RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
10889815 ยท 2021-01-12
Assignee
Inventors
- Leonid Beigelman (San Mateo, CA)
- James McSwiggen (Arlington, MA, US)
- Chandra Vargeese (Schwenksville, PA)
Cpc classification
C12N2310/344
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/317
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/8218
CHEMISTRY; METALLURGY
C12N2320/51
CHEMISTRY; METALLURGY
C12N2310/346
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism.
Claims
1. A compound comprising: (I) a short interfering nucleic acid (siNA) molecule capable of inhibiting expression of a human huntingtin gene, wherein the human huntingtin gene comprises a nucleotide sequence of GenBank Accession Number NM_002111, said siNA molecule consisting of a single-stranded polynucleotide comprising a nucleotide sequence complementary to a huntingtin RNA, wherein said single-stranded polynucleotide: i) is about 19 to 20 nucleotides in length; ii) comprises 10 or more phosphorothioate internucleotide linkages; iii) comprises 10 or more modified pyrimidines chosen from 2 deoxy pyrimidine, 2-O-methyl pyrimidine, 2-deoxy-2-fluoro pyrimidine, locked nucleic acid (LNA) pyrimidine, 2-methoxyethoxy (MOE) pyrimidine, or a combination thereof; and (II) a galactosamine.
2. The compound of claim 1, wherein the single-stranded polynucleotide comprises 10 or more 2-deoxy pyrimidines.
3. The compound of claim 1, wherein the single-stranded polynucleotide comprises one or more 2-methoxyethoxy (MOE) pyrimidines.
4. The compound of claim 1, wherein the galactosamine comprises N-acetylgalactosamine which is a mono-antennary galactosamine, bi-antennary galactosamine, or a tri-antennary galactosamine.
5. The compound of claim 1, wherein the galactosamine is attached at the 5-end or the 3-end of the single-stranded polynucleotide.
6. The compound of claim 1, wherein the single stranded polynucleotide is 20 nucleotides long.
7. The compound of claim 1, wherein the 10 or more modified pyrimidines comprise 4 or more 2 deoxy pyrimidines.
8. A short interfering nucleic acid (siNA) molecule capable of inhibiting expression of a human huntingtin gene, wherein the human huntingtin gene comprises a nucleotide sequence of GenBank Accession Number NM_002111, said siNA molecule consisting of a single-stranded polynucleotide comprising a nucleotide sequence complementary to a human huntingtin RNA, wherein said single-stranded polynucleotide: i) is about 19 to 20 nucleotides in length; ii) comprises 10 or more phosphorothioate internucleotide linkages; and iii) comprises 10 or more modified pyrimidines chosen from 2 deoxy pyrimidine, 2-O-methyl pyrimidine, 2-deoxy-2-fluoro pyrimidine, 2-methoxyethoxy (MOE) pyrimidine, or a combination thereof.
9. The siNA molecule of claim 8, wherein the single-stranded polynucleotide further comprises a ligand chosen from a galactosamine or a cholesterol.
10. The siNA molecule of claim 8, wherein the single-stranded polynucleotide further comprises a ligand chosen from a mono-antennary galactosamine, bi-antennary galactosamine, or a tri-antennary galactosamine.
11. The siNA molecule of claim 8, wherein the single-stranded polynucleotide comprises one or more 2-methoxyethoxy (MOE) pyrimidines.
12. The siNA molecule of claim 8, wherein the single-stranded polynucleotide comprises 1, 2, 3, 4, 5 or more locked nucleic acid (LNA) pyrimidines, wherein said LNA pyrimidines is/are located at the 5-end, the 3-end, both of the 5 and 3-ends, of the single-stranded polynucleotide.
13. The siNA molecule of claim 8, wherein the 10 or more modified pyrimidines comprise 4 or more 2 deoxy pyrimidines.
14. The siNA molecule of claim 8, wherein the single-stranded polynucleotide comprises 10 or more 2-deoxy nucleotides.
15. The siNA molecule of claim 8, wherein the single-stranded polynucleotide comprises one or more 5-methylcytosines.
16. The siNA molecule of claim 8, wherein the single-stranded polynucleotide comprises 5 or more 5-methylcytosines.
17. A short interfering nucleic acid (siNA) molecule capable of inhibiting expression of a human huntingtin gene, wherein the human huntingtin gene comprises a nucleotide sequence of GenBank Accession Number NM_002111, said siNA molecule consisting of a single-stranded polynucleotide comprising a nucleotide sequence complementary to a human huntingtin RNA, wherein said single-stranded polynucleotide: i) is 20 nucleotides in length; ii) comprises 10 or more phosphorothioate internucleotide linkages; and iii) comprises 10 or more modified pyrimidines chosen from 2 deoxy pyrimidine, 2-O-methyl pyrimidine, 2-deoxy-2-fluoro pyrimidine, 2-methoxyethoxy (MOE) pyrimidine, or a combination thereof; and iv) comprises one or more 5-methylcytosines.
18. The siNA molecule of claim 17, which comprises 5 or more 5-methylcytosine nucleotides.
19. The siNA molecule of claim 17, wherein the single-stranded polynucleotide comprises one or more 2-methoxyethoxy (MOE) pyrimidines.
20. The siNA molecule of claim 17, wherein the 10 or more modified pyrimidines comprise 4 or more 2 deoxy pyrimidines.
21. The siNA molecule of claim 17, wherein the single-stranded polynucleotide comprises 10 or more modified pyrimidines chosen from 2 deoxy pyrimidine or 2-methoxyethoxy (MOE) pyrimidine, or a combination thereof.
22. The compound of claim 1, wherein at least 60% of nucleotide positions in the single-stranded polynucleotide are modified nucleotides.
23. The compound of claim 1, wherein at least 80% of nucleotide positions in the single-stranded polynucleotide are modified nucleotides.
24. The siNA molecule of claim 8, wherein at least 60% of nucleotide positions in the single-stranded polynucleotide are modified nucleotides.
25. The siNA molecule of claim 8, wherein at least 80% of nucleotide positions in the single-stranded polynucleotide are modified nucleotides.
26. The siNA molecule of claim 17, wherein at least 60% of nucleotide positions in the single-stranded polynucleotide are modified nucleotides.
27. The siNA molecule of claim 17, wherein at least 80% of nucleotide positions in the single-stranded polynucleotide are modified nucleotides.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88)
(89)
(90)
(91)
(92)
(93)
DETAILED DESCRIPTION OF THE INVENTION
(94) Mechanism of Action of Nucleic Acid Molecules of the Invention
(95) The discussion that follows discusses the proposed mechanism of RNA interference mediated by short interfering RNA as is presently known, and is not meant to be limiting and is not an admission of prior art. Applicant demonstrates herein that chemically-modified short interfering nucleic acids possess similar or improved capacity to mediate RNAi as do siRNA molecules and are expected to possess improved stability and activity in vivo; therefore, this discussion is not meant to be limited to siRNA only and can be applied to siNA as a whole. By improved capacity to mediate RNAi or improved RNAi activity is meant to include RNAi activity measured in vitro and/or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention. In this invention, the product of these activities can be increased in vitro and/or in vivo compared to an all RNA siRNA or a siNA containing a plurality of ribonucleotides. In some cases, the activity or stability of the siNA molecule can be decreased (i.e., less than ten-fold), but the overall activity of the siNA molecule is enhanced in vitro and/or in vivo.
(96) RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33; Fire et al., 1998, Nature, 391, 806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes which is commonly shared by diverse flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2, 5-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
(97) The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as Dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., 2001, Nature, 409, 363). Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001, Science, 293, 834). The RNAi response also features an endonuclease complex containing a siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the guide sequence of the siRNA duplex (Elbashir et al., 2001, Genes Dev., 15, 188). In addition, RNA interference can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see for example Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237). As such, siNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional level or post-transcriptional level.
(98) RNAi has been studied in a variety of systems. Fire et al., 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates has revealed certain requirements for siRNA length, structure, chemical composition, and sequence that are essential to mediate efficient RNAi activity. These studies have shown that 21 nucleotide siRNA duplexes are most active when containing two 2-nucleotide 3-terminal nucleotide overhangs. Furthermore, substitution of one or both siRNA strands with 2-deoxy or 2-O-methyl nucleotides abolishes RNAi activity, whereas substitution of 3-terminal siRNA nucleotides with deoxy nucleotides was shown to be tolerated. Mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5-end of the siRNA guide sequence rather than the 3-end (Elbashir et al., 2001, EMBO J., 20, 6877). Other studies have indicated that a 5-phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell, 107, 309); however, siRNA molecules lacking a 5-phosphate are active when introduced exogenously, suggesting that 5-phosphorylation of siRNA constructs may occur in vivo.
(99) Synthesis of Nucleic Acid Molecules
(100) Synthesis of nucleic acids greater than 100 nucleotides in length is difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. In this invention, small nucleic acid motifs (small refers to nucleic acid motifs no more than 100 nucleotides in length, preferably no more than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length; e.g., individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) are preferably used for exogenous delivery. The simple structure of these molecules increases the ability of the nucleic acid to invade targeted regions of protein and/or RNA structure. Exemplary molecules of the instant invention are chemically synthesized, and others can similarly be synthesized.
(101) Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) are synthesized using protocols known in the art, for example as described in Caruthers et al., 1992, Methods in Enzymology 211, 3-19, Thompson et al., International PCT Publication No. WO 99/54459, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al., 1997, Methods Mol. Bio., 74, 59, Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No. 6,001,311. All of these references are incorporated herein by reference. The synthesis of oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5-end, and phosphoramidites at the 3-end. In a non-limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 mol scale protocol with a 2.5 min coupling step for 2-O-methylated nucleotides and a 45 second coupling step for 2-deoxy nucleotides or 2-deoxy-2-fluoro nucleotides. Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle. Alternatively, syntheses at the 0.2 mol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle. A 33-fold excess (60 L of 0.11 M=6.6 mol) of 2-O-methyl phosphoramidite and a 105-fold excess of S-ethyl tetrazole (60 L of 0.25 M=15 mol) can be used in each coupling cycle of 2-O-methyl residues relative to polymer-bound 5-hydroxyl. A 22-fold excess (40 L of 0.11 M=4.4 mol) of deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40 L of 0.25 M=10 mol) can be used in each coupling cycle of deoxy residues relative to polymer-bound 5-hydroxyl. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and oxidation solution is 16.9 mM 12, 49 mM pyridine, 9% water in THF (PERSEPTIVE). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide, 0.05 M in acetonitrile) is used.
(102) Deprotection of the DNA-based oligonucleotides is performed as follows: the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aqueous methylamine (1 mL) at 65 C. for 10 minutes. After cooling to 20 C., the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is then added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder.
(103) The method of synthesis used for RNA including certain siNA molecules of the invention follows the procedure as described in Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al., 1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol. Bio., 74, 59, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5-end, and phosphoramidites at the 3-end. In a non-limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 mol scale protocol with a 7.5 min coupling step for alkylsilyl protected nucleotides and a 2.5 min coupling step for 2-O-methylated nucleotides. Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle. Alternatively, syntheses at the 0.2 mol scale can be done on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle. A 33-fold excess (60 L of 0.11 M=6.6 mol) of 2-O-methyl phosphoramidite and a 75-fold excess of S-ethyl tetrazole (60 L of 0.25 M=15 mol) can be used in each coupling cycle of 2-O-methyl residues relative to polymer-bound 5-hydroxyl. A 66-fold excess (120 L of 0.11 M=13.2 mol) of alkylsilyl (ribo) protected phosphoramidite and a 150-fold excess of S-ethyl tetrazole (120 L of 0.25 M=30 mol) can be used in each coupling cycle of ribo residues relative to polymer-bound 5-hydroxyl. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); oxidation solution is 16.9 mM 12, 49 mM pyridine, 9% water in THF (PERSEPTIVE). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide0.05 M in acetonitrile) is used.
(104) Deprotection of the RNA is performed using either a two-pot or one-pot protocol. For the two-pot protocol, the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65 C. for 10 minutes. After cooling to 20 C., the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is then added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder. The base deprotected oligoribonucleotide is resuspended in anhydrous TEA/HF/NMP solution (300 L of a solution of 1.5 mL N-methylpyrrolidinone, 750 L TEA and 1 mL TEA.3HF to provide a 1.4 M HF concentration) and heated to 65 C. After 1.5 h, the oligomer is quenched with 1.5 M NH.sub.4HCO.sub.3.
(105) Alternatively, for the one-pot protocol, the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 33% ethanolic methylamine/DMSO: 1/1 (0.8 mL) at 65 C. for 15 minutes. The vial is brought to room temperature TEA.3HF (0.1 mL) is added and the vial is heated at 65 C. for 15 minutes. The sample is cooled at 20 C. and then quenched with 1.5 M NH.sub.4HCO.sub.3.
(106) For purification of the trityl-on oligomers, the quenched NH.sub.4HCO.sub.3 solution is loaded onto a C-18 containing cartridge that had been prewashed with acetonitrile followed by 50 mM TEAA. After washing the loaded cartridge with water, the RNA is detritylated with 0.5% TFA for 13 minutes. The cartridge is then washed again with water, salt exchanged with 1 M NaCl and washed with water again. The oligonucleotide is then eluted with 30% acetonitrile.
(107) The average stepwise coupling yields are typically >98% (Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of ordinary skill in the art will recognize that the scale of synthesis can be adapted to be larger or smaller than the example described above including but not limited to 96-well format.
(108) Alternatively, the nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., 1992, Science 256, 9923; Draper et al., International PCT publication No. WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
(109) The siNA molecules of the invention can also be synthesized via a tandem synthesis methodology as described in Example 1 herein, wherein both siNA strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate siNA fragments or strands that hybridize and permit purification of the siNA duplex. The linker can be a polynucleotide linker or a non-nucleotide linker. The tandem synthesis of siNA as described herein can be readily adapted to both multiwell/multiplate synthesis platforms such as 96 well or similarly larger multi-well platforms. The tandem synthesis of siNA as described herein can also be readily adapted to large scale synthesis platforms employing batch reactors, synthesis columns and the like.
(110) A siNA molecule can also be assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the RNA molecule.
(111) The nucleic acid molecules of the present invention can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2-amino, 2-C-allyl, 2-fluoro, 2-O-methyl, 2-H (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163). siNA constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al., supra, the totality of which is hereby incorporated herein by reference) and re-suspended in water.
(112) In another aspect of the invention, siNA molecules of the invention are expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of siNA molecules.
(113) Optimizing Activity of the Nucleic Acid Molecule of the Invention.
(114) Chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al., 1991, Science 253, 314; Usman and Cedergren, 1992, Trends in Biochem. Sci. 17, 334; Usman et al., International Publication No. WO 93/15187; and Rossi et al., International Publication No. WO 91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al., U.S. Pat. No. 6,300,074; and Burgin et al., supra; all of which are incorporated by reference herein). All of the above references describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules described herein. Modifications that enhance their efficacy in cells, and removal of bases from nucleic acid molecules to shorten oligonucleotide synthesis times and reduce chemical requirements are desired.
(115) There are several examples in the art describing sugar, base and phosphate modifications that can be introduced into nucleic acid molecules with significant enhancement in their nuclease stability and efficacy. For example, oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2-amino, 2-C-allyl, 2-fluoro, 2-O-methyl, 2-O-allyl, 2-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992, TIBS. 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163; Burgin et al., 1996, Biochemistry, 35, 14090). Sugar modification of nucleic acid molecules have been extensively described in the art (see Eckstein et al., International Publication PCT No. WO 92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem. Sci., 1992, 17, 334-339; Usman et al. International Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711 and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., International PCT publication No. WO 97/26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No. 5,627,053; Woolf et al., International PCT Publication No. WO 98/13526; Thompson et al., U.S. Ser. No. 60/082,404 which was filed on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39, 1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010; all of the references are hereby incorporated in their totality by reference herein). Such publications describe general methods and strategies to determine the location of incorporation of sugar, base and/or phosphate modifications and the like into nucleic acid molecules without modulating catalysis, and are incorporated by reference herein. In view of such teachings, similar modifications can be used as described herein to modify the siNA nucleic acid molecules of the instant invention so long as the ability of siNA to promote RNAi is cells is not significantly inhibited.
(116) While chemical modification of oligonucleotide internucleotide linkages with phosphorothioate, phosphorodithioate, and/or 5-methylphosphonate linkages improves stability, excessive modifications can cause some toxicity or decreased activity. Therefore, when designing nucleic acid molecules, the amount of these internucleotide linkages should be minimized. The reduction in the concentration of these linkages should lower toxicity, resulting in increased efficacy and higher specificity of these molecules.
(117) Short interfering nucleic acid (siNA) molecules having chemical modifications that maintain or enhance activity are provided. Such a nucleic acid is also generally more resistant to nucleases than an unmodified nucleic acid. Accordingly, the in vitro and/or in vivo activity should not be significantly lowered. In cases in which modulation is the goal, therapeutic nucleic acid molecules delivered exogenously should optimally be stable within cells until translation of the target RNA has been modulated long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the disease state. Improvements in the chemical synthesis of RNA and DNA (Wincott et al., 1995, Nucleic Acids Res. 23, 2677; Caruthers et al., 1992, Methods in Enzymology 211, 3-19 (incorporated by reference herein)) have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability, as described above.
(118) In one embodiment, nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in nucleic acid molecules of the invention results in both enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands. In another embodiment, nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA locked nucleic acid nucleotides such as a 2, 4-C methylene bicyclo nucleotide (see for example Wengel et al., International PCT Publication No. WO 00/66604 and WO 99/14226).
(119) In another embodiment, the invention features conjugates and/or complexes of siNA molecules of the invention. Such conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell. The conjugates and complexes provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention. The present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, cholesterol, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example, proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes. In general, the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers. These compounds are expected to improve delivery and/or localization of nucleic acid molecules of the invention into a number of cell types originating from different tissues, in the presence or absence of serum (see Sullenger and Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
(120) In one embodiment, the invention features a compound having Formula 1:
(121) ##STR00008##
(122) wherein each R.sub.1, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7 and R.sub.8 is independently hydrogen, alkyl substituted alkyl, aryl, substituted aryl, or a protecting group, each n is independently an integer from 0 to about 200, R.sub.12 is a straight or branched chain alkyl, substituted alkyl, aryl, or substituted aryl, and R.sub.2 is a siNA molecule or a portion thereof.
(123) In one embodiment, the invention features a compound having Formula 2:
(124) ##STR00009##
(125) wherein each R.sub.3, R.sub.4, R.sub.5, R.sub.6 and R.sub.7 is independently hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a protecting group, each n is independently an integer from 0 to about 200, R.sub.12 is a straight or branched chain alkyl, substituted alkyl, aryl, or substituted aryl, and R.sub.2 is a siNA molecule or a portion thereof.
(126) In one embodiment, the invention features a compound having Formula 3:
(127) ##STR00010##
(128) wherein each R.sub.1, R.sub.3, R.sub.4, R.sub.5 R.sub.6 and R.sub.7 is independently hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a protecting group, each n is independently an integer from 0 to about 200, R.sub.12 is a straight or branched chain alkyl, substituted alkyl, aryl, or substituted aryl, and R.sub.2 is a siNA molecule or a portion thereof.
(129) In one embodiment, the invention features a compound having Formula 4:
(130) ##STR00011##
(131) wherein each R.sub.3, R.sub.4, R.sub.5, R.sub.6 and R.sub.7 is independently hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a protecting group, each n is independently an integer from 0 to about 200, R.sub.2 is a siNA molecule or a portion thereof, and R.sub.13 is an amino acid side chain.
(132) In one embodiment, the invention features a compound having Formula 5:
(133) ##STR00012##
(134) wherein each R.sub.1 and R.sub.4 is independently a protecting group or hydrogen, each R.sub.3, R.sub.5, R.sub.6, R.sub.7 and R.sub.8 is independently hydrogen, alkyl or nitrogen protecting group, each n is independently an integer from 0 to about 200, R.sub.12 is a straight or branched chain alkyl, substituted alkyl, aryl, or substituted aryl, and each R.sub.9 and R.sub.10 is independently a nitrogen containing group, cyanoalkoxy, alkoxy, aryloxy, or alkyl group.
(135) In one embodiment, the invention features a compound having Formula 6:
(136) ##STR00013##
(137) wherein each R.sub.4, R.sub.5, R.sub.6 and R.sub.7 is independently hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a protecting group, R.sub.2 is a siNA molecule or a portion thereof, each n is independently an integer from 0 to about 200, and L is a degradable linker.
(138) In one embodiment, the invention features a compound having Formula 7:
(139) ##STR00014##
(140) wherein each R.sub.1, R.sub.3, R.sub.4, R.sub.5, R.sub.6 and R.sub.7 is independently hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, or a protecting group, each n is independently an integer from 0 to about 200, R.sub.12 is a straight or branched chain alkyl, substituted alkyl, aryl, or substituted aryl, and R.sub.2 is a siNA molecule or a portion thereof.
(141) In one embodiment, the invention features a compound having Formula 8:
(142) ##STR00015##
(143) wherein each R.sub.1 and R.sub.4 is independently a protecting group or hydrogen, each R.sub.3, R.sub.5, R.sub.6 and R.sub.7 is independently hydrogen, alkyl or nitrogen protecting group, each n is independently an integer from 0 to about 200, R.sub.12 is a straight or branched chain alkyl, substituted alkyl, aryl, or substituted aryl, and each R.sub.9 and R.sub.10 is independently a nitrogen containing group, cyanoalkoxy, alkoxy, aryloxy, or alkyl group.
(144) In one embodiment, R.sub.13 of a compound of the invention comprises an alkylamino or an alkoxy group, for example, CH.sub.2O or CH(CH.sub.2)CH.sub.2O.
(145) In another embodiment, R.sub.12 of a compound of the invention is an alkylhyrdroxyl, for example, (CH2).sub.nOH, where n comprises an integer from about 1 to about 10.
(146) In another embodiment, L of Formula 6 of the invention comprises serine, threonine, or a photolabile linkage.
(147) In one embodiment, R.sub.9 of a compound of the invention comprises a phosphorus protecting group, for example OCH.sub.2CH.sub.2CN (oxyethylcyano).
(148) In one embodiment, R.sub.10 of a compound of the invention comprises a nitrogen containing group, for example, N(R.sub.14) wherein R.sub.14 is a straight or branched chain alkyl having from about 1 to about 10 carbons.
(149) In another embodiment, R.sub.10 of a compound of the invention comprises a heterocycloalkyl or heterocycloalkenyl ring containing from about 4 to about 7 atoms, and having from about 1 to about 3 heteroatoms comprising oxygen, nitrogen, or sulfur.
(150) In another embodiment, R.sub.1 of a compound of the invention comprises an acid labile protecting group, such as a trityl or substituted trityl group, for example, a dimethoxytrityl or mono-methoxytrityl group.
(151) In another embodiment, R.sub.4 of a compound of the invention comprises a tert-butyl, Fm (fluorenyl-methoxy), or allyl group.
(152) In one embodiment, R.sub.6 of a compound of the invention comprises a TFA (trifluoracetyl) group.
(153) In another embodiment, R.sub.3, R.sub.5 R.sub.7 and R.sub.8 of a compound of the invention are independently hydrogen.
(154) In one embodiment, R.sub.7 of a compound of the invention is independently isobutyryl, dimethylformamide, or hydrogen.
(155) In another embodiment, R.sub.12 of a compound of the invention comprises a methyl group or ethyl group.
(156) In one embodiment, the invention features a compound having Formula 27:
(157) ##STR00016##
(158) wherein n is an integer from about 0 to about 20, R.sub.4 is H or a cationic salt, X is a siNA molecule or a portion thereof, and R.sub.24 is a sulfur containing leaving group, for example a group comprising:
(159) ##STR00017##
(160) In one embodiment, the invention features a compound having Formula 39:
(161) ##STR00018##
(162) wherein n is an integer from about 0 to about 20, X is a siNA molecule or a portion thereof, and P is a phosphorus containing group.
(163) In another embodiment, a thiol containing linker of the invention is a compound having Formula 41:
(164) ##STR00019##
(165) wherein n is an integer from about 0 to about 20, P is a phosphorus containing group, for example a phosphine, phosphite, or phosphate, and R24 is any alkyl, substituted alkyl, alkoxy, aryl, substituted aryl, alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl group with or without additional protecting groups.
(166) In one embodiment, the invention features a compound having Formula 43:
(167) ##STR00020##
(168) wherein X comprises a siNA molecule or portion thereof; W comprises a degradable nucleic acid linker; Y comprises a linker molecule or amino acid that can be present or absent; Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, or label; n is an integer from about 1 to about 100; and N is an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(169) In another embodiment, the invention features a compound having Formula 44:
(170) ##STR00021##
(171) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; n is an integer from about 1 to about 50, and PEG represents a compound having Formula 45:
(172) ##STR00022##
(173) wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, or label; and n is an integer from about 1 to about 100. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(174) In another embodiment, the invention features a compound having Formula 46:
(175) ##STR00023##
(176) wherein X comprises a siNA molecule or portion thereof; each W independently comprises linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule or chemical linkage that can be present or absent; and PEG represents a compound having Formula 45:
(177) ##STR00024##
(178) wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, or label; and n is an integer from about 1 to about 100. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(179) In one embodiment, the invention features a compound having Formula 47:
(180) ##STR00025##
(181) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be the same or different and can be present or absent, Y comprises a linker molecule that can be present or absent; each Q independently comprises a hydrophobic group or phospholipid; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and n is an integer from about 1 to about 10. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(182) In another embodiment, the invention features a compound having Formula 48:
(183) ##STR00026##
(184) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and B represents a lipophilic group, for example a saturated or unsaturated linear, branched, or cyclic alkyl group, cholesterol, or a derivative thereof. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(185) In another embodiment, the invention features a compound having Formula 49:
(186) ##STR00027##
(187) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and B represents a lipophilic group, for example a saturated or unsaturated linear, branched, or cyclic alkyl group, cholesterol, or a derivative thereof. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(188) In another embodiment, the invention features a compound having Formula 50:
(189) ##STR00028##
(190) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule or chemical linkage that can be present or absent; and each Q independently comprises a hydrophobic group or phospholipid. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(191) In one embodiment, the invention features a compound having Formula 51:
(192) ##STR00029##
(193) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; Y comprises a linker molecule or amino acid that can be present or absent; Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, or label; SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, and n is an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(194) In another embodiment, the invention features a compound having Formula 52:
(195) ##STR00030##
(196) wherein X comprises a siNA molecule or portion thereof; Y comprises a linker molecule or chemical linkage that can be present or absent; each R1, R2, R3, R4, and R5 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N; Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, or label; SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, n is an integer from about 1 to about 20; and N is an integer from about 1 to about 20. In another embodiment, X comprises a siNA molecule or a portion thereof. In another embodiment, Y is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(197) In another embodiment, the invention features a compound having Formula 53:
(198) ##STR00031##
(199) wherein B comprises H, a nucleoside base, or a non-nucleosidic base with or without protecting groups; each R1 independently comprises O, N, S, alkyl, or substituted N; each R2 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, or a phosphorus containing group; each R3 independently comprises N or ON, each R4 independently comprises O, CH2, S, sulfone, or sulfoxy; X comprises H, a removable protecting group, a siNA molecule or a portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, each n is independently an integer from about 1 to about 50; and N is an integer from about 1 to about 10. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(200) In another embodiment, the invention features a compound having Formula 54:
(201) ##STR00032##
(202) wherein B comprises H, a nucleoside base, or a non-nucleosidic base with or without protecting groups; each R1 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, or a phosphorus containing group; X comprises H, a removable protecting group, a siNA molecule or a portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; and SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(203) In one embodiment, the invention features a compound having Formula 55:
(204) ##STR00033##
(205) wherein each R1 independently comprises O, N, S, alkyl, or substituted N; each R2 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, or a phosphorus containing group; each R3 independently comprises H, OH, alkyl, substituted alkyl, or halo; X comprises H, a removable protecting group, a siNA molecule or a portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, each n is independently an integer from about 1 to about 50; and N is an integer from about 1 to about 100. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(206) In another embodiment, the invention features a compound having Formula 56:
(207) ##STR00034##
(208) wherein R1 comprises H, alkyl, alkylhalo, N, substituted N, or a phosphorus containing group; R2 comprises H, O, OH, alkyl, alkylhalo, halo, S, N, substituted N, or a phosphorus containing group; X comprises H, a removable protecting group, a siNA molecule or a portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, and each n is independently an integer from about 0 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(209) In another embodiment, the invention features a compound having Formula 57:
(210) ##STR00035## wherein R1 can include the groups:
(211) ##STR00036## and wherein R2 can include the groups:
(212) ##STR00037##
(213) and wherein Tr is a removable protecting group, for example a trityl, monomethoxytrityl, or dimethoxytrityl; SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, and n is an integer from about 1 to about 20.
(214) In one embodiment, compounds having Formula 52, 53, 54, 55, 56, and 57 are featured wherein each nitrogen adjacent to a carbonyl can independently be substituted for a carbonyl adjacent to a nitrogen or each carbonyl adjacent to a nitrogen can be substituted for a nitrogen adjacent to a carbonyl.
(215) In another embodiment, the invention features a compound having Formula 58:
XW[Y(V).sub.n].sub.N58
(216) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; Y comprises a linker molecule or amino acid that can be present or absent; V comprises a signal protein or peptide, for example Human serum albumin protein, Antennapedia peptide, Kaposi fibroblast growth factor peptide, Caiman crocodylus Ig(5) light chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza hemagglutinin envelope glycoprotein peptide, or transportan A peptide; each n is independently an integer from about 1 to about 50; and N is an integer from about 1 to about 100. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(217) In another embodiment, the invention features a compound having Formula 59:
(218) ##STR00038##
(219) wherein each R1 independently comprises O, S, N, substituted N, or a phosphorus containing group; each R2 independently comprises O, S, or N; X comprises H, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, or other biologically active molecule; n is an integer from about 1 to about 50, Q comprises H or a removable protecting group which can be optionally absent, each W independently comprises a linker molecule or chemical linkage that can be present or absent, and V comprises a signal protein or peptide, for example Human serum albumin protein, Antennapedia peptide, Kaposi fibroblast growth factor peptide, Caiman crocodylus Ig(5) light chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza hemagglutinin envelope glycoprotein peptide, or transportan A peptide, or a compound having Formula 45
(220) ##STR00039##
(221) wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, a removable protecting group, a siNA molecule or a portion thereof; and n is an integer from about 1 to about 100. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(222) In another embodiment, the invention features a compound having Formula 60:
(223) ##STR00040## wherein R1 can include the groups:
(224) ##STR00041## and wherein R2 can include the groups:
(225) ##STR00042##
(226) and wherein Tr is a removable protecting group, for example a trityl, monomethoxytrityl, or dimethoxytrityl; n is an integer from about 1 to about 50; and R8 is a nitrogen protecting group, for example a phthaloyl, trifluoroacetyl, FMOC, or monomethoxytrityl group.
(227) In another embodiment, the invention features a compound having Formula 61:
(228) ##STR00043##
(229) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be the same or different and can be present or absent, Y comprises a linker molecule that can be present or absent; each 5 independently comprises a signal protein or peptide, for example Human serum albumin protein, Antennapedia peptide, Kaposi fibroblast growth factor peptide, Caiman crocodylus Ig(5) light chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza hemagglutinin envelope glycoprotein peptide, or transportan A peptide; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and n is an integer from about 1 to about 10. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(230) In another embodiment, the invention features a compound having Formula 62:
(231) ##STR00044##
(232) wherein X comprises a siNA molecule or portion thereof; each 5 independently comprises a signal protein or peptide, for example Human serum albumin protein, Antennapedia peptide, Kaposi fibroblast growth factor peptide, Caiman crocodylus Ig(5) light chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza hemagglutinin envelope glycoprotein peptide, or transportan A peptide; W comprises a linker molecule or chemical linkage that can be present or absent; each R1, R2, and R3 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and each n is independently an integer from about 1 to about 10. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(233) In another embodiment, the invention features a compound having Formula 63:
(234) ##STR00045##
(235) wherein X comprises a siNA molecule or portion thereof; V comprises a signal protein or peptide, for example Human serum albumin protein, Antennapedia peptide, Kaposi fibroblast growth factor peptide, Caiman crocodylus Ig(5) light chain peptide, HIV envelope glycoprotein gp41 peptide, HIV-1 Tat peptide, Influenza hemagglutinin envelope glycoprotein peptide, or transportan A peptide; W comprises a linker molecule or chemical linkage that can be present or absent; each R1, R2, R3 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, R4 represents an ester, amide, or protecting group, and each n is independently an integer from about 1 to about 10. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(236) In another embodiment, the invention features a compound having Formula 64:
(237) ##STR00046##
(238) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, A comprises a nitrogen containing group, and B comprises a lipophilic group. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(239) In another embodiment, the invention features a compound having Formula 65:
(240) ##STR00047##
(241) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, RV comprises the lipid or phospholipid component of any of Formulae 47-50, and R6 comprises a nitrogen containing group. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(242) In another embodiment, the invention features a compound having Formula 92:
(243) ##STR00048##
(244) wherein B comprises H, a nucleoside base, or a non-nucleosidic base with or without protecting groups; each R1 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, or a phosphorus containing group; X comprises H, a removable protecting group, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, enzymatic nucleic acid, amino acid, peptide, protein, lipid, phospholipid, biologically active molecule or label; W comprises a linker molecule or chemical linkage that can be present or absent; R2 comprises O, NH, S, CO, COO, ONC, or alkyl; R3 comprises alkyl, akloxy, or an aminoacyl side chain; and SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers.
(245) In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(246) In another embodiment, the invention features a compound having Formula 86:
(247) ##STR00049##
(248) wherein R1 comprises H, alkyl, alkylhalo, N, substituted N, or a phosphorus containing group; R2 comprises H, O, OH, alkyl, alkylhalo, halo, S, N, substituted N, or a phosphorus containing group; X comprises H, a removable protecting group, a siNA molecule or a portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent; R3 comprises O, NH, S, CO, COO, ONC, or alkyl; R4 comprises alkyl, akloxy, or an aminoacyl side chain; and SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers, and each n is independently an integer from about 0 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(249) In another embodiment, the invention features a compound having Formula 87:
(250) ##STR00050##
(251) wherein X comprises a protein, peptide, antibody, lipid, phospholipid, oligosaccharide, label, biologically active molecule, for example a vitamin such as folate, vitamin A, E, B6, B12, coenzyme, antibiotic, antiviral, nucleic acid, nucleotide, nucleoside, or oligonucleotide such as an enzymatic nucleic acid, allozyme, antisense nucleic acid, siNA, 2,5-A chimera, decoy, aptamer or triplex forming oligonucleotide, or polymers such as polyethylene glycol; W comprises a linker molecule or chemical linkage that can be present or absent; and Y comprises siNA or a portion thereof; R1 comprises H, alkyl, or substituted alkyl. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(252) In another embodiment, the invention features a compound having Formula 88:
(253) ##STR00051##
(254) wherein X comprises a protein, peptide, antibody, lipid, phospholipid, oligosaccharide, label, biologically active molecule, for example a vitamin such as folate, vitamin A, E, B6, B12, coenzyme, antibiotic, antiviral, nucleic acid, nucleotide, nucleoside, or oligonucleotide such as an enzymatic nucleic acid, allozyme, antisense nucleic acid, siNA, 2,5-A chimera, decoy, aptamer or triplex forming oligonucleotide, or polymers such as polyethylene glycol; W comprises a linker molecule or chemical linkage that can be present or absent, and Y comprises a siNA or a portion thereof. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(255) In another embodiment, the invention features a compound having Formula 99:
(256) ##STR00052##
(257) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine or branched derivative thereof, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(258) In another embodiment, the invention features a compound having Formula 100:
(259) ##STR00053##
(260) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and SG comprises a sugar, for example galactose, galactosamine, N-acetyl-galactosamine or branched derivative thereof, glucose, mannose, fructose, or fucose and the respective D or L, alpha or beta isomers. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(261) In one embodiment, the SG component of any compound having Formulae 99 or 100 comprises a compound having Formula 101:
(262) ##STR00054##
(263) wherein Y comprises a linker molecule or chemical linkage that can be present or absent and each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group.
(264) In one embodiment, the W-SG component of a compound having Formulae 99 comprises a compound having Formula 102:
(265) ##STR00055##
(266) wherein R2 comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, a protecting group, or another compound having Formula 102; R1 independently H, OH, alkyl, substituted alkyl, or halo and each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and R3 comprises O or R3 in Formula 99, and n is an integer from about 1 to about 20.
(267) In one embodiment, the W-SG component of a compound having Formulae 99 comprises a compound having Formula 103:
(268) ##STR00056##
(269) wherein R1 comprises H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, a protecting group, or another compound having Formula 103; each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and R3 comprises H or R3 in Formula 99, and each n is independently an integer from about 1 to about 20.
(270) In one embodiment, the invention features a compound having Formula 104:
(271) ##STR00057##
(272) wherein R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and each n is independently an integer from about 1 to about 20, and
(273) wherein R1 can include the groups:
(274) ##STR00058##
(275) and wherein R2 can include the groups:
(276) ##STR00059##
(277) In one embodiment, the invention features a compound having Formula 105:
(278) ##STR00060##
(279) wherein X comprises a siNA molecule or a portion thereof, R2 comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylhalo, S, N, substituted N, a protecting group, or a nucleotide, polynucleotide, or oligonucleotide or a portion thereof; R1 independently H, OH, alkyl, substituted alkyl, or halo and each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and n is an integer from about 1 to about 20.
(280) In one embodiment, the invention features a compound having Formula 106:
(281) ##STR00061##
(282) wherein X comprises a siNA molecule or a portion thereof, R1 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and each n is independently an integer from about 1 to about 20
(283) In another embodiment, the invention features a compound having Formula 107:
(284) ##STR00062##
(285) wherein X comprises a siNA molecule or portion thereof; each W independently comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and Cholesterol comprises cholesterol or an analog, derivative, or metabolite thereof. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(286) In another embodiment, the invention features a compound having Formula 108:
(287) ##STR00063##
(288) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, Y comprises a linker molecule that can be present or absent; each R1, R2, R3, and R4 independently comprises O, OH, H, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, and Cholesterol comprises cholesterol or an analog, derivative, or metabolite thereof. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(289) In one embodiment, the W-Cholesterol component of a compound having Formula 107 comprises a compound having Formula 109:
(290) ##STR00064##
(291) wherein R3 comprises R3 as described in Formula 107, and n is independently an integer from about 1 to about 20.
(292) In one embodiment, the invention features a compound having Formula 110:
(293) ##STR00065##
(294) wherein R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each n is independently an integer from about 1 to about 20, and
(295) wherein R1 can include the groups:
(296) ##STR00066##
(297) and wherein R2 can include the groups:
(298) ##STR00067##
(299) In one embodiment, the invention features a compound having Formula 111:
(300) ##STR00068##
(301) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, and n is an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(302) In one embodiment, the invention features a compound having Formula 112:
(303) ##STR00069##
(304) wherein n is an integer from about 1 to about 20. In another embodiment, a compound having Formula 112 is used to generate a compound having Formula 111 via NHS ester mediated coupling with a biologically active molecule, such as a siNA molecule or a portion thereof. In a non-limiting example, the NHS ester coupling can be effectuated via attachment to a free amine present in the siNA molecule, such as an amino linker molecule present on a nucleic acid sugar (e.g. 2-amino linker) or base (e.g., C5 alkyl amine linker) component of the siNA molecule.
(305) In one embodiment, the invention features a compound having Formula 113:
(306) ##STR00070##
(307) wherein R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each n is independently an integer from about 1 to about 20, and
(308) wherein R1 can include the groups:
(309) ##STR00071##
(310) and wherein R2 can include the groups:
(311) ##STR00072##
(312) In another embodiment, a compound having Formula 113 is used to generate a compound having Formula 111 via phosphoramidite mediated coupling with a biologically active molecule, such as a siNA molecule or a portion thereof.
(313) In one embodiment, the invention features a compound having Formula 114:
(314) ##STR00073##
(315) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, and n is an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(316) In one embodiment, the invention features a compound having Formula 115:
(317) ##STR00074##
(318) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, and each n is independently an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(319) In one embodiment, the invention features a compound having Formula 116:
(320) ##STR00075##
(321) wherein R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each n is independently an integer from about 1 to about 20, and
(322) wherein R1 can include the groups:
(323) ##STR00076##
(324) and wherein R2 can include the groups:
(325) ##STR00077##
(326) In another embodiment, a compound having Formula 116 is used to generate a compound having Formula 114 or 115 via phosphoramidite mediated coupling with a biologically active molecule, such as a siNA molecule or a portion thereof.
(327) In one embodiment, the invention features a compound having Formula 117:
(328) ##STR00078##
(329) wherein R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, each n is independently an integer from about 1 to about 20, and
(330) wherein R1 can include the groups:
(331) ##STR00079##
(332) and wherein R2 can include the groups:
(333) ##STR00080##
(334) In another embodiment, a compound having Formula 117 is used to generate a compound having Formula 105 via phosphoramidite mediated coupling with a biologically active molecule, such as a siNA molecule or a portion thereof.
(335) In one embodiment, the invention features a compound having Formula 118:
(336) ##STR00081##
(337) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and each n is independently an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(338) In one embodiment, the invention features a compound having Formula 119:
(339) ##STR00082##
(340) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and each n is independently an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(341) In one embodiment, the invention features a compound having Formula 120:
(342) ##STR00083##
(343) wherein R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, each n is independently an integer from about 1 to about 20, and
(344) wherein R1 can include the groups:
(345) ##STR00084##
(346) and wherein R2 can include the groups:
(347) ##STR00085##
(348) In another embodiment, a compound having Formula 120 is used to generate a compound having Formula 118 or 119 via phosphoramidite mediated coupling with a biologically active molecule, such as a siNA molecule or a portion thereof.
(349) In one embodiment, the invention features a compound having Formula 121:
(350) ##STR00086##
(351) wherein X comprises a siNA molecule or portion thereof; W comprises a linker molecule or chemical linkage that can be present or absent, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, and each n is independently an integer from about 1 to about 20. In another embodiment, W is selected from the group consisting of amide, phosphate, phosphate ester, phosphoramidate, or thiophosphate ester linkage.
(352) In one embodiment, the invention features a compound having Formula 122:
(353) ##STR00087##
(354) wherein R3 comprises H, OH, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, label, or a portion thereof, or OR5 where R5 a removable protecting group, R4 comprises O, alkyl, alkylhalo, O-alkyl, O-alkylcyano, S, S-alkyl, S-alkylcyano, N or substituted N, each R7 independently comprises an acyl group that can be present or absent, for example a acetyl group, each n is independently an integer from about 1 to about 20, and
(355) wherein R1 can include the groups:
(356) ##STR00088##
(357) and wherein R2 can include the groups:
(358) ##STR00089##
(359) In another embodiment, a compound having Formula 122 is used to generate a compound having Formula 121 via phosphoramidite mediated coupling with a biologically active molecule, such as a siNA molecule or a portion thereof.
(360) In one embodiment, the invention features a compound having Formula 94,
XYWYZ 94
(361) wherein X comprises a siNA molecule or a portion thereof; each Y independently comprises a linker or chemical linkage that can be present or absent, W comprises a biodegradable nucleic acid linker molecule, and Z comprises a biologically active molecule, for example an enzymatic nucleic acid, allozyme, antisense nucleic acid, siNA, 2,5-A chimera, decoy, aptamer or triplex forming oligonucleotide, peptide, protein, or antibody.
(362) In another embodiment, W of a compound having Formula 94 of the invention comprises 5-cytidine-deoxythymidine-3, 5-deoxythymidine-cytidine-3, 5-cytidine-deoxyuridine-3, 5-deoxyuridine-cytidine-3, 5-uridine-deoxythymidine-3, or 5-deoxythymidine-uridine-3.
(363) In yet another embodiment, W of a compound having Formula 94 of the invention comprises 5-adenosine-deoxythymidine-3, 5-deoxythymidine-adenosine-3, 5-adenosine-deoxyuridine-3, or 5-deoxyuridine-adenosine-3.
(364) In another embodiment, Y of a compound having Formula 94 of the invention comprises a phosphorus containing linkage, phosphoramidate linkage, phosphodiester linkage, phosphorothioate linkage, amide linkage, ester linkage, carbamate linkage, disulfide linkage, oxime linkage, or morpholino linkage.
(365) In another embodiment, compounds having Formula 89 and 91 of the invention are synthesized by periodate oxidation of an N-terminal Serine or Threonine residue of a peptide or protein.
(366) In one embodiment, X of compounds having Formulae 43, 44, 46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 105-108, 111, 114, 115, 118, 119, or 121 of the invention comprises a siNA molecule or a portion thereof. In one embodiment, the siNA molecule can be conjugated at the 5 end, 3-end, or both 5 and 3 ends of the sense strand or region of the siNA. In one embodiment, the siNA molecule can be conjugated at the 3-end of the antisense strand or region of the siNA with a compound of the invention. In one embodiment, both the sense strand and antisense strands or regions of the siNA molecule are conjugated with a compound of the invention. In one embodiment, only the sense strand or region of the siNA is conjugated with a compound of the invention. In one embodiment, only the antisense strand or region of the siNA is conjugated with a compound of the invention.
(367) In one embodiment, W and/or Y of compounds having Formulae 43, 44, 46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 101, 107, 108, 111, 114, 115, 118, 119, or 121 of the invention comprises a degradable or cleavable linker, for example a nucleic acid sequence comprising ribonucleotides and/or deoxynucleotides, such as a dimer, trimer, or tetramer. A non limiting example of a nucleic acid cleavable linker is an adenosine-deoxythymidine (A-dT) dimer or a cytidine-deoxythymidine (C-dT) dimer. In yet another embodiment, W and/or V of compounds having Formulae 43, 44, 48-51, 58, 63-65, 96, 99, 100, 107, 108, 111, 114, 115, 118, 119, or 121 of the invention comprises a N-hydroxy succinimide (NHS) ester linkage, oxime linkage, disulfide linkage, phosphoramidate, phosphorothioate, phosphorodithioate, phosphodiester linkage, or NHC(O), CH.sub.3NC(O), CONH, C(O)NCH.sub.3, S, SO, SO.sub.2, O, NH, NCH.sub.3 group. In another embodiment, the degradable linker, W and/or Y, of compounds having Formulae Formulae 43, 44, 46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 101, 107, 108, 111, 114, 115, 118, 119, or 121 of the invention comprises a linker that is susceptible to cleavage by carboxypeptidase activity.
(368) In another embodiment, W and/or Y of Formulae 43, 44, 46-52, 58, 61-65, 85-88, 92, 94, 95, 99, 100, 101, 107, 108, 111, 114, 115, 118, 119, or 121 comprises a polyethylene glycol linker having Formula 45:
(369) ##STR00090##
(370) wherein Z comprises H, OH, O-alkyl, SH, S-alkyl, alkyl, substituted alkyl, aryl, substituted aryl, amino, substituted amino, nucleotide, nucleoside, nucleic acid, oligonucleotide, amino acid, peptide, protein, lipid, phospholipid, or label; and n is an integer from about 1 to about 100.
(371) In one embodiment, the nucleic acid conjugates of the instant invention are assembled by solid phase synthesis, for example on an automated peptide synthesizer, for example a Miligen 9050 synthesizer and/or an automated oligonucleotide synthesizer such as an ABI 394, 390Z, or Pharmacia OligoProcess, OligoPilot, OligoMax, or AKTA synthesizer. In another embodiment, the nucleic acid conjugates of the invention are assembled post synthetically, for example, following solid phase oligonucleotide synthesis (see for example
(372) In another embodiment, V of compounds having Formula 58-63 and 96 comprise peptides having SEQ ID NOS: 507-516 (Table V).
(373) In one embodiment, the nucleic acid conjugates of the instant invention are assembled post synthetically, for example, following solid phase oligonucleotide synthesis.
(374) The present invention provides compositions and conjugates comprising nucleosidic and non-nucleosidic derivatives. The present invention also provides nucleic acid, polynucleotide and oligonucleotide derivatives including RNA, DNA, and PNA based conjugates. The attachment of compounds of the invention to nucleosides, nucleotides, non-nucleosides, and nucleic acid molecules is provided at any position within the molecule, for example, at internucleotide linkages, nucleosidic sugar hydroxyl groups such as 5, 3, and 2-hydroxyls, and/or at nucleobase positions such as amino and carbonyl groups.
(375) The exemplary conjugates of the invention are described as compounds of the formulae herein, however, other peptide, protein, phospholipid, and poly-alkyl glycol derivatives are provided by the invention, including various analogs of the compounds of formulae 1-122, including but not limited to different isomers of the compounds described herein.
(376) The exemplary folate conjugates of the invention are described as compounds shown by formulae herein, however, other folate and antifolate derivatives are provided by the invention, including various folate analogs of the formulae of the invention, including dihydrofloates, tetrahydrofolates, tetrahydorpterins, folinic acid, pteropolyglutamic acid, 1-deaza, 3-deaza, 5-deaza, 8-deaza, 10-deaza, 1,5-deaza, 5,10 dideaza, 8,10-dideaza, and 5,8-dideaza folates, antifolates, and pteroic acids. As used herein, the term folate is meant to refer to folate and folate derivatives, including pteroic acid derivatives and analogs.
(377) The present invention features compositions and conjugates to facilitate delivery of molecules into a biological system such as cells. The conjugates provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes. The present invention encompasses the design and synthesis of novel agents for the delivery of molecules, including but not limited to siNA molecules. In general, the transporters described are designed to be used either individually or as part of a multi-component system. The compounds of the invention generally shown in Formulae herein are expected to improve delivery of molecules into a number of cell types originating from different tissues, in the presence or absence of serum.
(378) In another embodiment, the compounds of the invention are provided as a surface component of a lipid aggregate, such as a liposome encapsulated with the predetermined molecule to be delivered. Liposomes, which can be unilamellar or multilamellar, can introduce encapsulated material into a cell by different mechanisms. For example, the liposome can directly introduce its encapsulated material into the cell cytoplasm by fusing with the cell membrane. Alternatively, the liposome can be compartmentalized into an acidic vacuole (i.e., an endosome) and its contents released from the liposome and out of the acidic vacuole into the cellular cytoplasm.
(379) In one embodiment the invention features a lipid aggregate formulation of the compounds described herein, including phosphatidylcholine (of varying chain length; e.g., egg yolk phosphatidylcholine), cholesterol, a cationic lipid, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethyleneglycol-2000 (DSPE-PEG2000). The cationic lipid component of this lipid aggregate can be any cationic lipid known in the art such as dioleoyl 1,2,-diacyl-3-trimethylammonium-propane (DOTAP). In another embodiment this cationic lipid aggregate comprises a covalently bound compound described in any of the Formulae herein.
(380) In another embodiment, polyethylene glycol (PEG) is covalently attached to the compounds of the present invention. The attached PEG can be any molecular weight but is preferably between 2000-50,000 daltons.
(381) The compounds and methods of the present invention are useful for introducing nucleotides, nucleosides, nucleic acid molecules, lipids, peptides, proteins, and/or non-nucleosidic small molecules into a cell. For example, the invention can be used for nucleotide, nucleoside, nucleic acid, lipids, peptides, proteins, and/or non-nucleosidic small molecule delivery where the corresponding target site of action exists intracellularly.
(382) In one embodiment, the compounds of the instant invention provide conjugates of molecules that can interact with cellular receptors, such as high affinity folate receptors and ASGPr receptors, and provide a number of features that allow the efficient delivery and subsequent release of conjugated compounds across biological membranes. The compounds utilize chemical linkages between the receptor ligand and the compound to be delivered of length that can interact preferentially with cellular receptors. Furthermore, the chemical linkages between the ligand and the compound to be delivered can be designed as degradable linkages, for example by utilizing a phosphate linkage that is proximal to a nucleophile, such as a hydroxyl group. Deprotonation of the hydroxyl group or an equivalent group, as a result of pH or interaction with a nuclease, can result in nucleophilic attack of the phosphate resulting in a cyclic phosphate intermediate that can be hydrolyzed. This cleavage mechanism is analogous RNA cleavage in the presence of a base or RNA nuclease. Alternately, other degradable linkages can be selected that respond to various factors such as UV irradiation, cellular nucleases, pH, temperature etc. The use of degradable linkages allows the delivered compound to be released in a predetermined system, for example in the cytoplasm of a cell, or in a particular cellular organelle.
(383) The present invention also provides ligand derived phosphoramidites that are readily conjugated to compounds and molecules of interest. Phosphoramidite compounds of the invention permit the direct attachment of conjugates to molecules of interest without the need for using nucleic acid phosphoramidite species as scaffolds. As such, the used of phosphoramidite chemistry can be used directly in coupling the compounds of the invention to a compound of interest, without the need for other condensation reactions, such as condensation of the ligand to an amino group on the nucleic acid, for example at the N6 position of adenosine or a 2-deoxy-2-amino function. Additionally, compounds of the invention can be used to introduce non-nucleic acid based conjugated linkages into oligonucleotides that can provide more efficient coupling during oligonucleotide synthesis than the use of nucleic acid-based phosphoramidites. This improved coupling can take into account improved steric considerations of abasic or non-nucleosidic scaffolds bearing pendant alkyl linkages.
(384) Compounds of the invention utilizing triphosphate groups can be utilized in the enzymatic incorporation of conjugate molecules into oligonucleotides. Such enzymatic incorporation is useful when conjugates are used in post-synthetic enzymatic conjugation or selection reactions, (see for example Matulic-Adamic et al., 2000, Bioorg. Med. Chem. Lett., 10, 1299-1302; Lee et al., 2001, NAR., 29, 1565-1573; Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al., 1994, TIBTECH 12, 268; Bartel et al., 1993, Science 261:1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al., 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 7, 442; Santoro et al., 1997, Proc. Natl. Acad. Sci., 94, 4262; Tang et al., 1997, RNA 3, 914; Nakamaye & Eckstein, 1994, supra; Long & Uhlenbeck, 1994, supra; Ishizaka et al., 1995, supra; Vaish et al., 1997, Biochemistry 36, 6495; Kuwabara et al., 2000, Curr. Opin. Chem. Biol., 4, 669).
(385) The term biodegradable linker as used herein, refers to a nucleic acid or non-nucleic acid linker molecule that is designed as a biodegradable linker to connect one molecule to another molecule, for example, a biologically active molecule to a siNA molecule of the invention or the sense and antisense strands of a siNA molecule of the invention. The biodegradable linker is designed such that its stability can be modulated for a particular purpose, such as delivery to a particular tissue or cell type. The stability of a nucleic acid-based biodegradable linker molecule can be modulated by using various chemistries, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically-modified nucleotides, such as 2-O-methyl, 2-fluoro, 2-amino, 2-O-amino, 2-C-allyl, 2-O-allyl, and other 2-modified or base modified nucleotides. The biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid molecule, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus-based linkage, for example, a phosphoramidate or phosphodiester linkage. The biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
(386) The term biodegradable as used herein, refers to degradation in a biological system, for example enzymatic degradation or chemical degradation.
(387) The term biologically active molecule as used herein, refers to compounds or molecules that are capable of eliciting or modifying a biological response in a system. Non-limiting examples of biologically active siNA molecules either alone or in combination with other molecules contemplated by the instant invention include therapeutically active molecules such as antibodies, cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, 2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and analogs thereof. Biologically active molecules of the invention also include molecules capable of modulating the pharmacokinetics and/or pharmacodynamics of other biologically active molecules, for example, lipids and polymers such as polyamines, polyamides, polyethylene glycol and other polyethers.
(388) The term phospholipid as used herein, refers to a hydrophobic molecule comprising at least one phosphorus group. For example, a phospholipid can comprise a phosphorus-containing group and saturated or unsaturated alkyl group, optionally substituted with OH, COOH, oxo, amine, or substituted or unsubstituted aryl groups.
(389) The term alkyl as used herein refers to a saturated aliphatic hydrocarbon, including straight-chain, branched-chain isoalkyl, and cyclic alkyl groups. The term alkyl also comprises alkoxy, alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl, alkylamino, alkenyl, alkynyl, alkoxy, cycloalkenyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6 hydrocarbyl, aryl or substituted aryl groups. Preferably, the alkyl group has 1 to 12 carbons. More preferably it is a lower alkyl of from about 1 to about 7 carbons, more preferably about 1 to about 4 carbons. The alkyl group can be substituted or unsubstituted. When substituted the substituted group(s) preferably comprise hydroxy, oxy, thio, amino, nitro, cyano, alkoxy, alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl, alkylamino, silyl, alkenyl, alkynyl, alkoxy, cycloalkenyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6 hydrocarbyl, aryl or substituted aryl groups. The term alkyl also includes alkenyl groups containing at least one carbon-carbon double bond, including straight-chain, branched-chain, and cyclic groups. Preferably, the alkenyl group has about 2 to about 12 carbons. More preferably it is a lower alkenyl of from about 2 to about 7 carbons, more preferably about 2 to about 4 carbons. The alkenyl group can be substituted or unsubstituted. When substituted the substituted group(s) preferably comprise hydroxy, oxy, thio, amino, nitro, cyano, alkoxy, alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl, alkylamino, silyl, alkenyl, alkynyl, alkoxy, cycloalkenyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6 hydrocarbyl, aryl or substituted aryl groups. The term alkyl also includes alkynyl groups containing at least one carbon-carbon triple bond, including straight-chain, branched-chain, and cyclic groups. Preferably, the alkynyl group has about 2 to about 12 carbons. More preferably it is a lower alkynyl of from about 2 to about 7 carbons, more preferably about 2 to about 4 carbons. The alkynyl group can be substituted or unsubstituted. When substituted the substituted group(s) preferably comprise hydroxy, oxy, thio, amino, nitro, cyano, alkoxy, alkyl-thio, alkyl-thio-alkyl, alkoxyalkyl, alkylamino, silyl, alkenyl, alkynyl, alkoxy, cycloalkenyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heteroaryl, C1-C6 hydrocarbyl, aryl or substituted aryl groups. Alkyl groups or moieties of the invention can also include aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester groups. The preferred substituent(s) of aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino groups. An alkylaryl group refers to an alkyl group (as described above) covalently joined to an aryl group (as described above). Carbocyclic aryl groups are groups wherein the ring atoms on the aromatic ring are all carbon atoms. The carbon atoms are optionally substituted. Heterocyclic aryl groups are groups having from about 1 to about 3 heteroatoms as ring atoms in the aromatic ring and the remainder of the ring atoms are carbon atoms.
(390) Suitable heteroatoms include oxygen, sulfur, and nitrogen, and include furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkyl pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted. An amide refers to an C(O)NHR, where R is either alkyl, aryl, alkylaryl or hydrogen. An ester refers to an C(O)OR, where R is either alkyl, aryl, alkylaryl or hydrogen.
(391) The term alkoxyalkyl as used herein refers to an alkyl-O-alkyl ether, for example, methoxyethyl or ethoxymethyl.
(392) The term alkyl-thio-alkyl as used herein refers to an alkyl-S-alkyl thioether, for example, methylthiomethyl or methylthioethyl.
(393) The term amino as used herein refers to a nitrogen containing group as is known in the art derived from ammonia by the replacement of one or more hydrogen radicals by organic radicals. For example, the terms aminoacyl and aminoalkyl refer to specific N-substituted organic radicals with acyl and alkyl substituent groups respectively.
(394) The term amination as used herein refers to a process in which an amino group or substituted amine is introduced into an organic molecule.
(395) The term exocyclic amine protecting moiety as used herein refers to a nucleobase amino protecting group compatible with oligonucleotide synthesis, for example, an acyl or amide group.
(396) The term alkenyl as used herein refers to a straight or branched hydrocarbon of a designed number of carbon atoms containing at least one carbon-carbon double bond. Examples of alkenyl include vinyl, allyl, and 2-methyl-3-heptene.
(397) The term alkoxy as used herein refers to an alkyl group of indicated number of carbon atoms attached to the parent molecular moiety through an oxygen bridge. Examples of alkoxy groups include, for example, methoxy, ethoxy, propoxy and isopropoxy.
(398) The term alkynyl as used herein refers to a straight or branched hydrocarbon of a designed number of carbon atoms containing at least one carbon-carbon triple bond. Examples of alkynyl include propargyl, propyne, and 3-hexyne.
(399) The term aryl as used herein refers to an aromatic hydrocarbon ring system containing at least one aromatic ring. The aromatic ring can optionally be fused or otherwise attached to other aromatic hydrocarbon rings or non-aromatic hydrocarbon rings. Examples of aryl groups include, for example, phenyl, naphthyl, 1,2,3,4-tetrahydronaphthalene and biphenyl. Preferred examples of aryl groups include phenyl and naphthyl.
(400) The term cycloalkenyl as used herein refers to a C3-C8 cyclic hydrocarbon containing at least one carbon-carbon double bond. Examples of cycloalkenyl include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadiene, cyclohexenyl, 1,3-cyclohexadiene, cycloheptenyl, cycloheptatrienyl, and cyclooctenyl.
(401) The term cycloalkyl as used herein refers to a C3-C8 cyclic hydrocarbon. Examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.
(402) The term cycloalkylalkyl, as used herein, refers to a C3-C7 cycloalkyl group attached to the parent molecular moiety through an alkyl group, as defined above. Examples of cycloalkylalkyl groups include cyclopropylmethyl and cyclopentylethyl.
(403) The terms halogen or halo as used herein refers to indicate fluorine, chlorine, bromine, and iodine.
(404) The term heterocycloalkyl, as used herein refers to a non-aromatic ring system containing at least one heteroatom selected from nitrogen, oxygen, and sulfur. The heterocycloalkyl ring can be optionally fused to or otherwise attached to other heterocycloalkyl rings and/or non-aromatic hydrocarbon rings. Preferred heterocycloalkyl groups have from 3 to 7 members. Examples of heterocycloalkyl groups include, for example, piperazine, morpholine, piperidine, tetrahydrofuran, pyrrolidine, and pyrazole. Preferred heterocycloalkyl groups include piperidinyl, piperazinyl, morpholinyl, and pyrolidinyl.
(405) The term heteroaryl as used herein refers to an aromatic ring system containing at least one heteroatom selected from nitrogen, oxygen, and sulfur. The heteroaryl ring can be fused or otherwise attached to one or more heteroaryl rings, aromatic or non-aromatic hydrocarbon rings or heterocycloalkyl rings. Examples of heteroaryl groups include, for example, pyridine, furan, thiophene, 5,6,7,8-tetrahydroisoquinoline and pyrimidine. Preferred examples of heteroaryl groups include thienyl, benzothienyl, pyridyl, quinolyl, pyrazinyl, pyrimidyl, imidazolyl, benzimidazolyl, furanyl, benzofuranyl, thiazolyl, benzothiazolyl, isoxazolyl, oxadiazolyl, isothiazolyl, benzisothiazolyl, triazolyl, tetrazolyl, pyrrolyl, indolyl, pyrazolyl, and benzopyrazolyl.
(406) The term C1-C6 hydrocarbyl as used herein refers to straight, branched, or cyclic alkyl groups having 1-6 carbon atoms, optionally containing one or more carbon-carbon double or triple bonds. Examples of hydrocarbyl groups include, for example, methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl, 3-methylpentyl, vinyl, 2-pentene, cyclopropylmethyl, cyclopropyl, cyclohexylmethyl, cyclohexyl and propargyl. When reference is made herein to C1-C6 hydrocarbyl containing one or two double or triple bonds it is understood that at least two carbons are present in the alkyl for one double or triple bond, and at least four carbons for two double or triple bonds.
(407) The term protecting group as used herein, refers to groups known in the art that are readily introduced and removed from an atom, for example O, N, P, or S. Protecting groups are used to prevent undesirable reactions from taking place that can compete with the formation of a specific compound or intermediate of interest. See also Protective Groups in Organic Synthesis, 3rd Ed., 1999, Greene, T. W. and related publications.
(408) The term nitrogen protecting group, as used herein, refers to groups known in the art that are readily introduced on to and removed from a nitrogen. Examples of nitrogen protecting groups include Boc, Cbz, benzoyl, and benzyl. See also Protective Groups in Organic Synthesis, 3rd Ed., 1999, Greene, T. W. and related publications.
(409) The term hydroxy protecting group, or hydroxy protection as used herein, refers to groups known in the art that are readily introduced on to and removed from an oxygen, specifically an OH group. Examples of hyroxy protecting groups include trityl or substituted trityl groups, such as monomethoxytrityl and dimethoxytrityl, or substituted silyl groups, such as tert-butyldimethyl, trimethylsilyl, or tert-butyldiphenyl silyl groups. See also Protective Groups in Organic Synthesis, 3rd Ed., 1999, Greene, T. W. and related publications.
(410) The term acyl as used herein refers to C(O)R groups, wherein R is an alkyl or aryl.
(411) The term phosphorus containing group as used herein, refers to a chemical group containing a phosphorus atom. The phosphorus atom can be trivalent or pentavalent, and can be substituted with O, H, N, S, C or halogen atoms. Examples of phosphorus containing groups of the instant invention include but are not limited to phosphorus atoms substituted with O, H, N, S, C or halogen atoms, comprising phosphonate, alkylphosphonate, phosphate, diphosphate, triphosphate, pyrophosphate, phosphorothioate, phosphorodithioate, phosphoramidate, phosphoramidite groups, nucleotides and nucleic acid molecules.
(412) The term phosphine or phosphite as used herein refers to a trivalent phosphorus species, for example compounds having Formula 97:
(413) ##STR00091## wherein R can include the groups:
(414) ##STR00092## and wherein S and T independently include the groups:
(415) ##STR00093##
(416) The term phosphate as used herein refers to a pentavalent phosphorus species, for example a compound having Formula 98:
(417) ##STR00094## wherein R includes the groups:
(418) ##STR00095##
(419) and wherein S and T each independently can be a sulfur or oxygen atom or a group which can include:
(420) ##STR00096##
(421) and wherein M comprises a sulfur or oxygen atom. The phosphate of the invention can comprise a nucleotide phosphate, wherein any R, S, or T in Formula 98 comprises a linkage to a nucleic acid or nucleoside.
(422) The term cationic salt as used herein refers to any organic or inorganic salt having a net positive charge, for example a triethylammonium (TEA) salt.
(423) The term degradable linker as used herein, refers to linker moieties that are capable of cleavage under various conditions. Conditions suitable for cleavage can include but are not limited to pH, UV irradiation, enzymatic activity, temperature, hydrolysis, elimination, and substitution reactions, and thermodynamic properties of the linkage.
(424) The term photolabile linker as used herein, refers to linker moieties as are known in the art, that are selectively cleaved under particular UV wavelengths. Compounds of the invention containing photolabile linkers can be used to deliver compounds to a target cell or tissue of interest, and can be subsequently released in the presence of a UV source.
(425) The term nucleic acid conjugates as used herein, refers to nucleoside, nucleotide and oligonucleotide conjugates.
(426) The term lipid as used herein, refers to any lipophilic compound. Non-limiting examples of lipid compounds include fatty acids and their derivatives, including straight chain, branched chain, saturated and unsaturated fatty acids, carotenoids, terpenes, bile acids, and steroids, including cholesterol and derivatives or analogs thereof.
(427) The term folate as used herein, refers to analogs and derivatives of folic acid, for example antifolates, dihydrofloates, tetrahydrofolates, tetrahydorpterins, folinic acid, pteropolyglutamic acid, 1-deaza, 3-deaza, 5-deaza, 8-deaza, 10-deaza, 1,5-deaza, 5,10 dideaza, 8,10-dideaza, and 5,8-dideaza folates, antifolates, and pteroic acid derivatives.
(428) The term compounds with neutral charge as used herein, refers to compositions which are neutral or uncharged at neutral or physiological pH. Examples of such compounds are cholesterol and other steroids, cholesteryl hemisuccinate (CHEMS), dioleoyl phosphatidyl choline, distearoylphosphotidyl choline (DSPC), fatty acids such as oleic acid, phosphatidic acid and its derivatives, phosphatidyl serine, polyethylene glycol-conjugated phosphatidylamine, phosphatidylcholine, phosphatidylethanolamine and related variants, prenylated compounds including farnesol, polyprenols, tocopherol, and their modified forms, diacylsuccinyl glycerols, fusogenic or pore forming peptides, dioleoylphosphotidylethanolamine (DOPE), ceramide and the like.
(429) The term lipid aggregate as used herein refers to a lipid-containing composition wherein the lipid is in the form of a liposome, micelle (non-lamellar phase) or other aggregates with one or more lipids.
(430) The term nitrogen containing group as used herein refers to any chemical group or moiety comprising a nitrogen or substituted nitrogen. Non-limiting examples of nitrogen containing groups include amines, substituted amines, amides, alkylamines, amino acids such as arginine or lysine, polyamines such as spermine or spermidine, cyclic amines such as pyridines, pyrimidines including uracil, thymine, and cytosine, morpholines, phthalimides, and heterocyclic amines such as purines, including guanine and adenine.
(431) Therapeutic nucleic acid molecules (e.g., siNA molecules) delivered exogenously optimally are stable within cells until reverse transcription of the RNA has been modulated long enough to reduce the levels of the RNA transcript. The nucleic acid molecules are resistant to nucleases in order to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of nucleic acid molecules described in the instant invention and in the art have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability as described above.
(432) In yet another embodiment, siNA molecules having chemical modifications that maintain or enhance enzymatic activity of proteins involved in RNAi are provided. Such nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus, in vitro and/or in vivo the activity should not be significantly lowered.
(433) Use of the nucleic acid-based molecules of the invention will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes; nucleic acid molecules coupled with known small molecule modulators; or intermittent treatment with combinations of molecules, including different motifs and/or other chemical or biological molecules). The treatment of subjects with siNA molecules can also include combinations of different types of nucleic acid molecules, such as enzymatic nucleic acid molecules (ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys, and aptamers.
(434) In another aspect a siNA molecule of the invention comprises one or more 5 and/or a 3-cap structure, for example on only the sense siNA strand, the antisense siNA strand, or both siNA strands.
(435) By cap structure is meant chemical modifications, which have been incorporated at either terminus of the oligonucleotide (see, for example, Adamic et al., U.S. Pat. No. 5,998,203, incorporated by reference herein). These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5-terminus (5-cap) or at the 3-terminal (3-cap) or can be present on both termini. Non-limiting examples of the 5-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety); 4,5-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3,4-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3-3-inverted nucleotide moiety; 3-3-inverted abasic moiety; 3-2-inverted nucleotide moiety; 3-2-inverted abasic moiety; 1,4-butanediol phosphate; 3-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3-phosphate; 3-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety.
(436) Non-limiting examples of the 3-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety), 4, 5-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4-thio nucleotide, carbocyclic nucleotide; 5-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3,4-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5-5-inverted nucleotide moiety; 5-5-inverted abasic moiety; 5-phosphoramidate; 5-phosphorothioate; 1,4-butanediol phosphate; 5-amino; bridging and/or non-bridging 5-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging methylphosphonate and 5-mercapto moieties (for more details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925; incorporated by reference herein).
(437) By the term non-nucleotide is meant any group or compound which can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity. The group or compound is abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a base at the 1-position.
(438) By nucleotide as used herein is as recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1 position of a nucleotide sugar moiety. Nucleotides generally comprise a base, sugar and a phosphate group. The nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety, (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other; see, for example, Usman and McSwiggen, supra; Eckstein et al., International PCT Publication No. WO 92/07065; Usman et al., International PCT Publication No. WO 93/15187; Uhlman & Peyman, supra, all are hereby incorporated by reference herein). There are several examples of modified nucleic acid bases known in the art as summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183. Some of the non-limiting examples of base modifications that can be introduced into nucleic acid molecules include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), propyne, and others (Burgin et al., 1996, Biochemistry, 35, 14090; Uhlman & Peyman, supra). By modified bases in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1 position or their equivalents.
(439) In one embodiment, the invention features modified siNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphonoacetate, and/or thiophosphonoacetate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a review of oligonucleotide backbone modifications, see Hunziker and Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al., 1994, Novel Backbone Replacements for Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-39.
(440) By abasic is meant sugar moieties lacking a base or having other chemical groups in place of a base at the 1 position, see for example Adamic et al., U.S. Pat. No. 5,998,203.
(441) By unmodified nucleoside is meant one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1 carbon of (3-D-ribo-furanose.
(442) By modified nucleoside is meant any nucleotide base which contains a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate. Non-limiting examples of modified nucleotides are shown by Formulae I-VII and/or other modifications described herein.
(443) In connection with 2-modified nucleotides as described for the present invention, by amino is meant 2-NH.sub.2 or 2-O NH.sub.2, which can be modified or unmodified. Such modified groups are described, for example, in Eckstein et al., U.S. Pat. No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878, which are both incorporated by reference in their entireties.
(444) Various modifications to nucleic acid siNA structure can be made to enhance the utility of these molecules. Such modifications will enhance shelf-life, half-life in vitro, stability, and ease of introduction of such oligonucleotides to the target site, e.g., to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
(445) Administration of Nucleic Acid Molecules
(446) A siNA molecule of the invention can be adapted for use to treat any disease, infection or condition associated with gene expression, and other indications that can respond to the level of gene product in a cell or tissue, alone or in combination with other therapies. For example, a siNA molecule can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. Methods for the delivery of nucleic acid molecules are described in Akhtar et al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999, Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS Symp. Ser., 752, 184-192, all of which are incorporated herein by reference. Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan et al., PCT WO 94/02595 further describe the general methods for delivery of nucleic acid molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins (see for example Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT publication Nos. WO 03/47518 and WO 03/46185), poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for example U.S. Pat. No. 6,447,796 and US Patent Application Publication No. US 2002130430), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722). In one embodiment, nucleic acid molecules or the invention are administered via biodegradable implant materials, such as elastic shape memory polymers (see for example Lendelein and Langer, 2002, Science, 296, 1673). Alternatively, the nucleic acid/vehicle combination is locally delivered by direct injection or by use of an infusion pump. Direct injection of the nucleic acid molecules of the invention, whether subcutaneous, intramuscular, or intradermal, can take place using standard needle and syringe methodologies, or by needle-free technologies such as those described in Conry et al., 1999, Clin. Cancer Res., 5, 2330-2337 and Barry et al., International PCT Publication No. WO 99/31262. Many examples in the art describe CNS delivery methods of oligonucleotides by osmotic pump, (see Chun et al., 1998, Neuroscience Letters, 257, 135-138, D'Aldin et al., 1998, Mol. Brain Research, 55, 151-164, Dryden et al., 1998, J. Endocrinol., 157, 169-175, Ghirnikar et al., 1998, Neuroscience Letters, 247, 21-24) or direct infusion (Broaddus et al., 1997, Neurosurg. Focus, 3, article 4). Other routes of delivery include, but are not limited to oral (tablet or pill form) and/or intrathecal delivery (Gold, 1997, Neuroscience, 76, 1153-1158). More detailed descriptions of nucleic acid delivery and administration are provided in Sullivan et al., supra, Draper et al., PCT WO93/23569, Beigelman et al., PCT WO99/05094, and Klimuk et al., PCT WO99/04819 all of which have been incorporated by reference herein. The molecules of the instant invention can be used as pharmaceutical agents. Pharmaceutical agents prevent, modulate the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a subject.
(447) In addition, the invention features the use of methods to deliver the nucleic acid molecules of the instant invention to hematopoietic cells, including monocytes and lymphocytes. These methods are described in detail by Hartmann et al., 1998, J. Phamacol. Exp. Ther., 285(2), 920-928; Kronenwett et al., 1998, Blood, 91(3), 852-862; Filion and Phillips, 1997, Biochim. Biophys. Acta., 1329(2), 345-356; Ma and Wei, 1996, Leuk. Res., 20(11/12), 925-930; and Bongartz et al., 1994, Nucleic Acids Research, 22(22), 4681-8. Such methods, as described above, include the use of free oligonucleotide, cationic lipid formulations, liposome formulations including pH sensitive liposomes and immunoliposomes, and bioconjugates including oligonucleotides conjugated to fusogenic peptides, for the transfection of hematopoietic cells with oligonucleotides.
(448) In one embodiment, a compound, molecule, or composition for the treatment of ocular conditions (e.g., macular degeneration, diabetic retinopathy etc.) is administered to a subject intraocularly or by intraocular means. In another embodiment, a compound, molecule, or composition for the treatment of ocular conditions (e.g., macular degeneration, diabetic retinopathy etc.) is administered to a subject periocularly or by periocular means (see for example Ahlheim et al., International PCT publication No. WO 03/24420). In one embodiment, a siNA molecule and/or formulation or composition thereof is administered to a subject intraocularly or by intraocular means. In another embodiment, a siNA molecule and/or formulation or composition thereof is administered to a subject periocularly or by periocular means. Periocular administration generally provides a less invasive approach to administering siNA molecules and formulation or composition thereof to a subject (see for example Ahlheim et al., International PCT publication No. WO 03/24420). The use of periocular administraction also minimizes the risk of retinal detachment, allows for more frequent dosing or administraction, provides a clinically relevant route of administraction for macular degeneration and other optic conditions, and also provides the possibility of using reservoirs (e.g., implants, pumps or other devices) for drug delivery.
(449) In one embodiment, a siNA molecule of the invention is complexed with membrane disruptive agents such as those described in U.S. Patent Application Publication No. 20010007666, incorporated by reference herein in its entirety including the drawings. In another embodiment, the membrane disruptive agent or agents and the siNA molecule are also complexed with a cationic lipid or helper lipid molecule, such as those lipids described in U.S. Pat. No. 6,235,310, incorporated by reference herein in its entirety including the drawings.
(450) In one embodiment, siNA molecules of the invention are formulated or complexed with polyethylenimine (e.g., linear or branched PEI) and/or polyethylenimine derivatives, including for example grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEI, and polyethylene glycol PEI (PEG-PEI) derivatives thereof (see for example Ogris et al., 2001, AAPA PharmSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14, 840-847; Kunath et al., 2002, Phramaceutical Research, 19, 810-817; Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002, Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA, 96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release, 60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry, 274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99, 14640-14645; and Sagara, U.S. Pat. No. 6,586,524, incorporated by reference herein.
(451) In one embodiment, a siNA molecule of the invention comprises a bioconjugate, for example a nucleic acid conjugate as described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr. 30, 2003; U.S. Pat. Nos. 6,528,631; 6,335,434; 6,235,886; 6,153,737; 5,214,136; 5,138,045, all incorporated by reference herein.
(452) Thus, the invention features a pharmaceutical composition comprising one or more nucleic acid(s) of the invention in an acceptable carrier, such as a stabilizer, buffer, and the like. The polynucleotides of the invention can be administered (e.g., RNA, DNA or protein) and introduced into a subject by any standard means, with or without stabilizers, buffers, and the like, to form a pharmaceutical composition. When it is desired to use a liposome delivery mechanism, standard protocols for formation of liposomes can be followed. The compositions of the present invention can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for injectable administration, and the other compositions known in the art.
(453) The present invention also includes pharmaceutically acceptable formulations of the compounds described. These formulations include salts of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
(454) A pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged nucleic acid is desirable for delivery). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
(455) By systemic administration is meant in vivo systemic absorption or accumulation of drugs in the blood stream followed by distribution throughout the entire body. Administration routes that lead to systemic absorption include, without limitation: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular. Each of these administration routes exposes the siNA molecules of the invention to an accessible diseased tissue. The rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drug carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES). A liposome formulation that can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach can provide enhanced delivery of the drug to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as cancer cells.
(456) By pharmaceutically acceptable formulation is meant a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity. Non-limiting examples of agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as Pluronic P85), which can enhance entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999, Fundam. Clin. Pharmacol., 13, 16-26); biodegradable polymers, such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich, D F et al, 1999, Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, Mass.); and loaded nanoparticles, such as those made of polybutylcyanoacrylate, which can deliver drugs across the blood brain barrier and can alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999). Other non-limiting examples of delivery strategies for the nucleic acid molecules of the instant invention include material described in Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al., 1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA., 92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107; Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 4910-4916; and Tyler et al., 1999, PNAS USA., 96, 7053-7058.
(457) The invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., International PCT Publication No. WO 96/10391; Ansell et al., International PCT Publication No. WO 96/10390; Holland et al., International PCT Publication No. WO 96/10392). Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
(458) The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.
(459) A pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state. The pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
(460) The nucleic acid molecules of the invention and formulations thereof can be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles. The term parenteral as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like. In addition, there is provided a pharmaceutical formulation comprising a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier. One or more nucleic acid molecules of the invention can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients. The pharmaceutical compositions containing nucleic acid molecules of the invention can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
(461) Compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
(462) Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
(463) Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
(464) Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid
(465) Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.
(466) Pharmaceutical compositions of the invention can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions can also contain sweetening and flavoring agents.
(467) Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents. The pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
(468) The nucleic acid molecules of the invention can also be administered in the form of suppositories, e.g., for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter and polyethylene glycols.
(469) Nucleic acid molecules of the invention can be administered parenterally in a sterile medium. The drug, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
(470) Dosage levels of the order of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per subject per day). The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host treated and the particular mode of administration. Dosage unit forms generally contain between from about 1 mg to about 500 mg of an active ingredient.
(471) It is understood that the specific dose level for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
(472) For administration to non-human animals, the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
(473) The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
(474) In one embodiment, the invention comprises compositions suitable for administering nucleic acid molecules of the invention to specific cell types. For example, the asialoglycoprotein receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432) is unique to hepatocytes and binds branched galactose-terminal glycoproteins, such as asialoorosomucoid (ASOR). In another example, the folate receptor is overexpressed in many cancer cells. Binding of such glycoproteins, synthetic glycoconjugates, or folates to the receptor takes place with an affinity that strongly depends on the degree of branching of the oligosaccharide chain, for example, triatennary structures are bound with greater affinity than biatenarry or monoatennary chains (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Lee and Lee, 1987, Glycoconjugate J., 4, 317-328, obtained this high specificity through the use of N-acetyl-D-galactosamine as the carbohydrate moiety, which has higher affinity for the receptor, compared to galactose. This clustering effect has also been described for the binding and uptake of mannosyl-terminating glycoproteins or glycoconjugates (Ponpipom et al., 1981, J. Med. Chem., 24, 1388-1395). The use of galactose, galactosamine, or folate based conjugates to transport exogenous compounds across cell membranes can provide a targeted delivery approach to, for example, the treatment of liver disease, cancers of the liver, or other cancers. The use of bioconjugates can also provide a reduction in the required dose of therapeutic compounds required for treatment. Furthermore, therapeutic bioavialability, pharmacodynamics, and pharmacokinetic parameters can be modulated through the use of nucleic acid bioconjugates of the invention. Non-limiting examples of such bioconjugates are described in Vargeese et al., U.S. Ser. No. 10/201,394, filed Aug. 13, 2001; and Matulic-Adamic et al., U.S. Ser. No. 10/151,116, filed May 17, 2002. In one embodiment, nucleic acid molecules of the invention are complexed with or covalently attached to nanoparticles, such as Hepatitis B virus S, M, or L evelope proteins (see for example Yamado et al., 2003, Nature Biotechnology, 21, 885). In one embodiment, nucleic acid molecules of the invention are delivered with specificity for human tumor cells, specifically non-apoptotic human tumor cells including for example T-cells, hepatocytes, breast carcinoma cells, ovarian carcinoma cells, melanoma cells, intestinal epithelial cells, prostate cells, testicular cells, non-small cell lung cancers, small cell lung cancers, etc.
EXAMPLES
(475) The following are non-limiting examples showing the selection, isolation, synthesis and activity of nucleic acids of the instant invention.
Example 1: Tandem Synthesis of siNA Constructs
(476) Exemplary siNA molecules of the invention are synthesized in tandem using a cleavable linker, for example, a succinyl-based linker. Tandem synthesis as described herein is followed by a one-step purification process that provides RNAi molecules in high yield. This approach is highly amenable to siNA synthesis in support of high throughput RNAi screening, and can be readily adapted to multi-column or multi-well synthesis platforms.
(477) After completing a tandem synthesis of a siNA oligo and its complement in which the 5-terminal dimethoxytrityl (5-O-DMT) group remains intact (trityl on synthesis), the oligonucleotides are deprotected as described above. Following deprotection, the siNA sequence strands are allowed to spontaneously hybridize. This hybridization yields a duplex in which one strand has retained the 5-O-DMT group while the complementary strand comprises a terminal 5-hydroxyl. The newly formed duplex behaves as a single molecule during routine solid-phase extraction purification (Trityl-On purification) even though only one molecule has a dimethoxytrityl group. Because the strands form a stable duplex, this dimethoxytrityl group (or an equivalent group, such as other trityl groups or other hydrophobic moieties) is all that is required to purify the pair of oligos, for example, by using a C18 cartridge.
(478) Standard phosphoramidite synthesis chemistry is used up to the point of introducing a tandem linker, such as an inverted deoxy abasic succinate or glyceryl succinate linker (see
(479) Purification of the siNA duplex can be readily accomplished using solid phase extraction, for example using a Waters C18 SepPak Ig cartridge conditioned with 1 column volume (CV) of acetonitrile, 2 CV H.sub.2O, and 2 CV 50 mM NaOAc. The sample is loaded and then washed with 1 CV H.sub.2O or 50 mM NaOAc. Failure sequences are eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc and 50 mM NaCl). The column is then washed, for example with 1 CV H.sub.2O followed by on-column detritylation, for example by passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) over the column, then adding a second CV of 1% aqueous TFA to the column and allowing to stand for approximately 10 minutes. The remaining TFA solution is removed and the column washed with H.sub.2O followed by 1 CV 1M NaCl and additional H.sub.2O. The siNA duplex product is then eluted, for example, using 1 CV 20% aqueous CAN.
(480)
Example 2: Serum Stability of Chemically Modified siNA Constructs
(481) Chemical modifications were introduced into siNA constructs to determine the stability of these constructs compared to native siNA oligonucleotides (containing two thymidine nucleotide overhangs) in human serum. An investigation of the serum stability of RNA duplexes revealed that siNA constructs consisting of all RNA nucleotides containing two thymidine nucleotide overhangs have a half-life in serum of 15 seconds, whereas chemically modified siNA constructs remained stable in serum for 1 to 3 days depending on the extent of modification (see
(482) Internal labeling was performed via kinase reactions with polynucleotide kinase (PNK) and .sup.32P--ATP, with addition of radiolabeled phosphate at nucleotide 13 of strand 2, counting in from the 3 side. Ligation of the remaining 8-mer fragments with T4 RNA ligase resulted in the full length, 21-mer, strand 2. Duplexing of RNAi was done by adding appropriate concentrations of the siNA oligonucleotides and heating to 95 C. for 5 minutes followed by slow cooling to room temperature. Reactions were performed by adding 100% serum to the siNA duplexes and incubating at 37 C., then removing aliquots at desired time-points. Results of this study are summarized in
Example 3: Identification of Potential siNA Target Sites in any RNA Sequence
(483) The sequence of an RNA target of interest, such as a viral or human mRNA transcript, is screened for target sites, for example by using a computer folding algorithm. In a non-limiting example, the sequence of a gene or RNA gene transcript derived from a database, such as Genbank, is used to generate siNA targets having complementarity to the target. Such sequences can be obtained from a database, or can be determined experimentally as known in the art. Target sites that are known, for example, those target sites determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or antisense, or those targets known to be associated with a disease or condition such as those sites containing mutations or deletions, can be used to design siNA molecules targeting those sites. Various parameters can be used to determine which sites are the most suitable target sites within the target RNA sequence. These parameters include but are not limited to secondary or tertiary RNA structure, the nucleotide base composition of the target sequence, the degree of homology between various regions of the target sequence, or the relative position of the target sequence within the RNA transcript. Based on these determinations, any number of target sites within the RNA transcript can be chosen to screen siNA molecules for efficacy, for example by using in vitro RNA cleavage assays, cell culture, or animal models. In a non-limiting example, anywhere from 1 to 1000 target sites are chosen within the transcript based on the size of the siNA construct to be used. High throughput screening assays can be developed for screening siNA molecules using methods known in the art, such as with multi-well or multi-plate assays or combinatorial/siNA library screening assays to determine efficient reduction in target gene expression.
Example 4: Selection of siNA Molecule Target Sites in a RNA
(484) The following non-limiting steps can be used to carry out the selection of siNAs targeting a given gene sequence or transcript.
(485) The target sequence is parsed in silico into a list of all fragments or subsequences of a particular length, for example 23 nucleotide fragments, contained within the target sequence. This step is typically carried out using a custom Perl script, but commercial sequence analysis programs such as Oligo, MacVector, or the GCG Wisconsin Package can be employed as well.
(486) In some instances the siNAs correspond to more than one target sequence; such would be the case for example in targeting different transcripts of the same gene, targeting different transcripts of more than one gene, or for targeting both the human gene and an animal homolog. In this case, a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find matching sequences in each list. The subsequences are then ranked according to the number of target sequences that contain the given subsequence; the goal is to find subsequences that are present in most or all of the target sequences. Alternately, the ranking can identify subsequences that are unique to a target sequence, such as a mutant target sequence. Such an approach would enable the use of siNA to target specifically the mutant sequence and not effect the expression of the normal sequence.
(487) In some instances the siNA subsequences are absent in one or more sequences while present in the desired target sequence; such would be the case if the siNA targets a gene with a paralogous family member that is to remain untargeted. As in case 2 above, a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find sequences that are present in the target gene but are absent in the untargeted paralog.
(488) The ranked siNA subsequences can be further analyzed and ranked according to GC content. A preference can be given to sites containing 30-70% GC, with a further preference to sites containing 40-60% GC.
(489) The ranked siNA subsequences can be further analyzed and ranked according to self-folding and internal hairpins. Weaker internal folds are preferred; strong hairpin structures are to be avoided.
(490) The ranked siNA subsequences can be further analyzed and ranked according to whether they have runs of GGG or CCC in the sequence. GGG (or even more Gs) in either strand can make oligonucleotide synthesis problematic and can potentially interfere with RNAi activity, so it is avoided other appropriately suitable sequences are available. CCC is searched in the target strand because that will place GGG in the antisense strand.
(491) The ranked siNA subsequences can be further analyzed and ranked according to whether they have the dinucleotide UU (uridine dinucleotide) on the 3-end of the sequence, and/or AA on the 5-end of the sequence (to yield 3 UU on the antisense sequence). These sequences allow one to design siNA molecules with terminal TT thymidine dinucleotides.
(492) Four or five target sites are chosen from the ranked list of subsequences as described above. For example, in subsequences having 23 nucleotides, the right 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the upper (sense) strand of the siNA duplex, while the reverse complement of the left 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the lower (antisense) strand of the siNA duplex (see Tables I). If terminal TT residues are desired for the sequence (as described in paragraph 7), then the two 3 terminal nucleotides of both the sense and antisense strands are replaced by TT prior to synthesizing the oligos.
(493) The siNA molecules are screened in an in vitro, cell culture or animal model system to identify the most active siNA molecule or the most preferred target site within the target RNA sequence.
(494) In an alternate approach, a pool of siNA constructs specific to a target sequence is used to screen for target sites in cells expressing target RNA, such as human HeLa cells. The general strategy used in this approach is shown in
Example 5: RNAi Activity of Chemically Modified siNA Constructs
(495) Short interfering nucleic acid (siNA) is emerging as a powerful tool for gene regulation. All-ribose siNA duplexes activate the RNAi pathway but have limited utility as therapeutic compounds due to their nuclease sensitivity and short half-life in serum, as shown in Example 2 above. To develop nuclease-resistant siNA constructs for in vivo applications, siNAs that target luciferase mRNA and contain stabilizing chemical modifications were tested for activity in HeLa cells. The sequences for the siNA oligonucleotide sequences used in this study are shown in Table I. Modifications included phosphorothioate linkages (PS), 2-O-methyl nucleotides, or 2-fluoro (F) nucleotides in one or both siNA strands and various 3-end stabilization chemistries, including 3-glyceryl, 3-inverted abasic, 3-inverted Thymidine, and/or Thymidine. The RNAi activity of chemically stabilized siNA constructs was compared with the RNAi activity of control siNA constructs consisting of all ribonucleotides at every position except the 3-terminus which comprised two thymidine nucleotide overhangs. Active siNA molecules containing stabilizing modifications such as described herein should prove useful for in vivo applications, given their enhanced nuclease-resistance.
(496) A luciferase reporter system was utilized to test RNAi activity of chemically modified siNA constructs compared to siNA constructs consisting of all RNA nucleotides containing two thymidine nucleotide overhangs. Sense and antisense siNA strands (20 uM each) were annealed by incubation in buffer (100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 min. at 90 C. followed by 1 hour at 37 C. Plasmids encoding firefly luciferase (pGL2) and renilla luciferase (pRLSV40) were purchased from Promega Biotech.
(497) HeLa S3 cells were grown at 37 C. in DMEM with 5% FBS and seeded at 15,300 cells in 100 ul media per well of a 96-well plate 24 hours prior to transfection. For transfection, 4 ul Lipofectamine 2000 (Life Technologies) was added to 96 ul OPTI-MEM, vortexed and incubated at room temperature for 5 minutes. The 100 ul diluted lipid was then added to a microtiter tube containing 5 ul pGL2 (200 ng/ul), 5 ul pRLSV40 (8 ng/ul) 6 ul siNA (25 nM or 10 nM final), and 84 ul OPTI-MEM, vortexed briefly and incubated at room temperature for 20 minutes. The transfection mix was then mixed briefly and 50 ul was added to each of three wells that contained HeLa S3 cells in 100 ul media. Cells were incubated for 20 hours after transfection and analyzed for luciferase expression using the Dual luciferase assay according to the manufacturer's instructions (Promega Biotech). The results of this study are summarized in
(498) For example,
(499)
(500)
(501)
(502)
(503)
(504)
(505)
(506)
(507)
(508)
(509)
Example 6: RNAi Activity Titration
(510) A titration assay was performed to determine the lower range of siNA concentration required for RNAi activity both in a control siNA construct consisting of all RNA nucleotides containing two thymidine nucleotide overhangs and a chemically modified siNA construct comprising five phosphorothioate internucleotide linkages in both the sense and antisense strands. The assay was performed as described above, however, the siNA constructs were diluted to final concentrations between 2.5 nM and 0.025 nM. Results are shown in
Example 7: siNA Design
(511) siNA target sites were chosen by analyzing sequences of the target RNA and optionally prioritizing the target sites on the basis of folding (structure of any given sequence analyzed to determine siNA accessibility to the target), by using a library of siNA molecules as described in Example 4, or alternately by using an in vitro siNA system as described in Example 9 herein. siNA molecules were designed that could bind each target and are optionally individually analyzed by computer folding to assess whether the siNA molecule can interact with the target sequence. Varying the length of the siNA molecules can be chosen to optimize activity. Generally, a sufficient number of complementary nucleotide bases are chosen to bind to, or otherwise interact with, the target RNA, but the degree of complementarity can be modulated to accommodate siNA duplexes or varying length or base composition. By using such methodologies, siNA molecules can be designed to target sites within any known RNA sequence, for example those RNA sequences corresponding to the any gene transcript.
(512) Chemically modified siNA constructs are designed to provide nuclease stability for systemic administration in vivo and/or improved pharmacokinetic, localization, and delivery properties while preserving the ability to mediate RNAi activity. Chemical modifications as described herein are introduced synthetically using synthetic methods described herein and those generally known in the art. The synthetic siNA constructs are then assayed for nuclease stability in serum and/or cellular/tissue extracts (e.g. liver extracts). The synthetic siNA constructs are also tested in parallel for RNAi activity using an appropriate assay, such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity. Synthetic siNA constructs that possess both nuclease stability and RNAi activity can be further modified and re-evaluated in stability and activity assays. The chemical modifications of the stabilized active siNA constructs can then be applied to any siNA sequence targeting any chosen RNA and used, for example, in target screening assays to pick lead siNA compounds for therapeutic development (see for example
Example 8: Chemical Synthesis and Purification of siNA
(513) siNA molecules can be designed to interact with various sites in the RNA message, for example, target sequences within the RNA sequences described herein. The sequence of one strand of the siNA molecule(s) is complementary to the target site sequences described above. The siNA molecules can be chemically synthesized using methods described herein. Inactive siNA molecules that are used as control sequences can be synthesized by scrambling the sequence of the siNA molecules such that it is not complementary to the target sequence. Generally, siNA constructs can by synthesized using solid phase oligonucleotide synthesis methods as described herein (see for example Usman et al., U.S. Pat. Nos. 5,804,683; 5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117; 6,469,158; Scaringe et al., U.S. Pat. Nos. 6,111,086; 6,008,400; 6,111,086 all incorporated by reference herein in their entirety).
(514) In a non-limiting example, RNA oligonucleotides are synthesized in a stepwise fashion using the phosphoramidite chemistry as is known in the art. Standard phosphoramidite chemistry involves the use of nucleosides comprising any of 5-O-dimethoxytrityl, 2-O-tert-butyldimethylsilyl, 3-O-2-Cyanoethyl N,N-diisopropylphosphoramidite groups, and exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2-isobutyryl guanosine). Alternately, 2-O-Silyl Ethers can be used in conjunction with acid-labile 2-O-orthoester protecting groups in the synthesis of RNA as described by Scaringe supra. Differing 2 chemistries can require different protecting groups, for example 2-deoxy-2-amino nucleosides can utilize N-phthaloyl protection as described by Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference herein in its entirety).
(515) During solid phase synthesis, each nucleotide is added sequentially (3- to 5-direction) to the solid support-bound oligonucleotide. The first nucleoside at the 3-end of the chain is covalently attached to a solid support (e.g., controlled pore glass or polystyrene) using various linkers. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are combined resulting in the coupling of the second nucleoside phosphoramidite onto the 5-end of the first nucleoside. The support is then washed and any unreacted 5-hydroxyl groups are capped with a capping reagent such as acetic anhydride to yield inactive 5-acetyl moieties. The trivalent phosphorus linkage is then oxidized to a more stable phosphate linkage. At the end of the nucleotide addition cycle, the 5-O-protecting group is cleaved under suitable conditions (e.g., acidic conditions for trityl-based groups and Fluoride for silyl-based groups). The cycle is repeated for each subsequent nucleotide.
(516) Modification of synthesis conditions can be used to optimize coupling efficiency, for example by using differing coupling times, differing reagent/phosphoramidite concentrations, differing contact times, differing solid supports and solid support linker chemistries depending on the particular chemical composition of the siNA to be synthesized. Deprotection and purification of the siNA can be performed as is generally described in Deprotection and purification of the siNA can be performed as is generally described in Usman et al., U.S. Pat. Nos. 5,831,071, 6,353,098, 6,437,117, and Bellon et al., U.S. Pat. Nos. 6,054,576, 6,162,909, 6,303,773, or Scaringe supra, incorporated by reference herein in their entireties. Additionally, deprotection conditions can be modified to provide the best possible yield and purity of siNA constructs. For example, applicant has observed that oligonucleotides comprising 2-deoxy-2-fluoro nucleotides can degrade under inappropriate deprotection conditions. Such oligonucleotides are deprotected using aqueous methylamine at about 35 C. for 30 minutes. If the 2-deoxy-2-fluoro containing oligonucleotide also comprises ribonucleotides, after deprotection with aqueous methylamine at about 35 C. for 30 minutes, TEA-HF is added and the reaction maintained at about 65 C. for an additional 15 minutes.
Example 9: RNAi In Vitro Assay to Assess siNA Activity
(517) An in vitro assay that recapitulates RNAi in a cell free system is used to evaluate siNA constructs specific to target RNA. The assay comprises the system described by Tuschl et al., 1999, Genes and Development, 13, 3191-3197 and Zamore et al., 2000, Cell, 101, 25-33 adapted for use with target RNA. A Drosophila extract derived from syncytial blastoderm is used to reconstitute RNAi activity in vitro. Target RNA is generated via in vitro transcription from an appropriate plasmid using T7 RNA polymerase or via chemical synthesis as described herein. Sense and antisense siNA strands (for example 20 uM each) are annealed by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at 90 C. followed by 1 hour at 37 C., then diluted in lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate). Annealing can be monitored by gel electrophoresis on an agarose gel in TBE buffer and stained with ethidium bromide. The Drosophila lysate is prepared using zero to two-hour-old embryos from Oregon R flies collected on yeasted molasses agar that are dechorionated and lysed. The lysate is centrifuged and the supernatant isolated. The assay comprises a reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM final concentration), and 10% [vol/vol] lysis buffer containing siNA (10 nM final concentration). The reaction mixture also contains 10 mM creatine phosphate, 10 ug.Math.ml creatine phosphokinase, 100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL RNasin (Promega), and 100 uM of each amino acid. The final concentration of potassium acetate is adjusted to 100 mM. The reactions are pre-assembled on ice and preincubated at 25 C. for 10 minutes before adding RNA, then incubated at 25 C. for an additional 60 minutes. Reactions are quenched with 4 volumes of 1.25 Passive Lysis Buffer (Promega). Target RNA cleavage is assayed by RT-PCR analysis or other methods known in the art and are compared to control reactions in which siNA is omitted from the reaction.
(518) Alternately, internally-labeled target RNA for the assay is prepared by in vitro transcription in the presence of [alpha-.sup.32p] CTP, passed over a G 50 Sephadex column by spin chromatography and used as target RNA without further purification. Optionally, target RNA is 5-.sup.32P-end labeled using T4 polynucleotide kinase enzyme. Assays are performed as described above and target RNA and the specific RNA cleavage products generated by RNAi are visualized on an autoradiograph of a gel. The percentage of cleavage is determined by Phosphor Imager quantitation of bands representing intact control RNA or RNA from control reactions without siNA and the cleavage products generated by the assay.
(519) In one embodiment, this assay is used to determine target sites the RNA target for siNA mediated RNAi cleavage, wherein a plurality of siNA constructs are screened for RNAi mediated cleavage of the RNA target, for example, by analyzing the assay reaction by electrophoresis of labeled target RNA, or by northern blotting, as well as by other methodology well known in the art.
Example 10: Nucleic Acid Inhibition of Target RNA In Vivo
(520) siNA molecules targeted to the target RNA are designed and synthesized as described above. These nucleic acid molecules can be tested for cleavage activity in vivo, for example, using the following procedure.
(521) Two formats are used to test the efficacy of siNAs targeting a particular gene transcript. First, the reagents are tested on target expressing cells (e.g., HeLa), to determine the extent of RNA and protein inhibition. siNA reagents are selected against the RNA target. RNA inhibition is measured after delivery of these reagents by a suitable transfection agent to cells. Relative amounts of target RNA are measured versus actin using real-time PCR monitoring of amplification (eg., ABI 7700 Taqman). A comparison is made to a mixture of oligonucleotide sequences made to unrelated targets or to a randomized siNA control with the same overall length and chemistry, but with randomly substituted nucleotides at each position. Primary and secondary lead reagents are chosen for the target and optimization performed. After an optimal transfection agent concentration is chosen, a RNA time-course of inhibition is performed with the lead siNA molecule. In addition, a cell-plating format can be used to determine RNA inhibition.
(522) Delivery of siNA to Cells
(523) Cells (e.g., HeLa) are seeded, for example, at 110.sup.5 cells per well of a six-well dish in EGM-2 (BioWhittaker) the day before transfection. siNA (final concentration, for example 20 nM) and cationic lipid (e.g., final concentration 2 g/ml) are complexed in EGM basal media (Biowhittaker) at 37 C. for 30 mins in polystyrene tubes. Following vortexing, the complexed siNA is added to each well and incubated for the times indicated. For initial optimization experiments, cells are seeded, for example, at 110.sup.3 in 96 well plates and siNA complex added as described. Efficiency of delivery of siNA to cells is determined using a fluorescent siNA complexed with lipid. Cells in 6-well dishes are incubated with siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde for 15 minutes at room temperature. Uptake of siNA is visualized using a fluorescent microscope.
(524) Taqman and Lightcycler Quantification of mRNA
(525) Total RNA is prepared from cells following siNA delivery, for example, using Qiagen RNA purification kits for 6-well or Rneasy extraction kits for 96-well assays. For Taqman analysis, dual-labeled probes are synthesized with the reporter dye, FAM or JOE, covalently linked at the 5-end and the quencher dye TAMRA conjugated to the 3-end. One-step RT-PCR amplifications are performed on, for example, an ABI PRISM 7700 Sequence Detector using 50 l reactions consisting of 10 l total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, 1 TaqMan PCR reaction buffer (PE-Applied Biosystems), 5.5 mM MgCl.sub.2, 300 M each dATP, dCTP, dGTP, and dTTP, 10 U RNase Inhibitor (Promega), 1.25 U AmpliTaq Gold (PE-Applied Biosystems) and 10 U M-MLV Reverse Transcriptase (Promega). The thermal cycling conditions can consist of 30 min at 48 C., 10 min at 95 C., followed by 40 cycles of 15 sec at 95 C. and 1 min at 60 C. Quantitation of mRNA levels is determined relative to standards generated from serially diluted total cellular RNA (300, 100, 33, 11 ng/rn) and normalizing to 1-actin or GAPDH mRNA in parallel TaqMan reactions. For each gene of interest an upper and lower primer and a fluorescently labeled probe are designed. Real time incorporation of SYBR Green I dye into a specific PCR product can be measured in glass capillary tubes using a lightcyler. A standard curve is generated for each primer pair using control cRNA. Values are represented as relative expression to GAPDH in each sample.
(526) Western Blotting
(527) Nuclear extracts can be prepared using a standard micro preparation technique (see for example Andrews and Faller, 1991, Nucleic Acids Research, 19, 2499). Protein extracts from supernatants are prepared, for example using TCA precipitation. An equal volume of 20% TCA is added to the cell supernatant, incubated on ice for 1 hour and pelleted by centrifugation for 5 minutes. Pellets are washed in acetone, dried and resuspended in water. Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear extracts) or 4-12% Tris-Glycine (supernatant extracts) polyacrylamide gel and transferred onto nitro-cellulose membranes. Non-specific binding can be blocked by incubation, for example, with 5% non-fat milk for 1 hour followed by primary antibody for 16 hour at 4 C. Following washes, the secondary antibody is applied, for example (1:10,000 dilution) for 1 hour at room temperature and the signal detected with SuperSignal reagent (Pierce).
Example 11: Animal Models
(528) Various animal models can be used to screen siNA constructs in vivo as are known in the art, for example those animal models that are used to evaluate other nucleic acid technologies such as enzymatic nucleic acid molecules (ribozymes) and/or antisense. Such animal models are used to test the efficacy of siNA molecules described herein. In a non-limiting example, siNA molecules that are designed as anti-angiogenic agents can be screened using animal models. There are several animal models available in which to test the anti-angiogenesis effect of nucleic acids of the present invention, such as siNA, directed against genes associated with angiogenesis and/or metastais, such as VEGFR (e.g., VEGFR1, VEGFR2, and VEGFR3) genes. Typically a corneal model has been used to study angiogenesis in rat and rabbit, since recruitment of vessels can easily be followed in this normally avascular tissue (Pandey et al., 1995 Science 268: 567-569). In these models, a small Teflon or Hydron disk pretreated with an angiogenesis factor (e.g. bFGF or VEGF) is inserted into a pocket surgically created in the cornea. Angiogenesis is monitored 3 to 5 days later. siNA molecules directed against VEGFR mRNAs would be delivered in the disk as well, or dropwise to the eye over the time course of the experiment. In another eye model, hypoxia has been shown to cause both increased expression of VEGF and neovascularization in the retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92: 905-909; Shweiki et al., 1992 J. Clin. Invest. 91: 2235-2243).
(529) Several animal models exist for screening of anti-angiogenic agents. These include corneal vessel formation following corneal injury (Burger et al., 1985 Cornea 4: 35-41; Lepri, et al., 1994 J. Ocular Pharmacol. 10: 273-280; Ormerod et al., 1990 Am. J. Pathol. 137: 1243-1252) or intracorneal growth factor implant (Grant et al., 1993 Diabetologia 36: 282-291; Pandey et al. 1995 supra; Zieche et al., 1992 Lab. Invest. 67: 711-715), vessel growth into Matrigel matrix containing growth factors (Passaniti et al., 1992 supra), female reproductive organ neovascularization following hormonal manipulation (Shweiki et al., 1993 Clin. Invest. 91: 2235-2243), several models involving inhibition of tumor growth in highly vascularized solid tumors (O'Reilly et al., 1994 Cell 79: 315-328; Senger et al., 1993 Cancer and Metas. Rev. 12: 303-324; Takahasi et al., 1994 Cancer Res. 54: 4233-4237; Kim et al., 1993 supra), and transient hypoxia-induced neovascularization in the mouse retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92: 905-909).gene
(530) The cornea model, described in Pandey et al. supra, is the most common and well characterized anti-angiogenic agent efficacy screening model. This model involves an avascular tissue into which vessels are recruited by a stimulating agent (growth factor, thermal or alkali burn, endotoxin). The corneal model utilizes the intrastromal corneal implantation of a Teflon pellet soaked in a VEGF-Hydron solution to recruit blood vessels toward the pellet, which can be quantitated using standard microscopic and image analysis techniques. To evaluate their anti-angiogenic efficacy, siNA molecules are applied topically to the eye or bound within Hydron on the Teflon pellet itself. This avascular cornea as well as the Matrigel model (described below) provide for low background assays. While the corneal model has been performed extensively in the rabbit, studies in the rat have also been conducted.
(531) The mouse model (Passaniti et al., supra) is a non-tissue model which utilizes Matrigel, an extract of basement membrane (Kleinman et al., 1986) or Millipore filter disk, which can be impregnated with growth factors and anti-angiogenic agents in a liquid form prior to injection. Upon subcutaneous administration at body temperature, the Matrigel or Millipore filter disk forms a solid implant. VEGF embedded in the Matrigel or Millipore filter disk is used to recruit vessels within the matrix of the Matrigel or Millipore filter disk which can be processed histologically for endothelial cell specific vWF (factor VIII antigen) immunohistochemistry, Trichrome-Masson stain, or hemoglobin content. Like the cornea, the Matrigel or Millipore filter disk are avascular; however, it is not tissue. In the Matrigel or Millipore filter disk model, siNA molecules are administered within the matrix of the Matrigel or Millipore filter disk to test their anti-angiogenic efficacy. Thus, delivery issues in this model, as with delivery of siNA molecules by Hydron-coated Teflon pellets in the rat cornea model, may be less problematic due to the homogeneous presence of the siNA within the respective matrix.
(532) The Lewis lung carcinoma and B-16 murine melanoma models are well accepted models of primary and metastatic cancer and are used for initial screening of anti-cancer agents. These murine models are not dependent upon the use of immunodeficient mice, are relatively inexpensive, and minimize housing concerns. Both the Lewis lung and B-16 melanoma models involve subcutaneous implantation of approximately 10.sup.6 tumor cells from metastatically aggressive tumor cell lines (Lewis lung lines 3LL or D122, LLc-LN7; B-16-BL6 melanoma) in C57BL/6J mice. Alternatively, the Lewis lung model can be produced by the surgical implantation of tumor spheres (approximately 0.8 mm in diameter). Metastasis also may be modeled by injecting the tumor cells directly intraveneously. In the Lewis lung model, microscopic metastases can be observed approximately 14 days following implantation with quantifiable macroscopic metastatic tumors developing within 21-25 days. The B-16 melanoma exhibits a similar time course with tumor neovascularization beginning 4 days following implantation. Since both primary and metastatic tumors exist in these models after 21-25 days in the same animal, multiple measurements can be taken as indices of efficacy. Primary tumor volume and growth latency as well as the number of micro- and macroscopic metastatic lung foci or number of animals exhibiting metastases can be quantitated. The percent increase in lifespan can also be measured. Thus, these models would provide suitable primary efficacy assays for screening systemically administered siNA molecules and siNA formulations.
(533) In the Lewis lung and B-16 melanoma models, systemic pharmacotherapy with a wide variety of agents usually begins 1-7 days following tumor implantation/inoculation with either continuous or multiple administration regimens. Concurrent pharmacokinetic studies can be performed to determine whether sufficient tissue levels of siNA can be achieved for pharmacodynamic effect to be expected. Furthermore, primary tumors and secondary lung metastases can be removed and subjected to a variety of in vitro studies (i.e. target RNA reduction).
(534) Ohno-Matsui et al., 2002, Am. J. Pathology, 160, 711-719 describe a model of severe proliferative retinopathy and retinal detachment in mice under inducible expression of vascular endothelial growth factor. In this model, expression of a VEGF transgene results in elevated levels of ocular VEGF that is associated with severe proliferative retinopathy and retinal detachment. Furthermore, Mori et al., 2001, J. Cellular Physiology, 188, 253-263, describe a model of laser induced choroidal neovascularization that can be used in conjunction with intravitreous or subretianl injection of siNA molecules of the invention to evaluate the efficacy of siNA treatment of severe proliferative retinopathy and retinal detachment.
(535) In utilizing these models to assess siNA activity, VEGFR1, VEGFR2, and/or VEGFR3 protein levels can be measured clinically or experimentally by FACS analysis. VEGFR1, VEGFR2, and/or VEGFR3 encoded mRNA levels can be assessed by Northern analysis, RNase-protection, primer extension analysis and/or quantitative RT-PCR. siNA molecules that block VEGFR1, VEGFR2, and/or VEGFR3 protein encoding mRNAs and therefore result in decreased levels of VEGFR1, VEGFR2, and/or VEGFR3 activity by more than 20% in vitro can be identified using the techniques described herein.
Example 12: siNA-Mediated Inhibition of Angiogenesis In Vivo
(536) The purpose of this study was to assess the anti-angiogenic activity of siNA targeted against VEGFR1, using the rat cornea model of VEGF induced angiogenesis discussed in Example 11 above). The siNA molecules shown in
(537) The stimulus for angiogenesis in this study was the treatment of the filter disk with 30 M VEGF which is implanted within the cornea's stroma. This dose yields reproducible neovascularization stemming from the pericorneal vascular plexus growing toward the disk in a dose-response study 5 days following implant. Filter disks treated only with the vehicle for VEGF show no angiogenic response. The siNA were co-adminstered with VEGF on a disk in three different siNA concentrations. One concern with the simultaneous administration is that the siNA would not be able to inhibit angiogenesis since VEGF receptors can be stimulated. However, Applicant has observed that in low VEGF doses, the neovascular response reverts to normal suggesting that the VEGF stimulus is essential for maintaining the angiogenic response. Blocking the production of VEGF receptors using simultaneous administration of anti-VEGF-R mRNA siNA could attenuate the normal neovascularization induced by the filter disk treated with VEGF.
(538) Materials and Methods:
(539) Test Compounds and Controls
(540) R&D Systems VEGF, carrier free at 75 M in 82 mM Tris-C1, pH 6.9 siNA, 1.67 G/L, SITE 2340 (SIRNA/RPI 29695/29699) sense/antisense siNA, 1.67 G/L, INVERTED CONTROL FOR SITE 2340 (SIRNA/RPI 29983/29984) sense/antisense siNA 1.67 g/L, Site 2340 (Sirna/RPI 30196/30416) sense/antisense
Animals Harlan Sprague-Dawley Rats, Approximately 225-250 g 45 males, 5 animals per group.
Husbandry
(541) Animals are housed in groups of two. Feed, water, temperature and humidity are determined according to Pharmacology Testing Facility performance standards (SOP's) which are in accordance with the 1996 Guide for the Care and Use of Laboratory Animals (NRC). Animals are acclimated to the facility for at least 7 days prior to experimentation. During this time, animals are observed for overall health and sentinels are bled for baseline serology.
(542) Experimental Groups
(543) Each solution (VEGF and siNAs) was prepared as a 1 solution for final concentrations shown in the experimental groups described in Table III.
(544) siNA Annealing Conditions
(545) siNA sense and antisense strands are annealed for 1 minute in H.sub.2O at 1.67 mg/mL/strand followed by a 1 hour incubation at 37 C. producing 3.34 mg/mL of duplexed siNA. For the 20 g/eye treatment, 6 Ls of the 3.34 mg/mL duplex is injected into the eye (see below). The 3.34 mg/mL duplex siNA can then be serially diluted for dose response assays.
(546) Preparation of VEGF Filter Disk
(547) For corneal implantation, 0.57 mm diameter nitrocellulose disks, prepared from 0.45 m pore diameter nitrocellulose filter membranes (Millipore Corporation), were soaked for 30 min in 1 L of 75 M VEGF in 82 mM Tris-HCl (pH 6.9) in covered petri dishes on ice. Filter disks soaked only with the vehicle for VEGF (83 mM Tris-C1 pH 6.9) elicit no angiogenic response.
(548) Corneal Surgery
(549) The rat corneal model used in this study was a modified from Koch et al. Supra and Pandey et al., supra. Briefly, corneas were irrigated with 0.5% povidone iodine solution followed by normal saline and two drops of 2% lidocaine. Under a dissecting microscope (Leica MZ-6), a stromal pocket was created and a presoaked filter disk (see above) was inserted into the pocket such that its edge was 1 mm from the corneal limbus.
(550) Intraconjunctival Injection of Test Solutions
(551) Immediately after disk insertion, the tip of a 40-50 m OD injector (constructed in our laboratory) was inserted within the conjunctival tissue 1 mm away from the edge of the corneal limbus that was directly adjacent to the VEGF-soaked filter disk. Six hundred nanoliters of test solution (siNA, inverted control or sterile water vehicle) were dispensed at a rate of 1.2 L/min using a syringe pump (Kd Scientific). The injector was then removed, serially rinsed in 70% ethanol and sterile water and immersed in sterile water between each injection. Once the test solution was injected, closure of the eyelid was maintained using microaneurism clips until the animal began to recover gross motor activity. Following treatment, animals were warmed on a heating pad at 37 C.
(552) Quantitation of Angiogenic Response
(553) Five days after disk implantation, animals were euthanized following administration of 0.4 mg/kg atropine and corneas were digitally imaged. The neovascular surface area (NSA, expressed in pixels) was measured postmortem from blood-filled corneal vessels using computerized morphometry (Image Pro Plus, Media Cybernetics, v2.0). The individual mean NSA was determined in triplicate from three regions of identical size in the area of maximal neovascularization between the filter disk and the limbus. The number of pixels corresponding to the blood-filled corneal vessels in these regions was summated to produce an index of NSA. A group mean NSA was then calculated. Data from each treatment group were normalized to VEGF/siNA vehicle-treated control NSA and finally expressed as percent inhibition of VEGF-induced angiogenesis.
(554) Statistics
(555) After determining the normality of treatment group means, group mean percent inhibition of VEGF-induced angiogenesis was subjected to a one-way analysis of variance. This was followed by two post-hoc tests for significance including Dunnett's (comparison to VEGF control) and Tukey-Kramer (all other group mean comparisons) at alpha=0.05. Statistical analyses were performed using JMP v.3.1.6 (SAS Institute).
(556) Results of the study are graphically represented in
Example 13: Inhibition of HBV Using siNA Molecules of the Invention
(557) Transfection of HepG2 Cells with psHBV-1 and siNA
(558) The human hepatocellular carcinoma cell line Hep G2 was grown in Dulbecco's modified Eagle media supplemented with 10% fetal calf serum, 2 mM glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 25 mM Hepes, 100 units penicillin, and 100 g/ml streptomycin. To generate a replication competent cDNA, prior to transfection the HBV genomic sequences are excised from the bacterial plasmid sequence contained in the psHBV-1 vector. Other methods known in the art can be used to generate a replication competent cDNA. This was done with an EcoRI and Hind III restriction digest. Following completion of the digest, a ligation was performed under dilute conditions (20 g/ml) to favor intermolecular ligation. The total ligation mixture was then concentrated using Qiagen spin columns.
(559) siNA Activity Screen and Dose Response Assay
(560) Transfection of the human hepatocellular carcinoma cell line, Hep G2, with replication-competent HBV DNA results in the expression of HBV proteins and the production of virions. To test the efficacy of siNAs targeted against HBV RNA, several siNA duplexes targeting different sites within HBV pregenomic RNA were co-transfected with HBV genomic DNA once at 25 nM with lipid at 12.5 ug/ml into Hep G2 cells, and the subsequent levels of secreted HBV surface antigen (HBsAg) were analyzed by ELISA (see
(561) Analysis of HBsAg Levels Following siNA Treatment
(562) To determine siNA activity, HbsAg levels were measured following transfection with siNA. Immulon 4 (Dynax) microtiter wells were coated overnight at 4 C. with anti-HBsAg Mab (Biostride B88-95-31ad,ay) at 1 gg/ml in Carbonate Buffer (Na2CO3 15 mM, NaHCO.sub.335 mM, pH 9.5). The wells were then washed 4 with PBST (PBS, 0.05% Tween 20) and blocked for 1 hr at 37 C. with PBST, 1% BSA. Following washing as above, the wells were dried at 37 C. for 30 min. Biotinylated goat ant-HBsAg (Accurate YVS1807) was diluted 1:1000 in PBST and incubated in the wells for 1 hr. at 37 C. The wells were washed 4 with PBST. Streptavidin/Alkaline Phosphatase Conjugate (Pierce 21324) was diluted to 250 ng/ml in PBST, and incubated in the wells for 1 hr. at 37 C. After washing as above, p-nitrophenyl phosphate substrate (Pierce 37620) was added to the wells, which were then incubated for 1 hour at 37 C. The optical density at 405 nm was then determined. Results of the HBV screen study are summarized in
(563) Comparison of Different Chemically Stabilized siNA Motifs Targeting HBV RNA Site 1580
(564) Two different siNA stabilization chemistries were compared in a dose response HBsAg assay using inverted matched chemistry controls. The Stab7/8 (Table IV) constructs comprise a sense strand having 2-deoxy-2-fluoro pyrimidine nucleotides and 2-deoxy purine nucleotides with 5 and 3 terminal inverted deoxyabasic residues and an antisense strand having 2-deoxy-2-fluoro pyrimidine nucleotides and 2-O-methyl purine nucleotides with a terminal 3 phosphorothioate linkage. The Stab7/11 (Table IV) constructs comprise a sense strand having 2-deoxy-2-fluoro pyrimidine nucleotides and 2-deoxy purine nucleotides with 5 and 3 terminal inverted deoxyabasic residues and an antisense strand having 2-deoxy-2-fluoro pyrimidine nucleotides and 2-deoxy purine nucleotides with a terminal 3 phosphorothioate linkage (see for example Table I). As shown in
(565) Time Course Evaluation of Different Chemically Stabilized siNA Motifs Targeting HBV RNA Site 1580
(566) Four different siNA constructs having different stabilization chemistries were compared to an unstabilized siRNA construct in a dose response time course HBsAg assay, the results of which are shown in
(567) A second study was performed using the stab 4/5 (Sirna 30355/30366), stab 7/8 (Sirna 30612/30620), and stab 7/11 (Sirna 30612/31175) siNA constructs described above to examine the duration of effect of the modified siNA constructs out to 21 days post transfection compared to an all RNA control siNA (Sirna 30287/30298). A single transfection was performed with siRNAs targeted to HBV site 1580 and the culture media was subsequently replaced every three days. Secreted HBsAg levels were monitored for at 3, 6, 9, 12, 15, 18 and 21 days post-transfection.
Example 14: Inhibition of HCV Using siNA Molecules of the Invention
(568) siNA Inhibition of a Chimeric HCV/Poliovirus in HeLa Cells
(569) Inhibition of a chimeric HCV/Poliovirus was investigated using 21 nucleotide siNA duplexes in HeLa cells. Seven siNA constructs were designed that target three regions in the highly conserved 5 untranslated region (UTR) of HCV RNA. The siNAs were screened in two cell culture systems dependent upon the 5-UTR of HCV; one requires translation of an HCV/luciferase gene, while the other involves replication of a chimeric HCV/poliovirus (PV) (see Blatt et al., U.S. Ser. No. 09/740,332, filed Dec. 18, 2000, incorporated by reference herein). Two siNAs (29579/29586; 29578/29585) targeting the same region (shifted by one nucleotide) are active in both systems (see
(570) siNA Inhibition of a HCV RNA Expression in a HCV Replicon System
(571) In addition, a HCV replicon system was used to test the efficacy of siNAs targeting HCV RNA. The reagents are tested in cell culture using Huh7 cells (see for example Randall et al., 2003, PNAS USA, 100, 235-240) to determine the extent of RNA and protein inhibition. siNA were selected against the HCV target as described herein. RNA inhibition was measured after delivery of these reagents by a suitable transfection agent to Huh7 cells. Relative amounts of target RNA are measured versus actin using real-time PCR monitoring of amplification (eg., ABI 7700 Taqman). A comparison is made to a mixture of oligonucleotide sequences designed to target unrelated targets or to a randomized siNA control with the same overall length and chemistry, but with randomly substituted nucleotides at each position. Primary and secondary lead reagents were chosen for the target and optimization performed. After an optimal transfection agent concentration is chosen, a RNA time-course of inhibition is performed with the lead siNA molecule. In addition, a cell-plating format can be used to determine RNA inhibition. A non-limiting example of a multiple target screen to assay siNA mediated inhibition of HCV RNA is shown in
Example 15: Target Discovery in Mammalian Cells Using siNA Molecules
(572) In a non-limiting example, compositions and methods of the invention are used to discover genes involved in a process of interest within mammalian cells, such as cell growth, proliferation, apoptosis, morphology, angiogenesis, differentiation, migration, viral multiplication, drug resistance, signal transduction, cell cycle regulation, or temperature sensitivity or other process. First, a randomized siNA library is generated.
(573) These constructs are inserted into a vector capable of expressing a siNA from the library inside mammalian cells. Alternately, a pool of synthetic siNA molecules is generated.
(574) Reporter System
(575) In order to discover genes playing a role in the expression of certain proteins, such as proteins involved in a cellular process described herein, a readily assayable reporter system is constructed in which a reporter molecule is co-expressed when a particular protein of interest is expressed. The reporter system consists of a plasmid construct bearing a gene coding for a reporter gene, such as Green Fluorescent Protein (GFP) or other reporter proteins known and readily available in the art. The promoter region of the GFP gene is replaced by a portion of a promoter for the protein of interest sufficient to direct efficient transcription of the GFP gene. The plasmid can also contain a drug resistance gene, such as neomycin resistance, in order to select cells containing the plasmid.
(576) Host Cell Lines for Target Discovery
(577) A cell line is selected as host for target discovery. The cell line is preferably known to express the protein of interest, such that upstream genes controlling the expression of the protein can be identified when modulated by a siNA construct expressed therein. The cells preferably retain protein expression characteristics in culture. The reporter plasmid is transfected into cells, for example, using a cationic lipid formulation. Following transfection, the cells are subjected to limiting dilution cloning, for example, under selection by 600 g/mL Geneticin. Cells retaining the plasmid survive the Geneticin treatment and form colonies derived from single surviving cells. The resulting clonal cell lines are screened by flow cytometry for the capacity to upregulate GFP production.
(578) Treating the cells with, for example, sterilized M9 bacterial medium in which Pseudomonas aeruginosa had been cultured (Pseudomonas conditioned medium, PCM) is used to induce the promoter. The PCM is supplemented with phorbol myristate acetate (PMA). A clonal cell line highly responsive to promoter induction is selected as the reporter line for subsequent studies.
(579) siNA Library Construction
(580) A siNA library was constructed with oligonucleotides containing hairpin siNA constructs having randomized antisense regions and self complementary sense regions. The library is generated synthesizing siNA constructs having randomized sequence. Alternately, the siNA libraries are constructed as described in Usman et al., U.S. Ser. No. 60/402,996 (incorporated by reference herein) Oligo sequence 5 and 3 of the siNA contains restriction endonuclease cleavage sites for cloning. The 3 trailing sequence forms a stem-loop for priming DNA polymerase extension to form a hairpin structure. The hairpin DNA construct is melted at 90 C. allowing DNA polymerase to generate a dsDNA construct. The double-stranded siNA library is cloned into, for example, a U6+27 transcription unit located in the 5 LTR region of a retroviral vector containing the human nerve growth factor receptor (hNGFr) reporter gene. Positioning the U6+27/siNA transcription unit in the 5 LTR results in a duplication of the transcription unit when the vector integrates into the host cell genome. As a result, the siNA is transcribed by RNA polymerase III from U6+27 and by RNA polymerase II activity directed by the 5 LTR. The siNA library is packaged into retroviral particles that are used to infect and transduce clonal cells selected above. Assays of the hNGFr reporter are used to indicate the percentage of cells that incorporated the siNA construct. By randomized region is meant a region of completely random sequence and/or partially random sequence. By completely random sequence is meant a sequence wherein theoretically there is equal representation of A, T, G and C nucleotides or modified derivatives thereof, at each position in the sequence. By partially random sequence is meant a sequence wherein there is an unequal representation of A, T, G and C nucleotides or modified derivatives thereof, at each position in the sequence. A partially random sequence can therefore have one or more positions of complete randomness and one or more positions with defined nucleotides.
(581) Enriching for Non-Responders to Induction
(582) Sorting of siNA library-containing cells is performed to enrich for cells that produce less reporter GFP after treatment with the promoter inducers PCM and PMA. Lower GFP production cancan be due to RNAi activity against genes involved in the activation of the mucin promoter. Alternatively, siNA can directly target the mucin/GFP transcript resulting in reduced GFP expression.
(583) Cells are seeded at a certain density, such as 110.sup.6 per 150 cm.sup.2 style cell culture flasks and grown in the appropriate cell culture medium with fetal bovine serum. After 72 hours, the cell culture medium is replaced with serum-free medium. After 24 hours of serum deprivation, the cells are treated with serum-containing medium supplemented with PCM (to 40%) and PMA (to 50 nM) to induced GFP production. After 20 to 22 hours, cells are monitored for GFP level on, for example, a FACStar Plus cell sorter. Sorting is performed if 90% of siNA library cells from an unsorted control sample were induced to produce GFP above background levels. Two cell fractions are collected in each round of sorting. Following the appropriate round of sorting, the M1 fraction is selected to generate a database of siNA molecules present in the sorted cells.
(584) Recovery of siNA Sequence from Sorted Cells
(585) Genomic DNA is obtained from sorted siNA library cells by standard methods. Nested polymerase chain reaction (PCR) primers that hybridized to the retroviral vector 5 and 3 of the siNA are used to recover and amplify the siNA sequences from the particular clone of library cell DNA. The PCR product is ligated into a bacterial cloning vector. The recovered siNA library in plasmid form can be used to generate a database of siNA sequences. For example, the library is cloned into E. coli. DNA is prepared by plasmid isolation from bacterial colonies or by direct colony PCR and siNA sequence is determined. A second method can use the siNA library to transfect cloned cells. Clonal lines of stably transfected cells are established and induced with, for example, PCM and PMA. Those lines which fail to respond to GFP induction are probed by PCR for single siNA integration events. The unique siNA sequences obtained by both methods are added to a Target Sequence Tag (TST) database.
(586) Bioinformatics
(587) The antisense region sequences of the isolated siNA constructs are compared to public and private gene data banks. Gene matches are compiled according to perfect and imperfect matches. Potential gene targets are categorized by the number of different siNA sequences matching each gene. Genes with more than one perfect siNA match are selected for Target Validation studies.
(588) Validation of the Target Gene
(589) To validate a target as a regulator of protein expression, siNA reagents are designed to the target gene cDNA sequence from Genbank. The siNA reagents are complexed with a cationic lipid formulation prior to administration to cloned cells at appropriate concentrations (e.g. 5-50 nM or less). Cells are treated with siNA reagents, for example from 72 to 96 hours. Before the termination of siNA treatment, PCM (to 40%) and PMA (to 50 nM), for example, are added to induce the promoter. After twenty hours of induction the cells are harvested and assayed for phenotypic and molecular parameters. Reduced GFP expression in siNA treated cells (measured by flow cytometry) is taken as evidence for validation of the target gene. Knockdown of target RNA in siNA treated cells can correlate with reduced endogenous RNA and reduced GFP RNA to complete validation of the target.
Example 16: Screening siNA Constructs for Improved Pharmacokinetics
(590) In a non-limiting example, siNA constructs are screened in vivo for improved pharmacokinetic properties compared to all RNA or unmodified siNA constructs. Chemical modifications are introduced into the siNA construct based on educated design parameters (e.g. introducing 2-mofications, base modifications, backbone modifications, terminal cap modifications, or covalently attached conjugates etc). The modified construct in tested in an appropriate system (e.g human serum for nuclease resistance, shown, or an animal model for PK/delivery parameters). In parallel, the siNA construct is tested for RNAi activity, for example in a cell culture system such as a luciferase reporter assay). Lead siNA constructs are then identified which possess a particular characteristic while maintaining RNAi activity, and can be further modified and assayed once again. This same approach can be used to identify siNA-conjugate molecules with improved pharmacokinetic profiles, delivery, localized delivery, cellular uptake, and RNAi activity.
Example 17: Indications
(591) The siNA molecules of the invention can be used to treat a variety of diseases and conditions through modulation of gene expression. Using the methods described herein, chemically modified siNA molecules can be designed to modulate the expression any number of target genes, including but not limited to genes associated with cancer, metabolic diseases, infectious diseases such as viral, bacterial or fungal infections, neurologic diseases, musculoskeletal diseases, diseases of the immune system, diseases associated with signaling pathways and cellular messengers, and diseases associated with transport systems including molecular pumps and channels.
(592) Non-limiting examples of various viral genes that can be targeted using siNA molecules of the invention include Hepatitis C Virus (HCV, for example Genbank Accession Nos: D11168, D50483.1, L38318 and S82227), Hepatitis B Virus (HBV, for example GenBank Accession No. AF100308.1), Human Immunodeficiency Virus type 1 (HIV-1, for example GenBank Accession No. U51188), Human Immunodeficiency Virus type 2 (HIV-2, for example GenBank Accession No. X60667), West Nile Virus (WNV for example GenBank accession No. NC_001563), cytomegalovirus (CMV for example GenBank Accession No. NC_001347), respiratory syncytial virus (RSV for example GenBank Accession No. NC_001781), influenza virus (for example GenBank Accession No. AF037412, rhinovirus (for example, GenBank accession numbers: D00239, X02316, X01087, L24917, M16248, K02121, X01087), papillomavirus (for example GenBank Accession No. NC_001353), Herpes Simplex Virus (HSV for example GenBank Accession No. NC_001345), and other viruses such as HTLV (for example GenBank Accession No. AJ430458). Due to the high sequence variability of many viral genomes, selection of siNA molecules for broad therapeutic applications would likely involve the conserved regions of the viral genome. Nonlimiting examples of conserved regions of the viral genomes include but are not limited to 5-Non Coding Regions (NCR), 3-Non Coding Regions (NCR) LTR regions and/or internal ribosome entry sites (IRES). siNA molecules designed against conserved regions of various viral genomes will enable efficient inhibition of viral replication in diverse patient populations and may ensure the effectiveness of the siNA molecules against viral quasi species which evolve due to mutations in the non-conserved regions of the viral genome.
(593) Non-limiting examples of human genes that can be targeted using siNA molecules of the invention using methods described herein include any human RNA sequence, for example those commonly referred to by Genbank Accession Number. These RNA sequences can be used to design siNA molecules that inhibit gene expression and therefore abrogate diseases, conditions, or infections associated with expression of those genes. Such non-limiting examples of human genes that can be targeted using siNA molecules of the invention include VEGF (for example GenBank Accession No. NM_003376.3), VEGFr (VEGFR1 for example GenBank Accession No. XM_067723, VEGFR2 for example GenBank Accession No. AF063658), HER1, HER2, HER3, and HER4 (for example Genbank Accession Nos: NM_005228, NM_004448, NM_001982, and NM_005235 respectively), telomerase (TERT, for example GenBank Accession No. NM_003219), telomerase RNA (for example GenBank Accession No. U86046), NFkappaB, Rel-A (for example GenBank Accession No. NM_005228), NOGO (for example GenBank Accession No. AB020693), NOGOr (for example GenBank Accession No. XM_015620), RAS (for example GenBank Accession No. NM_004283), RAF (for example GenBank Accession No. XM_033884), CD20 (for example GenBank Accession No. X07203), METAP2 (for example GenBank Accession No. NM_003219), CLCA1 (for example GenBank Accession No. NM_001285), phospholamban (for example GenBank Accession No. NM_002667), PTP1B (for example GenBank Accession No. M31724), PCNA (for example GenBank Accession No. NM_002592.1), PKC-alpha (for example GenBank Accession No. NM_002737) and others. The genes described herein are provided as non-limiting examples of genes that can be targeted using siNA molecules of the invention. Additional examples of such genes are described by accession number in Beigelman et al., U.S. Ser. No. 60/363,124, filed Mar. 11, 2002 and incorporated by reference herein in its entirety.
(594) The siNA molecule of the invention can also be used in a variety of agricultural applications involving modulation of endogenous or exogenous gene expression in plants using siNA, including use as insecticidal, antiviral and anti-fungal agents or modulate plant traits such as oil and starch profiles and stress resistance.
Example 18: Diagnostic Uses
(595) The siNA molecules of the invention can be used in a variety of diagnostic applications, such as in the identification of molecular targets (e.g., RNA) in a variety of applications, for example, in clinical, industrial, environmental, agricultural and/or research settings. Such diagnostic use of siNA molecules involves utilizing reconstituted RNAi systems, for example, using cellular lysates or partially purified cellular lysates. siNA molecules of this invention can be used as diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of endogenous or exogenous, for example viral, RNA in a cell. The close relationship between siNA activity and the structure of the target RNA allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA. By using multiple siNA molecules described in this invention, one can map nucleotide changes, which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with siNA molecules can be used to inhibit gene expression and define the role of specified gene products in the progression of disease or infection. In this manner, other genetic targets can be defined as important mediators of the disease. These experiments will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes, siNA molecules coupled with known small molecule inhibitors, or intermittent treatment with combinations siNA molecules and/or other chemical or biological molecules). Other in vitro uses of siNA molecules of this invention are well known in the art, and include detection of the presence of mRNAs associated with a disease, infection, or related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a siNA using standard methodologies, for example, fluorescence resonance emission transfer (FRET).
(596) In a specific example, siNA molecules that cleave only wild-type or mutant forms of the target RNA are used for the assay. The first siNA molecules (i.e., those that cleave only wild-type forms of target RNA) are used to identify wild-type RNA present in the sample and the second siNA molecules (i.e., those that cleave only mutant forms of target RNA) are used to identify mutant RNA in the sample. As reaction controls, synthetic substrates of both wild-type and mutant RNA are cleaved by both siNA molecules to demonstrate the relative siNA efficiencies in the reactions and the absence of cleavage of the non-targeted RNA species. The cleavage products from the synthetic substrates also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population. Thus, each analysis requires two siNA molecules, two substrates and one unknown sample, which is combined into six reactions. The presence of cleavage products is determined using an RNase protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired phenotypic changes in target cells. The expression of mRNA whose protein product is implicated in the development of the phenotype (i.e., disease related or infection related) is adequate to establish risk. If probes of comparable specific activity are used for both transcripts, then a qualitative comparison of RNA levels is adequate and decreases the cost of the initial diagnosis. Higher mutant form to wild-type ratios are correlated with higher risk whether RNA levels are compared qualitatively or quantitatively.
Example 19: Synthesis of siNA Conjugates
(597) The introduction of conjugate moieties to siNA molecules of the invention is accomplished either during solid phase synthesis using phosphoramidite chemistry described above, or post-synthetically using, for example, N-hydroxysuccinimide (NHS) ester coupling to an amino linker present in the siNA. Typically, a conjugate introduced during solid phase synthesis will be added to the 5-end of a nucleic acid sequence as the final coupling reaction in the synthesis cycle using the phosphoramidite approach. Coupling conditions can be optimized for high yield coupling, for example by modification of coupling times and reagent concentrations to effectuate efficient coupling. As such, the 5-end of the sense strand of a siNA molecule is readily conjugated with a conjugate moiety having a reactive phosphorus group available for coupling (e.g., a compound having Formulae 1, 5, 8, 55, 56, 57, 60, 86, 92, 104, 110, 113, 115, 116, 117, 118, 120, or 122) using the phosphoramidite approach, providing a 5-terminal conjugate (see for example
(598) Conjugate precursors having a reactive phosphorus group and a protected hydroxyl group can be used to incorporate a conjugate moiety anywhere in the siNA sequence, such as in the loop portion of a single stranded hairpin siNA construct (see for example
(599) Conjugate derivatives can also be introduced to a siNA molecule post synthetically. Post synthetic conjugation allows a conjugate moiety to be introduced at any position within the siNA molecule where an appropriate functional group is present (e.g., a C5 alkylamine linker present on a nucleotide base or a 2-alkylamine linker present on a nucleotide sugar can provide a point of attachment for an NHS-conjugate moiety). Generally, a reactive chemical group present in the siNA molecule is unmasked following synthesis, thus allowing post-synthetic coupling of the conjugate to occur. In a non-limiting example, an protected amino linker containing nucleotide (e.g., TFA protected C5 propylamino thymidine) is introduced at a desired position of the siNA during solid phase synthesis. Following cleavage and deprotection of the siNA, the free amine is made available for NHS ester coupling of the conjugate at the desired position within the siNA sequence, such as at the 3-end of the sense and/or antisense strands, the 3 and/or 5-end of the sense strand, or within the siNA sequence, such as in the loop portion of a single stranded hairpin siNA sequence.
(600) A conjugate moiety can be introduced at different locations within a siNA molecule using both solid phase synthesis and post-synthetic coupling approaches. For example, solid phase synthesis can be used to introduce a conjugate moiety at the 5-end of the siNA (e.g. sense strand) and post-synthetic coupling can be used to introduce a conjugate moiety at the 3-end of the siNA (e.g. sense strand and/or antisense strand). As such, a siNA sense strand having 3 and 5 end conjugates can be synthesized (see for example
Example 20: Pharmacokinetics of siNA Conjugates (FIG. 67)
(601) Three nuclease resistant siNA molecule targeting site 1580 of hepatitis B virus (HBV) RNA were designed using Stab 7/8 chemistry (see Table IV) and a 5-terminal conjugate moiety.
(602) One siNA conjugate comprises a branched cholesterol conjugate linked to the sense strand of the siNA. The cholesterol siNA conjugate molecule has the structure shown below:
(603) ##STR00097##
(604) where T stands for thymidine, B stands for inverted deoxyabasic, G stands for 2-deoxy guanosine, A stands for 2-deoxy adenosine, G stands for 2-O-methyl guanosine, A stands for 2-O-methyl adenosine, u stands for 2-fluoro uridine, c stands for 2-fluoro cytidine, a stands for adenosine, and s stands for phosphorothioate linkage.
(605) Another siNA conjugate comprises a branched phospholipid conjugate linked to the sense strand of the siNA. The phospholipid siNA conjugate molecule has the structure shown below:
(606) ##STR00098##
(607) where T stands for thymidine, B stands for inverted deoxyabasic, G stands for 2-deoxy guanosine, A stands for 2-deoxy adenosine, G stands for 2-O-methyl guanosine, A stands for 2-O-methyl adenosine, u stands for 2-fluoro uridine, c stands for 2-fluoro cytidine, a stands for adenosine, and s stands for phosphorothioate linkage.
(608) Another siNA conjugate comprises a polyethylene glycol (PEG) conjugate linked to the sense strand of the siNA. The PEG siNA conjugate molecule has the structure shown below:
(609) ##STR00099##
(610) where T stands for thymidine, B stands for inverted deoxyabasic, G stands for 2-deoxy guanosine, A stands for 2-deoxy adenosine, G stands for 2-O-methyl guanosine, A stands for 2-O-methyl adenosine, u stands for 2-fluoro uridine, c stands for 2-fluoro cytidine, a stands for adenosine, and s stands for phosphorothioate linkage.
(611) The Cholesterol, Phospholipid, and PEG conjugates were evaluated for pharmakokinetic properties in mice compared to a non-conjugated siNA construct having matched chemistry and sequence. This study was conducted in female CD-1 mice approximately 26 g (6-7 weeks of age). Animals were housed in groups of 3. Food and water were provided ad libitum. Temperature and humidity were according to Pharmacology Testing Facility performance standards (SOP's) which are in accordance with the 1996 Guide for the Care and Use of Laboratory Animals (NRC). Animals were acclimated to the facility for at least 3 days prior to experimentation.
(612) Absorbance at 260 nm was used to determine the actual concentration of the stock solution of pre-annealed HBV siNA. An appropriate amount of HBV siNA was diluted in sterile veterinary grade normal saline (0.9%) based on the average body weight of the mice. A small amount of the antisense (Stab 7) strand was internally labeled with gamma 32P-ATP. The 32P-labeled stock was combined with excess sense strand (Stab 8) and annealed. Annealing was confirmed prior to combination with unlabled drug. Each mouse received a subcutaneous bolus of 30 mg/kg (based on duplex) and approximately 10 million cpm (specific activity of approximately 15 cpm/ng).
(613) Three animals per timepoint (1, 4, 8, 24, 72, 96 h) were euthanized by CO2 inhalation followed immediately by exsanguination. Blood was sampled from the heart and collected in heparinized tubes. After exsanguination, animals were perfused with 10-15 mL of sterile veterinary grade saline via the heart. Samples of liver were then collected and frozen.
(614) Tissue samples were homogenized in a digestion buffer prior to compound quantitation. Quantitation of intact compound was determined by scintillation counting followed by PAGE and phosphorimage analysis. Results are shown in
Example 21: Cell Culture of siNA Conjugates (FIG. 68)
(615) The Cholesterol conjugates and Phospholipid conjugated siNA constructs described in Example 20 above were evaluated for cell culture efficacy in a HBV cell culture system.
(616) Transfection of HepG2 Cells with psHBV-1 and siNA
(617) The human hepatocellular carcinoma cell line Hep G2 was grown in Dulbecco's modified Eagle media supplemented with 10% fetal calf serum, 2 mM glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 25 mM Hepes, 100 units penicillin, and 100 g/ml streptomycin. To generate a replication competent cDNA, prior to transfection the HBV genomic sequences are excised from the bacterial plasmid sequence contained in the psHBV-1 vector. Other methods known in the art can be used to generate a replication competent cDNA. This was done with an EcoRI and Hind III restriction digest. Following completion of the digest, a ligation was performed under dilute conditions (20 gg/ml) to favor intermolecular ligation. The total ligation mixture was then concentrated using Qiagen spin columns.
(618) siNA Activity Screen and Dose Response Assay
(619) Transfection of the human hepatocellular carcinoma cell line, Hep G2, with replication-competent HBV DNA results in the expression of HBV proteins and the production of virions. To test the efficacy of siNA conjugates targeted against HBV RNA, the Cholesterol siNA conjugate and Phospholipid siNA conjugate described in Example 12 were compared to a non-conjugated control siNA (see
Example 22: Ex Vivo Stability of siNA Constructs
(620) Chemically modified siNA constructs were designed and synthesized in order to improve resistance to nucleases while maintaining silencing in cell culture systems. Modified strands, designated Stab 4, Stab 5, Stab 7, Stab 8, and Stab 11 (Table IV), were tested in three sets of duplexes that demonstrated a range of stability and activity. These duplexes contained differentially modified sense and antisense strands. All modified sense strands contain terminal 5 and 3 inverted abasic caps, while antisense strands possess a 3 terminal phosphorothioate linkage. The results characterize the impact of chemical modifications on nuclease resistance in ex vivo models of the environments sampled by drugs.
(621) Active siNAs were assessed for their resistance to degradation in serum and liver extracts. Stability in blood will be a requirement for a systemically administered siNA, and an anti-HBV or anti-HCV siNA would require stability and activity in the hepatic intracellular environment. Liver extracts potentially provide an extreme nuclease model where many catabolic enzymes are present. Both mouse and human systems were assessed.
(622) Individual strands of siNA duplexes were internally labeled with 32P and incubated as single strands or as duplex siRNAs in human or mouse serum and liver extracts. Representative data is shown in Table VI. Throughout the course of the experiments, constant levels of ribonuclease activity were verified. The extent and pattern of all-RNA siNA degradation (3 minute time point) did not change following preincubation of serum or liver extract at 37 C. for up to 24 hours.
(623) The biological activity of siRNAs containing all-ribose residues has been well established. The extreme instability (t1/2=0.017 hours) of these compounds in serum underscores the need for chemical modification for use in systemic therapeutic applications. The Stab 4/5 duplex modifications provide significant stability in human and mouse serum (t1/2's=10-408 hours) and human liver extract (t1/2's=28-43 hours).
(624) In human serum the Stab 4 strand chemistry in the context of the Stab 4/5 duplex, possesses greater stability than the Stab 5 strand chemistry (t1/2=408 vs. 39 hours). This result highlights the impact terminal modifications have on stability. A fully-modified Stab 7/11 construct (no ribonucleotides present) was generated from the Stab 4/5 constructs by substituting the ribonucleotides in all purine positions with deoxyribonucleotides. Another fully modified construct, Stab 7/8, was generated by replacing all purine positions in the antisense strand with 2-O-methyl nucleotides. This proved to be the most stable antisense strand chemistry observed, with t1/2=816 hours in human liver extract.
(625) The dramatic stability of Stab 8 modifications was also observed when non-duplexed single strands were incubated in human serum and liver extract, as shown in Table VII. An approximate five-fold increase in serum stability is seen for the double stranded constructs, compared to that observed for the individual strands. In liver extract, the siNA duplex provides even greater stability compared to the single strands. For example, the Stab 5 chemistry is greater than 100-fold more stable in the Stab 4/5 duplex relative to its stability alone.
(626) Terminal modifications have a large impact on stability in human serum, as can be seen from a comparison of sense verses antisense stabilities in duplex form, and the Stab 4 and Stab 5 single-strand stabilities. Therefore, a number of 3 antisense capping moieties on Stab 4/5 chemistry duplexes were assessed for their contribution to stability in human serum. The structures of these modifications are shown in
(627) These results suggest that susceptibility to 3 exonucleases is a major path to degradation in the serum.
Example 23: Activity of siNA Molecules Delivered Via Hydrodynamic Injection
(628) An in vivo mouse model that utilizes hydrodynamic tail vein injection of a replication competent HBV vector has been used to assess the activity of chemically stabilized siRNA targeted to HBV RNA. The hydrodynamic delivery of nucleic acids in the mouse has been described by Liu et al., 1999, Gene Therapy, 6, 1258-1266, who showed that the vast majority of the nucleic acid is delivered to the liver by this technique. The use of the hydrodynamic technology to develop an HBV mouse model has been described by Yang et al., 2002, PNAS, 99, 13825-13830. In the vector-based model, HBV replicates in the liver for approximately 10 days, resulting in detectable levels of HBV RNA and antigens in the liver and HBV DNA and antigens in the serum.
(629) To assess the activity of chemically stabilized siNAs against HBV, co-injection of the siNAs along with the HBV vector was done in mouse strain C57BL/J6. The HBV vector used, pWTD, is a head-to-tail dimer of the complete HBV genome (see for example Buckwold et al., 1996, J. Virology, 70, 5845-5851). For a 20 gram mouse, a total injection of 1.6 ml containing 10 g or 1 g of pWTD and 100 g of siNA duplex in saline, was injected into the tail vein within 5 seconds. For a larger mouse, the volume is scaled to maintain a level of 140% of the blood volume of the mouse. The injection is done using a 3 cc syringe and 27 g needle. The animals were sacrificed at 72 hrs post-injection. Animals were treated with siNA constructs and matched chemistry inverted controls. Analysis of the HBV DNA (
Example 24: Activity Screens Using Chemically Modified siNA
(630) Two formats can be used to identify active chemically modified siNA molecules against target nucleic acid molecules (e.g., RNA). One format involves screening unmodified siNA constructs in an appropriate system (e.g., cell culture or animal models) then applying chemical modifications to the sequence of identified leads and rescreening the modified constructs. Another format involves direct screening of chemically modified constructs to identify chemically modified leads (see for example the Stab 7/8 HCV screen shown in
(631) Activity Screen of Stab 7/8 Constructs Targeting Luciferase RNA
(632) HeLa cells were co-transfected with pGF3 vector (250 ng/well), renilla luciferase vector (10 ng/well) and siNA (0.5-25 nM) using 0.5 ul lipofectamine2000 per well. Twenty-four hours post-transfection, the cells were assayed for luciferase activity using the Promega Dual Luciferase Assay Kit per the manufacturer's instruction. siNA constructs having high levels of activity were identified and tested in a dose response assay with concentrations ranging from 0.5 to 25 nM. Results for siNA constructs targeting sites 80, 237, and 1478 are shown in
(633) Activity Screen of Combination siNA Constructs Targeting HBV RNA in HepG2 Cells
(634) The HBV HepG2 cell culture system described in Example 13 above was utilized to evaluate the efficacy of various combinations of chemical modifications (Table V) in the sense strand and antisense strand of siNA molecules as compared to matched chemistry inverted controls. To determine siNA activity, HbsAg levels were measured following transfection with siNA. Immulon 4 (Dynax) microtiter wells were coated overnight at 4 C. with anti-HBsAg Mab (Biostride B88-95-31ad,ay) at 1 gg/ml in Carbonate Buffer (Na2CO3 15 mM, NaHCO.sub.335 mM, pH 9.5). The wells were then washed 4 with PBST (PBS, 0.05% Tween 20) and blocked for 1 hr at 37 C. with PBST, 1% BSA. Following washing as above, the wells were dried at 37 C. for 30 min. Biotinylated goat ant-HBsAg (Accurate YVS1807) was diluted 1:1000 in PBST and incubated in the wells for 1 hr. at 37 C. The wells were washed 4 with PBST. Streptavidin/Alkaline Phosphatase Conjugate (Pierce 21324) was diluted to 250 ng/ml in PBST, and incubated in the wells for 1 hr. at 37 C. After washing as above, p-nitrophenyl phosphate substrate (Pierce 37620) was added to the wells, which were then incubated for 1 hour at 37 C. The optical density at 450 nm was then determined. Results of the combination HBV siNA screen are shown in
(635) All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.
(636) One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The methods and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.
(637) It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. Thus, such additional embodiments are within the scope of the present invention and the following claims. The present invention teaches one skilled in the art to test various combinations and/or substitutions of chemical modifications described herein toward generating nucleic acid constructs with improved activity for mediating RNAi activity. Such improved activity can comprise improved stability, improved bioavailability, and/or improved activation of cellular responses mediating RNAi. Therefore, the specific embodiments described herein are not limiting and one skilled in the art can readily appreciate that specific combinations of the modifications described herein can be tested without undue experimentation toward identifying siNA molecules with improved RNAi activity.
(638) The invention illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. Thus, for example, in each instance herein any of the terms comprising, consisting essentially of, and consisting of may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the description and the appended claims.
(639) In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.
(640) TABLE-US-00001 TABLEI Sirna/ SEQ RPI# Aliases Sequence ID# 28443 Sirna/RPIGL2Str1(sense) cGuAcGcGGAAuAcuucGATT 349 2-aminoUC 28444 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGTT 350 2-aminoUC 28445 Sirna/RPIGL2Str1(sense) cGuAcGcGGAAuAcuucGAuT 351 2-aminoUCuT3end 28446 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGuT 352 2-aminoUCuT3end 30051 HCV-Luc:325U21siNA55 P= BC.sub.sC.sub.sC.sub.sC.sub.sG.sub.sGGAGGUCUCGUAGAXXB 353 S+ 3 univ.base2+ 5/3 invAba(antisense) 30052 HCV-Luc:325U21siNArev55 BA.sub.sG.sub.sA.sub.sU.sub.sG.sub.sCUCUGGAGGGCCCCXXB 354 P= S+ 3 univ.base2+ 5/3 invAba(antisense) 30053 HCV-Luc:345L21siNA(325C) U.sub.sC.sub.sU.sub.sA.sub.sC.sub.sGAGACCUCCCGGGGXXB 355 (antisense)55 P= S+ 3 univ. base2+ 3 invAba(sense) 30054 HCV-Luc:345L21siNA(325C) G.sub.sG.sub.sG.sub.sG.sub.sC.sub.sCCUCCAGAGCAUCUXXB 356 (antisense)rev55 P= S+ 3 univ.base2+ 3 invAba(sense) 30055 HCV-Luc:325U21siNAallYP= BC.sub.sC.sub.sC.sub.sC.sub.sGGGAGGU.sub.sC.sub.sU.sub.sC.sub.sGU.sub.sAGAXXB 357 S+ 3 univ.base2+ 5/3 invAba(antisense) 30056 HCV-Luc:325U21siNArevall BAGAU.sub.sGC.sub.sU.sub.sC.sub.sU.sub.sGGAGGGC.sub.sC.sub.sC.sub.sC.sub.sXXB 358 YP= S+ 3 univ.base2+ 5/3 invAba(antisense) 30057 HCV-Luc:345L21siNA(325C) U.sub.sC.sub.sU.sub.sAC.sub.sGAGAC.sub.sC.sub.sU.sub.sC.sub.sC.sub.sC.sub.sGGGGXXB 359 (antisense)allYP= S+ 3 univ.base2+ 3 invAba (sense) 30058 HCV-Luc:345L21siNA(325C) GGGGC.sub.sC.sub.sC.sub.sU.sub.sC.sub.sC.sub.sAGAGC.sub.sAU.sub.sC.sub.sU.sub.sXXB 360 (antisense)revallYP= S+ 3 univ.base2+ 3 invAba (sense) 30059 HCV-Luc:325U21siNA4/3P= S Bc.sub.sc.sub.sc.sub.sc.sub.sGGGAGGucucGuA.sub.sG.sub.sA.sub.sXXB 361 ends+ allY-2F+ 3 univ.base 2+ 5/3 invAba(antisense) 30060 HCV-Luc:325U21siNArev4/3P= S BA.sub.sG.sub.sA.sub.su.sub.sGcucuGGAGGGcc.sub.sc.sub.sc.sub.sXXB 362 ends+ allY-2F+ 3 univ.base 2+ 5/3 invAba(antisense) 30170 HCV-Luc:325U21siNAallY-2F+ BccccGGGAGGucucGuAGAXXB 363 3 univ.base2+ 5/3 invAba (antisense) 30171 HCV-Luc:325U21siNArevall BAGAuGcucuGGAGGGccccXXB 364 Y-2F+ 3 univ.base2+ 5/3 invAba(antisense) 30172 HCV-Luc:345L21siNA(325C) BU.sub.sC.sub.sU.sub.sAC.sub.sGAGAC.sub.sC.sub.sU.sub.sC.sub.sC.sub.sC.sub.sGGGGXXB 365 (antisense)allYP= S+ 3 univ.base2+ 5/3 invAba (antisense) 30173 HCV-Luc:345L21siNA(325C) ucuAcGAGAccucccGGGG 366 (antisense)allY-2F 30174 HCV-Luc:345L21siNA(325C) GGGGcccuccAGAGcAucu 367 (antisense)revallY-2F 30175 HCV-Luc:345L21siNA(325C) ucuAcGAGAccucccGGGGXX 368 (antisense)allY-2F+ 3 univ.base2 30176 HCV-Luc:345L21siNA(325C) GGGGcccuccAGAGcAucuXX 369 (antisense)revallY-2F+ 3 univ.base2 30177 HCV-Luc:345L21siNA(325C) BucuAcGAGAccucccGGGGXXB 370 (antisense)allY-2F+ 3 univ. base2+ 5/3 iB 30178 HCV-Luc:325U21siNAallYP= C.sub.sC.sub.sC.sub.sC.sub.sGGGAGGU.sub.sC.sub.sU.sub.sC.sub.sGU.sub.sAGAXXB 371 S+ 3 univ.base2+ 3 invAba (sense) 30063 Sirna/RPIGL2Str1(sense) BcGuAcGcGGAAuAcuucGATTB 372 2-FU,C+ 3,5 abasic 30222 Sirna/RPIGL2Str1(sense)Y BcGuAcGcGGAAuAcuucGATTB 373 2-O-Mewith3-TT&5/3 iB 30224 Sirna/RPIGL2Str2(antisense)Y ucGAAGuAuuccGcGuAcGT.sub.sT 374 2-F&3 TsT 30430 Sirna/RPIGL2Str2(antisense) ucgaaguauuccgcguacgT.sub.sT 375 2-FU,C+ 5,3 abasic,A, G= 2-O-Me 30431 Sirna/RPIGL2Str1(sense) BcguacgcggaauacuucgaTTB 376 2-FU,C+ 3,5 abasic,TT; 2-O-Me-A,G 30433 Sirna/RPIGL2Str1(sense) BcGuAcGcGGAAuAcuucGATTB 377 2-FU,C+ 3,5 abasic,TT; 2-deoxy-A,G 30550 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGT.sub.st 378 2-FU,C3-dTsT 30555 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGTL 379 2-FU,C3-glycerol.T 30556 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGTTL 380 2-FU,C3-glycerol,2T 30226 revSirna/RPIGL2Str1(sense) BAGcuucAuAAGGcGcAuGcTTB 381 Y2-O-Mewith3-TT&5/3 iB 30227 revSirna/RPIGL2Str1(sense) BAGcuucAuAAGGcGcAuGcTTB 382 Y2-Fwith3-TT&5/3 iB 30229 revSirna/RPIGL2Str2 GcAuGcGccuuAuGAAGcuT.sub.sT 383 (antisense)Y2-F&3 TsT 30434 Sirna/RPIGL2Str1(sense) BcguacgcGGAAuAcuucgaTTB 384 2-FU,C+ 3,5 Abasic, TT;2-O-Me-A,G;ribocore 30435 Sirna/RPIGL2Str1(sense) BcGuAcGcGGAAuAcuucGATTB 385 2-FU,C+ 3,5 Abasic, TT;2-deoxyA,G;ribocore 30546 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcG3T 386 2-FU,C3-dTT 30551 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGTddC 387 2-FU,CdTddC 30557 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGT 388 2-FU,C3-invertedT,T 30558 Sirna/RPIGL2Str2(antisense) ucGAAGuAuuccGcGuAcGTT 389 2-FU,C3-invertedT,TT 30196 FLT1:2340U21siRNAsenseiBcaps BcAAccAcAAAAuAcAAcAATTB 419 w/2FY's 30416 FLT1:2358L21siRNA(2340C) uuGuuGuAuuuuGuGGuuGT.sub.sT 420 (antisense)TsT 29548 HBV:394L21siRNA(414C) GAUGAGGCAUAGCAGCAGGTT 421 (antisense) 29544 HBV:414U21siRNApos(sense) CCUGCUGCUAUGCCUCAUCTT 422 29556 HBV:394L21siRNAneg(414C) GGACGACGAUACGGAGUAGTT 423 (antisense)inv 29552 HBV:414U21siRNApos(sense)inv CUACUCCGUAUCGUCGUCCTT 424 30350 HBV:262U21siRNAstab04(sense) BuGGAcuucucucAAuuuucuAB 425 30361 HBV:280L21siRNA(262C) GAAAAuuGAGAGAAGuccAT.sub.sT 426 (antisense)stab05 30372 HBV:262U21siRNAinvstab04 BAucuuuuAAcucucuucAGGuB 427 (sense) 30383 HBV:280L21siRNA(262C) AccuGAAGAGAGuuAAAAGT.sub.sT 428 (antisense)invstab05 30352 HBV:380U21siRNAstab04(sense) BuGuGucuGcGGcGuuuuAucAB 429 30363 HBV:398L21siRNA(380C) AuAAAAcGccGcAGAcAcAT.sub.sT 430 (antisense)stab05 30374 HBV:380U21siRNAinvstab04 BAcuAuuuuGcGGcGucuGuGuB 431 (sense) 30385 HBV:398L21siRNA(380C) AcAcAGAcGccGcAAAAuAT.sub.sT 432 (antisense)invstab05 30353 HBV:413U21siRNAstab04(sense) BuccuGcuGcuAuGccucAucuB 433 30364 HBV:431L21siRNA(413C) AuGAGGcAuAGcAGcAGGAT.sub.sT 434 (antisense)stab05 30375 HBV:413U21siRNAinvstab04 BucuAcuccGuAucGucGuccuB 435 (sense) 30386 HBV:431L21siRNA(413C) AGGAcGAcGAuAcGGAGuAT.sub.sT 436 (antisense)invstab05 30354 HBV:462U21siRNAstab04(sense) BuAuGuuGcccGuuuGuccucuB 437 30365 HBV:480L21siRNA(462C) AGGAcAAAcGGGcAAcAuAT.sub.sT 438 (antisense)stab05 30376 HBV:462U21siRNAinvstab04 BucuccuGuuuGcccGuuGuAuB 439 (sense) 30387 HBV:480L21siRNA(462C) AuAcAAcGGGcAAAcAGGAT.sub.sT 440 (antisense)inv 30355 HBV:1580U21siRNAstab04(sense) BuGuGcAcuucGcuucAccucuB 441 30366 HBV:1598L21siRNA(1580C) AGGuGAAGcGAAGuGcAcAT.sub.sT 442 (antisense)stab05 30377 HBV:1580U21siRNAinvstab04 BucuccAcuucGcuucAcGuGuB 443 (sense) 30388 HBV:1598L21siRNA(1580C) AcAcGuGAAGcGAAGuGGAT.sub.sT 444 (antisense)invstab05 30356 HBV:1586U21siRNAstab04(sense) BcuucGcuucAccucuGcAcGuB 445 30367 HBV:1604L21siRNA(1586C) GuGcAGAGGuGAAGcGAAGT.sub.sT 446 (antisense)stab05 30378 HBV:1586U21siRNAinvstab04 BuGcAcGucuccAcuucGcuucB 447 (sense) 30389 HBV:1604L21siRNA(1586C) GAAGcGAAGuGGAGAcGuGT.sub.sT 448 (antisense)invstab05 30357 HBV:1780U21siRNAstab04(sense) BAGGcuGuAGGcAuAAAuuGGuB 449 30368 HBV:1798L21siRNA(1780C) cAAuuuAuGccuAcAGccuT.sub.sT 450 (antisense)stab05 30379 HBV:1780U21siRNAinvstab04 BuGGuuAAAuAcGGAuGucGGAB 451 (sense) 30390 HBV:1798L21siRNA(1780C) uccGAcAuccGuAuuuAAcT.sub.sT 452 (antisense)invstab05 30612 HBV:1580U21siRNAstab07(sense) BuGuGcAcuucGcuucAccuTTB 453 30620 HBV:1598L21siRNA(1580C) aggugaagcgaagugcacaT.sub.sT 454 (antisense)stab08 30628 HBV:1582U21siRNAinvstab07 BucuccAcuucGcuucAcGuTTB 455 (sense) 30636 HBV:1596L21siRNA(1578C) gcacacgugaagcgaagugT.sub.sT 456 (antisense)invstab08 30612 HBV:1580U21siRNAstab07(sense) BuGuGcAcuucGcuucAccuTTB 457 31175 HBV:1598L21siRNA(1580C)stab11 AGGuGAAGcGAAGuGcAcAT.sub.sT 458 (antisense) 30612 HBV:1580U21siRNAstab07(sense) BuGuGcAcuucGcuucAccuTTB 459 31176 HBV:1596L21siRNA(1578C) GcAcAcGuGAAGcGAAGuGT.sub.sT 460 (antisense)invstab11 (antisense) 30287 HBV:1580U21siRNA(sense) UGUGCACUUCGCUUCACCUCU 461 30298 HBV:1598L21siRNA(1580C) AGGUGAAGCGAAGUGCACACG 462 (antisense) 30355 HBV:1580U21siRNAstab04(sense) BuGuGcAcuucGcuucAccucuB 463 30366 HBV:1598L21siRNA(1580C) AGGuGAAGcGAAGuGcAcATsT 464 (antisense)stab05 30612 HBV:1580U21siRNAstab07(sense) BuGuGcAcuucGcuucAccuTTB 465 31175 HBV:1598L21siRNA(1580C)stab11 AGGuGAAGcGAAGuGcAcATsT 466 (antisense) 30612 HBV:1580U21siRNAstab07(sense) BuGuGcAcuucGcuucAccuTTB 467 30620 HBV:1598L21siRNA(1580C) AGGuGAAGcGAAGuGcAcATsT 468 (antisense)stab08 31335 HBV:1580U21siRNAstab09(sense) BUGUGCACUUCGCUUCACCUTTB 469 31337 HBV:1598L21siRNA(1580C)stab10 AGGUGAAGCGAAGUGCACATsT 470 (antisense) 31456 HCVa:291U21siRNAstab04 BcuuGuGGuAcuGccuGAuATTB 471 31468 HCVa:309L21siRNA(291C)stab05 uAucAGGcAGuAccAcAAGTsT 472 31480 HCVa:291U21siRNAinvstab04 BAuAGuccGucAuGGuGuucTTB 473 31492 HCVa:309L21siRNA(291C)inv GAAcAccAuGAcGGAcuAuTsT 474 stab05 31461 HCVa:300U21siRNAstab04 BcuGccuGAuAGGGuGcuuGTTB 475 31473 HCVa:318L21siRNA(300C)stab05 cAAGcAcccuAucAGGcAGTsT 476 31485 HCVa:300U21siRNAinvstab04 BGuucGuGGGAuAGuccGucTTB 477 31497 HCVa:318L21siRNA(300C)inv GAcGGAcuAucccAcGAAcTsT 478 stab05 31463 HCVa:303U21siRNAstab04 BccuGAuAGGGuGcuuGcGATTB 479 31475 HCVa:321L21siRNA(303C)stab05 ucGcAAGcAcccuAucAGGTsT 480 31487 HCVa:303U21siRNAinvstab04 BAGcGuucGuGGGAuAGuccTTB 481 31499 HCVa:321L21siRNA(303C)inv GGAcuAucccAcGAAcGcuTsT 482 stab05 31344 HCVa:325U21siRNAstab07 BccccGGGAGGucucGuAGATTB 483 30562 HCVa:345L21siRNA(325C)Y-2F, ucuAcGAGAccucccGGGGTsT 484 R-2OMe+ TsT 31345 HCVa:325U21siRNAinvstab07 BAGAuGcucuGGAGGGccccTTB 485 31346 HCVa:343L21siRNA(325C)inv GGGGcccuccAGAGcAucuTsT 486 stab08 31702 HCVa:326U21siRNAstab07 BcccGGGAGGucucGuAGAcTTB 487 31706 HCVa:344L21siRNA(326C)stab08 GucuAcGAGAccucccGGGTsT 488 31710 HCVa:326U21siRNAinvstab07 BcAGAuGcucuGGAGGGcccTTB 489 31714 HCVa:344L21siRNA(326C)inv GGGcccuccAGAGcAucuGTsT 490 stab08 31703 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGAccTTB 491 31707 HCVa:345L21siRNA(327C)stab08 GGucuAcGAGAccucccGGTsT 492 31711 HCVa:327U21siRNAinvstab07 BccAGAuGcucuGGAGGGccTTB 493 31715 HCVa:345L21siRNA(327C)inv GGcccuccAGAGcAucuGGTsT 494 stab08 31704 HCVa:328U21siRNAstab07 BcGGGAGGucucGuAGAccGTTB 495 31708 HCVa:346L21siRNA(328C)stab08 cGGucuAcGAGAccucccGTsT 496 31712 HCVa:328U21siRNAinvstab07 BGccAGAuGcucuGGAGGGcTTB 497 31716 HCVa:346L21siRNA(328C)inv GcccuccAGAGcAucuGGcTsT 498 stab08 31705 HCVa:329U21siRNAstab07 BGGGAGGucucGuAGAccGuTTB 499 31709 HCVa:347L21siRNA(329C)stab08 AcGGucuAcGAGAccucccTsT 500 31713 HCVa:329U21siRNAinvstab07 BuGccAGAuGcucuGGAGGGTTB 501 31717 HCVa:347L21siRNA(329C)inv cccuccAGAGcAucuGGcATsT 502 stab08 31703 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGAccTTB 503 31707 HCVa:345L21siRNA(327C)stab08 GGucuAcGAGAccucccGGTsT 504 31711 HCVa:327U21siRNAinvstab07 BccAGAuGcucuGGAGGGccTTB 505 31715 HCVa:345L21siRNA(327C)inv GGcccuccAGAGcAucuGGTsT 506 stab08 29579 HCVa:325U21siRNA CCCCGGGAGGUCUCGUAGACCGU 543 HCVa:327siRNA3-classI10bp UCUCGUAGACCUUGGUCUACGAGACCUCCCGGTT 544 HCVa:327siRNA3-classI8bp UCGUAGACCUUGGUCUACGAGACCUCCCGGTT 545 HCVa:327siRNA3-classI6bp GUAGACCUUGGUCUACGAGACCUCCCGGTT 546 HCVa:327siRNA3-classI4bp AGACCUUGGUCUACGAGACCUCCCGGTT 547 HCVa:327siRNA5-classI10bp GGUCUACGAGACCUCCCGGUUCCGGGAGGUCU 548 HCVa:327siRNA5-classI8bp GGUCUACGAGACCUCCCGGUUCCGGGAGGU 549 HCVa:327siRNA5-classI6bp GGUCUACGAGACCUCCCGGUUCCGGGAG 550 HCVa:327siRNA5-classI4bp GGUCUACGAGACCUCCCGGUUCCGGG 551 HCVa:327siRNA3-gaaa10bp CUCGUAGACCGAAAGGUCUACGAGACCUCCCGGTT 552 HCVa:327siRNA3-gaaa8bp CGUAGACCGAAAGGUCUACGAGACCUCCCGGTT 553 HCVa:327siRNA3-gaaa6bp UAGACCGAAAGGUCUACGAGACCUCCCGGTT 554 HCVa:327siRNA3-gaaa4bp GACCGAAAGGUCUACGAGACCUCCCGGTT 555 HCVa:327siRNA5-gaaa10bp GGUCUACGAGACCUCCCGGUUGAAACCGGGAGGUC 556 HCVa:327siRNA5-gaaa8bp GGUCUACGAGACCUCCCGGUUGAAACCGGGAGG 557 HCVa:327siRNA5-gaaa6bp GGUCUACGAGACCUCCCGGUUGAAACCGGGA 558 HCVa:327siRNA5-gaaa4bp GGUCUACGAGACCUCCCGGUUGAAACCGG 559 HCVa:327siRNA3-uuuguguag10bp CGUAGACCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 560 HCVa:327siRNA3-uuuguguag8bp UAGACCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 561 HCVa:327siRNA3-uuuguguag6bp GACCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 562 HCVa:327siRNA3-uuuguguag4bp CCUUUUUGUGUAGGGUCUACGAGACCUCCCGGTT 563 HCVa:327siRNA5-uuuguguag10bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGGGAGGUC 564 HCVa:327siRNA5-uuuguguag8bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGGGAGG 565 HCVa:327siRNA5-uuuguguag6bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGGGA 566 HCVa:327siRNA5-uuuguguag4bp GGUCUACGAGACCUCCCGGUUUUUGUGUAGCCGG 567 HCVa:327siRNA3-classI10bp ucucGuAGAccuuGGucuAcGAGAccucccGGTsT 568 stab08 HCVa:327siRNA3-classI8bp ucGuAGAccuuGGucuAcGAGAccucccGGTsT 569 stab08 HCVa:327siRNA3-classI6bp GuAGAccuuGGucuAcGAGAccucccGGTsT 570 stab08 HCVa:327siRNA3-classI4bp AGAccuuGGucuAcGAGAccucccGGTsT 571 stab08 HCVa:327siRNA5-classI10bp GGucuAcGAGAccucccGGuuccGGGAGGucu 572 stab08 HCVa:327siRNA5-classI8bp GGucuAcGAGAccucccGGuuccGGGAGGu 573 stab08 HCVa:327siRNA5-classI6bp GGucuAcGAGAccucccGGuuccGGGAG 574 stab08 HCVa:327siRNA5-classI4bp GGucuAcGAGAccucccGGuuccGGG 575 stab08 HCVa:327siRNA3-gaaa10bp cucGuAGAccGAAAGGucuAcGAGAccucccGGTsT 576 stab08 HCVa:327siRNA3-gaaa8bp cGuAGAccGAAAGGucuAcGAGAccucccGGTsT 577 stab08 HCVa:327siRNA3-gaaa6bp uAGAccGAAAGGucuAcGAGAccucccGGTsT 578 stab08 HCVa:327siRNA3-gaaa4bp GAccGAAAGGucuAcGAGAccucccGGTsT 579 stab08 HCVa:327siRNA5-gaaa10bp GGucuAcGAGAccucccGGuuGAAAccGGGAGGuc 580 stab08 HCVa:327siRNA5-gaaa8bp GGucuAcGAGAccucccGGuuGAAAccGGGAGG 581 stab08 HCVa:327siRNA5-gaaa6bp GGucuAcGAGAccucccGGuuGAAAccGGGA 582 stab08 HCVa:327siRNA5-gaaa4bp GGucuAcGAGAccucccGGuuGAAAccGG 583 stab08 HCVa:327siRNA3-uuuguguag10bp cGuAGAccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 584 stab08 HCVa:327siRNA3-uuuguguag8bp uAGAccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 585 stab08 HCVa:327siRNA3-uuuguguag6bp GAccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 586 stab08 HCVa:327siRNA3-uuuguguag4bp ccuuuuuGuGuAGGGucuAcGAGAccucccGGTsT 587 stab08 HCVa:327siRNA5-uuuguguag10bp GGucuAcGAGAccucccGGuuuuuGuGuAGccGGGAGGuc 588 stab08 HCVa:327siRNA5-uuuguguag8bp GGucuAcGAGAccucccGGuuuuuGuGuAGccGGGAGG 589 stab08 HCVa:327siRNA5-uuuguguag6bp GGucuAcGAGAccucccGGuuuuuGuGuAGccGGGA 590 stab08 HCVa:327siRNA5-uuuguguag4bp GGucuAcGAGAccucccGGuuuuuGuGuAGccGG 591 stab08 HCVa:347L23siRNA(327C)stab08 AcGGucuAcGAGAccucccGGTsT 592 HCVa:346L22siRNA(327C)stab08 cGGucuAcGAGAccucccGGTsT 593 HCVa:345L21siRNA(327C)stab08 GGucuAcGAGAccucccGGTsT 594 HCVa:344L20siRNA(327C)stab08 GucuAcGAGAccucccGGTsT 595 HCVa:343L19siRNA(327C)stab08 ucuAcGAGAccucccGGTsT 596 HCVa:342L18siRNA(327C)stab08 cuAcGAGAccucccGGTsT 597 HCVa:341L17siRNA(327C)stab08 uAcGAGAccucccGGTsT 598 HCVa:340L16siRNA(327C)stab08 AcGAGAccucccGGTsT 599 HCVa:339L15siRNA(327C)stab08 cGAGAccucccGGTsT 600 HCVa:345L21siRNA(327C)stab08 GGucuAcGAGAccucccGGGsG 601 GG HCVa:345L20siRNA(327C)stab08 GGucuAcGAGAccucccGGsG 602 G HCVa:345L20siRNA(327C)stab08 GGucuAcGAGAccucccGGsT 603 HCVa:345L19siRNA(327C)stab08 GGucuAcGAGAccucccGsG 604 HCVa:345L18siRNA(327C)stab08 GGucuAcGAGAccucccsG 605 HCVa:345L17siRNA(327C)stab08 GGucuAcGAGAccuccsc 606 HCVa:345L16siRNA(327C)stab08 GGucuAcGAGAccucsc 607 HCVa:345L15siRNA(327C)stab08 GGucuAcGAGAccusc 608 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGAccTTB 609 HCVa:327U21siRNAstab07GT BccGGGAGGucucGuAGAccGTB 610 HCVa:327U21siRNAstab07 BcGGGAGGucucGuAGAccTTB 611 HCVa:328U20siRNAstab07 BGGGAGGucucGuAGAccTTB 612 HCVa:329U19siRNAstab07 BGGAGGucucGuAGAccTTB 613 HCVa:330U18siRNAstab07 BGAGGucucGuAGAccTTB 614 HCVa:331U17siRNAstab07 BAGGucucGuAGAccTTB 615 HCVa:332U16siRNAstab07 BccGGGAGGucucGuAGAccTB 616 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGAccB 617 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGAcB 618 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGAB 619 HCVa:327U21siRNAstab07 BccGGGAGGucucGuAGB 620 31270 FLT1:349U21siRNAstab09sense BCUGAGUUUAAAAGGCACCCTTB 621 31273 FLT1:367L21siRNA(349C)stab10 GGGUGCCUUUUAAACUCAGTsT 622 antisense 31276 FLT1:349U21siRNAstab09inv BCCCACGGAAAAUUUGAGUCTTB 623 sense 31279 FLT1:367L21siRNA(349C)stab10 GACUCAAAUUUUCCGUGGGTsT 624 invantisense 31679 HBV1598allRNAsense AGGUGAAGCGAAGUGCACAUU 625 30287 HBV1598allRNAantisense UGUGCACUUCGCUUCACCUCU 626 31336 HBV:1580U21siRNAinvstab09 BUCCACUUCGCUUCACGUGUTTB 627 sense 31338 HBV:1598L21siRNA(1580C)inv ACACGUGAAGCGAAGUGGATsT 629 stab10antisense 32636 Luc3:80U21siRNAstab07sense BAuAAGGcuAuGAAGAGAuATTB 630 32676 Luc3:98L21siRNA(80C)stab08 uAucucuucAuAGccuuAuTsT 631 antisense 32640 Luc3:237U21siRNAstab07sense BcGuAuGcAGuGAAAAcucuTTB 632 32680 Luc3:255L21siRNA(237C)stab08 AGAGuuuucAcuGcAuAcGTsT 633 antisense 32662 Luc3:1478U21siRNAstab07sense BuGAcGGAAAAAGAGAucGuTTB 634 32702 Luc3:1496L21siRNA(1478C)stab08 AcGAucucuuuuuccGucATsT 635 antisense 32666 Luc3:1544U21siRNAstab07sense BGAGuuGuGuuuGuGGAcGATTB 636 32706 Luc3:1562L21siRNA(1544C)stab08 ucGuccAcAAAcAcAAcucTsT 637 antisense 32672 Luc3:1607U21siRNAstab07sense BGAGAGAuccucAuAAAGGcTTB 638 32712 Luc3:1625L21siRNA(1607C)stab08 GccuuuAuGAGGAucucucTsT 639 antisense 33139 HCVa:282U21siRNAstab07sense BGcGAAAGGccuuGuGGuAcTTB 640 33179 HCVa:300L21siRNA(282C)stab08 GuAccAcAAGGccuuucGcTsT 641 antisense 33140 HCVa:283U21siRNAstab07sense BcGAAAGGccuuGuGGuAcuTTB 642 33180 HCVa:301L21siRNA(283C)stab08 AGuAccAcAAGGccuuucGTsT 643 antisense 33145 HCVa:289U21siRNAstab07sense BGccuuGuGGuAcuGccuGATTB 644 33185 HCVa:307L21siRNA(289C)stab08 ucAGGcAGuAccAcAAGGcTsT 645 antisense 33149 HCVa:304U21siRNAstab07sense BcuGAuAGGGuGcuuGcGAGTTB 646 33183 HCVa:304L21siRNA(286C)stab08 GGcAGuAccAcAAGGccuuTsT 647 antisense 33150 HCVa:305U21siRNAstab07sense BuGAuAGGGuGcuuGcGAGuTTB 648 33190 HCVa:323L21siRNA(305C)stab08 AcucGcAAGcAcccuAucATsT 649 antisense 33151 HCVa:307U21siRNAstab07sense BAuAGGGuGcuuGcGAGuGcTTB 650 33191 HCVa:325L21siRNA(307C)stab08 GcAcucGcAAGcAcccuAuTsT 651 antisense 33158 HCVa:317U21siRNAstab07sense BuGcGAGuGccccGGGAGGuTTB 652 33187 HCVa:317L21siRNA(299C)stab08 AAGcAcccuAucAGGcAGuTsT 653 antisense 33210 HBV:258U21siRNAstab07sense BGuGGuGGAcuucucucAAuTTB 654 33250 HBV:276L21siRNA(258C)stab08 AuuGAGAGAAGuccAccAcTsT 655 antisense 33212 HBV:260U21siRNAstab07sense BGGuGGAcuucucucAAuuuTTB 656 33252 HBV:278L21siRNA(260C)stab08 AAAuuGAGAGAAGuccAccTsT 657 antisense 33214 HBV:263U21siRNAstab07sense BGGAcuucucucAAuuuucuTTB 658 33254 HBV:281L21siRNA(263C)stab08 AGAAAAuuGAGAGAAGuccTsT 659 antisense 32429 HBV:1583U21siRNAstab07sense BGcAcuucGcuucAccucuGTTB 660 32438 HBV:1601L21siRNA(1583C)stab08 cAGAGGuGAAGcGAAGuGcTsT 661 antisense 33226 HBV:1585U21siRNAstab07sense BAcuucGcuucAccucuGcATTB 662 33266 HBV:1603L21siRNA(1585C)stab08 uGcAGAGGuGAAGcGAAGuTsT 663 antisense 31651 HBV:1580U21siRNAstab06sense BUGUGCACUUCGCUUCACCUTTB 664 31652 HBV:1580U21siRNAinvstab06 BUCCACUUCGCUUCACGUGUTTB 665 sense 31653 HBV:1580U21siRNAstab16sense BUGUGCACUUCGCUUCACCUTTB 666 31654 HBV:1580U21siRNAinvstab16 BUCCACUUCGCUUCACGUGUTTB 667 sense 31657 HBV:1580U21siRNAstab18sense BuGuGcAcuucGcuucAccuTTB 668 31658 HBV:1580U21siRNAinvstab18 BuccAcuucGcuucAcGuGuTTB 669 sense UPPER CASE = ribonucleotide UPPER CASE UNDERLINE = 2-O-methyl nucleotide Lowercase = 2-deoxy-2-fluoro nucleotide T = thymidine T = inverted thymidine t = 3-deoxy thymidine B = inverted deoxyabasic succinate linker B = inverted deoxyabasic X = universal base (5-nitroindole) Z = universal base (3-nitropyrrole) S = phosphorothioate internucleotide linkage U = 5-bromodeoxyuridine A = deoxyadenosine G = deoxyguanosine L = glyceryl moiety ddC = dideoxy Cytidine p = phosphate
(641) TABLE-US-00002 TABLE II Reagent Equivalents Amount Wait Time* DNA Wait Time* 2-O-methyl Wait Time*RNA A. 2.5 mol Synthesis Cycle ABI 394 Instrument Phosphoramidites 6.5 163 L 45 sec 2.5 min 7.5 min S-Ethyl Tetrazole 23.8 238 L 45 sec 2.5 min 7.5 min Acetic Anhydride 100 233 L 5 sec 5 sec 5 sec N-Methyl 186 233 L 5 sec 5 sec 5 sec Imidazole TCA 176 2.3 mL 21 sec 21 sec 21 sec Iodine 11.2 1.7 mL 45 sec 45 sec 45 sec Beaucage 12.9 645 L 100 sec 300 sec 300 sec Acetonitrile NA 6.67 mL NA NA NA B. 0.2 mol Synthesis Cycle ABI 394 Instrument Phosphoramidites 15 31 L 45 sec 233 sec 465 sec S-Ethyl Tetrazole 38.7 31 L 45 sec 233 min 465 sec Acetic Anhydride 655 124 L 5 sec 5 sec 5 sec N-Methyl 1245 124 L 5 sec 5 sec 5 sec Imidazole TCA 700 732 L 10 sec 10 sec 10 sec Iodine 20.6 244 L 15 sec 15 sec 15 sec Beaucage 7.7 232 L 100 sec 300 sec 300 sec Acetonitrile NA 2.64 mL NA NA NA C. 0.2 mol Synthesis Cycle 96 well Instrument Equivalents: DNA/2- Amount: DNA/2-O- Wait Wait Time* 2- Wait Reagent O-methyl/Ribo methyl/Ribo Time* DNA O-methyl Time* Ribo Phosphoramidites 22/33/66 40/60/120 L 60 sec 180 sec 360 sec S-Ethyl Tetrazole 70/105/210 40/60/120 L 60 sec 180 min 360 sec Acetic Anhydride 265/265/265 50/50/50 L 10 sec 10 sec 10 sec N-Methyl 502/502/502 50/50/50 L 10 sec 10 sec 10 sec Imidazole TCA 238/475/475 250/500/500 L 15 sec 15 sec 15 sec Iodine 6.8/6.8/6.8 80/80/80 L 30 sec 30 sec 30 sec Beaucage 34/51/51 80/120/120 100 sec 200 sec 200 sec Acetonitrile NA 1150/1150/1150 L NA NA NA Wait time does not include contact time during delivery. Tandem synthesis utilizes double coupling of linker molecule
(642) TABLE-US-00003 TABLE III Number Solution on Stock VEGF of Injectate Conc. Group Filter (1.0 L) concentration Animals (6.0 L) Dose Injectate 1 Tris-Cl pH 6.9 NA 5 water NA NA 2 R&D Systems 3.53 g/L 5 water NA NA VEGF-carrier free 75 M 3 R&D Systems 3.53 g/L 5 Site 2340 10 g/eye 1.67 g/L VEGF-carrier Stab1 free siRNA 75 M 4 R&D Systems 3.53 g/L 5 Site 2340 3 g/eye 0.5 g/L VEGF-carrier Stab1 free siRNA 75 M 5 R&D Systems 3.53 g/L 5 Site 2340 1 g/eye 0.167 g/L VEGF-carrier Stab1 free siRNA 75 M 6 R&D Systems 3.53 g/L 5 Inactive 10 g/eye 1.67 g/L VEGF-carrier Site 2340 free Stab1 75 M siRNA 7 R&D Systems 3.53 g/L 5 Inactive 3 g/eye 0.5 g/L VEGF-carrier Site 2340 free Stab1 75 M siRNA 8 R&D Systems 3.53 g/L 5 Inactive 1 g/eye 0.167 g/L VEGF-carrier Site 2340 free Stab1 75 M siRNA
(643) TABLE-US-00004 TABLE IV Non-limiting examples of Stabilization Chemistries for chemically modified siNA constructs Chemistry pyrimidine Purine cap p = S Strand Stab 1 Ribo Ribo 5 at 5-end S/AS 1 at 3-end Stab 2 Ribo Ribo All Usually AS linkages Stab 3 2-fluoro Ribo 4 at 5-end Usually S 4 at 3-end Stab 4 2-fluoro Ribo 5 and 3- Usually S ends Stab 5 2-fluoro Ribo 1 at 3-end Usually AS Stab 6 2-O- Ribo 5 and 3- Usually S Methyl ends Stab 7 2-fluoro 2-deoxy 5 and 3- Usually S ends Stab 8 2-fluoro 2-O- 1 at 3-end S or AS Methyl Stab 9 Ribo Ribo 5 and 3- Usually S ends Stab 10 Ribo Ribo 1 at 3-end Usually AS Stab 11 2-fluoro 2-deoxy 1 at 3-end Usually AS Stab 12 2-fluoro LNA 5 and 3- Usually S ends Stab 13 2-fluoro LNA 1 at 3-end Usually AS Stab 14 2-fluoro 2-deoxy 2 at 5-end Usually AS 1 at 3-end Stab 15 2-deoxy 2-deoxy 2 at 5-end Usually AS 1 at 3-end Stab 16 Ribo 2-O- 5 and 3- Usually S Methyl ends Stab 17 2-O- 2-O- 5 and 3- Usually S Methyl Methyl ends Stab 18 2-fluoro 2-O- 1 at 3-end Usually AS Methyl CAP = any terminal cap, see for example FIG. 22. All Stab 1-18 chemistries can comprise 3-terminal thymidine (TT) residues All Stab 1-18 chemistries typically comprise 21 nucleotides, but can vary as described herein. S = sense strand AS = antisense strand
(644) TABLE-US-00005 TABLEV PeptidesforConjugation SEQ ID Peptide Sequence NO ANTENNAPEDIA RQIKIWFQNRRMKWKKamide 507 Kaposifibroblast AAVALLPAVLLALLAP+ VQR 508 growthfactor KRQKLMP caimancrocodylus MGLGLHLLVLAAALQGA 509 Ig(5)lightchain HIVenvelope GALFLGFLGAAGSTMGA+ 510 glycoproteingp41 PKSKRK5(NLSoftheSV40) HIV-1Tat RKKRRQRRR 511 Influenza GLFEAIAGFIENGWEGMIDGGGYC 512 hemagglutinin envelop glycoprotein RGDpeptide X-RGD-X 513 whereXisanyaminoacid orpeptide transportanA GWTLNSAGYLLGKINLKALAA 514 LAKKIL Somatostatin (S)FCYWKTCT 515 (tyr-3- octreotate) Pre-S-peptide (S)DHQLNPAF 516 (S) optional Serine for coupling Italic = optional D isomer for stability
(645) TABLE-US-00006 TABLE VI Duplex half-lives in human and mouse serum and liver extracts Stability S/AS All RNA 4*/5 4/5* 7/11* 7*/8 7/8* Sirna # 47715/47933 30355/30366 30355/30366 30612/31175 30612/30620 30612/30620 Human 0.017 408 39 54 130 94 Serum (0.96).sup. (0.65) (0.76) (0.88) (0.86) t.sub.1/2 hours Human 2.5 28.6 43.5 0.78/2.9.sup. 9 816 Liver (0.40) (0.66) (0.45) (0.39) (0.99) t.sub.1/2 hours Mouse 1.17 16.7 10 2.3 16.6 35.7 Serum (0.9) (0.81) (0.46) (0.69) t.sub.1/2 hours Mouse 6 1.08 0.80 0.20 0.22 120 Liver (0.89) t.sub.1/2 hours *The asterisk designates the strand carrying the radiolabel in the duplex. .sup.For longer half-lives the fraction full-length at the 18 hours is presented as the parenthetic lower number in each cell. .sup.A biphasic curve was observed, half-lives for both phases are shown.
(646) TABLE-US-00007 TABLE VII Single strand half-lives in human serum Stability Sirna # 4 5 7 11 8 30355 30366 30612 31175 30620 Human serum 22 16 13 19 28 t.sub.1/2 hours Human liver 0.92 0.40 0.43 0.27 192 t.sub.1/2 hours
(647) TABLE-US-00008 TABLEVIII Humanserumhalf-livesforStab4/5duplexchemistrywith terminuschemistriesofFIG.22 2 7 9 2 8 1 3 6 Cap (R= O) (R= O) (R= O) (R= S) (R= O) (R= O) (R= O) (R= O) Chemistry (B= T) (B= T) (B= T) (B= T) (B= T) (B= T) (B= T) (B= T) Human 1 1.2 2.3 39 96 460 770 770 Serumt.sub.1/2 (0.69).sup. (0.95) (0.94) (0.95) hours The capping structures were in the following position of the 4:5 chemistry formatted sequence: antisense strand - 5-uuGuuGuAuuuuGuGGuuG-CAP-3 where CAP is 1, 2, 3, 6, 7, 8, or 9 from FIG. 22. (SEQ ID NO: 670) sense strand 5-CAP-cAAccAcAAAAuAcAAcAATT-CAP-3 where CAP is 1 from FIG. 22. (SEQ ID NO: 671) .sup.For half-lives that extend beyond the time course sampled the fraction full-length is presented in parentheses.