METHODS AND KITS FOR DETECTING RHOA MUTATIONS

20230051573 · 2023-02-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to methods of detecting mutations associated with the Ras homologue gene family member (RHOA) gene, and diagnosing conditions associated with these mutations, using Competitive allele-specific TaqMan polymerase chain reaction (cast-PCR). The invention also extends to the products used to detect mutations, and their use in diagnosis.

Claims

1. A polymerase chain reaction (PCR) method for determining the presence or absence of a mutation in the Ras homologue gene family member A (RHOA) gene in a sample obtained from a subject, the method comprising: i) forming a mixture comprising the sample and a primer set, wherein the sample comprises a RHOA encoding nucleotide target sequence and the primer set comprises; (a) a mutation-specific forward primer; (b) a reverse primer; and (c) an oligoblocker, ii) subjecting the mixture of step (i) to, sequentially in steps, a denaturing step, an annealing step, and an extension step, wherein in the annealing step the forward primer and the oligoblocker compete to anneal to the target sequence, wherein the oligoblocker is capable of specifically hybridizing to a wild-type target sequence to block polymerase extension and the mutation-specific forward primer is capable of hybridizing to a mutated RHOA nucleotide sequence; and iii) determining whether a PCR product is obtained through steps (i) and (ii), wherein the presence of the PCR product is indicative of the presence of a mutation in the RHOA gene in the sample, and the absence of the PCR product is indicative of the absence of a mutation in the RHOA gene in the sample.

2. The method according to claim 1, wherein the sample is selected from a biological fluid sample, mononucleated white cells, polymorphonuclear leukocytes or tumour tissue, and/or wherein the sample is a biological fluid sample which comprises cell free nucleic acids (cfNA), and/or wherein the mutation in the RHOA gene results in an amino acid substitution, optionally wherein the substitution is selected from the group consisting of G14V, C16stop, G17V and F25L, and/or wherein the mutation-specific forward primer is capable of hybridizing to the nucleotide sequence as substantially as set out in SEQ ID NO: 127, 128, 129, 130, 131, 132, 133 or 134, or a fragment or variant thereof.

3.-5. (canceled)

6. The method according to claim 1, wherein the mutation-specific forward primer sequence is a nucleotide sequence of any one of SEQ ID NO: 1-14 or a variant or fragment thereof, preferably any one of SEQ ID NO: 5-7, 11-16 or a variant or fragment thereof, and is capable of hybridizing to a mutated RHOA nucleotide sequence resulting in the amino acid substitution F25L, and/or wherein the mutation-specific forward primer sequence is be a nucleotide sequence of any one of SEQ ID NO: 39-52 or a variant or fragment thereof, preferably any one of SEQ ID NO: 43-44, 50-51 or a variant or fragment thereof, and is capable of hybridizing to a mutated RHOA nucleotide sequence comprising a mutation resulting in the amino acid substitution G17V.

7. (canceled)

8. The method according to claim 1, wherein the mutation-specific forward primer sequence is a nucleotide sequence of any one of SEQ ID NO: 72-85 or a variant or fragment thereof, preferably any one of SEQ ID NO: 75-78, 83-85 or a variant or fragment thereof, and is capable of hybridizing to a mutated RHOA nucleotide sequence resulting in the amino acid substitution C16stop, and/or wherein the mutation-specific forward primer sequence is a nucleotide sequence of any one of SEQ ID NO: 89 — 102 or a variant or fragment thereof, preferably any one of SEQ ID NO: 92-95, 99-101 or a variant or fragment thereof, and is capable of hybridizing to a mutated RHOA nucleotide sequence resulting in the amino acid substitution G14V.

9. (canceled)

10. The method according to claim 1, wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution F25L, and the mutation-specific forward primer is selected from any one of SEQ ID NO: 1-14, the reverse primer is selected from any one of SEQ ID NO: 15-20, and the oligoblocker is selected from any one of SEQ ID NO: 21-31, 34-38; ii) the mutated RHOA nucleotide sequence results in the amino acid substitution G17V and the mutation-specific forward primer is selected from anyone of any one of SEQ ID NOs: 39-52, the reverse primer is selected from any one of SEQ ID NO: 53-59, and the oligoblocker is selected from any one of SEQ ID NO: 60-69; and/or iii) the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA C16Stop and wherein the mutation-specific primer is selected from any one of SEQ ID NO: 72-85, the reverse primer is selected from any one of SEQ ID NO: 53-59, 86-88, and the oligoblocker is selected from any one of SEQ ID NO: 60-69; and/or iv) the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA G14V and the mutation-specific primer is selected from any one of SEQ ID NOs: 89-102, the reverse primer is selected from any one of SEQ ID NO: 53-59, 86-88, and the oligoblocker is selected from SEQ ID NO: 60-69, 103-112.

11. A polymerase chain reaction (PCR) method for determining the presence or absence of a mutation in the Ras homologue gene family member A (RHOA) gene in a sample obtained from a subject, the method comprising: i) forming a mixture comprising the sample, a wild-type forward primer, a wild-type reverse primer, and a mutation specific fluorescent probe, wherein the sample comprises a RHOA encoding nucleotide target sequence; ii) subjecting the mixture of step (i) to, sequentially in steps, a denaturing step, an annealing step, and an extension step, wherein the mutant specific fluorescent probe is capable of hybridizing to a mutated RHOA nucleotide sequence and the wild-type forward primer and wild-type reverse primer are capable of hybridizing to a wild-type RHOA encoding nucleotide target sequence; and iii) detecting a fluorescent signal obtained by the reaction of step ii), wherein the presence of a fluorescent signal in a channel associated with the mutant specific fluorescent probe is indicative of the presence of a mutation in the RHOA gene, and the absence of a fluorescent signal is indicative of the absence of a mutation in the RHOA gene.

12. The method according to claim 11, wherein the wild-type forward primer and wild-type reverse primer are capable of hybridizing to a different region of the RHOA nucleotide sequence than the mutation-specific forward primer and reverse primer are capable of hybridizing to, and/or wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA F25L, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 118, or a fragment or variant thereof; ii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G17V, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 120, or a fragment or variant thereof; iii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution C16Stop, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 122, or a fragment or variant thereof; and/or iv) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G14V, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 124, or a fragment or variant thereof.

13. (canceled)

14. The method according to claim 11, wherein the method further comprises adding to the mixture of step i) a wild-type fluorescent probe that is substantially complementary to the wild-type RHOA nucleotide sequence, and is labelled with a different fluorophore with emission spectrum non-overlapping with the mutation specific fluorescent probe, optionally wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution F25L, and the wild-type florescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 117, or a fragment or variant thereof; ii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G17V, the wild-type florescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 119, or a fragment or variant thereof; iii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution C16Stop, the wild-type fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 121, or a fragment or variant thereof; and/or iv) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G14V, the wild-type fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 123, or a fragment or variant thereof.

15. (canceled)

16. The method according to claim 11, wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution F25L, the wild-type forward primer comprises a nucleic acid sequence as substantially set out in SEQ ID NO: 113, or a fragment or variant thereof, and the wild-type reverse primer comprises a nucleic acid sequence as substantially set out in SEQ ID NO: 114, or a fragment or variant thereof; and/or ii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G17V, C16Stop or G14V the wild-type forward primer comprises a nucleic acid sequence as substantially set out in SEQ ID NO: 115, or a fragment or variant thereof, the wild-type reverse primer comprises a nucleic acid sequence as substantially set out in SEQ ID NO: 116, or a fragment or variant thereof.

17. A polymerase chain reaction (PCR) method for determining the frequency of RHOA gene mutations in a sample obtained from a subject, the method comprising: i) forming a mixture comprising the sample and a first primer set, wherein the sample comprises RHOA encoding nucleotide first and second target sequences and the first primer set is the primer set according to claim 1; ii) (a) contacting the mixture of step i) with a second primer set comprising a wild-type forward primer and a wild-type reverse primer; or (b) forming a second mixture comprising the sample and a second primer set comprising a wild-type forward primer and a wild-type reverse primer; iii) subjecting the mixture of step ii) (a) or the mixtures of step i) and ii) (b) to, sequentially in steps, a denaturing step, an annealing step, and an extension step, wherein in the annealing step the mutation-specific forward primer and the oligoblocker compete to anneal to the first target sequence, wherein the oligoblocker is capable of specifically hybridizing to a wild-type target sequence to block polymerase extension, and the forward primer anneals to the second target sequence, wherein the second target sequence corresponds to a wild-type sequence of the RHOA gene; and iv) obtaining at least one PCR product through steps (i) to (iii), wherein the presence of a first product amplified for the first target sequence resulting from the first primer set is indicative of the presence of a mutation in the RHOA gene in the sample and the presence of a second product amplified product from the second target sequence resulting from the second primer set is indicative of the total number of RHOA encoding nucleotide sequences in the sample; and v) comparing the amount of sequence amplified from the first and second target sequences to determine the frequency of RHOA gene mutations in a sample.

18. The method according to claim 17, wherein the wild-type forward primer and wild-type reverse primer are capable of hybridizing to a different region of the RHOA nucleotide sequence than the mutation-specific forward primer and reverse primer are capable of hybridizing to.

19. The method according to claim 17, wherein the first primer set is as defined in claim 2.

20. A method of diagnosing cancer in a subject, or a predisposition thereto, or for providing a prognosis of cancer, comprising: a) i) performing a polymerase chain reaction (PCR) method according to claim 1; and ii) detecting the presence of a PCR product obtained through step (i) to diagnose or prognose cancer in the subject, wherein the presence of a PCR product is indicative of cancer; b) i) performing a polymerase chain reaction (PCR) method according to claim 11; and ii) detecting the presence of a fluorescent signal obtained by step i) to diagnose or prognose cancer in the subject, wherein the presence of a fluorescent signal is indicative of cancer; or c) i) performing a polymerase chain reaction (PCR) method according to claim 17; and ii) comparing the amount of sequence amplified from the first and second target sequences to determine the frequency of RHOA gene mutations in a sample, thereby diagnosing or prognosing cancer in the subject.

21. The method according to claim 20, wherein the cancer is peripheral T-cell lymphoma.

22. A mutation-specific forward primer that is capable of hybridizing to the nucleotide sequence as substantially as set out in SEQ ID NO: 127, 128, 129, 130, 131, 132, 133 or 134, or a fragment or variant thereof, optionally wherein the mutation-specific primer sequence is a nucleotide sequence of any one of SEQ ID NO: 1-14, 39-52, 72-85 and 89-102 or a variant or fragment thereof.

23. (canceled)

24. A mutation-specific forward primer and reverse primer pair, wherein the mutation specific forward primer is capable of hybridizing to a mutated RHOA nucleotide sequence, wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution F25L, the mutation-specific forward primer is selected from any one of SEQ ID NO: 1-14 and the reverse primer is selected from any one of SEQ ID NO: 15-20; ii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G17V, the mutation-specific forward primer is selected from anyone of any one of SEQ ID NOs: 39-52 and the reverse primer is selected from any one of SEQ ID NO: 53-59; iii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA C16Stop, the mutation-specific primer is selected from any one of SEQ ID NO: 72-85 and the reverse primer is selected from any one of SEQ ID NO: 53-59, 86-88; or iv) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G14V, the mutation-specific primer is selected from any one of SEQ ID NOs: 89-102, the reverse primer is selected from any one of SEQ ID NO: 53-59, 86-88; or a primer set comprising a mutation-specific forward primer a reverse primer and an oligoblocker, wherein the mutation specific forward primer is capable of hybridizing to a mutated RHOA nucleotide sequence, wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution F25L, and the mutation-specific forward primer is selected from any one of SEQ ID NO: 1-14, the reverse primer is selected from any one of SEQ ID NO: 15-20, and the oligoblocker is selected from any one of SEQ ID NO: 21-31, 34-38; ii) the mutated RHOA nucleotide sequence results in the amino acid substitution G17V and the mutation-specific forward primer is selected from anyone of any one of SEQ ID NOs: 39-52, the reverse primer is selected from any one of SEQ ID NO: 53-59, and the oligoblocker is selected from any one of SEQ ID NO: 60-69; iii) the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA C16Stop and wherein the mutation-specific primer is selected from any one of SEQ ID NO: 72-85, the reverse primer is selected from any one of SEQ ID NO: 53-59, 86-88, and the oligoblocker is selected from any one of SEQ ID NO: 60-69; or iv) the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA G14V and the mutation-specific primer is selected from any one of SEQ ID NOs: 89-102, the reverse primer is selected from any one of SEQ ID NO: 53-59, 86-88, and the oligoblocker is selected from SEQ ID NO: 60-69, 103-112.

25. (canceled)

26. A mutation specific fluorescent probe capable of hybridizing to a mutated RHOA nucleotide sequence, wherein: i) the mutated RHOA nucleotide sequence results in the amino acid substitution RHOA F25L, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 118, or a fragment or variant thereof; ii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G17V, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 120, or a fragment or variant thereof; iii) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution C16Stop, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 122, or a fragment or variant thereof; or iv) wherein the mutated RHOA nucleotide sequence results in the amino acid substitution G14V, and the mutation specific fluorescent probe comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 124, or a fragment or variant thereof.

27. A mutation specific fluorescent probe and wild-type specific fluorescent probe pair, wherein the mutation specific fluorescent probe is as defined in claim 26 and the wild-type fluorescent probe is substantially complementary to a wild-type RHOA nucleotide sequence, and is labelled with a different fluorophore with emission spectrum non-overlapping with the mutation specific fluorescent probe.

28. (canceled)

29. A method of diagnosing cancer in a subject, comprising: contacting a sample obtained from the subject with the mutation-specific forward primer of claim 22, the mutation-specific forward primer and reverse primer pair of claim 24, the primer set of claim 24, the mutation specific fluorescent probe of claim 26 or the mutation specific fluorescent probe and wild-type specific fluorescent probe pair of claim 27; performing a polymerase chain reaction (PCR) method; and detecting the presence of a PCR product, wherein the presence of a PCR product is indicative of cancer, or detecting the presence of a fluorescent signal, wherein the presence of a fluorescent signal is indicative of cancer, optionally wherein the cancer is peripheral T-cell lymphoma.

30. (canceled)

31. A kit for determining the presence, absence or frequency of a mutation in the RHOA gene, comprising: a) i) at least one mutation-specific forward primer of claim 22, at least one mutation-specific forward primer and reverse primer pair of claim 24, at least one primer set of claim 24; or ii) at least one mutation specific fluorescent probe of claim 26 or at least one mutation specific fluorescent probe and wild-type specific fluorescent probe pair of claim 27; b) a DNA polymerase c) optionally, a sample obtained from a subject; and d) instructions for use.

Description

[0190] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:

[0191] FIG. 1 shows Blat alignments (Human GRCh38/hg38) for all the PCR amplicons generated by the combinations of primers meeting the thermodynamic criteria

[0192] FIG. 2 shows a list of partial homologies generated by the proposed amplicons in inverse configuration

[0193] FIG. 3 shows detailed examples of the homologies generated by the proposed amplicons in inverse configuration.

[0194] FIG. 4 shows blat alignments (Human GRCh38/hg38) for the PCR amplicons generated by the combinations of primers meeting the IntPlex® thermodynamic criteria.

[0195] FIG. 5 shows BLAT analysis results for all the expected PCR products generated with the proposed primer sets in conventional configuration for the detection of the RHOA G17V mutation.

[0196] FIG. 6 shows Blat alignments (Human GRCh38/hg38) for all the PCR amplicons generated by the combinations of primers meeting the thermodynamic criteria.

[0197] FIG. 7 shows a list of partial homologies generated by the proposed amplicons in inverse configuration.

[0198] FIG. 8 shows detailed examples of the homologies generated by the proposed amplicons in inverse configuration.

[0199] FIG. 9 shows Blat alignments (Human GRCh38/hg38) for the PCR amplicons generated by the combinations of primers meeting the IntPlex® thermodynamic criteria.

[0200] FIG. 10 shows BLAT analysis results for all the expected PCR products generated with the proposed primer sets in conventional configuration for the detection of the RHOA C16* mutation.

[0201] FIG. 11 shows Blat alignments (Human GRCh38/hg38) for all the PCR amplicons generated by the combinations of primers meeting the thermodynamic criteria.

[0202] FIG. 12 shows a list of partial homologies generated by the proposed amplicons in inverse configuration.

[0203] FIG. 13 shows detailed examples of the homologies generated by the proposed amplicons in inverse configuration.

[0204] FIG. 14 shows BLAT analysis results for all the expected PCR products generated with the proposed primer sets in conventional configuration for the detection of the RHOA G14V mutation.

[0205] FIG. 15 shows Blat alignments (Human GRCh38/hg38) for all the PCR amplicons generated by the combinations of primers meeting the thermodynamic criteria.

[0206] FIG. 16 shows a list of partial homologies generated by the proposed amplicons in inverse configuration.

[0207] FIG. 17 shows BLAT analysis results for the expected PCR products generated with the proposed primer sets for the detection of the RHOA F25L mutation.

[0208] FIG. 18 shows Blat alignments (Human GRCh38/hg38) for all the PCR amplicons generated by the combinations of primers meeting the thermodynamic criteria.

[0209] FIG. 19 shows BLAT analysis results for the expected PCR products generated with the proposed primer sets for the detection of the G17V mutation.

[0210] FIG. 20 shows Blat alignments (Human GRCh38/hg38) for all the PCR amplicons generated by the combinations of primers meeting the thermodynamic criteria.

EXAMPLES

[0211] Materials and Methods

[0212] Design of the Allele-Specific Primer Targeting the Mutation of Interest

[0213] To optimise specificity and sensitivity of the allele-specific primer targeting the single nucleotide mutation of interest, the mutant base was generally positioned as 3′ end last nucleotide. The 3′ end of an allele-specific primer is mismatched for one allele (the WT allele) and is a perfect match for the other allele (the mutated allele). The 3′ positioning of the mismatch has the effect of partially blocking the amplification of the WT allele. Indeed, the Taq polymerase enzyme typically used for DNA amplification preferably extends DNA in presence of a perfect match at the 3′ primer end with a free hydroxyl group present. Furthermore, any residual non-specific amplification from the WT allele is further avoided using an oligoblocker.

[0214] The positioning of the targeted mutation as the 3′ end of the allele-specific primers generates two possible options for assay design: one in “conventional configuration”, with the primer sequence matching the reference sequence on the positive strand (hence with the primer annealing to the negative strand) with the mutation in 3′; one in “inverse configuration”, with the primer sequence matching the negative strand (hence with the primer annealing to the positive strand) with the mutation in 3′.

[0215] Both options were considered in the experimental section, and the thermodynamic characteristics of both options were generally compared, to ensure optimal Tm and GC % with absence of primer-dimers, blocker-primer dimers, self-dimerisation, and hairpins.

[0216] In addition, different combinations of primers at different lengths were tested, to provide optimal results.

[0217] In the selection of the primers targeting the mutation of interest the following recommendations were followed to prevent the risk of non-specific amplification and to improve the method's sensitivity:

[0218] Low melting temperature (Low Tm): Ideally, the Tm of the primer should be 10° C. below the annealing temperature of the PCR system (60° C.), with accepted range between 45-55° C. As the variant is targeted at the 3′end last base of the primer, Tm changes towards the optimal temperature are obtained by varying the primer length at the 5′ end.

[0219] Length of the allele-specific primer: The primer targeting the mutation should have low Tm (45-55° C.), suggesting a short length but it should be long enough to be highly specific and provide efficient amplification. Length was found optimal between 16 and 22 bp.

[0220] GC %: The GC content (percentage of guanines and cytosines out of the total number of bases) of the primer should ideally fall between 40 and 60%. Lower the GC %, lower the risk of non-specific amplification but it is associated with lower amplification efficiency. Higher the GC %, higher the risk of non-specific amplification but the amplification efficiency is increased.

[0221] 3′-tail GC %: Higher values (>25%) allow more specific annealing of the primer to its target sequence.

[0222] Secondary structures: the formation of primer self-dimers or hairpin loops is detrimental to the PCR efficiency as it considerably decreases the concentration of primer molecules available for the PCR reaction. Also, secondary structures can generate strong background signals that can negatively impact on the quantification accuracy of the desired PCR product. The software Oligoanalyzer® was used to analyse the change in Gibbs free energy required for breaking down the predicted secondary structures (←G). pG below −4 kcal/mol are indicative of primers at a very strong risk of self-annealing that should hence be modified to reach ΔG values closer to zero or discarded. Absence of any hairpin is ideal. In presence of hairpins with ΔG below −3 kcal/mol the primer should be modified to reach ΔG values closer to zero or discarded.

[0223] Paired Wild-Type Primer to the Allele-Specific Primer

[0224] In the selection of the paired wild-type primer the following criteria were followed to prevent the risk of non-specific amplification and to improve the method's sensitivity:

[0225] Amplicon size: the paired WT primer was positioned at 60-100 bp from the primer targeting the mutation in order to produce an amplicon of 60-100 bp. Such size was indeed found optimal by the inventors for detecting tumour-derived circulating DNA.

[0226] In the conventional configuration (allele-specific primer designed upon the reference sequence, annealing to the negative strand), the paired wild-type primer sequence is the complement-reverse of the reference sequence, in order to anneal to the positive strand.

[0227] In the inverse configuration (allele-specific primer designed as complement-reverse of the reference sequence to maintain the mutation in 3′, annealing to the positive strand), the paired wild type sequence is designed upon the reference sequence, in order to anneal to the negative strand.

[0228] Melting temperature: Ideally, the Tm difference between the Tm of the primer targeting the mutation and its paired WT primer should not exceed 5° C. As a consequence, the Tm of the paired WT primer should preferably be 50-60° C.

[0229] GC %, 3′ tail GC % and secondary structures: the same parameters described under “Design of the allele-specific primer targeting the mutation of interest”.

[0230] Off-target amplification: Co-amplification of any secondary product other than the target sequence should be avoided to ensure specificity. Presence of off-target amplification would generate false negative results and compromise the validity of the proposed method. To prevent this eventuality, the selected WT paired primers, together with their matched allele-specific primers, were analysed using several methods to confirm specificity for optimal primer combinations.

[0231] Unwanted homology regions: The amplicons are typically analysed using the “Blat” online tool on the UCSC Genome Browser website to determine the presence of potential secondary regions of homology that might generate non-specific products or alter the PCR efficiency.

[0232] Oligoblocker Design

[0233] The oligoblocker is an oligonucleotide complementary to the WT allele with respect to the mutation of interest. It is modified (e.g., phosphorylated in 3′) to block the polymerase elongation. The role of the oligoblocker is to avoid non-specific amplification of the WT sequence at the mutation locus. When the oligoblocker is hybridised to the WT sequence it avoids non-specific hybridisation of the primer targeting the mutation to the WT sequence, as it partially overlaps the primer target sequence.

[0234] The criteria for an optimal oligoblocker design are herein described, to prevent the risk of non-specific amplification and to improve the detection of low-frequency mutations.

[0235] Melting temperature: The oligoblocker Tm should preferably be close to 60° C. (the hybridization/extension temperature of the polymerase enzyme required for the PCR amplification reaction) and preferably at least 4° C. above the Tm of the primer targeting to the mutation. This preferred strategy ensures that the oligoblocker hybridizes to its target sequence before any potential non-specific hybridization to the WT locus by the allele-specific primer. Ideally, the oligoblocker Tm should hence be 55-60° C.

[0236] Position: The oligoblocker should be designed preferably so as to have the variant nt position towards the middle of its sequence. With this strategy, the oligoblocker occupies a larger portion of the allele-specific primer target region, aiding to avoid non-specific hybridization.

[0237] GC % and 3′GC %: the same parameters as described under “Design of the allele-specific primer targeting the mutation of interest” were followed.

[0238] Secondary structures: The same parameters as described under “Design of the allele-specific primer targeting the mutation of interest” were followed.

[0239] Length: The ideal length of an oligoblocker is between 19-23 bp.

[0240] Combinatorial Hetero-Dimer Analysis

[0241] The absence of hetero-annealing among the oligonucleotides (allele-specific primer, paired WT primer and oligoblocker) should preferably be verified. This strategy prevents the risk of forming primer-dimers and non-specific amplification, improving the efficiency of the method. The software Oligoanalyzer® can be used for this purpose and, based on its algorithms for the calculations of Gibbs free energy, just values above −4 Kcal/mol can be accepted. Oligonucleotide combinations with ΔG←4 kcal/mol need to be discarded and re-designed.

[0242] Design of the Wild-Type Primer Pair

[0243] This primer set should target a nucleic acid sequence located 100-350 bp, typically 300±10 bases pair, from the nucleic acid sequence targeted by the allele-specific primer set. Moreover, it should preferably target a nucleic acid sequence of the same size than the one targeted by the allele-specific primer set ±10%. Preferred characteristics of the primers that ensure optimal performance are listed below:

[0244] Melting temperature: The melting temperature should be comprised between 55 and 60° C., with less than 5° C. difference between the Tm of the two primers.

[0245] All other thermodynamic parameters to consider in the design of the wild-type primer pair (GC %, 3′GC %, amplicon size, secondary structures, off-target amplification and unwanted homology regions) are the same as described under “Paired Wild-Type primer to the allele-specific primer”.

[0246] In Vitro Validation for Mutated Region

[0247] Specificity test: This phase is generally performed for verifying that the mutation-specific primer set under evaluation amplifies only its target sequence. It is typically realised on genomic DNA carrying the mutation of interest or from synthetic double-strand DNA fragments carrying the mutation of interest diluted in wild-type genomic DNA background.

[0248] Non-specificity test: The non-specificity test can be performed to ensure that the primer set targeting the mutation of interest does not amplify any other region and that no primers-dimers or self-dimers are formed during the PCR reaction. Criteria to validate the non-specificity are typically: concentration values below 0.5 pg/μl and a different Tm from the expected Tm of the mutation, as determined by the specificity test.

[0249] Efficiency test: The efficiency of mutation-specific primer set is generally evaluated by running the assay on positive controls of known mutational load.

[0250] Sensitivity: To assess the sensitivity of the system in analysis, an assay is generally run on serial dilutions of DNA mutant for the variant in analysis.

[0251] Considerations for Probe-Based A-TAG Assays

[0252] Some extra considerations should be applied when adapting the A-TAG assay to a probe-based detection system.

[0253] Primer Design

[0254] The primer melting temperature should be comprised between 55° C. and 60° C. The primers should flank the mutant site with no overlapping allowed with the variant site in analysis.

[0255] All other thermodynamic considerations presented above regarding primer length, GC %, 3′ GC tail and secondary structure are applicable.

[0256] All thermodynamic considerations presented above regarding the design of the paired primer, the maximum temperature difference between primer pairs, their respective orientation and the analysis of off-target amplification and presence of unwanted homology regions are applicable.

[0257] Oligoblocker

[0258] No oligoblocker is required in this experimental setting. The wild-type allele and the mutant allele will be detected in the same reaction well.

[0259] Probe Design

[0260] The mutation of interest is targeted by the mutant probe, labelled in 5′ with a suitable fluorophore group, as 6FAM, HEX or VIC and with a suitable quencher at the 3′, as Black Hole-1 (BHQ-1). The wild-type allele is targeted by the wild-type probe, labelled in 5′ with a different fluorophore with emission spectrum non-overlapping with the mutant probe and with a suitable quencher at the 3′, as Black Hole-1 (BHQ-1). This strategy enables simultaneous detection of the mutant and the wild-type signal from the same reaction well, by reading at the two emission lengths.

[0261] Probe length, 13-25 nucleotides, with optimum Tm 5-10° C. above the primers Tm. Shorter probes are favoured as they tend to have better specificity.

[0262] Position of variant in analysis: In order to increase specificity, in case of a single nucleotide mutation, the site of the nucleotide targeted by the mutant probe and by the wild-type probe shall be preferably centered on the probe sequence, more preferably located within 80% central nucleotides, even more preferably within 60% central nucleotides, even further preferably within 40% central nucleotides.

[0263] Use of LNAs: The wild-type probe and the mutant probe are synthesised with a locked nucleic acid in correspondence of the variable position under investigation, to improve their affinity for the respective allele. This strategy increases specificity and the overall Tm of the probe, enabling the design of shorter and more specific probes. Each LNA increases the probe Tm of 2° C.

[0264] When required by thermodynamic constraints, each probe can contain more than one LNA, ideally spaced of 2 or more base pairs, in order to increase the probe Tm until the desired value.

[0265] Alternative setup: if desired, or if working in one fluorescent channel only, the experiment setup can be modified to use a simple oligonucleotide with LNAs at the desired position instead of either the mutant or the wild-type probe. In this setup, just the remaining probe will generate a fluorescent signal in case of hybridization and the LNA-oligonucleotide will serve to prompt competitive binding to increase specificity. No detectable signal will be generated from the LNA oligonucleotide.

[0266] Sequence constraints on probe design. The following recommendations should be followed whenever possible, to ensure optimal fluorescence levels: [0267] The probe may be designed within the sequence amplified by the selected primers flanking the variant position of interest. [0268] 5′ last nucleotide may not be a G; neither may the penultimate (second-from-last) nucleotide. [0269] 3′ end may have few Gs; specifically avoid GGG and GGAG [0270] Keep homopolymers (repeating nucleotides) to a minimum, preferably no more than 4 Gs together, no more than 6 As together, no more than 2 CC dinucleotides in the 30 middle of the probe. [0271] The probe may have <30 nucleotides between the fluorophore and the quencher to avoid affecting baseline signal intensity. [0272] The sequence within the target may have a GC content of 30-80% [0273] The probe may anneal to the strand that has more Gs than Cs (so the probe contains more Cs than Gs).

[0274] Combinatorial Heterodimer Analysis

[0275] The absence of hetero-annealing among the oligonucleotides (forward primer, paired reverse primer, wild-type probe and mutant probe) should preferably be verified. This strategy prevents the risk of forming primer-dimers and non-specific amplification, improving the efficiency of the method. The software Oligoanalyzer® can be used for this purpose and, based on its algorithms for the calculations of Gibbs free energy, just values above −4 Kcal/mol can be accepted. Oligonucleotide combinations with □G←4 kcal/mol need to be discarded and re-designed.

[0276] In Vitro Validation

[0277] All in vitro validation phases presented below should be thoroughly followed. A successful specificity test for a probe-based A-TAG assay will generate signal just from the wild-type probe. No amplification should be detected in the mutant probe channel when analysing wild-type DNA.

[0278] RHOA F25L

[0279] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0280] More specifically, in a preferred embodiment, the mutation is RHOA F25L, where the phenylalanine to leucine change is due to a single point mutation at position chr3: 49412950 (human assembly GRCh37/hg19) where the wild-type allele is an adenine (A) and the mutant allele is a guanine (G). The first set of reagents for detecting the RHOA F25L mutation comprises a mutation-specific primer selected from SEQ ID NO: 1-14, a paired primer selected from SEQ ID NO: 15-20, and an oligoblocker selected from SEQ ID NO:21-31, 34-38. Most preferably, the mutation-specific primer is selected from SEQ ID NO: 5-7, 11-16, the paired primer is selected from SEQ ID NO: 15, 17-20 and the oligoblocker is selected from SEQ ID NO: 23-24, 36-37. In another embodiment, a different paired primer can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412715-49412925 or chr3: 49412975-4913185 (human assembly GRCh37/hg19), according to the orientation of the allele-specific primer. A different oligoblocker can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412925-49412975 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412950 must be included in the selected oligoblocker sequence. In a preferred embodiment, the method amplifies a second WT target sequence, located preferably 200-400 bp from the first mutated target sequence, using a second set of reagents. In a more preferred embodiment, the second set of reagents comprises a first primer SEQ ID NO: 32 and a second primer SEQ ID NO: 33.

[0281] Primer Design for the Allele-Specific RHOA F25L IntPlex® System

[0282] The allele-specific primers considered in the design of this invention and their thermodynamic characteristics are listed in Table 2:

TABLE-US-00011 TABLE 2 List of all the RHOA F25L allele-specific primers considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Primer name Sequence Length Tm (° C.) GC% GC% tail self-dimers Hairpins Conventional configuration F25L 22 CTGGGAACTGGTCCTTGCTGAG 22 70 F25L 21 TGGGAACTGGTCCTTGCTGAG 21 66 F25L 20 GGGAACTGGTCCTTGCTGAG 20 64 F25L 19 GGAACTGGTCCTTGCTGAG 19 60 F25L 18 GAACTGGTCCTTGCTGAG 18 56 55.6  57.1 none none F25L 17 AACTGGTCCTTGCTGAG 17 52 52.9  57.1 none none F25L 16 ACTGGTCCTTGCTGAG 16 50 56.3  57.1 none none Inverse configuration F25L|22 AAGACATGCTTGCTCATAGTCC 22 64 F25L|21 AGACATGCTTGCTCATAGTCC 21 62 F25L|20 GACATGCTTGCTCATAGTCC 20 60 F25L|19 ACATGCTTGCTCATAGTCC 19 56 47.4  42.9  -2.17  -0.1 F25L|18 CATGCTTGCTCATAGTCC 18 54 50  42.9  -2.17  -0.1 F25L|17 ATGCTTGCTCATAGTCC 17 50 47.1  42.9  -0.22  -0.1 F25L|16 TGCTTGCTCATAGTCC 16 48 50  42.9 none none Accepted values for the parameters  16-22 45-55° 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (allele-specific primer) bp C. mol mol

[0283] Paired Wild-Type Primer

[0284] Results obtained with Primer 3

[0285] All allele-specific primers that met IntPlex® criteria (see Table 2) were used on Primer3 to find a compatible paired primer. Results are summarised in Table 3.

TABLE-US-00012 TABLE 3 List of all the RHOA F25L paired WT primers produced by Primer 3 and considered in the design of this invention and their thermodynamic characteristics. Allele- Allele-specific Paired WT Off target specific Primer Tm primer Paired Amplicon Tm GC% self- Off with wt allele- Primer (Primer3) name WT primer sequence Length size (° C.) GC% tail dimers Hairpins target? specific? F25L 18 54.95 F25 P20 AGAAACTGGTGATTGTTGGT 20   74 55.07 40  42.9  -0.07   0.04 no no F25L 17 53.35 F25 P20 AGAAACTGGTGATTGTTGGT 20   73 55.07 40  42.9  -0.07   0.04 no no F25L 16 52.18 F25 P20 AGAAACTGGTGATTGTTGGT 20   72 55.07 40  42.9  -0.07   0.04 no no F25L 19 54.96 F25 | P20 P3 CCTCGATATCTGCCACATAG 20   88 54.93 50  42.9  -3.86 Accepted values for the parameters in analysis 16-25 <100 bp ΔTm with 10-60% >25% >-4 Kcal/ >-3 Kcal/ no no (paired WT primer) bp paired mol mol primer <5° C.

[0286] Note that Tm are calculated following the recommended Primer3 algorithm. Accepted values are presented with white background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded.

[0287] From the results presented in Table 2 it was possible to select a definite candidate as paired WT primer for the RHOA F25L allele-specific primers F25L 18, F25L 17 and F25L 16 in conventional configuration.

[0288] On the other hand, the only potential paired wt-primer according to the allele-specific primers in inverse configuration F25L I 19, F25L I 18, F25L I 17, F25L I 16 contains a region of self-dimerization outside the accepted range.

[0289] The paired-wild type primer in inverse configuration may be manually designed following the thermodynamic criteria described in section 3.4.2 (common part of the patent file) and avoiding the self-dimerization region.

[0290] The paired WT primer F25 P20 in conventional configuration is suitable for in vitro evaluation, in combination with the allele-specific primers: F25L I 19, F25L I 18, F25L I 17, F25L I 16.

[0291] Region triggering high self-dymerisation in inverse configuration

TABLE-US-00013 SEQ ID No: 135 TTCCATCCACCTCGATATCTGCCACATAGTTCTCAAACACTGTGGGCAC ATACACCTCTGGGAACTGGTCCTTGCTGAGGACTATGAGCAAGCATGTC TTTCGATATC

[0292] Region triggering self-annealing as predicted by the In Silica software.

TABLE-US-00014 SEQ ID No: 136 GGACTATGAGCAAGCATGTCTT
—position of the allele-specific primer in inverse configuration.

[0293] Manually generated primer pair candidates in inverse configuration

TABLE-US-00015 TABLE 4 List of all potential RHOA F25 paired WT-primers in conventional configuration manually generated and considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer ® software. Accepted values are presented with white background and borderline values are presented with light grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Allele- Allele- Paired WT Off target specific specific primer Paired Amplicon Tm GC% self- with wt Primer Primer Tm name WT primer sequence Length size (° C.) GC% tail dimers Hairpins Off target? allele-specific? F25L | 19 56 F25 | P21 CCACATAGTTCTCAAACACTG 21   76 60 42.9  42.9  -0.07   0.04 Partial. Evaluate in silico. F25 | P20 CACATAGTTCTCAAACACTG 20   75 56 40.00  42.9  -0.07   0.04 Partial. Evaluate in silico. F25L | 18 54 F25 | P20 CACATAGTTCTCAAACACTG 20   74 56 40.00  42.9  -0.07   0.04 Partial. Evaluate in silico. F25 | P19 ACATAGTTCTCAAACACTG 19   73 52 36.80  42.9  -0.07   0.04 Partial. Evaluate in silico. F25L | 17 50 F25 | P20 CACATAGTTCTCAAACACTG 20   73 56 40.00  42.9  -0.07   0.04 Partial. Evaluate in silico. F25 | P19 ACATAGTTCTCAAACACTG 19   72 52 36.80  42.9  -0.07   0.04 Partial. Evaluate in silico. F25L | 16 48 F25 | P19 ACATAGTTCTCAAACACTG 19   71 52 36.80  42.9  -0.07   0.04 Partial. Evaluate in silico. F25 | P18 CATAGTTCTCAAACACTG 18   70 50 38.90  42.9  -0.07   0.04 Partial. Evaluate in silico. Accepted values for the parameters in analysis 16-25 <100 ΔTm with 10-60% >25% >-4 Kcal/ >-3 Kcal/ no no (paired WT primer) bp bp paired mol mol primer <5° C.

[0294] The following combinations meet the thermodynamic criteria required: [0295] F25L I 19+F25 I P21 [0296] F25L i 19+F25 I P20 [0297] F25L i 18+F25 I P20 [0298] F25L i 18+F25 I P19 [0299] F25L i 17+F25 I P20 [0300] F251, i 17+F25 I P19 [0301] F25L i 16+F25 I P19 [0302] F25L i 16+F25 I P18

[0303] Blat alignment of the validated primer pairs in conventional sense

TABLE-US-00016 >F25L_18 + F25_P20/74 bp SEQ ID No: 137 GAACTGGTCCTTGCTGAGgactatgagcaagcatgtctttccacaggct ccatcACCAACAATCACCAGTTTCT >F25L_17 + F25_P20/73 bp SEQ ID No: 138 AACTGGTCCTTGCTGAGgactatgagcaagcatgtctttccacaggctc catcACCAACAATCACCAGTTTCT >F25L_16 + F25_P20/72 bp

TABLE-US-00017 SEQ ID No: 139 ACTGGTCCTTGCTGAGgactatgagcaagcatgtctttccacaggctcc atcACCAACAATCACCAGTTTCT

[0304] When in conventional configuration, the forward primers (F25L_18, F25L_17, F25L_16) hit a secondary region of homology on chromosome 6, with all but the allele-specific position of the primer matching the secondary target. Nevertheless, as indicated from the characteristics of the reported homology (FIG. 17), the homology region does not cover the landing site of the reverse primer, so that no amplification outside the true target region will be possible. This primer combination can hence be accepted and analysed further.

[0305] All primer pairs in conventional configuration are expected to produce just one single amplicon at the expected chromosomal position. No other homologies are reported.

[0306] The following combinations in conventional configuration meet the thermodynamic criteria required: [0307] F25L 18 +F25L P20 [0308] F25L 17 +F25L P20 [0309] F25L 16+F25L P20

[0310] 1.1.4. Blat alignment of the validated primer pairs in inverse configuration

TABLE-US-00018 >F25L_I_19 + F25_I_P21/76 bp SEQ ID No: 140 CCACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggt ccttgctgaGGACTATGAGCAAGCATGT >F25L_I_19 + F25_I_P20/75 bp SEQ ID No: 141 CACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtc cttgctgaGGACTATGAGCAAGCATGT >F25L_I_18 + F25_I_P20/74 bp SEQ ID No: 142 CACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtc cttgctgaGGACTATGAGCAAGCATG >F25L_I_18 + F25_I_P19/74 bp SEQ ID No: 143 ACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtcc ttgctgaGGACTATGAGCAAGCATG >F25L_I_17 + F25_I_P20/73 bp SEQ ID No: 144 CACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtc cttgctgaGGACTATGAGCAAGCAT >F25L_I_17 + F25_I_P19/72 bp SEQ ID No: 145 ACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtcc ttgctgaGGACTATGAGCAAGCAT >F25L_I_16 + F25_I_P19/71 bp SEQ ID No: 146 ACATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtcc ttgctgaGGACTATGAGCAAGCA >F25L_I_16 + F25_I_P18/70 bp SEQ ID No: 147 CATAGTTCTCAAACACTGtgggcacatacacctctgggaactggtcct tgctgaGGACTATGAGCAAGCA

[0311] By working in inverse configuration, it is possible to observe a high homology region on chromosome 6. From closer analysis of the homology structure and distribution, it is possible to notice that there should be enough base pair differences in the primers binding site for ensuring specific amplification of amplicon of interest on chromosome 3, as highlighted in FIG. 3. Nevertheless, this aspect should be flagged during the in vitro testing, aimed at excluding any risk of secondary amplification.

[0312] Wet-lab validation will be performed preferentially on all thermodynamically suitable primer pairs in conventional configuration. In case this strategy fails the QC, all thermodynamically suitable primers in inverse configuration will be tested.

[0313] The following combinations of primers in inverse configuration can be tested as backup: [0314] F25L I 19+F25 I P21 [0315] F25L i 19+F25 I P20 [0316] F25L i 18+F25 I P20 [0317] F25L i 18+F25 I P19 [0318] F25L i 17+F25 I P20 [0319] F25L i 17+F25 I P19 [0320] F25L i 16+F25 I P19 [0321] F25L i 16+F25 I P18

[0322] 1.2. Oligoblocker Design for the Allele-Specific RHOA F25L System

[0323] 1.2.1. RHOA F25 Oligoblocker Candidates in Conventional Configuration

TABLE-US-00019 SEQ ID No: 148 [00001]embedded image, Wild-type target sequence for RHOA F25   oligoblocker design. [00002]embedded image

TABLE-US-00020 TABLE 5 List of all potential oligoblockers for the RHOA F25L codon, in conventional configuration, considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer ® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded Oligoblocker Tm GC% name Sequence Length (° C.) GC% tail self-dimers Hairpins F25L OB23 TGGTCCTTGCTGAAGACTATGAG 23  68 F25L OB22 GGTCCTTGCTGAAGACTATGAG 22  66 F25L OB21 GTCCTTGCTGAAGACTATGAG 21  62 47.6  42.9  -0.33  -0.21 F25L OB20 TCCTTGCTGAAGACTATGAG 20  58 45  42.9  -0.33  -0.21 F25L OB19 CCTTGCTGAAGACTATGAG 19  56 Accepted values for the parameters 19-23 ~60° 40-60% >25% >-4 Kcal/mol >-3 Kcal/mol in analysis (Oligoblocker) bp C.

[0324] RHOA F25 oligoblocker candidates in inverse configuration

TABLE-US-00021 [00003]embedded image  SEQ ID No: 149: Wild-type target sequence for RHOA  F25 oligoblocker design in inverse configuration. [00004]embedded image

TABLE-US-00022 TABLE 6 List of all potential oligoblockers for the RHOA F.sub.25L codon, in inverse configuration, considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded. Oligoblocker Tm GC % self- name Sequence Length  (° C.) GC % tail dimers Hairpins F25L i OB23 TGCTCATAGTCTTCAGCAAGGAC 23 68 F25L i OB22 GCTCATAGTCTTCAGCAAGGAC 22 66 F25L i OB21 GCTCATAGTCTTCAGCAAGGA 21 62   47.6  57.1 −1.53 −1.41 F25L i OB21/2 CTCATAGTCTTCAGCAAGGAC 21 62   47.6  57.1 −0.33 −0.21 F25L i OB20 CTCATAGTCTTCAGCAAGGA 20 58 45  57.1 −0.33 −0.21 F25L i OB19 CTCATAGTCTTCAGCAAGG 19 56 Accepted values for the parameters 19-23 bp ~60° C. 40-60% >25% > −4 > −3 in analysis (Oligoblocker) Kcal/mol 4Kcal/mol

[0325] Final Thermodynamic Analysis on All Candidate Primers and Oligoblockers

[0326] Heterodimers combinations to consider for all the primers/oligoblocker candidates that met the thermodynamic criteria described in the previous sections: [0327] Allele-specific primer+paired WT primer [0328] Allele-specific primer+oligoblocker [0329] Paired WT primer+oligoblocker

[0330] Thermodynamic analysis in conventional configuration

TABLE-US-00023 TABLE 7 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Oligonucleotide combination ΔG Validated? (conventional) (Kcal/mol) Y/N F25L 18 + F25 P20 −0.07 Y F25L 18 + F25L OB 21 −0.33 Y F25L 18 + F25L OB 20 −0.33 Y F25L 17 + F25 P20 −0.07 Y F25L 17 + F25L OB 21 −0.33 Y F25L 17 + F25L OB 20 −0.33 Y F25L 16 + F25 P20 none Y F25L 16 + F25L OB 21 −0.33 Y F25L 16 + F25L OB 20 −0.33 Y F25 P20 + F25L OB 21 none Y F25 P20 + F25L OB 20 none Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0331] All oligonucleotide candidates in conventional configuration meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0332] Thermodynamic analysis in inverse configuration

TABLE-US-00024 TABLE 8 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Accepted values are presented with white background and non-acceptable values are presented with dark grey background. Oligonucleotide combination ΔG Validated? (inverse) (Kcal/mol) Y/N F25L I 19 + F25 I P21 −0.69 Y F25L I 19 + F25 I P20 −0.69 Y F25L I 18 + F25 I P20 −0.69 Y F25L I 18 + F25 I P19 −0.69 Y F25L I 17 + F25 I P20 −0.69 Y F25L I 17 + F25 I P19 −0.69 Y F25L I 16 + F25 I P19 −0.69 Y F25L I 16 + F25 I P18 −0.69 Y F25L I 19 + F25L i OB21 −7.03 N F25L I 19 + F25L i OB21/2 −7.03 N F25L I 19 + F25L i OB20 −7.03 N F25L I 18 + F25L i OB21 −7.03 N F25L I 18 + F25L i OB21/2 −7.03 N F25L I 18 + F25L i OB20 −7.03 N F25L I 17 + F25L i OB21 −7.03 N F25L I 17 + F25L i OB21/2 −7.03 N F25L I 17 + F25L i OB20 −7.03 N F25L I 16 + F25L i OB21 −7.03 N F25L I 16 + F25L i OB21/2 −7.03 N F25L I 16 + F25L i OB20 −7.03 N F25 I P21 + F25L i OB21 −0.34 Y F25 I P21 + F25L i OB21/2 −0.34 Y F25 I P21 + F25L i OB20 −0.34 Y F25 I P20 + F25L i OB21 −0.34 Y F25 I P20 + F25L i OB21/2 −0.34 Y F25 I P20 + F25L i OB20 −0.34 Y F25 I P19 + F25L i OB21 −0.34 Y F25 I P19 + F25L i OB21/2 −0.34 Y F25 I P19 + F25L i OB20 −0.34 Y F25 I P18 + F25L i OB21 −0.34 Y F25 I P18 + F25L i OB21/2 −0.34 Y F25 I P18 + F25L i OB20 −0.34 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0333] All oligoblockers designed in inverse configuration do not meet the thermodynamic criteria required to ensure absence of primer dimers.

[0334] New oligoblockers should be designed in inverse configuration.

[0335] New Oligoblocker Design in Inverse Configuration

[0336] Given the results obtained in the previous paragraph, a new set of oligoblockers was generated in silico shifting the position of the wild-type allele towards the oligoblocker 3′ to avoid the region of homology with the allele specific primers.

TABLE-US-00025 TABLE 9 List of all potential oligoblockers for the RHOA F25L codon, in inverse configuration, considered in the design of this invention and their thermodynamic Oligoblocker Tm GC% self- name Sequence Length (° C.) GC% tail dimers Hairpins F25L i OB23/2 ACATGCTTGCTCATAGTCTTCAG 23  66 F25L i OB22/2 CATGCTTGCTCATAGTCTTCAG 22  64 F25L i OB21/3 ATGCTTGCTCATAGTCTTCAG 21  60 42.9  42.9  -0.22  -0.1 F25L i OB20/2 TGCTTGCTCATAGTCTTCAG 20  58 45  42.9 none none F25L i OB19/2 GCTTGCTCATAGTCTTCAG 19  56 Accepted values for the parameters 19-23 ~60° 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (Oligoblocker) bp C. mol mol

[0337] characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded.

[0338] New Thermodynamic Analysis in Inverse Configuration

TABLE-US-00026 TABLE 10 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Accepted values are presented with white background. Oligonucleotide combination ΔG Validated? (inverse) (Kcal/mol) Y/N F25L I 19 + F25L i OB21/3 −0.22 Y F25L I 19 + F25L i OB20/2 −0.22 Y F25L I 18 + F25L i OB21/3 −0.22 Y F25L I 18 + F25L i OB20/2 −0.22 Y F25L I 17 + F25L i OB21/3 −0.22 Y F25L I 17 + F25L i OB20/2 −0.22 Y F25L I 16 + F25L i OB21/3 −0.22 Y F25L I 16 + F25L i OB20/2 none Y F25 I P21 + F25L i OB21/3 −0.69 Y F25 I P21 + F25L i OB20/2 −0.69 Y F25 I P20 + F25L i OB21/3 −0.69 Y F25 I P20 + F25L i OB20/2 −0.69 Y F25 I P19 + F25L i OB21/3 −0.69 Y F25 I P19 + F25L i OB20/2 −0.69 Y F25 I P18 + F25L i OB21/3 −0.69 Y F25 I P18 + F25L i OB20/2 −0.69 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0339] Design of the F25L Wild-Type Set

[0340] RHOA F25 Wild-Type Set Candidates

TABLE-US-00027 TABLE 11 Evaluation of all thermodynamic parameters considered to select appropriate oligonucleotides for the RHOA F25 wild-type set. Accepted values are presented with white background. Primer Tm GC% self- Validated name Sequence Length (° C.) GC% tail dimers Hairpins Heterodimers (Y/N) F25 WT L GCAGGATGAGAATGGATTC 19 56 47.4  42.9  -1.78  -0.19 (32.3° C.)  -1.88 Y F25 WT R GAATTAGAGCTTTTTGCCTC 20 56 40  57.1  -3.13   0.16 (42.8° C.) Y Accepted values for the parameters 16-22 55-60°C 40-60% >25% >-4 Kcal/ >-3 Kcal/ >-4 Kcal/ Y in analysis (wild-type primer set) bp ΔTm with mol mol mol paired

[0341] Blat Alignment of the Validated Primer Pairs in Conventional Sense

[0342] The Blat local alignment (as shown in FIG. 4) highlighted the presence of secondary homology regions that are not spanning the primers landing sites. No secondary product is expected to be produced. This primer combination can hence be validated.

[0343] The oligonucleotide candidates of the RHOA 25 WT set meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0344] RHOA G17V

[0345] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0346] More specifically, in a preferred embodiment, the mutation is RHOA G17V, where the glucine to valine change is due to a single point mutation at position chr3: 49412973 (human assembly GRCh37/hg19) where the wild-type allele is a cytosine (C) and the mutant allele is an adenine (A). The first set of reagents for detecting the RHOA G17V mutation comprises a mutation-specific primer selected from SEQ ID NO: 39-52, a paired primer selected from SEQ ID NO: 53-59, and an oligoblocker selected from SEQ ID NO: 60-69. Most preferably, the mutation-specific primer is selected from SEQ ID NO: 43-44, 50-51, the paired primer is selected from SEQ ID NO: 53-54, 58-59 and the oligoblocker is selected from SEQ ID NO: 62-64, 67-69. In another embodiment, a different paired primer can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412738-49412948 and/or chr3: 49412998-49413208 (human assembly GRCh37/hg19). A different oligoblocker can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412948-49412998 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412973 must be included in the selected oligoblocker sequence. In a preferred embodiment, the method amplifies a second WT target sequence, located preferably 200-400 bp from the first mutated target sequence, using a second set of reagents. In a more preferred embodiment, the second set of reagents comprises a first primer SEQ ID NO: 70 and a second primer SEQ ID NO: 71.

[0347] Primer Design for the Allele-Specific RHOA G17V System

[0348] The allele-specific primers considered in the design of this invention and their thermodynamic characteristics are listed in Table 12:

TABLE-US-00028 TABLE 12 List of all the RHOA G17V allele-specific primers considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Primer name Sequence Length Tm (° C.) GC% GC% tail self-dimers Hairpins Conventional configuration G17V 22 ACTATGAGCAAGCATGTCTTTA 22 60 G17V 21 CTATGAGCAAGCATGTCTTTA 21 58 G17V 20 TATGAGCAAGCATGTCTTTA 20 54 35  28.6  -2.17  -0.21 G17V 19 ATGAGCAAGCATGTCTTTA 19 52 36.8  28.6  -2.17  -0.21 G17V 18 TGAGCAAGCATGTCTTTA 18 50 38.9  28.6  -2.17  -0.21 G17V 17 GAGCAAGCATGTCTTTA 17 48 41.2  28.6  -2.17  -0.21 G17V 16 AGCAAGCATGTCTTTA 16 44 37.5  28.6  -2.17  -0.21 Inverse configuration G17V | 22 TTGTTGGTGATGGAGCCTGTGT 22 66 G17V | 21 TGTTGGTGATGGAGCCTGTGT 21 64 G17V | 20 GTTGGTGATGGAGCCTGTGT 20 62 G17V | 19 TTGGTGATGGAGCCTGTGT 19 58 G17V | 18 TGGTGATGGAGCCTGTGT 18 56 55.6  57.1 none none G17V | 17 GGTGATGGAGCCTGTGT 17 54 58.8  58.1 none none G17V | 16 GTGATGGAGCCTGTGT 16 50 56.3  59.1 none none Accepted values for the parameters 16-22 45-55° 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (allele-specific orimer) bp C. mol mol

[0349] RHOA G17V

[0350] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0351] More specifically, in a preferred embodiment, the mutation is RHOA G17V, where the glycine to valine change is due to a single point mutation at position chr3: 49412973 (human assembly GRCh37/hg19) where the wild-type allele is a cytosine (C) and the mutant allele is an adenine (A). The first set of reagents for detecting the RHOA G17V mutation comprises a mutation-specific primer selected from SEQ ID NO: 39-52, a paired primer selected from SEQ ID NO: 53-59, and an oligoblocker selected from SEQ ID NO: 60-69. Most preferably, the mutation-specific primer is selected from SEQ ID NO: 43-44, 50-51, the paired primer is selected from SEQ ID NO: 53-54, 58-59 and the oligoblocker is selected from SEQ ID NO: 62-64, 67-69. In another embodiment, a different paired primer can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412738-49412948 and/or chr3: 49412998-49413208 (human assembly GRCh37/hg19). A different oligoblocker can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412948-49412998 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412973 must be included in the selected oligoblocker sequence. In a preferred embodiment, the method amplifies a second WT target sequence, located preferably 200-400 bp from the first mutated target sequence, using a second set of reagents. In a more preferred embodiment, the second set of reagents comprises a first primer SEQ ID NO: 70 and a second primer SEQ ID NO: 71.

[0352] Primer Design for the Allele-Specific RHOA G17V System

[0353] The allele-specific primers considered in the design of this invention and their thermodynamic characteristics are listed in Table 13:

TABLE-US-00029 TABLE 13 List of all the RHOA G17V allele-specific primers considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Primer name Sequence Length Tm (° C.) GC% GC% tail self-dimers Hairpins Conventional configuration G17V 22 ACTATGAGCAAGCATGTCTTTA 22 60 G17V 21 CTATGAGCAAGCATGTCTTTA 21 58 G17V 20 TATGAGCAAGCATGTCTTTA 20 54 35  28.6  -2.17  -0.21 G17V 19 ATGAGCAAGCATGTCTTTA 19 52 36.8  28.6  -2.17  -0.21 G17V 18 TGAGCAAGCATGTCTTTA 18 50 38.9  28.6  -2.17  -0.21 G17V 17 GAGCAAGCATGTCTTTA 17 48 41.2  28.6  -2.17  -0.21 G17V 16 AGCAAGCATGTCTTTA 16 44 37.5  28.6  -2.17  -0.21 Inverse configuration G17V | 22 TTGTTGGTGATGGAGCCTGTGT 22 66 G17V | 21 TGTTGGTGATGGAGCCTGTGT 21 64 G17V | 20 GTTGGTGATGGAGCCTGTGT 20 62 G17V | 19 TTGGTGATGGAGCCTGTGT 19 58 G17V | 18 TGGTGATGGAGCCTGTGT 18 56 55.6  57.1 none none G17V | 17 GGTGATGGAGCCTGTGT 17 54 58.8  58.1 none none G17V | 16 GTGATGGAGCCTGTGT 16 50 56.3  59.1 none none Accepted values for the parameters 16-22 45-55° 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (allele-specific orimer) bp C. mol mol

[0354] Paired Wild-Type Primer

[0355] Results Obtained with Primer 3

[0356] All allele-specific primers that met the IntPlex® criteria (see Table 13) were used on Primer3 to find a compatible paired primer. Results are summarised in Table 14.

TABLE-US-00030 TABLE 14 List of all the RHOA G17V paired WT primers produced by Primer 3 and considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated following the recommended Primers algorithm. Accepted values are presented with white background and borderline values are presented with light grey background. In the eventuality that one of the parameters in analysis falls Allele- Allele-specific Paired WT Off target specific PrimerTm primer Paired Amplicon Tm GC%  self- Off with wt allele- Primer (Primer3) name WT primer sequence Length size (° C.) GC% tail dimers Hairpins target? specific? G17V | 18 58.09 G17 | P18 TTCTCAAACACTGTGGGC 18  90 55.06 50  71.4  -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19  58 55.84 52.63  57.1  -0.33  -0.21 no no G17V | 17 55.95 G17 | P18 TTCTCAAACACTGTGGGC 18  89 55.06 50  71.4  -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19  57 55.84 52.63  57.1  -0.33  -0.21 no no G17V | 16 52.65 G17 | P20 TCTGCCACATAGTTCTCAAA 20  100 54.29 40  28.6 none none no no Accepted values forthe parameters 16-25 <100 bp ΔTm with 40-60% >25% >-4 Kcal/ -3 Kcal/ no no in analysis (paired WT primer) bp paired mol mol primer <5’C

[0357] outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded.

[0358] From the results presented in Table 14 it was possible to identify potential candidates as paired WT primer for the RHOA G17V allele-specific primers G17V I 18, G17V I 17 and G17V I 16 in inverse configuration.

[0359] On the other hand, Primer3 did not retrieve any candidate in conventional configuration.

[0360] The paired-wild type primer in conventional configuration may be manually designed following the thermodynamic criteria described above.

[0361] The paired WT primers G17 I P20, G17 I P19 and G17 I P18 in inverse configuration is suitable for in vitro evaluation, in combination with the allele-specific primers: G17V I 18, G17V I 17 and G17V I 16.

[0362] Manually Generated Primer Pair Candidates in Conventional Configuration

TABLE-US-00031 TABLE 15 List of potential RHOA G17 paired WT- primers in conventional configuration manually generated and considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background and borderline values are presented with light grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Allele- Allele- Off target specific specific Paired WT Paired Amplicon Tm GC% self- Off with wt allele- Primer Primer Tm primer name WT primer sequence Length size (° C.) GC% tail dimers Hairpins target? specific? G17V 20 54 G17 P21 TCTGTGTTTTGTGTTTCAGCA 21   90 58 38.1  42.9  -0.34  -0.22 no no G17 P20 CTGTGTTTTGTGTTTCAGCA 20   89 56 40.00  42.9  -0.34  -0.22 no no G17V 19 52 G17 P21 TCTGTGTTTTGTGTTTCAGCA 21   89 58 38.1  42.9  -0.34  -0.22 no no G17 P20 CTGTGTTTTGTGTTTCAGCA 20   88 56 40.00  42.9  -0.34  -0.22 no no G17V 18 50 G17 P20 CTGTGTTTTGTGTTTCAGCA 20   87 56 40.00  42.9  -0.34  -0.22 no no G17 P19 TGTGTTTTGTGTTTCAGCA 19   86 52 36.80  42.9 none none no no G17V 17 48 G17 P19 TGTGTTTTGTGTTTCAGCA 19   85 52 36.80  42.9 none none no no G17 P18 GTGTTTTGTGTTTCAGCA 18   84 50 38.90  42.9 none none no no Accepted values for the parameters 16-25 <100 bp ΔTm with 10-60% >25% >-4 Kcal/ >-3 Kcal/ no no in analysis (paired WT primer) bp paired mol mol primer <5° C.

[0363] The following combinations meet the thermodynamic criteria required: [0364] G17V 20+G17 P21 [0365] G17V 20+G17 P20 [0366] G17V 19+G17 P21 [0367] G17V 19+G17 P20 [0368] G17V 18+G17 P20 [0369] G17V 18+G17 P19 [0370] G17V 17+G17 P19 [0371] G17V 17+G17 P18

[0372] Blat alignment of the validated primer pairs in conventional sense

TABLE-US-00032 >G17V_20 + G17_P21/90 bp SEQ ID No: 150 TATGAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagt ttcttccggatggcagccatTGCTGAAACACAAAACACAGA >G17V_20 + G17_P20/89 bp SEQ ID No: 151 TATGAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagt ttcttccggatggcagccatTGCTGAAACACAAAACACAG >G17V_19 + G17_P21/89 bp SEQ ID No: 152 ATGAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagtt tcttccggatggcagccatTGCTGAAACACAAAACACAGA >G17V_19 + G17_P20/88 bp SEQ ID No: 153 ATGAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagtt tcttccggatggcagccatTGCTGAAACACAAAACACAG >G17V_18 + G17_P20/87 bp SEQ ID No: 154 TGAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagttt cttccggatggcagccatTGCTGAAACACAAAACACAG >G17V_18 + G17_P19/86 bp SEQ ID No: 155 TGAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagttt cttccggatggcagccatTGCTGAAACACAAAACACA >G17V_17 + G17_P19/85 bp SEQ ID No: 156 GAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagtttc ttccggatggcagccatTGCTGAAACACAAAACACA >G17V_17 + G17_P18/84 bp SEQ ID No: 157 GAGCAAGCATGTCTTTAcacaggctccatcaccaacaatcaccagtttc ttccggatggcagccatTGCTGAAACACAAAACAC

[0373] When in conventional configuration, all the paired primers hit two secondary regions of homology on chromosome 6, with all but the allele-specific position of the primer matching the secondary target. Nevertheless, as indicated from the characteristics of the reported homology (FIG. 5), the homology region does not cover the landing site of the forward primer, so that no amplification outside the true target region will be possible. These primer combinations can hence be accepted and analysed further (see FIG. 6.

[0374] All primer pairs in conventional configuration are expected to produce just one single amplicon at the expected chromosomal position. No other homologies are reported.

[0375] All tested combinations in conventional configuration meet the thermodynamic criteria required.

[0376] Blat alignment of the validated primer pairs in inverse configuration (FIG. 7)

TABLE-US-00033 >G17V_I18 + G17_IP18/90 bp SEQ ID No: 158 TTCTCAAACACTGTGGGCacatacacctctgggaactggtccttgctga agactatgagcaagcatgtctttACACAGGCTCCATCACCA >G17V_I18 + G17_IP19/58 bp SEQ ID No: 159 GAACTGGTCCTTGCTGAAGactatgagcaagcatgtctttACACAGGCT CCATCACCA  >G17V_I17 + G17_IP18/89 bp SEQ ID No: 160 TTCTCAAACACTGTGGGCacatacacctctgggaactggtccttgctga agactatgagcaagcatgtctttACACAGGCTCCATCACC >G17V_I17 + G17_IP19/57 bp SEQ ID No: 161 GAACTGGTCCTTGCTGAAGactatgagcaagcatgtctttACACAGGCT CCATCACC >G17V_I16 + G17_IP20/100 bp SEQ ID No: 162 TCTGCCACATAGTTCTCAAAcactgtgggcacatacacctctgggaact ggtccttgctgaagactatgagcaagcatgtctttACACAGGCTCCATC AC

[0377] G17V_I16+G17_IP20/100 bp: This combination is OK, as the homology does not affect any of the primer binding sites.

[0378] G17V_I17+G17_IP18/89 bp: This combination is OK, as the homology does not affect any of the primer binding sites.

[0379] G17V_I17+G17_IP19/57 bp: homology region on chromosome 6 that affects the paired primer binding site. Nevertheless, the allele-specific primer is specific so no non-specific product should be amplified.

[0380] G17V_I18+G17_IP18/90 bp: This combination is OK, as the homology does not affect any of the primer binding sites.

[0381] G17V_I18+G17_IP19/58 bp: homology region on chromosome 6 that affects the paired primer binding site. Nevertheless, the allele-specific primer is specific so no non-specific product should be amplified.

[0382] By working in inverse configuration, it is possible to observe a homology region on chromosome 6 when using the paired wt primer G17 I P19 (FIG. 8). It is important to notice that the allele-specific primer is not included in the homology region so this is unlikely to generate non-specific products. Nevertheless, this aspect should be flagged during the in vitro testing, aimed at excluding any risk of secondary amplification.

[0383] Wet-lab validation will be performed preferentially on all thermodynamically suitable primer pairs

[0384] Oligoblocker Design for the Allele-Specific RHOA G17V System

[0385] RHOA G17 Oligoblocker Candidates in Conventional Configuration

TABLE-US-00034 SEQ ID No: 163 [00005]embedded image Wild-type target sequence for RHOA F25  oligoblocker design. [00006]embedded image

TABLE-US-00035 TABLE 16 List of all potential oligoblockers for the RHOA G.sub.17 codon, in conventional configuration, considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded Oligoblocker Tm GC % self- name Sequence Length (° C.) GC % tail dimers Hairpins G17 OB23 CATGTCTTTCCACAGGCTCCATC 23 70 G17 OB22 ATGTCTTTCCACAGGCTCCATC 22 66 G17 OB21 ATGTCTTTCCACAGGCTCCAT 21 62 47.6  57.1 −0.22 −0.1 G17 OB20 ATGTCTTTCCACAGGCTCCA 20 60 50  71.4 −0.08 0.04 G17 OB19 ATGTCTTTCCACAGGCTCC 19 58 52.6   71.4 −0.08 0.04 Accepted values for the parameters 19-23 bp ~60° C. 40-60% >25% > −4 > −3 in analysis (Oligoblocker) Kcal/mol Kcal/mol

[0386] RHOA G17 Oligoblocker Candidates in Inverse Configuration

TABLE-US-00036 SEQ ID No: 164 [00007]embedded image  Wild-type target sequence for RHOA G17  oligoblocker design in inverse configuration. [00008]embedded image

TABLE-US-00037 TABLE 17 List of all potential oligoblockers for the RHOA G.sub.17 codon, in inverse configuration, considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded. Oligoblocker Tm GC % self- name Sequence Length (° C.) GC % tail dimers Hairpins G17 | OB23 ATGGAGCCTGTGGAAAGACATGC 23 70 G17 | OB22 ATGGAGCCTGTGGAAAGACATG 22 66 G17 | OB21 ATGGAGCCTGTGGAAAGACAT 21 62 47.6 28.6 −0.22 −0.1 G17 | OB20 ATGGAGCCTGTGGAAAGACA 20 60 50 28.6 −0.08 0.04 G17 | OB19 TGGAGCCTGTGGAAAGACA 19 58 52.6 28.6 −0.08 0.04 Accepted values for the parameters 19-23 bp ~60° C. 40-60% >25% > −4 > −3 in analysis (Oligoblocker) Kcal/mol Kcal/mol

[0387] Final Thermodynamic Analysis on All Candidate Primers and Oligoblockers

[0388] Heterodimers combinations to consider for all the primers/oligoblocker candidates that met the thermodynamic criteria described in the previous sections: [0389] Allele-specific primer+paired WT primer [0390] Allele-specific primer+oligoblocker [0391] Paired WT primer+oligoblocker

[0392] Thermodynamic analysis in conventional configuration

TABLE-US-00038 TABLE 18 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Oligonucleotide combination ΔG Validated? (conventional) (Kcal/mol) Y/N G17V 20 + G17 P21 −0.69 Y G17V 20 + G17 P20 −0.69 Y G17V 20 + G17 OB21 −3.1 Y G17V 20 + G17 OB20 −3.1 Y G17V 20 + G17 OB19 −3.1 Y G17V 19 + G17 P21 −0.69 Y G17V 19 + G17 P20 −0.69 Y G17V 19 + G17 OB21 −3.1 Y G17V 19 + G17 OB20 −3.1 Y G17V 19 + G17 OB19 −3.1 Y G17V 18 + G17 P20 −0.69 Y G17V 18 + G17 P19 −0.69 Y G17V 18 + G17 OB21 −3.1 Y G17V 18 + G17 OB20 −3.1 Y G17V 18 + G17 OB19 −3.1 Y G17V 17 + G17 P19 −0.69 Y G17V 17 + G17 P18 −0.69 Y G17V 17 + G17 OB21 −3.1 Y G17V 17 + G17 OB20 −3.1 Y G17V 17 + G17 OB19 −3.1 Y G17 P21 + G17 OB21 −3.64 N G17 P21 + G17 OB20 −3.64 N G17 P21 + G17 OB19 −3.64 N G17 P20 + G17 OB21 −3.64 N G17 P20 + G17 OB20 −3.64 N G17 P20 + G17 OB19 −3.64 N G17 P19 + G17 OB21 −2.04 Y G17 P19 + G17 OB20 −2.04 Y G17 P19 + G17 OB19 −2.04 Y G17 P18 + G17 OB21 −2.04 Y G17 P18 + G17 OB20 −2.04 Y G17 P18 + G17 OB19 −2.04 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0393] The oligonucleotide combinations that passed the thermodynamic QC analysis are:

TABLE-US-00039 G17V 18 + G17 P19 + G17 OB21 G17V 18 + G17 P19 + G17 OB20 G17V 18 + G17 P19 + G17 OB19 G17V 17 + G17 P19 + G17 OB21 G17V 17 + G17 P19 + G17 OB20 G17V 17 + G17 P19 + G17 OB19 G17V 18 + G17 P18 + G17 OB21 G17V 18 + G17 P18 + G17 OB20 G17V 18 + G17 P18 + G17 OB19 G17V 17 + G17 P18 + G17 OB21 G17V 17 + G17 P18 + G17 OB20 G17V 17 + G17 P18 + G17 OB19

[0394] All the oligonucleotide candidates in conventional configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification to and to improve the amplification efficiency.

[0395] It should be reported and considered in the following in vitro validation phases that all possible allele-specific primers form borderline hetero-dimers with the oligoblockers in conventional configuration. This cannot be avoided given the mutation position.

[0396] Thermodynamic analysis in inverse configuration

TABLE-US-00040 TABLE 19 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Accepted values are presented with white background and non-acceptable values are presented with dark grey background. Oligonucleotide combination ΔG Validated? (inverse) (Kcal/mol) Y/N G17V I 18 + G17 I P18 −3 Borderline G17V I 18 + G17 I P19 −1.43 Y G17V I 18 + G17 I OB21 −0.22 Y G17V I 18 + G17 I OB20 −0.08 Y G17V I 18 + G17 I OB19 −0.08 Y G17V I 17 + G17 I P18 −3 Borderline G17V I 17 + G17 I P19 −1.53 Y G17V I 17 + G17 I OB21 −0.22 Y G17V I 17 + G17 I OB20 −0.08 Y G17V I 17 + G17 I OB19 −0.08 Y G17V I 16 + G17 I P20 −2.04 Y G17V I 16 + G17 I OB21 −0.22 Y G17V I 16 + G17 I OB20 −0.08 Y G17V I 16 + G17 I OB19 −0.08 Y G17 I P18 + G17 I OB21 −3 Borderline G17 I P18 + G17 I OB20 −3 Borderline G17 I P18 + G17 I OB19 −3 Borderline G17 I P19 + G17 I OB21 −1.53 Y G17 I P19 + G17 I OB20 −1.53 Y G17 I P19 + G17 I OB19 −1.53 Y G17 I P20 + G17 I OB21 −5.11 N G17 I P20 + G17 I OB20 −5.11 N G17 I P20 + G17 I OB19 −5.11 N Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0397] The oligonucleotide combinations that passed the thermodynamic QC analysis are:

TABLE-US-00041 G17V I 18 + G17 I P18 + G17 I OB21 G17V I 18 + G17 I P18 + G17 I OB20 G17V I 18 + G17 I P18 + G17 I OB19 G17V I 18 + G17 I P19 + G17 I OB21 G17V I 18 + G17 I P19 + G17 I OB20 G17V I 18 + G17 I P19 + G17 I OB19 G17V I 17 + G17 I P18 + G17 I OB21 G17V I 17 + G17 I P18 + G17 I OB20 G17V I 17 + G17 I P18 + G17 I OB19 G17V I 17 + G17 I P19 + G17 I OB21 G17V I 17 + G17 I P19 + G17 I OB20 G17V I 17 + G17 I P19 + G17 I OB19

[0398] Important note: G17V 16 was excluded as according to Primer 3 the only suitable reverse primer was the G17 I P20 that had too strong hetero-dimers with the oligoblockers. Nevertheless, this allele-specific primer per se has acceptable thermodynamic values and should be hence kept as backup option in case all other allele-specific primers fail to pass the in vitro QC.

[0399] Design of the G17 Wild-Type Set

[0400] Given the proximity of the G17 position with the F25 position described in the previous chapter, one feasible option is to use the same WT system devised for F25, on RHOA second intron. A distinct WT set will be designed on RHOA first intron to ensure the reliability of the results.

[0401] RHOA G17 Wild-Type Set Candidates

TABLE-US-00042 TABLE 20 Evaluation of all thermodynamic parameters considered to select appropriate oligonucleotides for the RHOA G17 wild-type set. Accepted values are presented with white background. Primer Tm % GC% Validated name Sequence Length (° C.) GC tail self-dimers Hairpins Heterodimers (Y/N) G17 WTL GACACATGCTTTGGTAACC 19 56 47.4  57.1  -2.17 none  -1.81 Y G17 WTR CTTTTGGTGCCAGGTGGA 18 56 55.6  57.1  -1.81 none Y Accepted values for the parameters 16-22 55-60° C. 40-60% >25% >-4 Kcal/ >-3 Kcal/ >-4 Kcal/ Y in analysis (wild-type primer set) bp ΔTm with mol mol mol paired primer <5° C.

[0402] Blat Alignment of the Validated WT Primer Pairs

[0403] The Blat local alignment (FIG. 9) highlighted the presence of a partial secondary homology region that spans the G17 WT L primer binding site. Nevertheless, there are 4 to mismatches between the secondary target on chromosome 15 and the selected primer.

[0404] Moreover, no homology is reported for the G17 WT R primer binding site, so no secondary product is expected to be produced. This primer combination can hence be validated.

[0405] The oligonucleotide candidates of the RHOA G17 WT set meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0406] RHOA C16STOP

[0407] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0408] More specifically, in a preferred embodiment, the mutation is RHOA C16*, where the cysteine to stop codon change is due to a non-sense single point mutation at position chr3: 49412975 (human assembly GRCh37/hg19) where the wild-type allele is an adenine (A) and the mutant allele is a thymidine (T). The first set of reagents for detecting the RHOA C16* mutation comprises a mutation-specific primer selected from SEQ ID NO: 72-85, a paired primer selected from SEQ ID NO: 53-59, 86-88, and an oligoblocker selected from SEQ ID NO: 60-69. Most preferably, the mutation-specific primer is selected from SEQ ID NO: 75-78, 83-85, the paired primer is selected from SEQ ID NO: 53-54, 58-59, 86-88 and the oligoblocker is selected from SEQ ID NO: 62-64, 67-69. In another embodiment, a different paired primer can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412740-49412950 and/or chr3: 49413000-49413210 (human assembly GRCh37/hg19). A different oligoblocker can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412950-49413000 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412975 must be included in the selected oligoblocker sequence. In a preferred embodiment, the method amplifies a second WT target sequence, located preferably 200-400 bp from the first mutated target sequence, using a second set of reagents. In a more preferred embodiment, the second set of reagents comprises a first primer SEQ ID NO: 70 and a second primer SEQ ID NO: 71.

[0409] Primer Design for the Allele-Specific RHOA C16* System

[0410] The allele-specific primers considered in the design of this invention and their thermodynamic characteristics are listed in Table 21:

TABLE-US-00043 TABLE 21 List of all the RHOA C16* allele-specific primers considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Primer name Sequence Length Tm (° C.) GC% GC% tail self-dimers Hairpins Conventional configuration C16*22 TATGAGCAAGCATGTCTTTCCT 22 62 C16*21 ATGAGCAAGCATGTCTTTCCT 21 60 C16*20 TGAGCAAGCATGTCTTTCCT 20 58 C16*19 GAGCAAGCATGTCTTTCCT 19 56 47.4  42.9 -2.17  -0.21 C16*18 AGCAAGCATGTCTTTCCT 18 52 44.4  42.9    -2.17  -0.21 C16*17 GCAAGCATGTCTTTCCT 17 50 47.1  42.9  -2.17  -0.21 C16*16 CAAGCATGTCTTTCCT 16 46 43.8  42.9  -2.17  -0.21 Inverse configuration C16* | 22 GATTGTTGGTGATGGAGCCTGA 22 66 C16* | 21 ATTGTTGGTGATGGAGCCTGA 21 62 C16* | 20 TTGTTGGTGATGGAGCCTGA 20 60 C16*  | 19 TGTTGGTGATGGAGCCTGA 19 58 C16* |18 GTTGGTGATGGAGCCTGA 18 56 55.6  57.1 none none C16*  | 17 TTGGTGATGGAGCCTGA 17 52 52.9  57.1 none none C16* |16 TGGTGATGGAGCCTGA 16 50 56.3  57.1 none none Accepted values for the parameters 16-22 45-55° 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (allele-specific primer) bp C. mol mol

[0411] Paired Wild-Type Primer

[0412] Paired Wild Type Primers in Conventional Configuration

[0413] As paired wild type primer the first attempt will be evaluate the thermodynamic characteristics of the paired primers for the G17V assay that passed the QC step, as it would enable the use of the same primers for multiple assays, to reduce the number of variables.

[0414] Note that G17 P21 and G17 P20 present unacceptable heterodimers with the G17 oligoblocker, that will be as well evaluated as compatible oligoblocker for the C16* assay. Hence these combinations will be temporarily discarded.

[0415] It should be noted that the Tm of G17 P18 is on the lower side (˜50 C). For this reason, some extra paired primers were designed (C16* P20 and G16* P21).

TABLE-US-00044 TABLE 22 List of all the RHOA C16* paired primers in conventional configuration considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background and borderline values are presented with light grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Allele Off target Allele- specific Paired with wt specific Primer Tm WT primer Paired Amplicon Tm GC%  self- Off allele- Primer (Primer3) name WT primer sequence Length size (° C.) GC% tail dimers Hairpins target? specific? C16*19 55.49 G17 P19 TGTGTTTTGTGTTTCAGCA 19   85 53.85 36.84  42.9 none none Just paired no primer C16*18 54 G17 P19 TGTGTTTTGTGTTTCAGCA 19   84 53.85 36.84  42.9 none none Just paired no primer C16*17 52.07 G17 P19 TGTGTTTTGTGTTTCAGCA 19   83 53.85 36.84  42.9 none none Just paired no primer C16*16 47.67 G17 P19 TGTGTTTTGTGTTTCAGCA 19   82 53.85 36.84  42.9 none none Just paired no primer C16*19 55.49 G17 P18 GTGTTTTGTGTTTCAGCA 18   84 51.7 38.9  42.9 none none Just paired no primer C16*18 54 G17 P18 GTGTTTTGTGTTTCAGCA 18   83 51.7 38.9  42.9 none none Just paired no primer C16*17 52.07 G17 P18 GTGTTTTGTGTTTCAGCA 18   82 51.7 38.9  42.9 none none Just paired no primer C16*16 47.67 G17 P18 GTGTTTTGTGTTTCAGCA 18   81 51.7 38.9  42.9 none none Just paired no primer C16*19 55.49 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   84 53.47 35  42.9 -0.69  -0.57 Just paired no primer C16*18 54 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   83 53.47 35  42.9  -0.69  -0.57 Just paired no primer C16*17 52.07 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   82 53.47 35  42.9  -0.69  -0.57 Just paired no primer C16*16 47.67 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   81 53.47 35  42.9  -0.69  -0.57 Just paired no primer C16*19 55.49 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   84 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer C16*18 54 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   83 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer C16*17 52.07 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   82 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer C16*16 47.67 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   81 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer Accepted values for the parameters in analysis 16-25 <100 bp ΔTm with 40-60% >25% >-4 Kcal/ -3 Kcal/ no no (paired WT primer) bp paired mol mol primer <5° C.

[0416] Blat Alignment of the Validated Primer Pairs in Conventional Sense

[0417] In this case just the primer pair sets generating the longest amplicons have been considered for the Blat analysis (FIG. 10), as all shorter primers to generate primer products contained within the amplicons here presented.

TABLE-US-00045 >C16*19 + G17_P19 SEQ ID No: 165 GAGCAAGCATGTCTTTCCTcaggctccatcaccaacaatcaccagtttc ttccggatggcagccatTGCTGAAACACAAAACACA >C16*_19 + C16*P21 SEQ ID No: 166 GAGCAAGCATGTCTTTCCTcaggctccatcaccaacaatcaccagtttc ttccggatggcagcCATTGCTGAAACACAAAACAC

[0418] When in conventional configuration, the paired primers hit a secondary region of homology on chromosome 6. Nevertheless, as indicated from the characteristics of the reported homology (FIG. 9), the homology region does not cover the landing site of the forward primer, so that no amplification outside the true target region will be possible. These primer combinations can hence be accepted and analysed further.

[0419] All primer pairs in conventional configuration are expected to produce just one single amplicon at the expected chromosomal position. No other homologies are reported.

[0420] All tested combinations in conventional configuration meet the thermodynamic criteria required.

[0421] Paired Wild Type Primers in Inverse Configuration

[0422] As for the paired wild-type primers in conventional configuration, the first attempt will be evaluating the thermodynamic characteristics of the paired primers for the G17V assay that passed the QC step, as it would enable the use of the same primers for multiple assays, to reduce the number of variables. It should be noted that the paired primer G17 I P20 generated excessive hetero-dimers with all selected oligoblockers and was hence excluded from the analysis. A further attempt extending the primer in the opposite direction should be made.

TABLE-US-00046 TABLE 23 List of all the RHOA C16* paired primers in inverse configuration considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background and borderline values are presented with light grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. allele- Allele- specific Paired Off target specific Primer Tm WT primer Paired Amplicon Tm GC% self- off with wt Primer (Primer3) name WT primer sequence Length size (° C.) GC% tail dimers Hairprins target? allele-specific? C16* | 18 56.53 G17 | P18 TTCTCAAACACTGTGGGC 18 92 55.06 50 71.4 -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19 60 55.84 52.63 57.1 -0.33 -0.21 no no C16* | 17 54.66 G17 | P18 TTCTCAAACACTGTGGGC 18 91 55.06 50 71.4 -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19 59 55.84 52.63 57.1 -0.33 -0.21 no no C16* | 16 53.55 G17 | P18 TTCTCAAACACTGTGGGC 18 90 55.06 50 71.4 -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19 58 55.84 52.63 57.1 -0.33 -0.21 no no C16* | 18 56.53 C16* | P20 ATAGTTCTCAAACACTGTGG 20 96 52.84 40 57.1 -0.08 0.39 no no C16* | 17 54.66 C16* | P20 ATAGTTCTCAAACACTGTGG 20 95 52.84 40 57.1 -0.08 0.39 no no C16* | 16 53.55 C16* | P20 ATAGTTCTCAAACACTGTGG 20 94 52.84 40 57.1 -0.08 0.39 no no

[0423] Blat alignment of the validated primer pairs in inverse configuration

TABLE-US-00047 >C16*_I_18 + G17_I_P18/92 bp SEQ ID No: 167 TTCTCAAACACTGTGGGCacatacacctctgggaactggtccttgctga agactatgagcaagcatgtctttccTCAGGCTCCATCACCAAC >C16*_I_18 + G17_I_P19/60 bp SEQ ID No: 168 GAACTGGTCCTTGCTGAAGactatgagcaagcatgtctttccTCAGGCT CCATCACCAAC >C16*_I_17 + G17_I_P18/91 bp SEQ ID No: 169 TTCTCAAACACTGTGGGCacatacacctctgggaactggtccttgctga agactatgagcaagcatgtctttccTCAGGCTCCATCACCAA >C16*_I_17 + G17_I_P19/59 bp SEQ ID No: 170 GAACTGGTCCTTGCTGAAGactatgagcaagcatgtctttccTCAGGCT CCATCACCAA >C16*_I_16 + G17_I_P18/90 bp SEQ ID No: 171 TTCTCAAACACTGTGGGCacatacacctctgggaactggtccttgctga agactatgagcaagcatgtctttccTCAGGCTCCATCACCA >C16*_I_16 + G17_I_P19/58 bp SEQ ID No: 172 GAACTGGTCCTTGCTGAAGactatgagcaagcatgtctttccTCAGGCT CCATCACCA >C16*_I_18 + C16*_I_P20_96 bp (C16* I17 and C16* I16 are contained within the following product)

TABLE-US-00048 SEQ ID No: 173 ATAGTTCTCAAACACTGTGGgcacatacacctctgggaactggtccttg ctgaagactatgagcaagcatgtctttccTCAGGCTCCATCACCAAC 

[0424] The paired primer G17 I P19 generates an homology region on chromosome 6 (FIG. 12). Nevertheless, the allele-specific primer is specific so no non-specific product should be amplified.

[0425] All other combinations are perfectly fine.

[0426] By working in inverse configuration, it is possible to observe a homology region on chromosome 6 when using the paired wt primer G17 I P19 (FIG. 13). It is important to notice that the allele-specific primer is not included in the homology region so this is unlikely to generate non-specific products. Nevertheless, this aspect should be flagged during the in vitro testing, aimed at excluding any risk of secondary amplification.

[0427] Wet-lab validation will be performed preferentially on all thermodynamically suitable primer pairs

[0428] RHOA C16 Oligoblocker Candidates in Conventional and Inverse Configuration

[0429] As for the paired wild-type primers in conventional and inverse configuration, the first attempt will be evaluating the thermodynamic characteristics of the oligoblockers designed for the G17V assay that passed the QC step, as it would enable the use of the same oligoblocker for multiple assays, to reduce the number of variables.

[0430] The position of the WT allele on the oligoblocker is indicated in bold and underlined in the following table:

TABLE-US-00049 TABLE 24 List of all potential oligoblockers for the RHOA G17 and C16 codon, in conventional and inverse configuration, considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer ® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded Oligoblocker Tm GC% name Sequence Length (°C.) GC% tail self-dimers Hairpins G17 OB23 CATGTCTTTCCACAGGCTCCATC 23 70 G17 OB22 ATGTCTTTCCACAGGCTCCATC 22 66 G17 OB21 ATGTCTTTCCACAGGCTCCAT 21 62 47.6 57.1 -0.22 -0.1 G17 OB20 ATGTCTTTCCACAGGCTCCA 20 60 50 71.4 -0.08 0.04 G17 OB19 ATGTCTTTCCACAGGCTCC 19 58 52.6 71.4 -0.08 0.04 Oligoblocker Tm GC% name Sequence Length (° C.) GC% tail self-dimers Hairpins G17 | OB23 ATGGAGCCTGTGGAAAGACATGC 23  70 G17 | OB22 ATGGAGCCTGTGGAAAGACATG 22  66 G17 | OB21 ATGGAGCCTGTGGAAAGACAT 21  62 47.6  28.6  -0.22  -0.1 G17 | OB20 ATGGAGCCTGTGGAAAGACA 20  60 50  28.6  -0.08   0.04 G17 | OB19 TGGAGCCTGTGGAAAGACA 19  58 52.6  28.6  -0.08   0.04 Accepted values for the parameters 19-23 ~60° 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (Oligoblocker) bp C. mol mol

[0431] Final Thermodynamic Analysis on All Candidate Primers and Oligoblockers

[0432] Heterodimers combinations to consider for all the primers/oligoblocker candidates that met the thermodynamic criteria described in the previous sections: [0433] Allele-specific primer+paired WT primer [0434] Allele-specific primer+oligoblocker [0435] Paired WT primer+oligoblocker

[0436] Thermodynamic analysis in conventional configuration

TABLE-US-00050 TABLE 25 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Accepted values are presented with white background and borderline values are presented with light grey background. Oligonucleotide combination ΔG Validated? (conventional) (Kcal/mol) Y/N C16*19 + G17 P19 −0.69 Y C16*19 + G17 P18 −0.69 Y C16*19 + C16* P20 −0.69 Y C16*19 + C16* P21 −0.69 Y C16*18 + G17 P19 −0.69 Y C16*18 + G17 P18 −0.69 Y C16*18 + C16* P20 −0.69 Y C16*18 + C16* P21 −0.69 Y C16*17 + G17 P19 −0.69 Y C16*17 + G17 P18 −0.69 Y C16*17 + C16* P20 −0.69 Y C16*17 + C16* P21 −0.69 Y C16*16 + G17 P19 −0.69 Y C16*16 + G17 P18 −0.69 Y C16*16 + C16* P20 −0.69 Y C16*16 + C16* P21 −0.69 Y C16*19 + G17 OB21 −3.1 Borderline C16*19 + G17 OB20 −3.1 Borderline C16*19 + G17 OB19 −3.1 Borderline C16*18 + G17 OB21 −1.53 Y C16*18 + G17 OB20 −1.53 Y C16*18 + G17 OB19 −1.53 Y C16*17 + G17 OB21 −1.53 Y C16*17 + G17 OB20 −1.53 Y C16*17 + G17 OB19 −1.53 Y C16*16 + G17 OB21 −1.53 Y C16*16 + G17 OB20 −1.53 Y C16*16 + G17 OB19 −1.53 Y G17 P19 + G17 OB21 −2.04 Y G17 P19 + G17 OB20 −2.04 Y G17 P19 + G17 OB19 −2.04 Y G17 P18 + G17 OB21 −2.04 Y G17 P18 + G17 OB20 −2.04 Y G17 P18 + G17 OB19 −2.04 Y C16* P20 + G17 OB21 −2.04 Y C16* P20 + G17 OB20 −2.04 Y C16* P20 + G17 OB19 −2.04 Y C16* P21 + G17 OB21 −2.04 Y C16* P21 + G17 OB20 −2.04 Y C16* P21 + G17 OB19 −2.04 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0437] All the oligonucleotide candidates in conventional configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0438] It should be reported and considered in the following in vitro validation phases that the C16* 19 allele-specific primers form borderline hetero-dimers with the oligoblockers in conventional configuration. This cannot be avoided given the mutation position.

[0439] Thermodynamic analysis in inverse configuration

TABLE-US-00051 TABLE 25 Evaluation of heterodimers presence for all oligonucleotide candidates in inverse configuration evaluated for the allele-specific system. Accepted values are presented with white background and borderline values are presented with light grey background. Oligonucleotide combination ΔG Validated? (inverse) (Kcal/mol) Y/N C16* I 18 + G17 I P18 −3 borderline C16* I 18 + G17 I P19 −1.53 Y C16* I 17 + G17 I P18 −3 borderline C16* I 17 + G17 I P19 −1.53 Y C16* I 16 + G17 I P18 −3 borderline C16* I 16 + G17 I P19 −1.53 Y C16* I 18 + C16* I P20 −0.69 Y C16* I 17 + C16* I P20 −0.69 Y C16* I 16 + C16* I P20 −0.31 Y C16* I 18 + G17 I OB21 −0.22 Y C16* I 18 + G17 I OB20 none Y C16* I 18 + G17 I OB19 none Y C16* I 17 + G17 I OB21 −0.22 Y C16* I 17 + G17 I OB20 none Y C16* I 17 + G17 I OB19 none Y C16* I 16 + G17 I OB21 −0.22 Y C16* I 16 + G17 I OB20 none Y C16* I 16 + G17 I OB19 none Y G17 I P18 + G17 I OB21 −3 Borderline G17 I P18 + G17 I OB20 −3 Borderline G17 I P18 + G17 I OB19 −3 Borderline G17 I P19 + G17 I OB21 −1.53 Y G17 I P19 + G17 I OB20 −1.53 Y G17 I P19 + G17 I OB19 −1.53 Y C16* I P20 + G17 I OB21 −0.31 Y C16* I P20 + G17 I OB20 −0.31 Y C16* I P20 + G17 I OB19 −0.31 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0440] All the oligonucleotide candidates in inverse configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0441] Priority should be given to the combinations generating less heterodimers.

[0442] Design of the C16* Wild-Type Set

[0443] Given the proximity of the C16* position with the F25 and the G17V position described in the previous chapters, the correspondent WT assays will be used in conjunction with the C16* mutation specific assay.

[0444] RHOA G14V

[0445] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0446] More specifically, in a preferred embodiment, the mutation is RHOA G14V, where the glycine to valine change is due to a single point mutation at position chr3: 49412982 (human assembly GRCh37/hg19) where the wild-type allele is a cytosine (C) and the mutant allele is an adenine (A). The first set of reagents for detecting the RHOA G14V mutation comprises a mutation-specific primer selected from SEQ ID NO: 89-102, a paired primer selected from SEQ ID NO: 53-59, 86-88, and an oligoblocker selected 30 from SEQ ID NO: 60-69, 103-112. Most preferably, the mutation-specific primer is selected from SEQ ID NO: 92-95, 99-101, the paired primer is selected from SEQ ID NO: 54, 58-59, 86-88 and the oligoblocker is selected from SEQ ID NO: 62-64, 67-69, 106-107, 111-112. In another embodiment, a different paired primer can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412747-49412957 and/or chr3: 49413007-49413217 (human assembly GRCh37/hg19). A different oligoblocker can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412957-49413007 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412982 must be included in the selected oligoblocker sequence. In a preferred embodiment, the method amplifies a second WT target sequence, located preferably 200-400 bp from the first mutated target sequence, using a second set of reagents. In a more preferred embodiment, the second set of reagents comprises a first primer SEQ ID NO: 70 and a second primer SEQ ID NO: 71.

[0447] Primer Design for the Allele-Specific RHOA G14V System

[0448] The allele-specific primers considered in the design of this invention and their thermodynamic characteristics are listed in Table 26:

TABLE-US-00052 TABLE 26 List of all the RHOA G14V allele-specific primers considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Primer name Sequence Length Tm (° C.) GC% GC% tail self-dimers Hairpins Conventional configuration G14V 22 AAGCATGTCTTTCCTCAGGCTA 22 64 G14V 21 AGCATGTCTTTCCTCAGGCTA 21 62 G14V 20 GCATGTCTTTCCTCAGGCTA 20 60 G14V 19 CATGTCTTTCCTCAGGCTA 19 56 47.4  57.1  -2.17 none G14V 18 ATGTCTTTCCTCAGGCTA 18 52 44.4  57.1  -1.46 none G14V 17 TGTCTTTCCTCAGGCTA 17 50 47.1  57.1  -1.46 none G14V 16 GTCTTTCCTCAGGCTA 16 48 50  57.1  -1.46 none Inverse configuration G14V|22 AACTGGTGATTGTTGGTGATGT 22 62 G14V|21 ACTGGTGATTGTTGGTGATGT 21 60 G14V|20 CTGGTGATTGTTGGTGATGT 20 58 G14V|19 TGGTGATTGTTGGTGATGT 19 54 42.1  42.9 none none G14V|18 GGTGATTGTTGGTGATGT 18 52 44.4  42.9 none none G14V|17 GTGATTGTTGGTGATGT 17 48 41.2  42.9 none none G14V|16 TGATTGTTGGTGATGT 16 44 Accepted values for the parameters 16-22 45-55°C 40-60% >25% >-4 Kcal/ >-3 Kcal/ in analysis (allele-specific primer) bp mol mol

[0449] Paired Wild-Type Primer

[0450] Paired Wild Type Primers in Conventional Configuration

[0451] As paired wild type primer the first attempt will be evaluate the thermodynamic characteristics of the paired primers for the G17V and C16* assay that passed the QC step, as it would enable the use of the same primers for multiple assays, to reduce the number of variables.

[0452] Note that G17 P21 and G17 P20 present unacceptable heterodimers with the G17 oligoblocker, that will be as well evaluated as compatible oligoblocker for the G14V assay. Hence these combinations will be temporarily discarded. Nevertheless, in case a new oligoblocker specific for G14V will be evaluated, these two combinations will be reconsidered.

TABLE-US-00053 TABLE 27 List of all the RHOA G14V paired primers in conventional configuration considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background and borderline values are Allele- Off target Allele- specific Paired with wt specific Primer Tm WT primer Paired Amplicon Tm GC% self- allele- Primer (PrimerS) name WT primer sequence Length size (° C.) GC% tail dimers Hairpins Off target? specific? G14V 19 53.84 G17 P19 TGTGTTTTGTGTTTCAGCA 19   78 53.85 36.84  42.9 none none Just paired no primer G14V 18 51.87 G17 P19 TGTGTTTTGTGTTTCAGCA 19   77 53.85 36.84  42.9 none none Just paired no primer G14V 17 50.96 G17 P19 TGTGTTTTGTGTTTCAGCA 19   76 53.85 36.84  42.9 none none Just paired no primer G14V 16 48.36 G17 P19 TGTGTTTTGTGTTTCAGCA 19   75 53.85 36.84  42.9 none none Just paired no primer G14V 19 53.84 G17 P18 GTGTTTTGTGTTTCAGCA 18   77 51.7 38.9  42.9 none none Just paired no primer G14V 18 51.87 G17 P18 GTGTTTTGTGTTTCAGCA 18   76 51.7 38.9  42.9 none none Just paired no primer G14V 17 50.96 G17 P18 GTGTTTTGTGTTTCAGCA 18   75 51.7 38.9  42.9 none none Just paired no primer G14V 16 48.36 G17 P18 GTGTTTTGTGTTTCAGCA 18   74 51.7 38.9  42.9 none none Just paired no primer G14V 19 53.84 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   77 53.47 35  42.9  -0.69  -0.57 Just paired no primer G14V 18 51.87 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   76 53.47 35  42.9  -0.69  -0.57 Just paired no primer G14V 17 50.96 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   75 53.47 35  42.9  -0.69  -0.57 Just paired no primer G14V 16 48.36 C16* P20 GTGTTTTGTGTTTCAGCAAT 20   74 53.47 35  42.9  -0.69  -0.57 Just paired no primer G14V 19 53.84 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   77 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer G14V 18 51.87 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   76 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer G14V 17 50.96 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   75 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer G14V 16 48.36 C16* P21 GTGTTTTGTGTTTCAGCAATG 21   74 55.09 38.1  42.9  -0.69  -0.57 Just paired no primer Accepted values for the parameters in analysis 16-25 <100 ΔTm with 40-60% >25% >-4 Kcal/ >-3 Kcal/ no no (paired WT primer) bp bp paired mol mol primer <5° C.

[0453] presented with light grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded.

[0454] Blat Alignment of the Validated Primer Pairs in Conventional Sense

[0455] In this case just the primer pair sets generating the longest amplicons have been considered for the Blat analysis, as all shorter primers to generate primer products contained within the amplicons here presented.

TABLE-US-00054 >G14V19 + G17_P19 SEQ ID No: 174 AAGCATGTCTTTCCTCAGGCTAcatcaccaacaatcaccagtttcttc cggatggcagccatTGCTGAAACACAAAACACA >G14V + C16*P21 SEQ ID No: 175 AAGCATGTCTTTCCTCAGGCTAcatcaccaacaatcaccagtttcttc cggatggcagcCATTGCTGAAACACAAAACAC

[0456] When in conventional configuration, the paired primers hit a secondary region of homology on chromosome 6 and on chromosome 8. Nevertheless, as indicated from the characteristics of the reported homology (FIG. 14), the homology region does not cover the landing site of the forward primer, so that no amplification outside the true target region will be possible (FIG. 15). These primer combinations can hence be accepted and analysed further.

[0457] All primer pairs in conventional configuration are expected to produce just one single amplicon at the expected chromosomal position. No other homologies are reported.

[0458] All tested combinations in conventional configuration meet the thermodynamic criteria required.

[0459] Paired Wild Type Primers in Inverse Configuration

[0460] As for the paired wild-type primers in conventional configuration, the first attempt will be evaluating the thermodynamic characteristics of the paired primers for the G17V and the C1*assays that passed the QC step, as it would enable the use of the same primers for multiple assays, to reduce the number of variables. It should be noted that the paired primer G17 I P20 generated excessive hetero-dimers with the selected oligoblockers for G17V and C16* and was excluded from the analysis. In case a new oligoblocker will be proposed for the G14V assay, the G17 I P20 primer will be re-analysed.

TABLE-US-00055 TABLE 28 List of all the RHOA G14V paired primers in inverse configuration considered in the design of this invention and their thermodynamic characteristics. Accepted values are presented with white background and borderline values are presented with light grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the primer is discarded. Allele- Allele- specific Paired Off target specific Primer Tm WT primer Paired Amplicon Tm GC% self- Off  with wt allele- Primer (Primer3) name WT primer sequence Length size (° C.) GC% tail dimers Hairpins target? specific? G14V | 19 54.56 G17 | P18 TTCTCAAACACTGTGGGC 18  100 55.06 50  71.4  -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19   68 55.84 52.63  57.1  -0.33  -0.21 no no G14V | 18 54.66 G17 | P18 TTCTCAAACACTGTGGGC 18   99 55.06 50  71.4  -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19   67 55.84 52.63  57.1  -0.33  -0.21 no no G14V | 17 53.55 G17 | P18 TTCTCAAACACTGTGGGC 18   98 55.06 50  71.4  -0.08 none no no G17 | P19 GAACTGGTCCTTGCTGAAG 19   66 55.84 52.63  57.1  -0.33  -0.21 no no G14V | 19 56.53 C16* | P20 ATAGTTCTCAAACACTGTGG 20  104 52.84 40  57.1  -0.08   0.39 no no G14V | 18 54.66 C16* | P20 ATAGTTCTCAAACACTGTGG 20  103 52.84 40  57.1  -0.08   0.39 no no G14 V| 17 53.55 C16* | P20 ATAGTTCTCAAACACTGTGG 20  102 52.84 40  57.1  -0.08   0.39 no no Accepted values for the parameters in analysis 16-25 <100 ΔTm with 40-60% >25% >-4 Kcal/ >-3 Kcal/ no no (paired WT primer) bp bp paired mol mol primer

[0461] Blat Alignment of the Validated Primer Pairs in Inverse Configuration

TABLE-US-00056 >G14V_I_19 + G17_I_P18/100 bp SEQ ID No: 176 TTCTCAAACACTGTGGGCacatacacctctgggaactggtccttgctg aagactatgagcaagcatgtctttccacaggCtCCATCACCAACAATC ACCA >G14V_I_19 + G17_I_P19/68 bp SEQ ID No: 177 GAACTGGTCCTTGCTGAAGactatgagcaagcatgtctttccacaggc tCCATCACCAACAATCACCA >G14V_I_19 + C16*_I_P20/104 bp SEQ ID No: 178 ATAGTTCTCAAACACTGTGGgcacatacacctctgggaactggtcctt gctgaagactatgagcaagcatgtctttccacaggctCCATCACCAAC AATCACCA

[0462] Please note that the remaining primers G14V I 18 and G14V I 17 do produce shorter amplicons contained in the amplicons above. The homology level should hence be perfectly comparable.

[0463] By working in inverse configuration it is possible to observe some regions of partial homology. It is important to notice that just one out of two primer at a time is included

[0464] in the homology region so this is unlikely to generate non-specific products. Nevertheless, this aspect should be flagged during the in vitro testing, aimed at excluding any risk of secondary amplification.

[0465] RHOA G14 Oligoblocker Candidates in Conventional and Inverse Configuration

[0466] As for the paired wild-type primers in conventional and inverse configuration, the first attempt will be evaluating the thermodynamic characteristics of the oligoblockers designed for the G17V and the C16* assay that passed the QC step, as it would enable the use of the same oligoblocker for multiple assays, to reduce the number of variables. The position of the WT allele on the oligoblocker is indicated in bold and underlined in to the following figure:

TABLE-US-00057 TABLE 29 List of all potential oligoblockers for the RHOA G.sub.17, C.sub.16 and G.sub.14 codon, in conventional and inverse configuration, considered in the design of this invention and their thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background. Borderline values are presented with light grey background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded Oligoblocker Tm GC % name Sequence Length (° C.) GC % tail self-dimers Hairpins G17 OB23 CATGTCTTTCCACAGGCTCCATC 23 70 G17 OB22 ATGTCTTTCCACAGGCTCCATC 22 66 G17 OB21 ATGTCTTTCCACAGGCTCCAT 21 62 47.6   57.1 −0.22 −0.1 G17 OB20 ATGTCTTTCCACAGGCTCCA 20 60 50   71.4 −0.08 0.04 G17 OB19 ATGTCTTTCCACAGGCTCC 19 58 52.6   71.4 −0.08 0.04 G17 | OB23 ATGGAGCCTGTGGAAAGACATGC 23 70 G17 | OB22 ATGGAGCCTGTGGAAAGACATG 22 66 G17 | OB21 ATGGAGCCTGTGGAAAGACAT 21 62 47.6   28.6 −0.22 −0.1 G17 | OB20 ATGGAGCCTGTGGAAAGACA 20 60 50   28.6 −0.08 0.04 G17 | OB19 TGGAGCCTGTGGAAAGACA 19 58 52.6   28.6 −0.08 0.04 Accepted values for the parameters 19-23 bp ~60° C. 40-60% >25% > −4 Kcal/mol > −3 Kcal/mol in analysis (Oligoblocker)

[0467] It is important to notice that the G14 codon is in this case shifted towards the 3′ end of the oligoblocker. This is normally avoided in the in silico design. Nevertheless, as two of the other assays will use this type of oligoblocker, an in vitro analysis will be performed anyway as in case of appropriate sensitivity and specificity of the common oligoblocker, its use will be favoured over the use of three distinct oligoblockers for the four mutations in analysis.

[0468] Thermodynamic Analysis on the Allele-Specific Primers and the Common Oligoblockers G17/C16/G14.

[0469] The combinations left to consider in this section to meet the thermodynamic criteria described in the previous sections are: [0470] Allele-specific primer+oligoblocker [0471] Allele-specific primer+paired primer

[0472] Thermodynamic analysis in conventional configuration

TABLE-US-00058 TABLE 30 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Accepted values are presented with white background and borderline values are presented with light grey background. Oligonucleotide combination ΔG Validated? (conventional) (Kcal/mol) Y/N G14V 19 + G17 P19 −1.53 Y G14V 19 + G17 P18 −1.53 Y G14V 19 + C16* P20 −1.53 Y G14V 19 + C16* P21 −1.53 Y G14V 18 + G17 P19 −1.53 Y G14V 18 + G17 P18 −1.53 Y G14V 18 + C16* P20 −1.53 Y G14V 18 + C16* P21 −1.53 Y G14V 17 + G17 P19 −1.53 Y G14V 17 + G17 P18 −1.53 Y G14V 17 + C16* P20 −1.53 Y G14V 17 + C16* P21 −1.53 Y G14V 16 + G17 P19 −1.53 Y G14V 16 + G17 P18 −1.53 Y G14V 16 + C16* P20 −1.53 Y G14V 16 + C16* P21 −1.53 Y G14V 19 + G17 OB21 −1.46 Y G14V 19 + G17 OB20 −1.46 Y G14V 19 + G17 OB19 −1.46 Y G14V 18 + G17 OB21 −1.46 Y G14V 18 + G17 OB20 −1.46 Y G14V 18 + G17 OB19 −1.46 Y G14V 17 + G17 OB21 −1.46 Y G14V 17 + G17 OB20 −1.46 Y G14V 17 + G17 OB19 −1.46 Y G14V 16 + G17 OB21 −1.46 Y G14V 16 + G17 OB20 −1.46 Y G14V 16 + G17 OB19 −1.46 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0473] All the oligonucleotide candidates in conventional configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0474] Thermodynamic analysis in inverse configuration

TABLE-US-00059 TABLE 31 Evaluation of heterodimers presence for all oligonucleotide candidates in inverse configuration evaluated for the allele-specific system. Accepted values are presented with white background. Oligonucleotide combination ΔG Validated? (inverse) (Kcal/mol) Y/N G14V I 19 + G17 I P18 −2.03 Y G14V I 19 + G17 I P19 −0.07 Y G14V I 19 + C16* I P20 −2.03 Y G14V I 18 + G17 I P18 −2.03 Y G14V I 18 + G17 I P19 −0.07 Y G14V I 18 + C16* I P20 −2.03 Y G14V I 17 + G17 I P18 −2.03 Y G14V I 17 + G17 I P19 −0.07 Y G14V I 17 + C16* I P20 −2.03 Y G14V I 19 + G17 I OB21 −1.56 Y G14V I 19 + G17 I OB20 −0.08 Y G14V I 19 + G17 I OB19 −0.08 Y G14V I 18 + G17 I OB21 −1.56 Y G14V I 18 + G17 I OB20 −0.08 Y G14V I 18 + G17 I OB19 −0.08 Y G14V I 17 + G17 I OB21 −1.56 Y G14V I 17 + G17 I OB20 −0.08 Y G14V I 17 + G17 I OB19 −0.08 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0475] All the oligonucleotide candidates in inverse configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0476] Priority should be given to the combinations generating less heterodimers.

[0477] RHOA G14-Centred Oligoblocker

[0478] Given that the oligoblocker described in paragraph 3.5.5 contains the G14 position towards the 3′ end of the sequence, an alternative set of oligoblockers will be designed keeping the G14 codon towards the middle of the sequence, in case the in vitro validation of all the G17 oligoblockers on the G14 codon does not satisfy the correspondent quality control parameters.

TABLE-US-00060 TABLE 32 Table 32: List of all potential oligoblockers for the RHOA G.sub.14 codon, in conventional and inverse configuration, considered in the design of this ivention and their Oligoblocker Tm GC % name Sequence Length (° C.) GC % tail self-dimers Hairpins G14 OB23 TTCCACAGGCTCCATCACCAACA 23 70 G14 OB22 TTCCACAGGCTCCATCACCAAC 22 68 G14 OB21 TCCACAGGCTCCATCACCAAC 21 66 G14 OB20 TCCACAGGCTCCATCACCAA 20 62 55   42.9 none none G14 OB19 CCACAGGCTCCATCACCAA 19 60 57.9   42.9 none none G14 | OB23 TGTTGGTGATGGAGCCTGTGGAA 23 70 G14 | OB22 TGTTGGTGATGGAGCCTGTGGA 22 68 G14 | OB21 GTTGGTGATGGAGCCTGTGGA 21 66 G14 | OB20 TTGGTGATGGAGCCTGTGGA 20 62 55   57.1 none none G14 | OB19 TTGGTGATGGAGCCTGTGG 19 60 57.9   71.4 none none Accepted values for the parameters in 19-23 bp ~60° C. 40-60% >25% > −4 Kcal/mol > −3 Kcal/mol analysis (Oligoblocker)

[0479] thermodynamic characteristics. Note that Tm are calculated using the Oligoanalyzer® software. Accepted values are presented with white background and non-acceptable values are presented with dark grey background. In the eventuality that one of the parameters in analysis falls outside the accepted range indicated in the last row the thermodynamic analysis is discontinued and the oligoblocker is discarded

[0480] Final Thermodynamic Analysis on All Candidate Primers and the G14 Oligoblockers

[0481] Thermodynamic analysis in conventional configuration

TABLE-US-00061 TABLE 33 Evaluation of heterodimers presence for all oligonucleotide candidates in conventional configuration evaluated for the allele-specific system. Accepted values are presented with white background. Oligonucleotide combination ΔG Validated? (conventional) (Kcal/mol) Y/N G14V 19 + G14 OB20 −1.46 Y G14V 19 + G14 OB19 −1.46 Y G14V 18 + G14 OB20 −1.46 Y G14V 18 + G14 OB19 −1.46 Y G14V 17 + G14 OB20 −1.46 Y G14V 17 + G14 OB19 −1.46 Y G14V 16 + G14 OB20 −1.46 Y G14V 16 + G14 OB19 −1.46 Y G17 P19 + G14 OB20 −2.04 Y G17 P19 + G14 OB19 −2.04 Y G17 P18 + G14 OB20 −2.04 Y G17 P18 + G14 OB19 −2.04 Y C16* P20 + G14 OB20 −2.04 Y C16* P20 + G14 OB19 −2.04 Y C16* P21 + G14 OB20 −2.04 Y C16* P21 + G14 OB19 −2.04 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0482] All the oligonucleotide candidates in conventional configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0483] Thermodynamic analysis in inverse configuration

TABLE-US-00062 TABLE 34 Evaluation of heterodimers presence for all oligonucleotide candidates in inverse configuration evaluated for the allele-specific system. Accepted values are presented with white background and borderline values are presented with light grey background. ΔG Validated? Oligonucleotide combination (Kcal/mol) Y/N G14V I 19 + G14 I OB20 none Y G14V I 19 + G14 I OB19 none Y G14V I 18 + G14 I OB20 none Y G14V I 18 + G14 I OB19 none Y G14V I 17 + G14 I OB20 none Y G14V I 17 + G14 I OB19 none Y G17 I P18 + G14 I OB19 −3 borderline G17 I P18 + G14 I OB20 −3 borderline G17 I P19 + G14 I OB19 −1.53 Y G17 I P19 + G14 I OB20 −1.53 Y C16* I P20 + G14 I OB20 −0.69 Y C16* I P20 + G14 I OB19 −0.69 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0484] All the oligonucleotide candidates in inverse configuration of the table above meet the thermodynamic criteria required to ensure absence of non-specific amplification and to improve the amplification efficiency.

[0485] Priority should be given to the combinations generating less heterodimers. In particular, the reverse primer G17 I P18 should be used just if the other combinations do not pass the in vitro QC steps.

[0486] Design of the C14 Wild-Type Set

[0487] Given the proximity of the C14 position with the C16* and the G17V position described in the previous chapters, the correspondent WT assays will be used in conjunction with the C16* mutation specific assay.

[0488] Probe-Based A-TAG Assays

[0489] RHOA F25L

[0490] The inventors have designed specific sets of primers and fluorescent probes allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0491] More specifically, in a preferred embodiment, the mutation is RHOA F25L, where the phenylalanine to leucine change is due to a single point mutation at position chr3: 49412950 (human assembly GRCh37/hg19) where the wild-type allele is an adenine (A) and the mutant allele is a guanine (G). In a preferred embodiment, the set of reagents for detecting the RHOA F25L mutation comprises a mutation-specific probe of SEQ ID NO: 118, a wild-type probe of SEQ ID NO: 117, a forward primer of SEQ ID NO: 113 and a reverse primer of SEQ ID NO: 114. In another embodiment, a different forward and reverse primers can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412830-49412949 for the forward primer and chr3: 49412951-49413071 for the reverse primer (human assembly GRCh37/hg19), with the fundamental prerequisite that the position chr3: 49412950 must be excluded from the selected primer sequence. A different mutant and wild-type probe can be chosen from ANY consecutive DNA sequence of size comprised between 13 and 25 base pairs selected in the following regions: chr3: 49412925-49412975 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412950 must be included in the selected probe sequence.

[0492] Selected Primers for the Probe-Based F25L Assay

[0493] The following is an example of primers selected for the F25L assay:

TABLE-US-00063 TABLE 35 Table 35: Evaluation of all thermo-dynamic parameters considered to select appropriate primers for the RHOA F.sub.25L probe-assay. Accepted values are presented with white background. Tm GC % self- Hetero- Validated Primer name Sequence Length (° C.) GC % tail dimers Hairpins dimers (Y/N) RHOA F25L L GCACATACACCTCTGG 16 55.8 56.2 71.4 none 24.8 −3.16 Y RHOA F25 R TGATTGTTGGTGATGG 17 55.6 41.2 42.9 none none Y A Accepted values for the 15-25 bp 55-60° C. 40-60% >25% > −4 <Tm > −4 Y parameters in analysis ΔTm r < 5° C. Kcal/mol Kcal/mol

[0494] Selected Probes for the Probe-Based F25L Assay

[0495] The following is an example of probes selected for the F25L assay:

TABLE-US-00064 TABLE 36 Table 36: Evaluation of all thermodynamic parameters considered to select appropriate probes for the RHOA F.sub.25L probe-assay. Accespted values are presented with white background. Val- # GC % self- Hair- Quen- idated Probe name Sequence Length LNA Tm (° C.) GC % tail dimers pins Dyes cher (Y/N) RHOA F25L /5HEX/CTGA + 20 1 61.8 45   57.1 none 10.9 HEX BHQ-1 Y WT AGACTATGAGCAAGCA/ 3BHQ_1/ RHOA F25L /56-FAM/CTGA + 19 1 61.9 52.6   57.1 none 10.9 6FAM BHQ-1 Y Mut GGACTATGAGCAAGC/ 3BHQ_1/ Accepted values for the 13-25 bp <4 55-60° C. 40-60% >25% > −4 «Tm FAM: BHQ-1 Y parameters in analysis ΔTmr < 5° C. Kcal/ mut mol HEX: WT

[0496] Any other combination could be evaluated to fit the thermodynamic parameters presented above.

[0497] BLAT Alignment of the Validated Primer Pairs

TABLE-US-00065 >RHOA_F25L_L + RHOAF25L_R_81 bp SEQ ID No: 179 GCACATACACCTCTGGgaactggtccttgctgaagactatgagcaagca tgtctttccacaggcTCCATCACCAACAATCA

[0498] The proposed primers hit a secondary region of homology on chromosome 6. Nevertheless, as indicated from the characteristics of the reported homology (FIG. 17), the homology region does not cover the landing site of the forward primer, so that no amplification outside the true target region will be possible (FIG. 18). These primer combinations can hence be accepted and analysed further.

[0499] Thermodynamic Analysis

TABLE-US-00066 TABLE 37 Evaluation of heterodimers presence for all primers and probes evaluated for the probe-based RHOA F25L assay. Accepted values are presented with white background. ΔG Validated? Oligonucleotide combination (Kcal/mol) Y/N F25L L + F25L R −3.16 Y F25L L + F25L mut −3.03 Y F25L L + F25L WT −1.18 Y F25L R + F25L mut −0.69 Y F25L R + F25L WT −0.69 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0500] RHOA G17V

[0501] The inventors have designed specific sets of primers and fluorescent probes allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0502] More specifically, in a preferred embodiment, the mutation is RHOA G17V, where the glucine to valine change is due to a single point mutation at position chr3: 49412973 (human assembly GRCh37/hg19) where the wild-type allele is a cytosine (C) and the mutant allele is an adenine (A). In a preferred embodiment, the set of reagents for detecting the RHOA G17V mutation comprises a mutation-specific probe of SEQ ID NO: 120, a wild-type probe of SEQ ID NO: 119, a forward primer of SEQ ID NO: 115 and a reverse primer of SEQ ID NO: 116. In another embodiment, a different forward and reverse primers can be chosen from any consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412853-49412972 for the forward primer and chr3: 49412974-49413093 for the reverse primer (human assembly GRCh37/hg19), with the fundamental prerequisite that the position chr3: 49412973 must be excluded from the selected primer sequence. A different mutant and wild-type probe can be chosen from ANY consecutive DNA sequence of size comprised between 13 and 25 base pairs selected in the following regions: chr3: 49412948-49412998 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412973 must be included in the selected probe sequence.

[0503] Selected Primers for the Probe-Based G17V Assay

[0504] The following is an example of primers selected for the G17V assay:

TABLE-US-00067 TABLE 38 Table 38: Evaluation of all thermodynamic parameters considered to select appropriate primers for the RHOA G.sub.17V probe-based assay. Accepted values are presented with white background. Borderline values are presented in light grey background. Primer GC % self- Hetero- Validated name Sequence Length Tm (° C.) GC % tail dimers Hairpins dimers (Y/N) RHOA F CCTTGCTGAA 19 55.9 44.4   28.6     −0.33 38.6     −1.88 Y GACTATGA RHOA R GTGCATTGCA 20 56.3 42.1   14.3    −3.8 34.5 Y GGTAATATC Accepted values 15-25 bp 55-60° C. 40-60% >25% > −4 <Tm > −4 Y for the parameters ΔTm r < 5° C. Kcal/mol Kcal/mol in analysis

[0505] Selected Probes for the Probe-Based G17V Assay

[0506] The following is an example of probes selected for the G17V assay:

TABLE-US-00068 TABLE 39 Table 39: Evaluation of all thermodynamic parameters considered to select appropriate probes for the RHOA G.sub.17V probe-based assay. Accepted values are presented with white background. Val- Probe # GC % self- Hair- dated name Sequence Length LNA Tm (° C.) GC % tails dimers pins Dyes Quencher (Y/N) RHOA /5HEX/CATGTCTTT + 19  1 62.8 52.6  71.4   −2.17 24.3 HEX BHQ-1 Y G17V WT CCACAGGCTC/3BHQ1/ RHOA /56-FAM/CATGTCTTT + 19  1 58.9 47.4  71.4   −2.17 35.8 6FAM BHQ-1 Y G17V Mut ACACAGGCTC/3BHQ1/ Accepted values for the 13-25 bp <4 55-60° C. 40-60% >25% > −4 «Tm FAM: BHQ-1 Y parameters in analysis ΔTmr < Kcal/ mut 5° C. mol HEX: WT

[0507] Any other combination could be evaluated to fit the thermodynamic parameters presented above.

[0508] BLAT alignment of the validated primer pairs

TABLE-US-00069 >RHOA_L + RHOA_R_120 bp SEQ ID No: 180 CCTTGCTGAAGACTATGAgcaagcatgtctttccacaggctccatcacc aacaatcaccagtttcttccggatggcagccattgctgaaacacaaaac acaGATATTACCTGCAATGCAC

[0509] The proposed primers hit a secondary region of homology on chromosome 6 and on chromosome 8. Nevertheless, as indicated from the characteristics of the reported homology (FIG. 19), the homology region does not cover the landing site of the reverse primer, so that no amplification outside the true target region will be possible. These primer combinations can hence be accepted and analysed further.

[0510] Thermodynamic Analysis

TABLE-US-00070 TABLE 40 Evaluation of heterodimers presence for all primers and probes evaluated for the probe-based RHOA G17V assay. Accepted values are presented with white background. ΔG Validated? Oligonucleotide combination (Kcal/mol) Y/N RHOA L + RHOA R −1.88 Y RHOA L + G17V mut −3.25 Y RHOA L + G17V WT −3.25 Y RHOA R + G17V mut −1.04 Y RHOA R + G17V WT −2.17 Y Accepted values for the >−4 Kcal/mol Y parameters in analysis

[0511] RHOA C16STOP

[0512] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0513] More specifically, in a preferred embodiment, the mutation is RHOA C16*, where the cysteine to stop codon change is due to a non-sense single point mutation at position chr3: 49412975 (human assembly GRCh37/hg19) where the wild-type allele is an adenine (A) and the mutant allele is a thymidine (T). In a preferred embodiment, the set of reagents for detecting the RHOA C16* mutation comprises a mutation-specific probe of SEQ ID NO: 122, a wild-type probe of SEQ ID NO: 121, a forward primer of SEQ ID NO: 115 and a reverse primer of SEQ ID NO: 116. In another embodiment, a different forward and reverse primers can be chosen from ANY consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412855-49412974 for the forward primer and chr3: 49412976-49413095 for the reverse primer (human assembly GRCh37/hg19), with the fundamental prerequisite that the position chr3: 49412975 must be excluded from the selected primer sequence. A different mutant and wild-type probe can be chosen from ANY consecutive DNA sequence of size comprised between 13 and 25 base pairs selected in the following regions: chr3: 49412950-49413000 (human assembly GRCh37/hg19) with the fundamental prerequisite that the position chr3: 49412975 must be included in the selected probe sequence.

[0514] Selected primers for the probe-based C16* assay

[0515] Given the proximity with the G17V position, the same primers (RHOA L and RHOA R) will be used for the C16* assay.

[0516] Selected probes for the probe-based C16* assay

[0517] The following is an example of probes selected for the C16* assay:

TABLE-US-00071 TABLE 41 Table 41: Evaluation of all thermodynamic parameters considered to select appropriate probes for the RHOA C16* probe-based assay. Accepted values are presented with white background. Probe # Tm GC % self- Hair- Validated name Sequence Length LNA (° C.) GC % tail dimers pins Dyes Quencher (Y/N) RHOA /5HEX/TGTCTTTC 20  1 64.5 50  57.1 −0.08 18.3 HEX BHQ-1 Y C16* C + ACAGGCTCCA WT T/3BHQ1/ RHOA /56-FAM/TGTCTT 20  1 64.5 50  57.1 −1.46 16.4 6FAM BHQ-1 Y C16* TCC + TCAGGCTC Mut CAT/3BHQ1/ Accepted values for 13-25 bp <4 55-60° C. 40-60% >25% > −4 «Tm FAM: BHQ-1 Y the parameters in ΔTmr < Kcal/mol mut analysis 5° C. HEX: WT

[0518] Any other combination could be evaluated to fit the thermodynamic parameters as described above.

[0519] BLAT Alignment of the Validated Primer Pairs

[0520] Refer to correspondent BLAT alignment and analysis performed for the probe-based G17V assay.

[0521] Thermodynamic Analysis

TABLE-US-00072 TABLE 41 Evaluation of heterodimers presence for all primers and probes evaluated for the probe-based RHOA C16* assay. Accepted values are presented with white background. ΔG Validated? Oligonucleotide combination (Kcal/mol) Y/N RHOA L + RHOA R −1.88 Y RHOA L + C16* mut −3.25 Y RHOA L + C16* WT −3.25 Y RHOA R + C16* mut −1.46 Y RHOA R + C16* WT −0.08 Y Accepted values for the >−4 Kcal/ mol Y parameters in analysis

[0522] RHOA G14V

[0523] The inventors have designed specific sets of primers allowing improved detection of the presence (or absence, or frequency) of such a mutation from a sample containing cfNA or genomic DNA.

[0524] More specifically, in a preferred embodiment, the mutation is RHOA G14V, where the glycine to valine change is due to a single point mutation at position chr3: 49412982 (human assembly GRCh37/hg19) where the wild-type allele is a cytosine (C) and the mutant allele is an adenine (A). In a preferred embodiment, the set of reagents for detecting the RHOA G14V mutation comprises a mutation-specific probe of SEQ ID NO: 124, a wild-type probe of SEQ ID NO: 123, a forward primer of SEQ ID NO: 115 and a reverse primer of SEQ ID NO: 116. In another embodiment, a different forward and reverse primers can be chosen from any consecutive DNA sequence of size comprised between 15 and 25 base pairs selected in the following regions: chr3: 49412862-49412981 for the forward primer and chr3: 49412983-49413102 for the reverse primer (human assembly GRCh37/hg19), with the fundamental prerequisite that the position chr3: 49412982 must be excluded from the selected primer sequence. A different mutant and wild-type probe can be chosen from any consecutive DNA sequence of size comprised between 13 and 25 base pairs selected in the following regions: chr3: 49412957-49413007 (human assembly GRCh37/hg19) with the prerequisite that the position chr3: 49412982 is included in the selected probe sequence.

[0525] Selected Primers for the Probe-Based G14V Assay

[0526] Given the proximity with the G17V position, the same primers (RHOA L and RHOA R) will be used for the G14V assay.

[0527] Selected Probes for the Probe-Based G14V Assay

[0528] The following is an example of probes selected for the G14V assay:

TABLE-US-00073 TABLE 42 Table 42: Evaluation of all thermodynamic parameters considered to select appropriate probes for the RHOA G14V probe-based assay. Accepted values are presented with white background. Probe # Tm GC % self- Hair- Validated name Sequence Length LNA (° C.) GC % tail dimers pins Dyes Quencher (Y/N) RHOA /5HEX/CACAGGCT + 19  1 65.2 57.9  57.1 none 31.1 HEX BHQ-1 Y G14V CCATCACCAAC/3BHQ_1/ WT RHOA /56-FAM/CACAGGCT + 19  1 61.3 52.6  57.1 none 31.1 6FAM BHQ-1 Y G14V ACATCACCAAC/3BHQ_1/ Mut Accepted values for 13-25 bp <4 55-60° C. 40-60% >25% > −4 «Tm FAM: BHQ-1 Y the parameters in ΔTmr < Kcal/ mut analysis 5° C. mol HEX: WT

[0529] Any other combination could be evaluated to fit the thermodynamic parameters presented above.

[0530] BLAT Alignment of the Validated Primer Pairs

[0531] Refer to correspondent BLAT alignment and analysis performed for the probe-based G17V assay.

[0532] Thermodynamic Analysis

TABLE-US-00074 TABLE 43 Evaluation of heterodimers presence for all primers and probes evaluated for the probe-based RHOA G14V assay. Accepted values are presented with white background. ΔG Validated? Oligonucleotide combination (Kcal/mol) Y/N RHOA L + RHOA R −1.88 Y RHOA L + G14V mut −1.46 Y RHOA L + G14V WT −1.46 Y RHOA R + G14V mut −1.2 Y RHOA R + G14V WT −1.2 Y Accepted values for the >−4 Kcal/ mol Y parameters in analysis

TABLE-US-00075 SEQUENCES SEQ ID number Name Sequence Mutation   1 F.sub.25L.sub.22 CTGGGAACTGGTCCTTGCTGAG F25L   2 F.sub.25L.sub.21 TGGGAACTGGTCCTTGCTGAG   3 F.sub.25L.sub.20 GGGAACTGGTCCTTGCTGAG   4 F.sub.25L.sub.19 GGAACTGGTCCTTGCTGAG   5 F.sub.25L.sub.18 GAACTGGTCCTTGCTGAG   6 F.sub.25L.sub.17 AACTGGTCCTTGCTGAG   7 F.sub.25L.sub.16 ACTGGTCCTTGCTGAG   8 F.sub.25L I.sub.22 AAGACATGCTTGCTCATAGTCC   9 F.sub.25L I.sub.21 AGACATGCTTGCTCATAGTCC  10 F.sub.25L I.sub.20 GACATGCTTGCTCATAGTCC  11 F.sub.25L I.sub.19 ACATGCTTGCTCATAGTCC  12 F.sub.25L I.sub.18 CATGCTTGCTCATAGTCC  13 F.sub.25L I.sub.17 ATGCTTGCTCATAGTCC  14 F.sub.25L I.sub.16 TGCTTGCTCATAGTCC  15 F.sub.25 P.sub.20 AGAAACTGGTGATTGTTGGT  16 F.sub.25 I P.sub.20 P.sub.3 CCTCGATATCTGCCACATAG  17 F.sub.25 I P.sub.21 CCACATAGTTCTCAAACACTG  18 F.sub.25 I P.sub.20 CACATAGTTCTCAAACACTG  19 F.sub.25 I P.sub.19 ACATAGTTCTCAAACACTG  20 F.sub.25 I P.sub.18 CATAGTTCTCAAACACTG  21 F.sub.25L OB.sub.23 TGGTCCTTGCTGAAGACTATGAG  22 F.sub.25L OB.sub.22 GGTCCTTGCTGAAGACTATGAG  23 F.sub.25L OB.sub.21 GTCCTTGCTGAAGACTATGAG  24 F.sub.25L OB.sub.20 TCCTTGCTGAAGACTATGAG  25 F.sub.25L OB.sub.19 CCTTGCTGAAGACTATGAG  26 F.sub.25Li OB.sub.23 TGCTCATAGTCTTCAGCAAGGAC  27 F.sub.25Li OB.sub.22 GCTCATAGTCTTCAGCAAGGAC  28 F.sub.25Li OB.sub.21 GCTCATAGTCTTCAGCAAGGA  29 F.sub.25Li OB.sub.21/.sub.2 CTCATAGTCTTCAGCAAGGAC  30 F.sub.25Li OB.sub.20 CTCATAGTCTTCAGCAAGGA  31 F.sub.25Li OB.sub.19 CTCATAGTCTTCAGCAAGG  32 F.sub.25 WT L GCAGGATGAGAATGGATTC  33 F.sub.25 WT R GAATTAGAGCTTTTTGCCTC  34 F.sub.25Li OB.sub.23/.sub.2 ACATGCTTGCTCATAGTCTTCAG  35 F.sub.25Li OB.sub.22/.sub.2 CATGCTTGCTCATAGTCTTCAG  36 F.sub.25Li OB.sub.21/.sub.3 ATGCTTGCTCATAGTCTTCAG  37 F.sub.25Li OB.sub.20/.sub.2 TGCTTGCTCATAGTCTTCAG  38 F.sub.25Li OB.sub.19/.sub.2 GCTTGCTCATAGTCTTCAG  39 G.sub.17V.sub.22 ACTATGAGCAAGCATGTCTTTA G17V  40 G.sub.17V.sub.21 CTATGAGCAAGCATGTCTTTA  41 G.sub.17V.sub.20 TATGAGCAAGCATGTCTTTA  42 G.sub.17V.sub.19 ATGAGCAAGCATGTCTTTA  43 G.sub.17V.sub.18 TGAGCAAGCATGTCTTTA  44 G.sub.17V.sub.17 GAGCAAGCATGTCTTTA  45 G.sub.17V.sub.16 AGCAAGCATGTCTTTA  46 G.sub.17V I.sub.22 TTGTTGGTGATGGAGCCTGTGT  47 G.sub.17V I.sub.21 TGTTGGTGATGGAGCCTGTGT  48 G.sub.17V I.sub.20 GTTGGTGATGGAGCCTGTGT  49 G.sub.17V I.sub.19 TTGGTGATGGAGCCTGTGT  50 G.sub.17V I.sub.18 TGGTGATGGAGCCTGTGT  51 G.sub.17V I.sub.17 GGTGATGGAGCCTGTGT  52 G.sub.17V I.sub.16 GTGATGGAGCCTGTGT  53 G.sub.17 I P.sub.18 TTCTCAAACACTGTGGGC  54 G.sub.17 I P.sub.19 GAACTGGTCCTTGCTGAAG  55 G.sub.17 I P.sub.20 TCTGCCACATAGTTCTCAAA  56 G.sub.17 P.sub.21 TCTGTGTTTTGTGTTTCAGCA  57 G.sub.17 P.sub.20 CTGTGTTTTGTGTTTCAGCA  58 G.sub.17 P.sub.19 TGTGTTTTGTGTTTCAGCA  59 G.sub.17 P.sub.18 GTGTTTTGTGTTTCAGCA  60 G.sub.17 OB.sub.23 CATGTCTTTCCACAGGCTCCATC  61 G.sub.17 OB.sub.22 ATGTCTTTCCACAGGCTCCATC  62 G.sub.17 OB.sub.21 ATGTCTTTCCACAGGCTCCAT  63 G.sub.17 OB.sub.20 ATGTCTTTCCACAGGCTCCA  64 G.sub.17 OB.sub.19 ATGTCTTTCCACAGGCTCC  65 G.sub.17 I OB.sub.23 ATGGAGCCTGTGGAAAGACATGC  66 G.sub.17 I OB.sub.22 ATGGAGCCTGTGGAAAGACATG  67 G.sub.17 I OB.sub.21 ATGGAGCCTGTGGAAAGACAT  68 G.sub.17 I OB.sub.20 ATGGAGCCTGTGGAAAGACA  69 G.sub.17 I OB.sub.19 TGGAGCCTGTGGAAAGACA  70 G.sub.17 WT L GACACATGCTTTGGTAACC  71 G.sub.17 WT R CTTTTGGTGCCAGGTGGA  72 C.sub.16*.sub.22 TATGAGCAAGCATGTCTTTCCT C16Stop  73 C.sub.16*.sub.21 ATGAGCAAGCATGTCTTTCCT  74 C.sub.16*.sub.20 TGAGCAAGCATGTCTTTCCT  75 C.sub.16*.sub.19 GAGCAAGCATGTCTTTCCT  76 C.sub.16*.sub.18 AGCAAGCATGTCTTTCCT  77 C.sub.16*.sub.17 GCAAGCATGTCTTTCCT  78 C.sub.16*.sub.16 CAAGCATGTCTTTCCT  79 C.sub.16* I.sub.22 GATTGTTGGTGATGGAGCCTGA  80 C.sub.16* I.sub.21 ATTGTTGGTGATGGAGCCTGA  81 C.sub.16* I.sub.20 TTGTTGGTGATGGAGCCTGA  82 C.sub.16* I.sub.19 TGTTGGTGATGGAGCCTGA  83 C.sub.16* I.sub.18 GTTGGTGATGGAGCCTGA  84 C.sub.16* I.sub.17 TTGGTGATGGAGCCTGA  85 C.sub.16* I.sub.16 TGGTGATGGAGCCTGA  86 C.sub.16* P.sub.20 GTGTTTTGTGTTTCAGCAAT  87 C.sub.16* P.sub.21 GTGTTTTGTGTTTCAGCAATG  88 C.sub.16* I P.sub.20 ATAGTTCTCAAACACTGTGG  89 G.sub.14V.sub.22 AAGCATGTCTTTCCTCAGGCTA G14V  90 G.sub.14V.sub.21 AGCATGTCTTTCCTCAGGCTA  91 G.sub.14V.sub.20 GCATGTCTTTCCTCAGGCTA  92 G.sub.14V.sub.19 CATGTCTTTCCTCAGGCTA  93 G.sub.14V.sub.18 ATGTCTTTCCTCAGGCTA  94 G.sub.14V.sub.17 TGTCTTTCCTCAGGCTA  95 G.sub.14V.sub.16 GTCTTTCCTCAGGCTA  96 G.sub.14V I.sub.22 AACTGGTGATTGTTGGTGATGT  97 G.sub.14V I.sub.21 ACTGGTGATTGTTGGTGATGT  98 G.sub.14V I.sub.20 CTGGTGATTGTTGGTGATGT  99 G.sub.14V I.sub.19 TGGTGATTGTTGGTGATGT 100 G.sub.14V I.sub.18 GGTGATTGTTGGTGATGT 101 G.sub.14V I.sub.17 GTGATTGTTGGTGATGT 102 G.sub.14V I.sub.16 TGATTGTTGGTGATGT 103 G.sub.14 OB.sub.23 TTCCACAGGCTCCATCACCAACA 104 G.sub.14 OB.sub.22 TTCCACAGGCTCCATCACCAAC 105 G.sub.14 OB.sub.21 TCCACAGGCTCCATCACCAAC 106 G.sub.14 OB.sub.20 TCCACAGGCTCCATCACCAA 107 G.sub.14 OB.sub.19 CCACAGGCTCCATCACCAA 108 G.sub.14 I OB.sub.23 TGTTGGTGATGGAGCCTGTGGAA 109 G.sub.14 I OB.sub.22 TGTTGGTGATGGAGCCTGTGGA 110 G.sub.14 I OB.sub.21 GTTGGTGATGGAGCCTGTGGA 111 G.sub.14 I OB.sub.20 TTGGTGATGGAGCCTGTGGA 112 G.sub.14 I OB.sub.19 TTGGTGATGGAGCCTGTGG

TABLE-US-00076 SEQUENCES FOR PROBE-BASED ASSAYS Probe-based assays SEQ ID number Name Sequence Mutation 113 RHOA F25L L GCACATACACCTCTGG F25L 114 RHOA F25 R TGATTGTTGGTGATGGA 115 RHOA F CCTTGCTGAAGACTATGA G17V, C16*, 116 RHOA R GTGCATTGCAGGTAATATC G14V 117 RHOA F25L WT /5HEX/CTGA + AGACTATGAGCAAGCA/3BHQ_1/ F25L 118 RHOA F25L Mut /56-FAM/CTGA + GGACTATGAGCAAGC/3BHQ_1/ 119 RHOA G17V WT /5HEX/CATGTCTTT + CCACAGGCTC/3BHQ_1/ G17V 120 RHOA G17V Mut /56-FAM/CATGTCTTT + ACACAGGCTC/3BHQ_1/ 121 RHOA C16* WT /5HEX/TGTCTTTCC + ACAGGCTCCAT/3BHQ_1/ C16* 122 RHOA C16* Mut /56-FAM/TGTCTTTCC + TCAGGCTCCAT/3BHQ_1/ 123 RHOA G14V WT /5HEX/CACAGGCT + CCATCACCAAC/3BHQ_1/ G14V 124 RHOA G14V Mut /56-FAM/CACAGGCT + ACATCACCAAC/3BH Q_1/