid proteins into single cells to address their functional interaction.
(111) The present invention contemplates a wide range of eukaryotic cells that may be targeted by the instant recombinant Gram-negative bacterial strain e.g. Hi-5 (BTI-TN-5B1-4; life technologies B855-02), HeLa cells, e.g. HeLa Cc12 (as ATCC No. CCL-2), fibroblast cells, e.g. 3T3 fibroblast cells (as ATCC No. CCL-92) or Mef (as ATCC No. SCRC-1040), Hek (as ATCC No. CRL-1573), HUVECs (as ATCC No. PCS-100-013), CHO (as ATCC No. CCL-61), Jurkat (as ATCC No. TIB-152), Sf-9 (as ATCC No. CRL-1711), HepG2 (as ATCC No. HB-8065), Vero (as ATCC No. CCL-81), MDCK (as ATCC No. CCL-34), THP-1 (as ATCC No. TIB-202), J774 (as ATCC No. TIB-67), RAW (as ATCC No. TIB-71), Caco2 (as ATCC No. HTB-37), NCI cell lines (as ATCC No. HTB-182), DU145 (as ATCC No. HTB-81), Lncap (as ATCC No. CRL-1740), MCF-7 (as ATCC No. HTB-22), MDA-MB cell lines (as ATCC No. HTB-128), PC3 (as ATCC No. CRL-1435), T47D (as ATCC No. CRL-2865), A549 (as ATCC No. CCL-185), U87 (as ATCC No. HTB-14), SHSY5Y (as ATCC No. CRL-2266s), Ea.Hy926 (as ATCC No. CRL-2922), Saos-2 (as ATCC No. HTBH-85), 4T1 (as ATCC No. CRL-2539), B16F10 (as ATCC No. CRL-6475), or primary human hepatocytes (as life technologies HMCPIS), preferably HeLa, Hek, HUVECs, 3T3, CHO, Jurkat, Sf-9, HepG2 Vero, THP-1, Caco2, Mef, A549, 4T1, B16F10 and primary human hepatocytes and most preferably HeLa, Hek, HUVECs, 3T3, CHO, Jurkat, THP-1, A549 and Mef. By target, is meant the extracellular adhesion of the recombinant Gram-negative bacterial strain to a eukaryotic cell.
(112) In accordance with the present invention, the delivery of a protein can be achieved by contacting a eukaryotic cell with a recombinant Gram-negative bacterial strain under appropriate conditions. Various references and techniques are conventionally available for those skilled in the art regarding the conditions for inducing the expression and translocation of virulon genes, including the desired temperature, Ca.sup.++ concentration, addition of inducers as Congo Red, manners in which the recombinant Gram-negative bacterial strain and target cells are mixed, and the like. See, for example, [45]. The conditions may vary depending on the type of eukaryotic cells to be targeted and the recombinant bacterial strain to be used. Such variations can be addressed by those skilled in the art using conventional techniques. Those skilled in the art can also use a number of assays to determine whether the delivery of a fusion protein is successful. For example, the fusion protein may be detected via immunofluorescence using antibodies recognizing a fused tag (like Myc-tag). The determination can also be based on the enzymatic activity of the protein being delivered, e.g., the assay described by [13].
(113) In one embodiment the present invention provides a method of purifying a heterologous protein comprising culturing the Gram-negative bacterial strain as described herein so that a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein and the heterologous protein is expressed and secreted into the supernatant of the culture. The fusion protein expressed may further comprise a protease cleavage site between the delivery signal from the bacterial T3SS effector protein and the heterologous protein and/or may further comprise a peptide tag.
(114) Thus in a particular embodiment the method of purifying a heterologous protein comprises
(115) i) culturing the Gram-negative bacterial strain as described herein so that a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein, the heterologous protein and a protease cleavage site between the delivery signal from the bacterial T3SS effector protein and the heterologous protein is expressed and secreted into the supernatant of the culture;
ii) adding a protease to the supernatant of the culture wherein the protease cleaves the fusion protein so that the heterologous protein is cleaved from the delivery signal from the bacterial T3SS effector protein;
iii) optionally isolating the heterologous protein from the supernatant of the culture
(116) Thus in another particular embodiment the method of purifying a heterologous protein comprises
(117) i) culturing the Gram-negative bacterial strain as described herein so that a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein, the heterologous protein and a peptide tag is expressed and secreted into the supernatant of the culture;
ii) targeting the peptide tag e.g. by affinity column purification of the supernatant.
(118) Thus in another particular embodiment the method of purifying a heterologous protein comprises
(119) i) culturing the Gram-negative bacterial strain as described herein so that a fusion protein which comprises a delivery signal from a bacterial T3SS effector protein, the heterologous protein, a protease cleavage site between the delivery signal from the bacterial T3SS effector protein and the heterologous protein and a peptide tag is expressed and secreted into the supernatant of the culture;
ii) adding a protease to the supernatant of the culture wherein the protease cleaves the fusion protein so that the heterologous protein is cleaved from the delivery signal from the bacterial T3SS effector protein;
ii) targeting the peptide tag e.g. by affinity column purification of the supernatant.
(120) In the above described particular embodiments the protease can be added to the supernatant of the culture in the form of e.g a purified protease protein or by adding a bacterial strain expressing and secreting a protease to the supernatant of the culture. Further steps may include removal of the protease e.g. via affinity column purification.
(121) In one embodiment the present invention provides the recombinant Gram-negative bacterial strain as described herein for use in medicine.
(122) In one embodiment the present invention provides the recombinant Gram-negative bacterial strain as described herein for use in the delivery of a heterologous protein as a medicament or as a vaccine to a subject. The heterologous protein can be delivered to a subject as a vaccine by contacting the Gram-negative bacterial strain with eukaryotic cells, e.g. with a living animal in vivo so that the heterologous protein is translocated into the living animal which then produces antibodies against the heterologous protein. The antibodies produced can be directly used or be isolated and purified and used in diagnosis, in research use as well as in therapy. The B-cells producing the antibodies or the therein contained DNA sequence can be used for further production of specific antibodies for use in diagnosis, in research use as well as in therapy
(123) In one embodiment the present invention provides a method for delivering a heterologous protein, wherein the heterologous protein is delivered in vitro into a eukaryotic cell.
(124) In a further embodiment the present invention provides a method for delivering a heterologous protein, wherein the eukaryotic cell is a living animal wherein the living animal is contacted with the Gram-negative bacterial strain in vivo so that a fusion protein is translocated into the living animal. The preferred animal is a mammal, more preferably a human being.
(125) In a further embodiment the present invention provides the use of the recombinant Gram-negative bacterial strain as described supre for High Throughput Screenings of inhibitors for a cellular pathway or event triggered by the translocated heterologous protein(s).
(126) In a further embodiment the present invention provides a library of Gram-negative bacterial strains, wherein the heterologous protein encoded by the second DNA sequence of the expression vector of the Gram-negative bacterial strains is a human or murine protein, preferably a human protein and, wherein each human or murein protein expressed by a Gram-negative bacterial strain is different in amino acid sequence. A possible library could e.g. contain the 560 protein containing Addgene human kinase Orf collection (Addgene No. 1000000014). As cloning vector for expression the above described expression vectors can be used.
(127) In a further embodiment the present invention provides a kit comprising a vector as described herein and a bacterial strain expressing and secreting a protease capable of cleaving the protease cleavage site comprised by the vector. A particular useful vector is a vector for use in combination with the bacterial strain to deliver a desired protein into eukaryotic cells as described above, wherein the vector comprises in the 5 to 3 direction:
(128) a promoter;
(129) a first DNA sequence encoding a delivery signal from a bacterial T3SS effector protein, operably linked to said promoter;
(130) a second DNA sequence encoding a heterologous protein fused in frame to the 3 end of said first DNA sequence; and alternatively
(131) a third DNA sequence encoding a protease cleavage site, wherein the third DNA sequence is located between the 3 end of said first DNA sequence and the 5 end of said second DNA sequence.
EXAMPLES
Example 1
(132) A) Materials and Methods
(133) Bacterial strains and growth conditions. The strains used in this study are listed in
(134) Genetic Manipulations of Y. enterocolitica.
(135) Genetic manipulations of Y. enterocolitica has been described [47, 48]. Briefly, mutators for modification or deletion of genes in the pYV plasmids or on the chromosome were constructed by 2-fragment overlapping PCR using purified pYV40 plasmid or genomic DNA as template, leading to 200-250 bp of flanking sequences on both sides of the deleted or modified part of the respective gene. Resulting fragments were cloned in pKNG101 [43] in E. coli BW19610 [46]. Sequence verified plasmids were transformed into E. coli Sm10 pir, from where plasmids were mobilized into the corresponding Y. enterocolitica strain. Mutants carrying the integrated vector were propagated for several generations without selection pressure. Then sucrose was used to select for clones that have lost the vector. Finally mutants were identified by colony PCR.
(136) Construction of Plasmids.
(137) Plasmid pBad_Si2 or pBad_Si1 (
(138) Full length genes or fragments thereof were amplified with the specific primers listed in Table I below and cloned as fusions to YopE.sub.1-138 into plasmid pBad_Si2 or in case of z-BIM (SEQ ID No. 21) into pBad_Si1 (see Table II below). For fusion to SteA or SopE, synthetic DNA constructs were cleaved by KpnI/HindII and cloned into pSi_266, pSi_267, pSi_268 or pSi_269 respectively. In case of genes of bacterial species, purified genomic DNA was used as template (S. flexneri M90T, Salmonella enterica subsp. enterica serovar Typhimurium SL1344, Bartonella henselae ATCC 49882). For human genes a universal cDNA library (Clontech) was used if not otherwise stated (
(139) TABLE-US-00001 TABLEI (PrimerNr.Si_:Sequence) 285:CATACCATGGGAGTGAGCAAGGGCGAG 286:GGAAGATCTttACTTGTACAGCTCGTCCAT 287:CGGGGTACCTCAACTAAATGACCGTGGTG 288:GTTAAAGCTTttcgaatctagactcgagCGTGGCGAACTGGTC 292:CAGTdcgagCAAATTCTAAACAAAATACTTCCAC 293:cagtTTCGAATTAATTTGTATTGCTTTGACGG 296:CAGTctcgagACTAACATAACACTATCCACCCAG 297:GTTAAAGCTTTCAGGAGGCATTCTGAAG 299:CAGTctcgagCAGGCCATCAAGTGTGTG 300:cagtTTCGAATCATTTTCTCTTCCTCTTCTTCA 301:CAGTctcgagGCTGCCATCCGGAA 302:cagtTTCGAATCACAAGACAAGGCACCC 306:GTTAAAGCTTGGAGGCATTCTGAAGatacttatt 307:CAGTctcgagCAAATACAGAGCTTCTATCACTCAG 308:GTTAAAGCTTTCAAGATGTGATTAATGAAGAAATG 317:cagtTTCGAACCCATAAAAAAGCCCTGTC 318:GTTAAAGCTTCTACTCTATCATCAAACGATAAAATGg 324:CAGTctcgagTTCACTCAAGAAACGCAAA 339:cagtTTCGAATTTTCTCTTCCTCTTCTTCAcg 341:cgtaTCTAGAAAAATGATGAAAATGGAGACTG 342:GTTAAAGCTTttaGCTGGAGACGGTGAC 346:CAGTctcgagTTCCAGATCCCAGAGTTTG 347:GTTAAAGCTTTCACTGGGAGGGGG 351:CAGTctcgagctcgagTTATCTACTCATAGAAACTACTTTTGC AG 352:cgcGGATCCtcagtgtctctgcggcatta 353:CATTTATTCCTCCTAGTTAGTCAcagcaactgctgctcctttc 354:gaaaggagcagcagttgctgTGACTAACTAGGAGGAATAAATG 355:cgattcacggattgctttctCATTATTCCCTCCAGGTACTA 356:TAGTACCTGGAGGGAATAATGagaaagcaatccgtgaatcg 357:cgtaTCTAGAcggctttaagtgcgacattc 364:cgtaTCTAGACTAAAGTATGAGGAGAGAAAATTGAA 365:GTTAAAGCTTTCAGCTTGCCGTCGT 367:CGTAtctagaGACCCGTTCCTGGTGC 369:cgtaTCTAGAccccccaagaagaagc 373:GTTAAAGCTTGCTGGAGACGGTGACC 386:CGTAtctagaTCAGGACGCTTCGGAGGTAG 387:CGTAtctagaATGGACTGTGAGGTCAACAA 389:CGTAtctagaGGCAACCGCAGCA 391:GTTAAAGCTTTCAGTCCATCCCATTTCTg 403:CGTAtctagatctggaatatccctggaca 406:GTTAAAGCTTgtctgtctcaatgccacagt 410:CAGTctcgagATGTCCGGGGTGGTg 413:cagtTTCGAATCACTGCAGCATGATGTC 417:CAGTctcgagAGTGGTGTTGATGATGACATG 420:cagtTTCGAATTAGTGATAAAAATAGAGTTCTTTTGTGAG 423:CAGTctcgagATGCACATAACTAATTTGGGATT 424:cagtTTCGAATTATACAAATGACGAATACCCTTT 425:GTTAAAGCTTttacaccttgcgcttcttcttgggcggGCTGGA GACGGTGAC 428:CGTAtctagaATGGACTTCAACAGGAACTTT 429:CGTAtctagaGGACATAGTCCACCAGCG 430:GTTAAAGCTTTCAGTTGGATCCGAAAAAC 433:CGTAtctagaGAATTAAAAAAAACACTCATCCCA 434:CGTAtctagaCCAAAGGCAAAAGCAAAAA 435:GTTAAAGCTTTTAGCTAGCCATGGCAAGC 436:CGTAtctagaATGCCCCGCCCC 437:GTTAAAGCTTCTACCCACCGTACTCGTCAAT 438:CGTAtctagaATGTCTGACACGTCCAGAGAG 439:GTTAAAGCTTTCATCTTCTTCGCAGGAAAAAG 445:cgcGGATCCttatgggttctcacagcaaaa 446:CATTTATTCCTCCTAGTTAGTCAaggcaacagccaatcaagag 447:ctettgattggctgttgcctTGACTAACTAGGAGGAATAAATG 448:ttgattgcagtgacatggtgCATTATTCCCTCCAGGTACTA 449:TAGTACCTGGAGGGAATAATGcaccatgtcactgcaatcaa 450:cgtaTCTAGAtagccgcagatgttggtatg 451:CGTAtctagaGATCAAGTCCAACTGGTGG 463:CAGTctcgaggaaagcttgtttaaggggc 464:cagtTTCGAAttagcgacggcgacg 476:GTTAAAGCTTttACTTGTACAGCTCGTCCAT 477:CGTAtctagaGTGAGCAAGGGCGAG 478:CAGTctcgagATGGAAGATTATACCAAAATAGAGAAA 479:GTTAAAGCTTCTACATCTTCTTAATCTGATTGTCCa 482:CGTAtctagaATGGCGCTGCAGCt 483:GTTAAAGCTTTCAGTCATTGACAGGAATTTTg 486:CGTAtctagaATGGAGCCGGCGGCG 487:GTTAAAGCTTTCAATCGGGGATGTCTg 492:CGTAtctagaATGCGCGAGGAGAACAAGGG 493:GTTAAAGCTTTCAGTCCCCTGTGGCTGTGc 494:CGTAtctagaATGGCCGAGCCTTG 495:GTTAAAGCTTttaTTGAAGATTTGTGGCTCC 504:CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGT ATTTTCAAAGTATGCCCCGCCCC 505:GTTAAAGCTTCCCACCGTACTCGTCAATtc 508:CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGTATT TTCAAAGTATGGCCGAGCCTTG 509:GTTAAAGCTTTTGAAGATTTGTGGCTCCc 511:CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGTAT TTTCAAAGTGTGAGCAAGGGCGAG 512:CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGTAT TTTCAAAGTCCGCCGAAAAAAAAACGTAAAGTTGTGAGCAAGGGCGAG 513:GTTAAAGCTTttAAACTTTACGTTTTTTTTTCGGCGGCTTGT ACAGCTCGTCCAT 515:CGTAtctagaGAAAATCTGTATTTTCAAAGTGAAAATCTGTAT TTTCAAAGTGATTATAAAGATGATGATGATAAAATGGCCGAGCCTTG 558:CGTATCTAGAATGACCAGTTTTGAAGATGC 559:GTTAAAGCTTTCATGACTCATTTTCATCCAT 561:CGTATCTAGAATGAGTCTCTTAAACTGTGAGAACAG 562:GTTAAAGCTTCTACACCCCCGCATCA 580:catgccatggATTTATGGTCATAGATATGACCTC 585:CAGTctcgagATGCAGATCTTCGTCAAGAC 586:GTTAAAGCTTgctagettcgaaACCACCACGTAGACGTAAGAC 588:cagtTTCGAAGATTATAAAGATGATTTGGATGATAAAATGGCCG AGCC 612:CGGGGTACCatgaggtagcttatttcctgataaag 613:CGGGGTACCataattgtccaaatagttatggtagc 614:catgccatggCGGCAAGGCTCCTC 615:cggggtaccTTTATTTGTCAACACTGCCC 616:cggggtaccTGCGGGGTCTTTACTCG 677:TTACTATTCGAAGAAATTATTCATAATATTGCCCGCCATCTG GCCCAAATTGGTGATGAAATGGATCATTAAGCTTGGAGTA 678:TACTCCAAGCTTAATGATCCATTTCATCACCAATTTGGGCCAGA TGGCGGGCAATATTATGAATAATTTCTTCGAATAGTAA 682:TTACTACTCGAGAAAAAACTGAGCGAATGTCTGCGCCGCATTGG TGATGAACTGGATAGCTAAGCTTGGAGTA 683:TACTCCAAGCTTAGCTATCCAGTTCATCACCAATGCGGCGCAGA CATTCGCTCAGTTTTTTCTCGAGTAGTAA
(140) TABLE-US-00002 TABLE II Cloned fusion proteins Protein to be Protein Backbone Resulting Primers. Primer delivred by T3SS Seq. ID. No. plasmid plasmid name Si_Nr.: Seq. ID No. YopE1-138- 3 pBad-MycHisA pBad_Si_1 285/286 (EGFP), 44/45 MycHis (Invitrogen) 287/288 (sycE- and YopE1-138) 46/47 YopE1-138- 3 pBad-MycHisA pBad_Si_2 287/288 (sycE- 46/47 MycHis (Invitrogen) YopE1-138) YopE1-138- 4 pBad_Si_2 pSi_16 292/293 48/49 IpgB1 YopE1-138- 5 pBad_Si_2 pSi_20 296/297 50/51 SopE YopE1-138- 26 pBad_Si_2 pSi_22 299/300 52/53 Rac1 Q61L YopE1-138- 27 pBad_Si_2 pSi_24 301/302 54/55 RhoA Q61E YopE1-138- 135 pBad_Si_2 pSi_28 296/306 50/56 SopE-MycHis YopE1-138- 6 pBad_Si_2 pSi_30 307/308 57/58 SopB YopE1-138- 28 pBad_Si_2 pSi_37 367/386 76/79 FADD YopE1-138- 7 pBad_Si_2 pSi_38 317/318 59/60 OspF YopE1-138- 136 pBad_Si_2 pSi_43 324/351 61/67 BepG 715-end YopE1-138- 137 pBad_Si_2 pSi_51 299/339 52/62 Rac1 Q61L- MycHis YopE1-138- 32 pBad_Si_2 pSi_53 341/342 63/64 Slmb1-VhH4 YopE1-138-Bad 29 pBad_Si_2 pSi_57 346/347 65/66 YopE1-138-SptP 8 pBad_Si_2 pSi_64 364/365 74/75 YopE1-138-NLS- 33 pBad_Si_2 pSi_70 369/342 77/64 Slmb1-VhH4 YopE1-138-Bid 24 pBad_Si_2 pSi_85 387/391 80/82 YopE1-138-t- 25 pBad_Si_2 pSi_87 389/391 81/82 Bid YopE1-138- 22 pBad_Si_2 pSi_97 403/406 83/84 Caspase3 p17 YopE1-138- 30 pBad_Si_2 pSi_103 410/413 85/86 GPCR GNA12 YopE1-138- 23 pBad_Si_2 pSi_106 417/420 87/88 Caspase3 p10/12 YopE1-138- 9 pBad_Si_2 pSi_111 423/424 89/90 IpgD YopE1-138- 34 pBad_Si_2 pSi_112 341/425 63/91 Slmb1-VhH4- NLS YopEl-138-z- 19 pBad_Si_2 pSi_116 428/430 92/94 Bid YopE1-138-z- 20 pBad_Si_2 pSi_117 429/430 93/94 t-Bid YopE1-138- 11 pBad_Si_2 pSi_118 433/435 95/97 BepA E305-end YopE1-138- 10 pBad_Si_2 pSi_119 434/435 96/97 BepA YopE1-138- 36 pBad_Si_2 pSi_120 436/437 98/99 ET1 YopE1-138-z- 21 pbad_Si_l pSi_121 438/439 100/101 BIM YopE1-138- 31 pBad_Si_2 pSi_124 451/373 108/78 VhH4 nanobody recognizing EGFP YopE1-138- 42 pBad_Si_2 pSi_132 463/464 109/110 TEV protease S219V YopE1-138- 37 pBad_Si_2 pSi_140 477/476 112/111 EGFP YopE1-138- 14 pBad_Si_2 pSi_143 478/479 113/114 Cdk1 YopE1-138- 15 pBad_Si_2 pSi_145 482/483 115/116 Mad2 YopE1-138- 16 pBad_Si_2 pSi_147 486/487 117/118 Ink4A YopE1-138- 17 pBad_Si_2 pSi_150 492/493 119/120 Ink4B YopE1-138- 18 pBad_Si_2 pSi_151 494/495 121/122 Ink4C YopE1-138- 13 pBad_Si_2 pSi_153 558/559 131/132 TIFA YopE1-138-2x 41 pBad_Si_2 pSi_156 504/505 123/124 TEVsite - ET1 YopE1-138- 39 pBad_Si_2 pSi_159 511/513 127/129 2xTEVsite - EGFP - NLS YopE1-138- 38 pBad_Si_2 pSi_160 512/476 128/111 2xTEVsite - NLS - EGFP YopE1-138-2x 40 pBad_Si_2 pSi_161 508/509 125/126 TEVsite - INK4C YopE1-138-2x 43 pBad_Si_2 pSi_164 515/509 130/126 TEVsite - Flag - INK4C YopE1-138- 12 pBad_Si_2 pSi_166 561/562 133/134 murine Traf6 YopE1-138-Y. 138 pBad_Si_2 pSi_318 677/678 148/149 enterocolitica codon optimized murine tBid BH3 part YopE1-138-Y. 139 pBad_Si_2 pSi_322 682/683 150/151 enterocolitica codon optimized murine Bax BH3 part SteA1-20 140 pBad- pSi_266 580/612 152/153 MycHisA (Invitrogen) SteA 141 pBad- pSi_267 580/613 152/154 MycHisA (Invitrogen) SopE1-81 142 pBad- pSi_268 614/615 155/156 MycHisA (Invitrogen) SopE1-105 143 pBad- pSi_269 614/616 155/157 MycHisA (Invitrogen) SteA1-20-S. 144 pSi 266 pSi_270 synthetic / enterica codon construct optimized murine tBid SteA-S. enterica 145 pSi_267 pSi_271 synthetic / codon optimized construct murine tBid SopE1-81-S. 146 pSi_268 pSi_272 synthetic / enterica codon construct optimized murine tBid SopE1-105-S. 147 pSi_269 pSi_273 synthetic / enterica codon construct optimized murine tBid YopE1-138-Y. 158 pBad_Si_2 pSi_362 745/746 172/173 enterocolitica codon optimized Ink4A 84-103 YopE1-138-Y. 159 pBad_Si_2 pSi_363 747/748 174/175 enterocolitica codon optimized p107/RBL1 657-662 (AAA02489.1) YopE1-138-Y. 160 pBad_Si_2 pSi_364 749/750 176/177 enterocolitica codon optimized p21 141-160 (AAH13967.1) YopE1-138-Y. 161 pBad_Si_2 pSi_366 753/754 178/179 enterocolitica codon optimized p21 145-160 (AAH13967.1) YopE1-138-Y. 162 pBad_Si_2 pSi_367 755/756 180/181 enterocolitica codon optimized p21 17-33 (AAH13967.1) YopE1-138-Y. 163 pBad_Si_2 pSi_368 757/758 182/183 enterocolitica codon optimized cyclin D2 139- 147 (CAA48493.1) SteA-Ink4a- 164 pSi_267 pSi_333 703/704 184/185 MycHis SopE1-105- 165 pSi_269 pSi_334 703/704 184/185 Ink4a-MycHis SteA-Ink4c- 166 pSi_267 pSi_335 PCR1: 186/187, MycHis 705/706; 188/189 PCR2: 707/708; overlapping PCR: 705/708 SopE1-105- 167 pSi_269 pSi_336 PCR1: 186/187, Ink4c-MycHis 705/706; 188/189 PCR2: 707/708; overlapping PCR: 705/708 SteA-Mad2- 168 pSi_267 pSi_337 709/710 190/191 MycHis SopE1-105- 169 pSi_269 pSi_338 709/710 190/191 Mad2-MycHis SteA-Cdk1- 170 pSi_267 pSi_339 711/712 192/193 MycHis SopE1-105- 171 pSi_269 pSi_340 711/712 192/193 Cdk1-MycHis YopE1-138-Y. 194 pBad_Si_2 pSi_315 synthetic / enterocolitica construct codon optimized murine tBid YopE1-138- 195 pBad_Si_2 pSi_236 585/586 197/198 Ubiquitin YopE1-138- 196 pSi_236 pSi_237_II 588/509 199/126 Ubiquitin-Flag- INK4C-MycHis
(141) Yop Secretion.
(142) Induction of the yop regulon was performed by shifting the culture to 37 C. in BHI-Ox (secretion-permissive conditions) [49]. As carbon source glucose was added (4 mg/ml).
(143) Total cell and supernatant fractions were separated by centrifugation at 20 800 g for 10 min at 4 C. The cell pellet was taken as total cell fraction. Proteins in the supernatant were precipitated with trichloroacetic acid 10% (w/v) final for 1 h at 4 C. After centrifugation (20 800 g for 15 min) and removal of the supernatant, the resulting pellet was washed in ice-cold Acetone over-night. The samples were centrifuged again, the supernatant was discarded and the pellet was air-dried and resuspened in 1SDS loading dye.
(144) Secreted proteins were analysed by SDS-PAGE; in each case, proteins secreted by 310.sup.8 bacteria were loaded per lane. Detection of specific secreted proteins by immunoblotting was performed using 12.5% SDS-PAGE gels. For detection of proteins in total cells, 210.sup.8 bacteria were loaded per lane, if not stated otherwise, and proteins were separated on 12.5% SDS-PAGE gels before detection by immunoblotting.
(145) Immunoblotting was carried out using rat monoclonal antibodies against YopE (MIPA193-13A9; 1:1000, [50]). The antiserum was preabsorbed twice overnight against Y. enterocolitica HOPEMT asd to reduce background staining. Detection was performed with secondary antibodies directed against rat antibodies and conjugated to horseradish peroxidase (1:5000; Southern biotech), before development with ECL chemiluminescent substrate (LumiGlo, KPM).
(146) Cell Culture and Infections.
(147) HeLa Cc12, swiss 3T3 fibroblast cells, 4T1, B16F10 and D2A1 were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS and 2 mM L-Glutamine (cDMEM). HUVECs were isolated and cultivated as described [51]. Jurkat and 4T1 cells were cultured in RPMI 1640 supplemented with 10% FCS and 2 mM L-Glutamine. Y. enterocolitica were grown in BHI with additives overnight at RT, diluted in fresh BHI to an OD.sub.600 of 0.2 and grown for 2 h at RT before a temperature shift to a 37 C. waterbath shaker for further 30 min or for 1 h in case of delivery of EGFP. Finally, the bacteria were collected by centrifugation (6000 rcf, 30 sec) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. S. enterica were grown in LB with additives overnight at 37 C. and either diluted 1:40 in fresh LB and grown for 2.5 h at 37 C. (SpiI T3SS inducting conditions) or the overnight culture was further incubated at 37 C. (SpiII T3SS inducing conditions). Finally, the bacteria were collected by centrifugation (6000 rcf, 30 sec) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. Cells seeded in 96-well (for Immunofluorescence) or 6-well (for Western blotting) plates were infected at indicated MOIs in DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. After adding bacteria, plates were centrifuged for 1 min at 1750 rpm and placed at 37 C. for indicated time periods. Extracellular bacteria were killed by gentamicin (100 mg/ml) if indicated. In case of immunofluorescence analysis, infection assays were stopped by 4% PFA fixation. For Western blot analysis cells were washed twice with ice-cold PBS and Phospho-safe lysis buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (16 000 rcf, 25 min, 4 C.). Supernatants were collected and analyzed for total protein content by Bradford BCA assay (Pierce) before SDS PAGE and Western blotting using anti-Phospho-Akt (Ser473 and T308, both Cell Signaling), anti-Actin (Millipore), Anti-Bid (Cell Signaling), anti-Myc (Santa Cruz), anti-p38 (Cell Signaling), anti-phospho-p-38 (Thr180/Tyr182; Cell Signaling), anti-Caspase-3 p17 (Cell Signaling) and anti-Ink4C (Cell Signaling) antibody.
(148) Secretion Analysis with S. enterica.
(149) For induction of protein secretion by S. enterica, S. enterica were cultivated overnight in LB containing 0.3 M NaCl on an orbital shaker (set to 150 rpm). S. enterica were then diluted 1:50 in fresh LB containing 0.3 M NaCl and grown for 4 h at 37 C. without shaking.
(150) Total cell and supernatant fractions were separated by centrifugation at 20 800 g for 20 min at 4 C. The cell pellet was taken as total cell fraction. Proteins in the supernatant were precipitated with trichloroacetic acid 10% (w/v) final for 1 h at 4 C. After centrifugation (20 800 g for 15 min) and removal of the supernatant, the resulting pellet was washed in ice-cold Acetone over-night. The samples were centrifuged again, the supernatant was discarded and the pellet was air-dried and resuspended in 1SDS loading dye.
(151) Secreted proteins were analysed by SDS-PAGE; in each case, proteins secreted by 3108 bacteria were loaded per lane. Detection of specific secreted proteins by immunoblotting was performed using 12.5% SDS-PAGE gels. For detection of proteins in total cells, 210.sup.8 bacteria were loaded per lane, if not stated otherwise, and proteins were separated on 12.5% SDS-PAGE gels before detection by immunoblotting. Immunoblotting was carried out using anti-Myc (Santa Cruz) antibody.
(152) Western Blotting of T3SS Translocated Proteins from Infected Cells.
(153) HeLa cells in 6-well plates were infected at an MOI of 100 as described above. In case of coinfection with the TEV protease translocating Y. enterocolitica strain, the OD.sub.600 of the strains was set and the two bacterial suspensions were mixed in a tube at a ratio of 1:1 (if not otherwise indicated) before addition to the cells. At the end of the infection, the cells were washed twice with ice-cold PBS and collected by scraping in a small volume of ice-cold PBS. After centrifugation (16 000 rcf, 5 min, 4 C.) the pellet was dissolved in 0.002% digitonin supplemented with a protease inhibitor cocktail (Roche complete, Roche). The dissolved pellets were incubated for 5 minutes on ice and then centrifuged (16 000 rcf, 25 min, 4 C.). Supernatants were collected and analyzed for total protein content by Bradford BCA assay (Pierce) before SDS PAGE and Western blotting using an anti-Myc (Santa Cruz, 9E11) or anti-Ink4C (Cell Signaling) antibody.
(154) Immunofluorescence.
(155) Cell seeded in 96-well plates (Corning) were infected as described above and after fixation with 4% PFA the cells were washed three times with PBS. The wells were then blocked using 5% goat serum in PBS 0.3% Triton X-100 for 1 h at RT. The primary antibody (anti-Myc, Santa Cruz, 1:100) was diluted in PBS with 1% BSA and 0.3% Triton X-100 and cells were incubated overnight at 4 C. Cells were washed 4 times with PBS before the secondary antibody (AF 488 anti-mouse, life technologies, 1:250) diluted in PBS with 1% BSA and 0.3% Triton X-100 was added. If needed Hoechst DNA staining (life technologies, 1:2500) and/or actin staining (Dy647-Phalloidin, DyeOmics) were included. In some cases only the DNA and/or actin stain was applied directly after washing the PFA off. Cells were incubated for 1 h at RT, washed three times with PBS and analyzed by automated image analysis as described below.
(156) Automated Microscopy and Image Analysis.
(157) Images were automatically acquired with an ImageXpress Micro (Molecular devices, Sunnyvale, USA). Quantification of anti-Myc staining intensities was performed using MetaXpress (Molecular devices, Sunnyvale, USA). Regions within cells excluding nuclear regions and regions containing bacteria were manually chosen (circles with an area of 40 pixels) and average intensity was recorded.
(158) TNF Stimulation and Western Blotting of Phospho-p38.
(159) HeLa cells seeded in 6-well plates were infected with an MOI of 100 as described above. 30 min p.i Gentamicin was added and 45 min p.i. TNF was added (10 ng/ml). 1 h 15 min p.i. cells were washed twice with ice-cold PBS and Phospho-safe lysis buffer (Novagen) was added to lyse the cells. After incubation on ice, the cells were centrifuged (16 000 rcf, 25 min, 4 C.). Supernatants were collected and analyzed for total protein content by Bradford BCA assay (Pierce) before SDS PAGE and Western blotting using an anti-Phospho-p38, total p38 antibodies (Cell Signaling) and anti-Actin antibody (Millipore).
(160) cAMP Level Determination of Infected HeLa Cells.
(161) HeLa cells seeded in 96-well plates were infected as described above. 30 min before the infection cDMEM was changed to DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine and 100 uM 3-Isobutyl-1-methylxanthin (IBMX, Sigma Aldrich). 60 min p.i. Gentamicin was added and cells were further incubated at 37 C. for another 90 min. Determination of cAMP was performed using a competitive ELISA according to the manufacturers instructions (Amersham, cAMP Biotrak, RPN225). As a positive control indicated amount of cholera toxin (C8052, Sigma Aldrich) was added for 1 h to cells in DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine and 100 uM IBMX.
(162) Zebrafish Embryo Infections, Imaging and Automated Image Quantification.
(163) All animal experiments were performed according to approved guidelines. Zebrafish were maintained at standard conditions [52]. Embryos were staged by hours postfertilization (hpf) at 28.5 C. [53]. The following zebrafish lines were used in this study: wild type fish (AB/EK and EK/TL). Infection protocol followed guidelines given in [54]. 12 hpf embryos were maintained in E3 medium containing 0.2 mM N-phenylthiourea (PTU) to prevent pigment formation. 2 days postfertilization (dpf) embryos were anesthetized by 0.2 mg/ml Tricaine and aligned on 1% agar plates in E3 using a hair loop tool [54]. Y. enterocolitica were grown in BHI supplemented with 0.4% Arabinose and antibiotics and mDap overnight at RT, diluted in fresh BHI with 0.5% Arabinose and other additives to an OD.sub.600 of 0.2 and grown for 2 h at RT before a temperature shift to a 37 C. waterbath shaker for further 45 min. Finally, the bacteria were collected by centrifugation (6000 rcf, 30 sec) and washed once with PBS. The OD.sub.600 was set to 2 in PBS containing mDAP. 1-2 nL of this suspension were injected into the hindbrain of aligned zebrafish embryos using an Femtojet Microinjector (Eppendorf) using Femtotips II (Eppendorf), where the tip of the needle had been broken off with fine tweezers. The injection time was set to 0.2 s and the compensation pressure to 15 hPa (Eppendorf, Femtojet) and the injection pressure was adjusted between 600 and 800 hPa. Drop size and thus the inoculum was checked by microscopy and by control plating. Following microinjection the fish were collected in E3 containing Tricaine and PTU and incubated for 30 min at 37 C. and incubated for further 5 h at 28 C. A fluorescence binocular (Leica) was used to observe bacterial EGFP fluorescence 1 h post infection in zebrafish hindbrains, and embryos that are not properly injected were discarded. At the end of the infection, fish were fixed with 2% ice-cold PFA for 1 h on ice and further with fresh ice-cold PFA overnight at 4 C. Antibody staining was performed as described previously [55, 56]. Briefly, embryos were washed 4 times with PBS 0.1% Tween for 5 min each wash and permeabilized with PBS-T+0.5% Triton X-100 for 30 min at RT. Embryos were blocked in blocking solution (PBS 0.1% Tween 0.1% TritonX-100 5% goat serum and 1% BSA) at 4 C. overnight. Antibody (Cleaved Caspase-3 (Asp175), Cell Signaling) was diluted 1:100 in blocking solution and incubated under shaking at 4 C. in the dark. Fish were washed 7 times with PBS 0.1% Tween for 30 min before the secondary antibody (goat anti-rabbit AF647, Invitrogen, 1:500) diluted in blocking solution was added and incubated at 4 C. overnight. Larvae were washed with PBS 0.1% Tween four times 30 min at 4 C. and once overnight and further washed 3-4 times. Images were taken with Leica TCS SP5 confocal microscope using a 40 water immersion objective. Images were analyzed using Imaris (Bitplane) and Image J software (http://imagej.nih.gov/ij/).
(164) Image analysis (on n=14 for pBad_Si2 or n=19 for z-BIM) was performed via CellProfiler [57] on maximum intensity z projections of recorded z-stack images. Briefly, bacteria were detected via the GFP channel. Around each area of a bacterial spot a circle with a radius of 10 pixels was created. Overlapping regions were separated equally among the connecting members. In those areas closely surrounding bacteria, the Caspase 3 p17 staining intensity was measured.
(165) Sample Preparation for Phosphoproteomics.
(166) For each condition, two 6-well plates of HeLa CCL-2 cells were grown to confluency. Cells were infected for 30 min as described above. At the indicated time-points, the plates were put on ice and washed twice with ice-cold PBS. Samples were then collected in urea solution [8 M Urea (AppliChem), 0.1 M Ammoniumbicarbonate (Sigma), 0.1% RapiGest (Waters), 1 PhosSTOP (Roche)]. The samples were briefly vortexed, sonicated at 4 C. (Hielscher), shaked for 5 min on a thermomixer (Eppendorf) and centrifuged for 20 min at 4 C. and 16'000 g. Supernatants were collected and stored at 80 C. for further processing. BCA Protein Assay (Pierce) was used to measure protein concentration.
(167) Phosphopeptide Enrichment.
(168) Disulfide bonds were reduced with tris(2-carboxyethyl)phosphine at a final concentration of 10 mM at 37 C. for 1 h. Free thiols were alkylated with 20 mM iodoacetamide (Sigma) at room temperature for 30 min in the dark. The excess of iodoacetamide was quenched with N-acetyl cysteine at a final concentration of 25 mM for 10 min at room temperature. Lys-C endopeptidase (Wako) was added to a final enzyme/protein ratio of 1:200 (w/w) and incubated for 4 h at 37 C. The solution was subsequently diluted with 0.1 M ammoniumbicarbonate (Sigma) to a final concentration below 2 M urea and digested overnight at 37 C. with sequencing-grade modified trypsin (Promega) at a protein-to-enzyme ratio of 50:1. Peptides were desalted on a C18 Sep-Pak cartridge (Waters) and dried under vacuum. Phosphopeptides were isolated from 2 mg of total peptide mass with TiO.sub.2 as described previously [58]. Briefly, dried peptides were dissolved in an 80% acetonitrile (ACN)-2.5% trifluoroacetic acid (TFA) solution saturated with phthalic acid. Peptides were added to the same amount of equilibrated TiO.sub.2 (5-m bead size, GL Sciences) in a blocked Mobicol spin column (MoBiTec) that was incubated for 30 min with end-over-end rotation. The column was washed twice with the saturated phthalic acid solution, twice with 80% ACN and 0.1% TFA, and finally twice with 0.1% TFA. The peptides were eluted with a 0.3 M NH.sub.4OH solution. The pH of the eluates was adjusted to be below 2.5 with 5% TFA solution and 2 M HCl. Phosphopeptides were again desalted with microspin C18 cartridges (Harvard Apparatus).
(169) LC-MS/MS Analysis.
(170) Chromatographic separation of peptides was carried out using an EASY nano-LC system (Thermo Fisher Scientific), equipped with a heated RP-HPLC column (75 m45 cm) packed in-house with 1.9 m C18 resin (Reprosil-AQ Pur, Dr. Maisch). Aliquots of 1 g total phosphopeptide sample were analyzed per LC-MS/MS run using a linear gradient ranging from 98% solvent A (0.15% formic acid) and 2% solvent B (98% acetonitrile, 2% water, 0.15% formic acid) to 30% solvent B over 120 minutes at a flow rate of 200 nl/min. Mass spectrometry analysis was performed on a dual pressure LTQ-Orbitrap mass spectrometer equipped with a nanoelectrospray ion source (both Thermo Fisher Scientific). Each MS1 scan (acquired in the Orbitrap) was followed by collision-induced dissociation (CID, acquired in the LTQ) of the 20 most abundant precursor ions with dynamic exclusion for 30 seconds. For phosphopeptide analysis the 10 most abundant precursor ions were subjected to CID with enabled multistage activation. Total cycle time was approximately 2 s. For MS1, 10.sup.6 ions were accumulated in the Orbitrap cell over a maximum time of 300 ms and scanned at a resolution of 60,000 FWHM (at 400 m/z). MS2 scans were acquired using the normal scan mode, a target setting of 10.sup.4 ions, and accumulation time of 25 ms. Singly charged ions and ions with unassigned charge state were excluded from triggering MS2 events. The normalized collision energy was set to 32%, and one microscan was acquired for each spectrum.
(171) Label-Free Quantification and Database Searching.
(172) The acquired raw-files were imported into the Progenesis software tool (Nonlinear Dynamics, Version 4.0) for label-free quantification using the default parameters. MS2 spectra were exported directly from Progenesis in mgf format and searched using the MASCOT algorithm (Matrix Science, Version 2.4) against a decoy database [59] containing normal and reverse sequences of the predicted SwissProt entries of Homo sapiens (www.ebi.ac.uk, release date 16 May 2012) and commonly observed contaminants (in total 41,250 sequences) generated using the SequenceReverser tool from the MaxQuant software (Version 1.0.13.13). To identify proteins originating from Y. enterocolitica, non phosphopeptide enriched samples were searched against the same database above including predicted SwissProt entries of Y. enterocolitica (www.ebi.ac.uk, release date 15 Aug. 2013) The precursor ion tolerance was set to 10 ppm and fragment ion tolerance was set to 0.6 Da. The search criteria were set as follows: full tryptic specificity was required (cleavage after lysine or arginine residues unless followed by proline), 2 missed cleavages were allowed, carbamidomethylation (C) was set as fixed modification and phosphorylation (S,T,Y) or oxidation (M) as a variable modification for TiO2 enriched or not enriched samples, respectively. Finally, the database search results were exported as an xml-file and imported back to the Progenesis software for MS1 feature assignment. For phosphopeptide quantification, a csv-file containing the MS1 peak abundances of all detected features was exported and for not enriched samples, a csv-file containing all protein measurements based on the summed feature intensities of all identified peptides per protein was created. Importantly, the Progenesis software was set that proteins identified by similar sets of peptides are grouped together and that only non-conflicting peptides with specific sequences for single proteins in the database were employed for protein quantification. Both files were further processed using the in-house developed SafeQuant v1.0 R script (unpublished data, available at https://github.com/eahrne/SafeQuant/). In brief, the software sets the identification level False Discovery Rate to 1% (based on the number of decoy protein sequence database hits) and normalizes the identified MS1 peak abundances (Extracted Ion Chromatogram, XIC) across all samples, i.e. the summed XIC of all confidently identified peptide features is scaled to be equal for all LC-MS runs. Next, all quantified phosphopeptides/proteins are assigned an abundance ratio for each time point, based on the median XIC per time point. The statistical significance of each ratio is given by its q-value (False Discovery Rate adjusted p-values), obtained by calculating modified t-statistic p-values [60] and adjusting for multiple testing [61]. The location of the phosphorylated residues was automatically assigned by MASCOT (score >10). All annotated spectra together with the MS raw files and search parameters employed, will be deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository [62]. Sequence alignment was performed using EMBL-EBI web based ClustalW2 multiple sequence alignment tool at http://www.ebi.ac.uk/Tools/msa/clustalw2/.
(173) B) Results
(174) A Protein Delivery System Based on Type 3 Secretion of YopE Fusion Proteins
(175) While the very N-terminus of the Y. enterocolitica T3SS effector YopE (SEQ ID No. 1) contains the secretion signal sufficient to translocate heterologous proteins [10], the chaperone-binding site (CBS) for its chaperone (SycE) is not included [63]. We selected the N-terminal 138 amino acids of YopE (SEQ ID No. 2) to be fused to proteins to be delivered, as this had been shown to give best results for translocation of other heterologous T3 S substrates [38]. As these N-terminal 138 amino acids of YopE contain the CBS, we further decided to coexpress SycE. The SycE-YopE.sub.1-138 fragment cloned from purified Y. enterocolitica pYV40 virulence plasmid contains the endogenous promoters of YopE and of its chaperone SycE (
(176) The background strain was carefully selected. First, to limit the translocation of endogenous effectors, we used a Y. enterocolitica strain that was deleted for all known effectors, Yop H, O, P, E, M and T (named HOPEMT) [64]. In addition, we used an auxotroph mutant that cannot grow in absence of exogenous meso-2,6-diaminopimelic acid [65]. This strain was deleted for the aspartate-beta-semialdehyde dehydrogenase gene (asd), and classified as biosafety level 1 by the Swiss safety agency (amendment to A010088/2). In addition, we deleted the adhesion proteins YadA and/or InvA to offer a larger choice of background strains. While the use of the yadA or yadA/invA strains reduce the background signalling induced [66], the delivered protein amount is affected as well [67].
(177) Characterization of YopE Fusion Protein Delivery into Eukaryotic Cells
(178) In an in-vitro secretion assay (see
(179) Redirection of T3SS Delivered Proteins to the Nucleus
(180) As YopE itself localized to the cytoplasm (
(181) Removal of the YopE.sub.1-138 Appendage after Translocation of the Fusion Protein to the Eukaryotic Cell
(182) While for bacterial delivery the YopE.sub.1-138 fragment is of great benefit, it might hamper the fusion proteins function and/or localization. Therefore, its removal after protein delivery would be optimal. To this end, we introduced two TEV cleavage sites (ENLYFQS) [71-73] in between YopE.sub.1-138 and a fusion partner (the transcriptional regulator ET1-Myc (SEQ ID No. 36 and 41) [74] and human INK4C (SEQ ID No. 40 and SEQ ID No. 43)). To keep the advantages of the presented method, we further fused the TEV protease (S219V variant; [75]) to YopE.sub.1-138 (SEQ ID No. 42) in another Y. enterocolitica strain. HeLa cells were infected with both strains at once. To allow analysis of the translocated fraction of proteins only, infected HeLa cells were lysed at 2 h p.i. (
(183) An alternative approach to the TEV protease dependent cleavage of the YopE fragment consisted in incorporating Ubiquitin into the fusion protein of interest. Indeed, Ubiquitin is processed at its C-terminus by a group of endogenous Ubiquitin-specific C-terminal proteases (Deubiquitinating enzymes, DUBs). As the cleavage is supposed to happen at the very C-terminus of Ubiquitin (after G76), the protein of interest should be free of additional amino acid sequence. This method was tested on the YopE1-138-Ubiquitin-Flag-INK4C-MycHis fusion protein. In control cells infected by YopE1-138-Flag-INK4C-MycHis-expressing bacteria, a band corresponding to YopE1-138-Flag-INK4C-MycHis was found, indicative of efficient translocation of the fusion protein (
(184) Translocation of Type III and Type IV Bacterial Effectors
(185) SopE from Salmonella enterica is a well-characterized guanine nucleotide exchange factor (GEF) that interacts with Cdc42, promoting actin cytoskeletal remodeling [79]. Whereas the translocation of YopE.sub.1-138-Myc into HeLa cells has no effect, translocated YopE.sub.1-138-SopE (SEQ ID No. 5 and 135) induced dramatic changes in the actin network (
(186) During Salmonella infection, SopE translocation is followed by translocation of SptP, which functions as a GTPase activating protein (GAP) for Cdc42 [81]. Whereas the translocation of YopE.sub.1-138-SopE-Myc (SEQ ID No. 135) alone triggered massive F-actin rearrangements, the co-infection with YopE.sub.1-138-SptP (SEQ ID No. 8) expressing bacteria abolished this effect in a dose dependent manner (
(187) The S. flexneri type III effector OspF functions as a phosphothreonine lyase that dephosphorylates MAP kinases p38 and ERK [82]. To test the functionality of translocated YopE.sub.1-138-OspF (SEQ ID No. 7), we monitored the phosphorylation of p38 after stimulation with TNF. In uninfected cells or in cells infected with YopE.sub.1-138-Myc expressing bacteria, TNF induced p38 phosphorylation. In contrast, after translocation of YopE.sub.1-138-OspF, TNF-induced phosphorylation was abolished, showing that the delivered OspF is active towards p38 (
(188) During Salmonella infection, the type III effector SopB protects epithelial cells from apoptosis by sustained activation of Akt [83]. Whereas the translocation of YopE.sub.1-138-Myc or YopE.sub.1-138-SopE had no effect on Akt, the translocation of YopE.sub.1-138-SopB (SEQ ID No. 6) induced a strong phosphorylation of Akt at T308 and S473, reflecting the active form (
(189) A number of bacteria, including Agrobacterium tumefaciens, Legionella pneumophila and Bartonella henselae, use type IV secretion to inject effectors into cells. We tested whether the type IV effector BepA from B. henselae could be translocated into HeLa cells using our tool. Full length BepA (SEQ ID No. 10) and BepA.sub.E305-end (SEQ ID No. 11) containing the C-terminal Bid domain, were cloned and cells were infected with the respective strains. As BepA was shown to induce the production of cyclic AMP (cAMP) [84], the level of cAMP in HeLa cells was measured after infection. Whereas the translocation of the Bid domain of the B. henselae effector BepG (SEQ ID No. 136) failed to induce cAMP, full length BepA and BepA.sub.E305-end triggered cAMP production in expected amounts [84] (
(190) Translocation of Eukaryotic Proteins into Epithelial Cells
(191) To show that human proteins can translocate via type III secretion we fused human apoptosis inducers for delivery by Y. enterocolitica to YopE.sub.1-138 or for delivery by S. enterica to SteA.sub.1-20, SteA, SopE.sub.1-81 or SopE.sub.1-105. We then monitored the translocation of the human BH3 interacting-domain death agonist (BID, SEQ ID No. 24), which is a pro-apoptotic member of the Bcl-2 protein family. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8). CASP8 cleaves BID, and the truncated BID (tBID, SEQ ID No. 25) translocates to mitochondria where it triggers cytochrome c release. The latter leads to the intrinsic mode of caspase 3 (CASP3) activation during which it is cleaved into 17 and 12 kDa subunits [85]. Whereas infection for 1 h with YopE.sub.1-138-Myc or YopE.sub.1-138-BID expressing Y. enterocolitica failed to induce apoptosis, the translocation of human tBID triggered cell death in larger extend than the well-characterized apoptosis inducer staurosporin (
(192) We further fused murine tBID (codon optimized for Y. enterocolitica; SEQ ID No. 194) or the BH3 domains of murine tBID or murine BAX (in both cases codon optimized for Y. enterocolitica; SEQ ID No. 138 and 139) to YopE.sub.1-138 for delivery by Y. enterocolitica. Whereas infection for 2.5 h with Y. enterocolitica HOPEMT asd delivering no protein or YopE.sub.1-138-Myc failed to induce apoptosis, the translocation of murine tBID (codon optimized to Y. enterocolitica, SEQ ID No. 194) triggered cell death in B16F10 (
(193) Whereas infection for 4 h with S. enterica aroA bacteria failed to induce apoptosis, the translocation of murine tBID triggered apoptosis, as the translocation of murine tBID lead to the production of CASP3 p17 subunit (
(194) Besides the here functionally elaborated translocated eukaryotic proteins, several other eukaryotic proteins have been secreted using the here-described tool. This includes for delivery by Y. enterocolitica (
(195) In Vivo Translocation of Truncated Bid in Zebrafish Embryos Induces Apoptosis
(196) An interesting feature of this bacterial tool is the potential use in living animals. Zebrafish in their embryonic state can be kept transparent allowing fluorescent staining and microscopy [54, 88, 89]. Few zebrafish apoptosis inducers have been described in detail, whereof z-BIM is the most potent [90]. Therefore, we decided to clone z-BIM into our system. Even if weakly homolgous to human BIM, we assayed the potency of apoptosis induction of YopE.sub.1-138-z-BIM (SEQ ID No. 21) in human epithelial cells. HeLa cells infected for 1 h with the strain translocating YopE.sub.1-138-z-BIM showed clear signs of cell death. We then performed in-vivo experiments with 2 days post fertilization (dpf) zebrafish embryos, using a localized infection model via microinjection of bacteria into the hindbrain [54]. After infection for 5.5 h the fish were fixed, permeabilized and stained for presence of CASP3 p17. Upon infection with the YopE.sub.1-138-Myc expressing strain, bacteria were visible in the hindbrain region (staining b,
(197) Phosphoproteomics Reveal the Global Impact of Translocated Proteins on Protein Phosphorylation
(198) Phosphorylation is a wide-spread post-translational modification which can either activate or inactivate biological processes and is therefore a suitable target to study signaling events [91, 92]. Despite this, no systems-level analysis of phosphorylation in apoptosis is available today. To analyze the impact of human tBid delivered into HeLa cells, we used a label-free phosphoproteomic approach by LC-MS/MS. In three independent experiments, cells were either left untreated, infected with HOPEMT asd+YopE.sub.1-138-Myc or with HOPEMT asd+YopE.sub.1-138-tBid for 30 minutes. Cells were lysed, followed by enzymatic digestion, phosphopetide enrichment and quantification and identification of individual phosphpeptides. We compared cells infected with HOPEMT asd+YopE.sub.1-138-Myc to cells infected with HOPEMT asd+YopE.sub.1-138-tBid, allowing us to identify 363 tBid dependent phosphorylation events. 286 phosphopeptides showed an increase in phosphorylation whereas 77 were less phosphorylated upon tBid delivery, corresponding to 243 different proteins, which we defined as the tBid phosphoproteome. The STRING database was used to create a protein-protein interaction network of the tBid phosphoproteome [93] (
LIST OF REFERENCES
(199) 1. Gibson, T. J., M. Seiler, and R. A. Veitia (2013) The transience of transient overexpression. Nat Methods. 10: 715-21. 2. Inoue, T., W. D. Heo, J. S. Grimley, T. J. Wandless, and T. Meyer (2005) An inducible translocation strategy to rapidly activate and inhibit small GTPase signaling pathways. Nat Methods. 2: 415-8. 3. Pust, S., H. Hochmann, E. Kaiser, G. von Figura, K. Heine, et al. (2007) A cell-permeable fusion toxin as a tool to study the consequences of actin-ADP-ribosylation caused by the Salmonella enterica virulence factor SpvB in intact cells. J Biol Chem. 282: 10272-82. 4. Hayes, C. S., S. K. Aoki, and D. A. Low (2010) Bacterial contact-dependent delivery systems. Annu Rev Genet. 44: 71-90. 5. Cornelis, G. R. (2006) The type III secretion injectisome. Nat Rev Microbiol. 4: 811-25. 6. Michiels, T., P. Wattiau, R. Brasseur, J. M. Ruysschaert, and G. Cornelis (1990) Secretion of Yop proteins by Yersiniae. Infect Immun. 58: 2840-9. 7. Letzelter, M., I. Sorg, L. J. Mota, S. Meyer, J. Stalder, et al. (2006) The discovery of SycO highlights a new function for type III secretion effector chaperones. EMBO J. 25: 3223-33. 8. Gauthier, A., and B. B. Finlay (2003) Translocated intimin receptor and its chaperone interact with ATPase of the type III secretion apparatus of enteropathogenic Escherichia coli. J Bacteriol. 185: 6747-55. 9. Wattiau, P., and G. R. Cornelis (1993) SycE, a chaperone-like protein of Yersinia enterocolitica involved in the secretion of YopE. Mol Microbiol. 8: 123-31. 10. Feldman, M. F., S. Muller, E. Wuest, and G. R. Cornelis (2002) SycE allows secretion of YopE-DHFR hybrids by the Yersinia enterocolitica type III Ysc system. Mol Microbiol. 46: 1183-97. 11. Akeda, Y., and J. E. Galan (2005) Chaperone release and unfolding of substrates in type III secretion. Nature. 437: 911-5. 12. Pais, S. V., C. Milho, F. Almeida, and L. J. Mota (2013) Identification of novel type III secretion chaperone-substrate complexes of Chlamydia trachomatis. PLoS One. 8: e56292. 13. Sory, M. P., and G. R. Cornelis (1994) Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol. 14: 583-94. 14. Garcia, J. T., F. Ferracci, M. W. Jackson, S. S. Joseph, I. Pattis, et al. (2006) Measurement of effector protein injection by type III and type IV secretion systems by using a 13-residue phosphorylatable glycogen synthase kinase tag. Infect Immun. 74: 5645-57. 15. Chen, L. M., G. Briones, R. O. Donis, and J. E. Galan (2006) Optimization of the delivery of heterologous proteins by the Salmonella enterica serovar Typhimurium type III secretion system for vaccine development. Infect Immun. 74: 5826-33. 16. Russmann, H., H. Shams, F. Poblete, Y. Fu, J. E. Galan, et al. (1998) Delivery of epitopes by the Salmonella type III secretion system for vaccine development. Science. 281: 565-8. 17. Russmann, H., U. Gerdemann, E.I. Igwe, K. Panthel, J. Heesemann, et al. (2003) Attenuated Yersinia pseudotuberculosis carrier vaccine for simultaneous antigen-specific CD4 and CD8 T-cell induction. Infect Immun. 71: 3463-72. 18. Chaux, P., R. Luiten, N. Demotte, V. Vantomme, V. Stroobant, et al. (1999) Identification of five MAGE-A1 epitopes recognized by cytolytic T lymphocytes obtained by in vitro stimulation with dendritic cells transduced with MAGE-A1. J Immunol. 163: 2928-36. 19. Blanco-Toribio, A., S. Muyldermans, G. Frankel, and L. A. Fernandez (2010) Direct injection of functional single-domain antibodies from E. coli into human cells. PLoS One. 5: e15227. 20. Bichsel, C., D. Neeld, T. Hamazaki, L. J. Chang, L. J. Yang, et al. (2013) Direct reprogramming of fibroblasts to myocytes via bacterial injection of MyoD protein. Cell Reprogram. 15: 117-25. 21. Bichsel, C., D. K. Neeld, T. Hamazaki, D. Wu, L. J. Chang, et al. (2011) Bacterial delivery of nuclear proteins into pluripotent and differentiated cells. PLoS One. 6: e16465. 22. Chamekh, M., A. Phalipon, R. Quertainmont, I. Salmon, P. Sansonetti, et al. (2008) Delivery of biologically active anti-inflammatory cytokines IL-10 and IL-1ra in vivo by the Shigella type III secretion apparatus. J Immunol. 180: 4292-8. 23. Hoffman, R. M. (2011) Tumor-seeking Salmonella amino acid auxotrophs. Curr Opin Biotechnol. 22: 917-23. 24. Hoang, T. T., S. Williams, H. P. Schweizer, and J. S. Lam (1997) Molecular genetic analysis of the region containing the essential Pseudomonas aeruginosa asd gene encoding aspartate-beta-semialdehyde dehydrogenase. Microbiology. 143 (Pt 3): 899-907. 25. Skurnik, M., and H. Wolf-Watz (1989) Analysis of the yopA gene encoding the Yop1 virulence determinants of Yersinia spp. Mol Microbiol. 3: 517-29. 26. Tertti, R., M. Skurnik, T. Vartio, and P. Kuusela (1992) Adhesion protein YadA of Yersinia species mediates binding of bacteria to fibronectin. Infect Immun. 60: 3021-4. 27. Isberg, R. R., and J. M. Leong (1990) Multiple beta 1 chain integrins are receptors for invasin, a protein that promotes bacterial penetration into mammalian cells. Cell. 60: 861-71. 28. Isberg, R. R., D. L. Voorhis, and S. Falkow (1987) Identification of invasin: a protein that allows enteric bacteria to penetrate cultured mammalian cells. Cell. 50: 769-78. 29. Leong, J. M., R. S. Fournier, and R. R. Isberg (1990) Identification of the integrin binding domain of the Yersinia pseudotuberculosis invasin protein. EMBO J. 9: 1979-89. 30. Mota, L. J., and G. R. Cornelis (2005) The bacterial injection kit: type III secretion systems. Ann Med. 37: 234-49. 31. Trosky, J. E., A. D. Liverman, and K. Orth (2008) Yersinia outer proteins: Yops. Cell Microbiol. 10: 557-65. 32. Brenner, D., and T. W. Mak (2009) Mitochondrial cell death effectors. Curr Opin Cell Biol. 21: 871-7. 33. Chalah, A., and R. Khosravi-Far (2008) The mitochondrial death pathway. Adv Exp Med Biol. 615: 25-45. 34. Fuchs, Y., and H. Steller (2011) Programmed cell death in animal development and disease. Cell. 147: 742-58. 35. Waugh, D. S. (2011) An overview of enzymatic reagents for the removal of affinity tags. Protein Expr Purif 80: 283-93. 36. Sarker, M. R., C. Neyt, I. Stainier, and G. R. Cornelis (1998) The Yersinia Yop virulon: LcrV is required for extrusion of the translocators YopB and YopD. J Bacteriol. 180: 1207-14. 37. Ramamurthi, K. S., and O. Schneewind (2005) A synonymous mutation in Yersinia enterocolitica yopE affects the function of the YopE type III secretion signal. J Bacteriol. 187: 707-15. 38. Wolke, S., N. Ackermann, and J. Heesemann (2011) The Yersinia enterocolitica type 3 secretion system (T3SS) as toolbox for studying the cell biological effects of bacterial Rho GTPase modulating T3SS effector proteins. Cell Microbiol. 13: 1339-57. 39. Forsberg, A., and H. Wolf-Watz (1990) Genetic analysis of the yopE region of Yersinia spp.: identification of a novel conserved locus, yerA, regulating yopE expression. J Bacteriol. 172: 1547-55. 40. Sambrook, J. 2001. Molecular cloning: a laboratory manual. D. W. Russell, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 41. Alto, N. M., and J. E. Dixon (2008) Analysis of Rho-GTPase mimicry by a family of bacterial type III effector proteins. Methods Enzymol. 439: 131-43. 42. Alto, N. M., F. Shao, C. S. Lazar, R. L. Brost, G. Chua, et al. (2006) Identification of a bacterial type III effector family with G protein mimicry functions. Cell. 124: 133-45. 43. Kaniga, K., I. Delor, and G. R. Cornelis (1991) A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene. 109: 137-41. 44. Yoneda, Y., T. Semba, Y. Kaneda, R. L. Noble, Y. Matsuoka, et al. (1992) A long synthetic peptide containing a nuclear localization signal and its flanking sequences of SV40 T-antigen directs the transport of IgM into the nucleus efficiently. Exp Cell Res. 201: 313-20. 45. Cornelis, G. R. 1997. Cross talk between Yersinia and eukaryotic cells. In Molecular aspects of host-pathoge interactions. S. MoCRAE, SMYTH, STOW, editor. Cambridge University Press. 46. Metcalf, W. W., W. Jiang, and B. L. Wanner (1994) Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers. Gene. 138: 1-7. 47. Diepold, A., M. Amstutz, S. Abel, I. Sorg, U. Jenal, et al. (2010) Deciphering the assembly of the Yersinia type III secretion injectisome. EMBO J. 29: 1928-40. 48. Iriarte, M., I. Stainier, and G. R. Cornelis (1995) The rpoS gene from Yersinia enterocolitica and its influence on expression of virulence factors. Infect Immun. 63: 1840-7. 49. Cornelis, G., J. C. Vanootegem, and C. Sluiters (1987) Transcription of the yop regulon from Y. enterocolitica requires trans acting pYV and chromosomal genes. Microb Pathog. 2: 367-79. 50. Grosdent, N., I. Maridonneau-Parini, M. P. Sory, and G. R. Cornelis (2002) Role of Yops and adhesins in resistance of Yersinia enterocolitica to phagocytosis. Infect Immun. 70: 4165-76. 51. Dehio, C., M. Meyer, J. Berger, H. Schwarz, and C. Lanz (1997) Interaction of Bartonella henselae with endothelial cells results in bacterial aggregation on the cell surface and the subsequent engulfment and internalisation of the bacterial aggregate by a unique structure, the invasome. J Cell Sci. 110 (Pt 18): 2141-54. 52. Westerfield, M. (2000) The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish Danio rerio University of Oregon Press, Eugene, ORp. 53. Kimmel, C. B., W. W. Ballard, S. R. Kimmel, B. Ullmann, and T. F. Schilling (1995) Stages of embryonic development of the zebrafish. Dev Dyn. 203: 253-310. 54. Benard, E. L., A. M. van der Sar, F. Ellett, G. J. Lieschke, H. P. Spaink, et al. (2012) Infection of zebrafish embryos with intracellular bacterial pathogens. J Vis Exp. 55. Blum, Y., H. G. Belting, E. Ellertsdottir, L. Herwig, F. Luders, et al. (2008) Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Dev Biol. 316: 312-22. 56. Herwig, L., Y. Blum, A. Krudewig, E. Ellertsdottir, A. Lenard, et al. (2011) Distinct cellular mechanisms of blood vessel fusion in the zebrafish embryo. Curr Biol. 21: 1942-8. 57. Carpenter, A. E., T. R. Jones, M. R. Lamprecht, C. Clarke, I. H. Kang, et al. (2006) CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol. 7: R100. 58. Bensimon, A., A. Schmidt, Y. Ziv, R. Elkon, S. Y. Wang, et al. (2010) ATM-dependent and -independent dynamics of the nuclear phosphoproteome after DNA damage. Sci Signal. 3: rs3. 59. Perkins, D. N., D. J. Pappin, D. M. Creasy, and J. S. Cottrell (1999) Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20: 3551-67. 60. Smyth, G. K. (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 3: Article3. 61. Ting, L., M. J. Cowley, S. L. Hoon, M. Guilhaus, M. J. Raftery, et al. (2009) Normalization and statistical analysis of quantitative proteomics data generated by metabolic labeling. Mol Cell Proteomics. 8: 2227-42. 62. Vizcaino, J. A., R. G. Cote, A. Csordas, J. A. Dianes, A. Fabregat, et al. (2013) The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res. 41: D1063-9. 63. Boyd, A. P., I. Lambermont, and G. R. Cornelis (2000) Competition between the Yops of Yersinia enterocolitica for delivery into eukaryotic cells: role of the SycE chaperone binding domain of YopE. J Bacteriol. 182: 4811-21. 64. Iriarte, M., and G. R. Cornelis (1998) YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells. Mol Microbiol. 29: 915-29. 65. Kudryashev, M., M. Stenta, S. Schmelz, M. Amstutz, U. Wiesand, et al. (2013) In situ structural analysis of the Yersinia enterocolitica injectisome. Elife. 2: e00792. 66. Schulte, R., G. A. Grassl, S. Preger, S. Fessele, C. A. Jacobi, et al. (2000) Yersinia enterocolitica invasin protein triggers IL-8 production in epithelial cells via activation of Rel p 65-p 65 homodimers. FASEB J. 14: 1471-84. 67. Mota, L. J., L. Journet, I. Sorg, C. Agrain, and G. R. Cornelis (2005) Bacterial injectisomes: needle length does matter. Science. 307: 1278. 68. Isaksson, E. L., M. Aili, A. Fahlgren, S. E. Carlsson, R. Rosqvist, et al. (2009) The membrane localization domain is required for intracellular localization and autoregulation of YopE in Yersinia pseudotuberculosis. Infect Immun. 77: 4740-9. 69. Denecker, G., S. Totemeyer, L. J. Mota, P. Troisfontaines, I. Lambermont, et al. (2002) Effect of low- and high-virulence Yersinia enterocolitica strains on the inflammatory response of human umbilical vein endothelial cells. Infect Immun. 70: 3510-20. 70. Sharma, S., A. Hirabuchi, K. Yoshida, K. Fujisaki, A. Ito, et al. (2013) Deployment of the Burkholderia glumae type III secretion system as an efficient tool for translocating pathogen effectors to monocot cells. Plant J. 74: 701-12. 71. Carrington, J. C., and W. G. Dougherty (1988) A viral cleavage site cassette: identification of amino acid sequences required for tobacco etch virus polyprotein processing. Proc Natl Acad Sci USA. 85: 3391-5. 72. Kapust, R. B., J. Tozser, T. D. Copeland, and D. S. Waugh (2002) The P1 specificity of tobacco etch virus protease. Biochem Biophys Res Commun. 294: 949-55. 73. Liang, H., H. Gao, C. A. Maynard, and W. A. Powell (2005) Expression of a self-processing, pathogen resistance-enhancing gene construct in Arabidopsis. Biotechnol Lett. 27: 435-42. 74. Weber, W., C. Fux, M. Daoud-el Baba, B. Keller, C. C. Weber, et al. (2002) Macrolide-based transgene control in mammalian cells and mice. Nat Biotechnol. 20: 901-7. 75. Kapust, R. B., J. Tozser, J. D. Fox, D. E. Anderson, S. Cherry, et al. (2001) Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency. Protein Eng. 14: 993-1000. 76. Lee, V. T., D. M. Anderson, and O. Schneewind (1998) Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone. Mol Microbiol. 28: 593-601. 77. Gray, D. C., S. Mahrus, and J. A. Wells (2010) Activation of specific apoptotic caspases with an engineered small-molecule-activated protease. Cell. 142: 637-46. 78. Henrichs, T., N. Mikhaleva, C. Conz, E. Deuerling, D. Boyd, et al. (2005) Target-directed proteolysis at the ribosome. Proc Natl Acad Sci USA. 102: 4246-51. 79. Hardt, W. D., L. M. Chen, K. E. Schuebel, X. R. Bustelo, and J. E. Galan (1998) S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell. 93: 815-26. 80. Hakansson, S., K. Schesser, C. Persson, E. E. Galyov, R. Rosqvist, et al. (1996) The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. EMBO J. 15: 5812-23. 81. Stebbins, C. E., and J. E. Galan (2001) Structural mimicry in bacterial virulence. Nature. 412: 701-5. 82. Li, H., H. Xu, Y. Zhou, J. Zhang, C. Long, et al. (2007) The phosphothreonine lyase activity of a bacterial type III effector family. Science. 315: 1000-3. 83. Norris, F. A., M. P. Wilson, T. S. Wallis, E. E. Galyov, and P. W. Majerus (1998) SopB, a protein required for virulence of Salmonella dublin, is an inositol phosphate phosphatase. Proc Natl Acad Sci USA. 95: 14057-9. 84. Pulliainen, A. T., K. Pieles, C. S. Brand, B. Hauert, A. Bohm, et al. (2012) Bacterial effector binds host cell adenylyl cyclase to potentiate Galphas-dependent cAMP production. Proc Natl Acad Sci USA. 109: 9581-6. 85. Li, H., H. Zhu, C. J. Xu, and J. Yuan (1998) Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell. 94: 491-501. 86. Nagaraj, N., J. R. Wisniewski, T. Geiger, J. Cox, M. Kircher, et al. (2011) Deep proteome and transcriptome mapping of a human cancer cell line. Mol Syst Biol. 7: 548. 87. Caussinus, E., O. Kanca, and M. Affolter (2011) Fluorescent fusion protein knockout mediated by anti-GFP nanobody. Nat Struct Mol Biol. 19: 117-21. 88. Cosma, C. L., L. E. Swaim, H. Volkman, L. Ramakrishnan, and J. M. Davis (2006) Zebrafish and frog models of Mycobacterium marinum infection. Curr Protoc Microbiol. Chapter 10: Unit 10B 2. 89. Mathias, J. R., M. E. Dodd, K. B. Walters, S. K. Yoo, E. A. Ranheim, et al. (2009) Characterization of zebrafish larval inflammatory macrophages. Dev Comp Immunol. 33: 1212-7. 90. Jette, C. A., A. M. Flanagan, J. Ryan, U. J. Pyati, S. Carbonneau, et al. (2008) BIM and other BCL-2 family proteins exhibit cross-species conservation of function between zebrafish and mammals. Cell Death Differ. 15: 1063-72. 91. Olsen, J. V., B. Blagoev, F. Gnad, B. Macek, C. Kumar, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127: 635-48. 92. Schmutz, C., E. Ahrne, C. A. Kasper, T. Tschon, I. Sorg, et al. (2013) Systems-Level Overview of Host Protein Phosphorylation During Shigella flexneri Infection Revealed by Phosphoproteomics. Mol Cell Proteomics. 12: 2952-68. 93. Szklarczyk, D., A. Franceschini, M. Kuhn, M. Simonovic, A. Roth, et al. (2011) The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res. 39: D561-8. 94. Huang da, W., B. T. Sherman, and R. A. Lempicki (2009) Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37: 1-13. 95. Huang da, W., B. T. Sherman, R. Stephens, M. W. Baseler, H. C. Lane, et al. (2008) DAVID gene ID conversion tool. Bioinformation. 2: 428-30. 96. Schwerk, C., and K. Schulze-Osthoff (2005) Regulation of apoptosis by alternative pre-mRNA splicing. Mol Cell. 19: 1-13. 97. Papagiannakopoulos, T., A. Shapiro, and K. S. Kosik (2008) MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 68: 8164-72. 98. Hoiseth, S. K., B. A. Stocker (1981) Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238-239.