SYSTEM AND METHOD FOR RAPID AND SENSITIVE DETECTION OF ANTI-PATHOGEN ANTIBODIES

Abstract

A serological detection system and a serological method of detecting a specific immunoglobulin (Ig) isotype against a target antigen in a sample, the serological detection system comprising: (a) a first probe having a first tag, the first probe having general binding affinity for all Ig having the same isotype as the specific Ig isotype in the sample, (b) a second probe having a second tag, the second probe being the target antigen of the specific Ig isotype in the sample, (c) a third tag, the third tag having binding affinity for the first tag and for the second tag so as to form a reporter complex in the presence of the specific IgG antibodies, and (d) a suitable substrate that generates an optically detectable signal in the presence of the reporter complex. In aspects, the serological detection system and the serological method are quantifiable.

Claims

1. A serological detection system for detecting immunoglobulins (Ig) of a specific isotype against a target antigen in a sample, the serological detection system comprising: (a) a first probe having a first tag, the first probe having general binding affinity for all Ig of the same isotype as the specific Ig isotype in the sample, (b) a second probe having a second tag, the second probe being the target antigen of the specific Ig isotype in the sample, (c) a third tag, the third tag having binding affinity for the first tag and for the second tag so as to form a reporter complex in the presence of the specific IgG antibodies, and (d) a suitable substrate that generates an optically detectable signal in the presence of the reporter complex.

2. (canceled)

3. (canceled)

4. The serological detection system of claim 1, wherein the first probe recognizes immunoglobulin G (IgG) without cross-reactivity with other Ig isotypes.

5. The serological detection system of claim 1, wherein the first probe is a protein G, or a suitable domain thereof.

6. The serological detection system according of claim 1, wherein the first probe is a protein G of a Streptococcus sp, a C1 domain of Streptococcus sp, a C2 domain of Streptococcus sp or a C3 domain of protein G of Streptococcus sp.

7. (canceled)

8. (canceled)

9. The serological detection system of claim 1, wherein the first probe recognizes immunoglobulin M (IgM) without cross-reactivity with other Ig isotypes or the first probe recognizes immunoglobulin A (IgA) without cross-reactivity with other Ig isotopes.

10. The serological detection system of claim 1, wherein the third tag is a 11S peptide of a nanoluciferase.

11. The serological system of claim 1, wherein the first probe is a protein G or a suitable protein G domain for general detection of IgGs in the sample, and the first tag is a 9 peptide of a nanoluciferase, the second probe is the target antigen of the specific IgG isotype, the second tag is a 10 peptide of the nanoluciferase, the third tag is a 11S of the nanoluciferase NanoLuc or a fragment thereof, and the substrate is a reagent that generates the optically detectable signal in the presence of the nanoluciferase.

12. The serological system of claim 1, wherein the first probe is a protein G or a suitable protein G domain for general detection of IgGs in the sample, and the first tag is a 10 peptide of a nanoluciferase, the second probe is the target antigen of the specific IgG isotype, the second tag is a 139 peptide of the nanoluciferase, the third tag is a 11S of the nanoluciferase NanoLuc or a fragment thereof, and the substrate is a reagent that generates the optically detectable signal in the presence of the nanoluciferase.

13. (canceled)

14. (canceled)

15. The serological system of claim 11, wherein the 9 peptide is included at the N-terminus of the protein G or of the suitable protein G domain, and the 1310 peptide is included at both the N-terminus and the C-terminus of the protein characteristic of the target.

16. The serological system of claim 1, wherein the first probe is an anti IgM antibody for general detection of IgMs in the sample, and the first tag is a 139 peptide of a nanoluciferase, the second probe is the target antigen of the specific IgM isotype, the second tag is a 1310 peptide of the nanoluciferase NanoLuc, the third tag is a 11S of the nanoluciferase NanoLuc or a fragment thereof, and the substrate is a reagent that generates the optically detectable signal in the presence of the nanoluciferase NanoLuc.

17. The serological system of claim 1, wherein the target antigen is from an infectious pathogen, or wherein the target antigen is an autoimmune antigen and the specific Ig isotype are autoantibodies.

18. (canceled)

19. The serological system of claim 17, wherein the target antigen is the infectious pathogen, and wherein the pathogen is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

20. The serological system of claim 19, wherein the second probe is a spike (S) protein of SARS-CoV-2 or a fragment thereof, or a receptor binding protein of a spike protein of SARS-CoV-2.

21. (canceled)

22. (canceled)

23. The serological system of claim 1, wherein a strength of the optically detectable signal correlates with the amount of the specific Ig isotype in the sample, thereby quantitating the specific Ig isotype against the target antigen in the sample.

24. A serological method of detecting the presence of specific Ig isotype against a target antigen in a sample of a subject, the method comprising: (a) reacting the sample with the serological system of claim 1, and (b) exposing the sample to an apparatus that detects the optically detectable signal in the sample, wherein detection of the optically detectable signal in the sample is indicative of the presence of the specific Ig isotype against the target antigen in the sample, and wherein the optically detectable signal has a strength, and the strength of the optically detectable signal is quantifiable and correlates with the amount of the specific Ig isotype against the target antigen in the sample.

25. (canceled)

26. The serological method of claim 24, wherein the strength of the optically detectable signal detected in the sample is compared to strength of optically detectable signal detected from a control sample devoid of the specific Ig isotype (negative control), and when the strength of optically detectable signal from the sample is greater than the strength of the optically detectable signal from the negative control is indicative of the presence of the specific Ig isotype in the sample.

27. (canceled)

28. The serological method of claim 24, wherein the target antigen is from an infectious pathogen and wherein pathogen is a bacterium, a fungus, a virus, a yeast, algae or a protozoan, or wherein the target antigen is an autoimmune antigen and the specific Ig isotype are autoantibodies.

29. The serological method of claim 28, wherein the pathogen is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and wherein the second probe is a spike (S) protein of SARS-CoV-2 or a fragment thereof, or the second probe is a receptor binding protein of a spike protein of SARS-CoV-2.

30-58. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0065] The following figures illustrate various aspects and preferred and alternative embodiments.

[0066] FIGS. 1A-1E. tNLuc assay for detecting -SARS-CoV-2 antibody. 1A. Schematic workflow of the tNLuc assay. 1B. Scan of all probe formats/combinations in the tNuc assay using CR3022 Ab (2 g/mL). Results are presented as a heatmap showing RLU values. 1C-1D. CR3022 at different concentrations was tested with the 9-G together with 10-S(C) or 10-S10 (1D) probes. Human IgG, a mouse monoclonal Ab, and rabbit polyclonal Abs were used as controls. 1E. Comparison of 10-S and 10-S10 affinities in the tNLuc system. The average Kd values of four experiments for each probe are presented as a bar graph. P value was calculated using a two tailed t-test.

[0067] FIGS. 2A-2E. Inhibitory effect of additional IgG on tNLuc assay. 2A. Dose response of IgG inhibition. Different amounts of human IgG as indicated were applied to samples containing 2 g/mL CR3022 followed by analysis with the tNLuc assay. 2B. Inhibition kinetics of IgG in the assay was examined with different doses of CR3022, without IgG or in presence of human IgG at 25, 50 or 100 g/mL, roughly the amounts in human serum at a 1:200 dilution. 2C. To mimic serum samples, different amounts of CR3022 (100, 33, 11 or 3.7 g/mL) were spiked into buffer containing background human IgG at concentrations of 5, 10 or 20 mg/mL. Each sample was serially diluted and then analyzed with the tNLuc assay. Sums of luminescence readings at 1:300, 1:900 and 1:2700 for each sample are presented. 2D. Serially diluted CR3022 (100, 50, 25, 12.5, and 6.25 g/mL) was spiked into serum samples (n=7, C1C7 labeled with different colors and shapes) collected before the pandemic. In blank samples (gray circle), CR3022 was tested in buffer without mixing with serum. Each sample was tested and analyzed as in 2C. Basal value (baseline) was calculated as the mean of the seven serum samples without CR3022 spiking. The line of standard deviation (SD)3 is highlighted as the limit of detection. Recovery is calculated as the percentage signal of a sample divided by the corresponding blank sample and is plotted in 2E. Data shown here are a representative result of two independent experiments with similar results.

[0068] FIGS. 3A-3B. Detection of -SARS CoV-2 antibody in serum samples with the tNLuc assay. 3A. Samples included 7 collected before the pandemic and 82 from verified active or convalescent COVID-19 patients collected at different times after symptom onset. These were serially diluted as indicated and subjected to tNLuc testing. CR3022 (0.4 mg/mL in stock) was used as positive control. The level of anti-SARS CoV-2 antibodies at each dilution measured using tNLuc. Data shown in 3A are a representative result of two independent experiments with similar results. The dashed lines representing pre-pandemic samples are found next to the baseline (x axis) and they are obscured by the baseline. 3B. The overall antibody signal in each sample was calculated by summation of luminescence signals at dilutions 1:300, 1:900, and 1:2700. Samples are categorized in groups based on time elapsed between symptom onset and sample collection, and their distribution is presented in violin plots. The central dashed lines represent medians.

[0069] FIG. 4A-4D. Comparison of tNLuc assay with ELISA and neutralizing antibody assays. 4A. The same samples in FIG. 3 were tested using ELISA and the results are compared with tNLuc using scatter plot. 4B-4D. Eighty sera were subject to neutralizing antibody tests: sVNT (4B), PRNT50 (4C) and PRNT90 (4D). R and P-value were obtained from two-tailed Pearson correlation analysis. Source data for FIGS. 4A to 4D are presented in Table 1.

[0070] FIG. 5. Schematic of tNLuc probes.

[0071] FIGS. 6A-6C. Computational simulation of inhibitory effects of IgG on the tNLuc assay. 6A. Virtual samples containing CR3022 (3.7, 11, 33 and 100 g/mL) in the presence of IgG at different levels (5, 10, and 20 mg/mL) were serially diluted as indicated. Their tNLuc signals at each dilution endpoint were calculated using the chemical kinetics model derived from the experimental data shown in FIG. 2B. 6B. Theoretical recovery rates of samples in 6A at different dilutions were calculated by dividing the calculated reading of a virtual sample in 6A by the corresponding virtual sample not containing IgG. 6C. The overall tNLuc signal of each virtual sample was calculated by luminescence summation of the calculated signals at the 1:300, 1:900 and 1:2700 dilutions obtained in 6A. Overall recovery rates are presented inset.

[0072] FIGS. 7A-7B. 7A. tNLuc-IgM assay for detecting anti-antigen IgM antibodies. 7B. Anti-S protein IgM levels in the sera of COVID-19 patients were evaluated using tNLuc-IgM assay presented herein. The results were plotted against days of symptom onset.

[0073] FIGS. 8A-8B. Detection of -SARS CoV-2 antibody in serum samples with the tNLuc assay. 8A. 70 serum samples collected from COVID-19 patients or convalescents were analyzed in two independent replicates using the tNLuc assay. The two sets of data are presented as a scatter plot. R and P values were obtained from two tailed Pearson analysis. 8B. tNLuc luminescence signal of 80 samples plotted against the time of sample collection.

DETAILED DISCLOSURE

Definitions

[0074] In this specification and in the claims that follow, reference will be made to several terms that shall be defined to have the meanings below. All numerical designations, e.g., dimensions and weight, including ranges, are approximations that typically may be varied (+) or () by increments of 0.1, 1.0, or 10.0, as appropriate. All numerical designations may be understood as preceded by the term about.

[0075] The term about, particularly in reference to a given quantity, is meant to encompass deviations of plus or minus five percent.

[0076] The term animal includes humans and other animals.

[0077] The term sample includes body fluid. The term body fluid, as used herein, includes blood, serum, plasma, urine, cerebrospinal fluid, saliva and any other body fluid that includes IgGs.

[0078] Throughout this specification and the claims, the terms comprise, comprises, and comprising are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the terms include, has and their grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items. Consisting essentially of when used to define systems, compositions and methods, shall mean excluding other elements of any essential significance to the combination for the intended use. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers. Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for using the systems of the present disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0079] The term NT as used herein refers to the N-terminal portion of a protein.

[0080] The term CT is used to refer to the C-terminal portion of a protein.

[0081] By isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro molecules of the same type. The term isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.

[0082] In this disclosure, the pathogen may be a human pathogen or an animal pathogen. The pathogen includes a bacterium, a fungus, a virus, a yeast, algae or a protozoan. In some embodiments, the pathogen is selected from the group consisting of Bacillus anthracis, Bordetella pertussis, Borrelia spp., Brucella spp., Chlamydia spp., Clostridium botulinum, Clostridium tetani, Corynebacterium diphtheriae, Enterobactereciae, Escherichia coli, Haemophilus influenza, Helicobacter pylori, Hemophilus spp., Klebsiella spp., Streptococcus pneumonia, Legionella pneumophila, Listeria monocytogenes, Mycobacterium tuberculosis, Mycoplasma spp., Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas spp., Ricketsia spp., Salmonella spp., Shigella spp., Staphylococcus spp., Streptococci spp., Vibrio cholera, Yersinia spp., Adenovirus species, corona virus species, CCHF virus, Cytomegalovirus, Dengue virus, Ebola virus, Epstein-Barr virus, SARS-CoV-2, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Herpes simplex viruses, HIV, HTLV, Human Herepes virus 6-8, Influenza virus, Measles virus, Mumps virus, Polio virus, Rabies virus, Rubella virus, SARS and associated coronaviruses, Respiratory Syncytial virus, Varicella Zoster virus, West Nile Virus, Yellow Fever virus, Zika virus, Plasmodium spp., and agents of endemic mycoses.

[0083] Overview

[0084] The present disclosure relates to a novel approach for detecting the presence of specific immunoglobulin isotypes against specific antigens in a sample. In alternative embodiments, the specific immunoglobulin (Ig) isotype immunoglobulin G (IgG) or immunoglobulin M (IgM) or IgA. In aspects the specific Ig antibody is a-severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) IgG or IgM. In this approach, a tri-part split of a reporter protein is used as a sensor for detecting the presence of the specific anti-antigen antibody, such as -SARS CoV-2 antibody.

[0085] Presented herein is a new serological system and assay for the detection of specific Ig antibodies against specific antigens with a quantifiability like that of ELISA but featuring great ease of use, more rapid detection and lesser requirement for specialized equipment. Furthermore, its readout shows tight correlation to neutralizing capability. Collectively these features suggest the system and methods of this disclosure have great value for use in clinical laboratories involved in pathogen testing. Additionally, the strategy employed in the assay described in this disclosure has the potential to be adapted for use in alternative diagnostic approaches to help combat infectious disorders or autoimmune diseases.

[0086] The antigens, in embodiments, are from infectious pathogens or from autoimmune disorders.

[0087] In one embodiment, the present disclosure is a serological detection system of a specific immunoglobulin isotype against a target antigen in a sample. In embodiment, the system includes: (a) a first probe having a first tag, the first probe having general binding affinity for the Ig isotype of the specific isotype in the sample, (b) a second probe having a second tag, the second probe being the antigen having specific binding affinity to the specific Ig isotype in the sample, (c) a third tag, the third tag having binding affinity for the first tag and for the second tag so as to form a reporter complex in the presence of the specific Ig isotype, and (d) a suitable substrate that generates an optically detectable signal in the presence of the reporter complex. In one embodiment, the specific Ig isotype is IgG. In another embodiment, the specific Ig isotype is IgM.

[0088] In embodiments, the present disclosure describes serological method of detecting the presence of a specific Ig isotype against a target of interest, which includes pathogen or antigens of an autoimmune disease in a sample of a subject, the method comprising: (a) reacting the sample with (i) a first probe having a first tag, the first probe having general binding affinity for the Ig isotype of the specific Ig isotype in the sample, and (ii) a second probe having a second tag, the second probe being an antigen having specific binding affinity to the specific Ig isotype in the sample, (b) reacting the sample with (i) a third tag having binding affinity for the first tag and for the second tag so as to form a reporter complex in the presence of the specific Ig isotype, and (ii) a suitable substrate that generates an optically detectable signal in the presence of the reporter complex, and (c) exposing the sample to an apparatus that detects the optically detectable signal in the sample, wherein detection of the optically detectable signal in the sample is indicative of the presence of-specific Ig isotype in the sample. In one embodiment, the specific Ig isotype is IgG. In another embodiment, the specific Ig isotype is IgM.

[0089] In some embodiments, the present disclosure relates to a serological diagnostic test of an infectious disease caused by a pathogen, or of an autoimmune disease in a subject comprising: (a) reacting a sample taken from the subject with (i) a first probe having a first tag, and (ii) a second probe having a second tag, the second probe being an antigen from the pathogen or from the autoimmune disease having specific binding affinity to a specific Ig isotype in the sample, the first probe having general binding affinity for the Ig isotype of the specific Ig isotype in the sample (b) reacting the sample with (i) a third tag having binding affinity for the first tag and for the second tag so as to form a reporter complex in the presence of the specific Ig isotype, and (ii) a suitable substrate that generates an optically detectable signal in the presence of the reporter complex, and (c) exposing the sample to an apparatus that detects the optically detectable signal in the sample, wherein detection of the optically detectable signal in the sample is indicative of a positive test, and absence of optically detectable signal being indicative of a negative test. In one embodiment, the specific Ig isotype is IgG. In another embodiment, the specific Ig isotype is IgM.

[0090] The first prole has binding affinity to any Ig of the same isotype of the specific lg. For example, if the specific Ig is IgG, then the first probe has general binding affinity to all IgGs, including the specific IgG. If the specific Ig is IgM, then the first probe has general binding affinity to all IgMs, including the specific IgM.

[0091] In embodiments, the serological systems and assays of the present disclosure are based on a splitting of NanoLuc (Nluc), the brightest luciferase identified so far, into three fragments or tags: two short peptides (9 and 10 each containing 11 amino acids) and one 16 kDa fragment (11S). The 9 and 10 tags are separately fused to a pair of probes. The first of these probes is suitable for general detection of one Ig isotype and has no cross-reactivity with other Ig isotypes. In one embodiment the Ig isotype is IgG and examples of the first probe include protein G of different streptococcal strains, or a domain of protein G, that exclusively binds to all isotypes of human IgG but does not bind to or cross-react with IgM, IgA or IgE. In another embodiment, the Ig isotype is IgM, and the first probe include is an IgM binder that specifically recognizes IgM and has no cross-reactivity with IgG, IgA or IgE molecules. Examples of IgM binders include antibodies that generally bind to IgM, such as those developed by NanoTag Biotechnologies (clone 2F2). The first probe is fused to a first tag, including the 9 peptide or the 10 peptide. The second probe is an antigen of the specific IgG isotype or IgM isotype and the antigen is of the disease being assayed. In embodiments, the disease is a COVID-19 infection, and the specific Ig is -SARS CoV-2 antibody, and the second probe is made, for example, from the viral spike (S) protein (including the receptor binding domain, RBD) or nucleocapsid (N) protein. The S protein is responsible for virus binding to receptor and the target of neutralizing antibodies in patients. As illustrated in FIG. 1A, (i) diluted serum or plasma samples are mixed with the two probes and incubated for an effective amount of time; (ii) an aliquot of this mixture is combined with the third component 11S (i.e., the third tag) and substrate and incubated for another effective amount of time, followed by luminescence recording with an apparatus such as a luminometer. An optical signal will be generated when the antibody against the target of interest is present in the sample.

[0092] A commonly used protein G is from Streptococcus G148, and it contains multiple domains. Domains C1, C2 and C3 are responsible for IgG binding with slight difference in their specificity. Protein G from other Streptococcus stains (such as G43 and C40) contains two IgG binding domains which are correspondent to the C1 and C3 domain of the G148 strain. All of these domains are suitable for the systems and methods of this disclosure. In the examples below, C2 of the G148 domain is used. The C3 domain of G148 was also tested and it seems to behave similarly as C2.

[0093] In embodiments, the serological systems, tests and methods of the present disclosure may be used as a high-throughput screening technology for detecting the presence of IgG antibodies against a pathogen or against any other target of interest.

[0094] The systems and methods of the present disclosure can also be used to follow the efficacy of a treatment of infectious disorders or other diseases. For example, in the case of COVID-19, a patient can be tested for quantifiably amount of -SARS CoV-2 antibody at different stages of the treatment using the systems, tests and methods of this disclosure. A reduction in the amount of -SARS CoV-2 antibody being indicative of the efficacy of the COVID-19 treatment.

[0095] In order to aid in the understanding and preparation of the present disclosure, the following illustrative, non-limiting examples are provided.

EXAMPLES

Example 1

[0096] Plasmids and Recombinant Proteins.

[0097] To create the general probe, the C2 domain of protein G of Streptococcus sp. (strain G148) was appended with the 89 tag and a 6xHis tag either at its N- or C-terminus (or both) (FIG. 5A). The cDNAs were cloned into pET16b by Gibson assembly. The plasmids were transformed into BL21-Gold (DE3) cells. For expression, the bacteria were grown at 37 C. until OD550 0.4-0.6, followed by further incubation at 22 C. for 4 hours in the presence of 0.2 mM IPTG. Bacterial cells were collected and lysed by sonication for further purification. Antibody specific probes were created by appending 810 tag to N or C, or both termini of SARS-CoV-2 spike protein (ectodomain) or its RBD 32. PDGFRB signal peptide was used as N-terminal leading sequence for N-tagged constructs to allow their correct secretion to extracellular space. PolyHis tag was added at their C-termini for purpose of purification. Several modifications were made to the S protein ectodomain probe similar to that previously reported: the foldon sequence was fused to the C-termini to promote trimerization; the furin cleavage site 682RRAR was mutated to GSAS; K986 and R987 were mutated to prolines to stabilize the prefusion conformation (FIG. 5A). The plasmids of antibody probes were transfected to HEK 293 cells by PEI and media of cultured cells were collected. Both general probes and antibody probe were purified with Ni Sepharose (Cytiva 17526801) according to the product manual. CR3022 was produced as described previously.sup.33. 11S was constructed and purified as described.sup.20. tNLuc assay. Patient sera or CR3022 were diluted in phosphate buffer saline supplemented with 0.1% Tween-20 and 0.1% fatty acid-free bovine serum albumin. In some cases, human IgG (Sigma 14506) was added to mimic human serum sample. The samples were mixed with probes at final concentration of 150 nM for general probes and 4 nM for antibody probes and were incubated at room temperature for 30 minutes. An aliquot of the mixture (5 l of sera sample or 2 l of CR3022 sample) was mixed with 9 volume of Nano-Glo buffer and substrate (Promega N1110) supplemented with recombinant 11S (final concentration 10 g/ml) in 96 or 384 well reading plate. After another 30 minutes of incubation at room temperature, luminescence signals were recorded by a microplate luminometer. CR3022 and probe binding kinetics was mathematically fitted with GraphPad Prism 8 in an allosteric sigmoidal model. IgG inhibitory effects on CR3022 binding kinetics was fitted in an allosteric noncompetitive model:

[00001]$Y=\frac{Y_{\max }{X}^{n_x}}{X^{n_x}\left(1+\frac{I^{n_i}}{K_i^{n_i}}\right)+K_m^{n_x}\left(1+\frac{I^{n_i}}{K_i^{n_i}}\right)}$

in which Y is the luminescence signal, X is the CR3022 concentration, I is the IgG concentration, n.sub.x is the Hill coefficient for CR3022 and probe interaction, and ni is the Hill coefficient for probe and IgG interaction.

[0098] ELISA. ELISA was undertaken according to previously described.sup.8,9 with some modifications. SARS-CoV-2 spike antigen was immobilized to a 384 well LUMITRAC high binding plate (Greinor Bio-One 781074) by incubating 20 l/well of S-810 protein (20 nM in PBS) at 37 C. for 1 hour. After blocking with blocking buffer (PBS supplemented with 0.1% Tween 20 and 3% skimmed milk) for one hour at room temperature, the plate was incubated with sera serially diluted in blocking buffer at room temperature for 2 hours. After three times of wash with PBST (PBS supplemented with 0.1% Tween 20), the plate was further incubated with a-human IgG antibody conjugated to horse radish peroxidase (Jackson ImmunoResearch 109-035-098, 1:50,000 in blocking buffer, 30 l/well) at room temperature for 1 hour. After three times of final wash with PBST, Pico chemiluminescence substrate mixture (Thermo Scientific 3769, 30 l/m1) was added to the plate and signals were recorded in a microplate luminometer. Data of serially diluted samples were analyzed with GraphPad Prism 8 by model fitting. The total signal was calculated as areas under curve (AUC) of the fitted curves.

[0099] sVNT. sVNT kit was purchased from Genscript and the assay was performed according to the manufacturer's instructions.sup.29. Briefly, diluted serum samples were mixed with HRP-RBD at a 1:1 ratio and incubated at 37 C. for 30 minutes. An aliquot (100 l) of the mixture was moved to a well of a test plate which was precoated with ACE2 provided by the manufacturer and was incubated at 37 C. for 15 minutes. After 4 times wash, signal was developed by incubation with TMB solution.

[0100] PRNT. PRNT was performed as described previously.sup.33. Briefly, diluted serum samples were incubated with SARS-CoV-2 virus (50 PFU) in a CO.sub.2 incubator for one hour. The mixture was then moved to a well of a 12-well plate cultured with Vero E6 cells (100% confluency) and incubated for one hour in a CO.sub.2 incubator with rocking every 15 minutes. To each well 1.5 ml prewarmed (37 C.) overlay medium (MEM without phenol red but supplemented with 4% FBS, L-glutamine, nonessential amino acids, sodium bicarbonate and 1.5% carboxymethycellose) was added followed by incubation for 72 hours. The cells were then fixed with 10% formalin (neutral-buffered) and subsequently stained with crystal violet (0.5% solved in 20% ethanol). Plaques were counted and compared to negative control. A titre is recorded as the highest serum dilution resulting in 50% and 90% reduction in plaques compared with controls. Human serum samples Negative control sera were taken before the pandemic. All patients were diagnosed by SARS-CoV-2 RT-PCR from nasopharyngeal swabs. All samples are de-identified and enrolled through REB approved protocols, REB20-044c or REB 149-1994.

[0101] Statistics. Statistical analysis was performed using GraphPad Prism 8. The performance difference between 10-S and 10-s-10 was analyzed an unpaired two-tailed t test. Correlation between tNLuc assay and other assays (ELISA, VNT or PRNT) was analyzed using Pearson product-moment correlation.

Results

[0102] In the present design, the 9 and 10 tags are separately fused to a pair of probes which can respectively recognize an IgG molecule against SARS-CoV-2 at different sites. The first probe is generated by fusing the 9 tag to the C2 domain of protein G, which exclusively binds to all the isotypes of human IgG but not to IgM, IgA or IgE immunoglobulins.sup.22. The second probe is specific to antibodies that bind the SARS-CoV-2 spike (S) protein, the viral membrane protein responsible for host cell receptor binding.sup.23 and which is also the target of most of the neutralizing antibodies found in patients.sup.24. We generated two forms of this probe by fusing the 10 tag to either the ectodomain of the S protein or to its receptor binding domain (RBD). The assay itself is remarkably straightforward to perform and involves only two simple steps (FIG. 1A): (i) diluted serum or plasma samples are mixed with the two probes and incubated for minutes; (ii) an aliquot of this mixture is combined with the third component, Ails, and the luciferase substrate and incubated for another 30 minutes, followed by luminescence recording with a luminometer. The whole process occurs directly in the liquid phase and does not require any washing steps.

[0103] As the peptide tags (9 and 10) can be fused either at the N- or C-terminus of the probes or at both positions (FIG. 5), we first sought to determine which combination of the various probes would result in the most signal with the least background. We tested all combinations of the probes with CR3022, an antibody that binds to the RBD of the SARS-CoV-2 S protein.sup.25, and observed that all combinations produced signal, albeit to varying extents (FIG. 1B). This suggests that despite the fact that the probes bind to different domains of IgG, the molecules are sufficiently flexible to allow proximal localization of the two tags, enabling reconstitution of tNLuc into an active luciferase. Of all the combinations, two produced the highest signal-to-background: 9-G with 810-S and 89-G with 810-S-810. Further testing of these two combinations using different concentrations of CR3022 demonstrated typical dose response curves (FIG. D). However, based on the calculated Kd values using 810-S(0.42 g/mL) and 810-S-810 (0.23 g/mL), we predicted that 10-S-10 would have greater potential to detect antibody at lower concentrations (FIG. 1E). Thus, the 9-G/10-S-10 probe pair was chosen to be used in the final assay.

[0104] Human plasma contains a high concentration of IgG (4-22 mg/mL, median 11 mg/mL in serum).sup.26,27, the vast majority of which will not be specific for the SARS-CoV-2 S-protein. Since they can, however, bind the protein G probe, these non-specific antibodies will reduce the sensitivity of our assay. We investigated the effect of IgG interference on the assay by adding different amounts of human IgG into the reaction mixture and as predicted inhibition was indeed observed (FIG. 2A). The detailed kinetics of inhibition were further analyzed based on the dose response testing of CR3022 in the presence of different amounts of IgG (FIG. 2B). We performed mathematical analysis by fitting different inhibition models to these experimental data. A model of allosteric noncompetitive inhibition provided the best fit, as judged by visual comparison of the curve positions/shapes with the plotted data points (FIG. 2B) and the calculated R.sup.2 (0.9911). The allosteric effect might be derived from the binding of protein G to two sites on an IgG molecule while the detailed molecular mechanism of noncompetitive inhibition merits further exploration.

[0105] Binding parameters derived from the model (Ki=58.5 g/mL, and Kd=0.22 g/mL which is consistent with the results in FIG. 1E) suggest a considerable difference of the probe binding affinities toward CR3022 antibody and general IgG. We therefore reasoned that the inhibition can be eliminated or alleviated simply by dilution, a step also required to reduce nonspecific signal when performing ELISA on blood samples. This was supported by computational simulation of assays, using the obtained mathematical model, on virtual samples containing different concentrations of IgG and varying amounts of CR3022 (FIG. 6A). The recovery rates (the luminescence ratio of a sample and the correspondent control without additional IgG) at different dilution endpoints were calculated (FIG. 6B). At 1:100 dilution, the recovery rates for the samples of 20 mg/mL IgG (close to the upper limit in human serum) are around 20%. This was significantly improved by further dilution, reaching 47-60% at 1:300 dilution and 86-88% at 1:900 dilution. Reduced IgG brought even better recovery; samples containing 10 mg/mL IgG (close to the median IgG in human serum) showed 80% recovery at 1:300 dilution and 5 mg/mL of IgG (close to the lower limit of IgG in human serum) showed more than 90% recovery at 1:300 dilution.

[0106] Building on these results, we then adopted a strategy involving sample dilution to obtain more accurate measurements of the S protein specific antibodies. The overall tNLuc signal of a sample was calculated using the signal summation algorithm (luminescence sum of RLU values at 1:300, 1:900 and 1:2700 dilutions) to avoid parameter estimation, as required by other algorithms, while still maintaining a power similar to curve fitting.sup.28. The signal at the lowest dilution endpoint (1:100) was excluded from the analysis to avoid the substantial signal interference caused by IgG under these conditions. Computational simulation (FIG. 6C) demonstrated good recovery; samples with medium and low IgG levels showed more than 80% recovery while samples with high IgG levels showed about 60% (for low CR3022 dose) to 70% (for high CR3022 dose) recovery. Performance was further evaluated experimentally with test samples containing varied doses of CR3022 and different concentrations of IgG (FIG. 2C); the results obtained were in good agreement with the computational prediction.

[0107] The performance was further evaluated via a spiking test with blank sera using seven serum samples collected before the COVID-19 pandemic. CR3022 was serially diluted and spiked into the matrix sera with concentrations of 100, 50, 25, 12.5, and 6.25 g/mL. As before, tNLuc assays were then performed on these samples by measuring the luminescence produced at further dilutions of 300, 900, and 2700 times, and the overall signal of each sample was calculated as a luminescence sum (FIG. 2D). The signals show an apparent linear relationship with the antibody concentration, indicating the detection range can reach to at least 100 g/mL. Calculation using the criterion of 3 times the standard deviation of the blank samples suggests the limit of detection of the assay is below 5 g/mL. Most of the recovery rates are within the range of 80-120% (FIG. 2E), demonstrating the robustness of the assay. Since the samples contained serially diluted CR3022, the results also indicated a good dilution linearity. In addition, all inter-sample coefficients of variation of the groups with different amounts of spiked CR3022 were smaller than 20% demonstrating the good consistency of the assay.

[0108] We then evaluated the tNLuc assay of the present disclosure with human serum samples. In addition to the above seven pre-pandemic sera, we also collected 82 serum samples from verified COVID-19 patients or convalescents across Canada, taken at different times (up to 80 days) after symptom onset. Again, the samples were serially diluted and analyzed using the tNLuc assay of the present disclosure. CR3022 was tested in parallel as a positive control. The samples displayed various signal amplitudes while those for pre-pandemic samples were close to baseline (FIG. 3A). As was done in FIG. 2C and FIG. 2D, the overall signal of the samples was calculated as luminescence summation of dilution points 1:300, 1:900, and 1:2700. A subset of the samples (n=70) was re-tested with tNLuc and comparison of the results obtained from these two independent tests showed a tight linear correlation (FIG. 8A), further demonstrating the consistency and reproducibility of the assay. Plotting the results against time of sample collection (FIG. 3b and FIG. 8B) also provided a rough overview of the kinetics of IgG production/levels in the context of COVID-19 progression in patients; only background signals were detected in pre-pandemic samples, antibodies were detected as early as 4-5 days after symptom onset, all the samples collected during days 11-20 produced high level signals and the majority of samples collected after day 20 still contained high level of antibodies although a very small fraction dropped to basal levels. The results showed excellent separation between controls and patient samples and the kinetics were consistent with multiple previous reports [3, 33-37], strongly suggesting good sensitivity and specificity of the tNLuc assay.

[0109] Finally, we compared the tNLuc assay with several other tests. Similar to the tNLuc assay, ELISA directly measures the antibodies specific to SARS-CoV-2 in blood samples. We performed the ELISA on all 14 samples using a common protocol.sup.9. The results demonstrated a high degree of correlation with those of the tNLuc assay (R.sup.2=0.783) (FIG. 4A), suggesting that the quantifiability and sensitivity of the tNLuc assay are similar to ELISA. In contrast to direct ELISA, neutralizing antibody assays measure only the antibodies responsible for antagonizing virus-receptor interaction. We therefore carried out two neutralization assays on 10 of the samples: the surrogate virus neutralization test (sVNT).sup.29 (FIG. 4B) and the plaque-reduction neutralization test (PRNT50 and 90).sup.39,31, the gold standard neutralization test, (FIGS. 4C, 4D). The results from each of these tests show high positive correlation with the tNLuc assay. Among them, the PRNT90 test produced results highly consistent with those of tNLuc (R 2=0.868). These observations suggest that the tNLuc assay provides a reliable indicator of the neutralization potential of a sample.

[0110] Presented herein is a new serological system and assay for the detection of antibodies against SARS CoV-2 with a quantifiability similar to that of ELISA but featuring with great ease of use, more rapid detection and lesser requirement for specialized equipment. Furthermore, the readout of the assay of the present disclosure shows tight correlation to neutralizing capability. Collectively these features suggest the system and methods of this disclosure have great value for use in clinical laboratories involved in COVID-19 testing. Additionally, the strategy employed in the assay described in this disclosure has the potential to be adapted for use in alternative diagnostic approaches to help combat other diseases, including autoimmune diseases, or other infectious diseases such as SARS, MERS and/or influenza.

TABLE-US-00001 TABLE 1 Comparison of tNLuc assay of the present disclosure to ELISA, sVNT and PRNT tNLuc (Luminescence ELISA VNT Dilution sum) (AUC) (%) PRNT50 PRNT90 OM8035 223 132.3 OM8066 232 177.2 OM8083 6490 2105 OM8087 3342 2305 CVD00768 1550 349.2 71.00342376 .sup.1:640 1:40 CVD01207 292 148.8 42.17669654 1:40 Negative CVD01221 230 296.2 22.09987196 Negative Negative CVD01286 264 116.8 0.339673913 Negative Negative CVD01385 220 63.59 5.095108696 1:20 Negative CVD01569 246 281.1 1.637824475 Negative Negative CVD01649 320 62.06 0.803461063 1:20 Negative CVD01715 210 195.7 2.822273074 Negative Negative CVD01735 219 150 4.271548436 Negative Negative CVD02040 2043 728.3 84.41403926 1:640 1:160 CVD01182 4996 1602 89.21508035 1:640 1:160 CVD01184 4669 2049 97.1574904 1:1280 1:160 CVD01463 2066 1517 96.33802817 1:1280 1:160 CVD01639 7838 1543 88.56613103 1:640 1:160 CVD01641 3941 2854 91.34443783 1:640 1:160 CVD01643 740 614.4 96.22248662 .sup.1:160 1:40 CVD01645 364 297.6 92.28940217 .sup.1:160 1:40 CVD01657 730 927.1 82.04573548 .sup.1:320 Negative CVD02063 5475 2388 54.63535229 .sup.1:160 Negative CVD02069 3775 2704 67.3053152 1:80 Negative CVD00130 901 1470 6.128232377 Negative Negative CVD00240 256 238.3 9.883103082 Negative Negative CVD00324 338 88.69 8.111937655 Negative Negative CVD00336 289 36.64 4.279891304 Negative Negative CVD00410 228 231.9 7.01381509 Negative Negative CVD00829 285 93.72 11.61443245 Negative Negative CVD00831 354 104.6 10.27126679 Negative Negative CVD00868 411 205.8 10.3189007 Negative Negative CVD01018 4568 4702 91.47247119 1:1280 1:320 CVD01022 13582 3514 94.67349552 1:1280 1:160 CVD01234 317 98.66 2.151088348 Negative Negative CVD01314 1308 2138 50.78125 1:640 1:20 CVD01339 21433 1779 95.48233696 1:640 1:320 CVD01342 294 86.91 1.630434783 Negative Negative CVD01384 1232 328.9 83.66168478 .sup.1:160 1:40 CVD01433 8674 1693 90.79483696 1:640 1:80 CVD01487 276 289.4 1.266996292 Negative Negative CVD01581 4224 1506 93.72682324 1:640 Negative CVD01583 358 77.59 1.205191595 Negative Negative CVD01619 3162 819.2 81.67490729 .sup.1:320 Negative CVD01620 3361 2040 90.2657602 1:640 1:80 CVD01630 6073 2372 94.56118665 1:640 1:40 CVD01701 7626 2130 95.46147979 .sup.1:320 1:40 CVD01730 7940 4356 95.95728452 1:640 1:80 CVD01734 31211 6239 96.18611747 1:640 1:640 CVD01738 6638 1091 91.1136537 1:640 1:160 CVD01741 2177 897.5 86.42257818 1:640 1:80 CVD01763 1952 1827 92.14340198 .sup.1:160 1:20 CVD01769 9894 2686 96.18611747 1:640 1:160 CVD01776 281 87.09 2.860411899 Negative Negative CVD01820 3042 1396 94.66056445 .sup.1:160 1:80 CVD01823 300 199.4 58.96262395 1:40 Negative CVD01827 2731 597.6 77.49809306 1:640 1:160 CVD01828 5930 1531 93.32570557 1:20 1:20 CVD01852 429 107.1 68.30663616 .sup.1:320 1:20 CVD01860 1368 859.7 55.98779558 1:640 1:20 CVD01881 579 256.5 41.71632896 1:20 Negative CVD01920 677 411.9 89.35240366 1:640 1:40 CVD01923 2064 875 86.92888359 1:640 Negative CVD01941 4872 956.9 81.3667064 1:640 1:320 CVD01952 5187 1400 91.89511323 1:640 1:160 CVD01953 8751 2653 90.9018673 1:640 1:160 CVD01981 7271 3077 84.98212157 1:640 1:40 CVD01982 10084 6458 94.99404052 1:640 1:320 CVD02004 855 720.4 82.87644021 1:80 Negative CVD02007 2876 489.3 85.93563766 .sup.1:160 1:40 CVD02016 9598 2169 90.66348828 .sup.1:320 1:160 CVD02049 3872 1507 90.24390244 1:640 1:80 CVD02052 2673 1478 91.07674004 1:640 1:20 CVD02054 224 173.4 8.774538965 Negative Negative CVD02059 669 1264 84.88994646 1:80 1:20 CVD02060 737 482.5 71.59428911 1:20 Negative CVD02064 19837 3660 83.64069007 1:640 1:40 CVD02066 201 169.3 4.074955384 Negative Negative CVD02076 464 910.8 53.62879239 1:20 Negative CVD02078 1922 1944 90.92801904 .sup.1:320 1:80 CVD02080 4014 3392 97.14455681 1:640 1:160 CVD02082 4421 2011 90.27364664 1:640 1:80 CVD02086 2866 1065 81.55859607 .sup.1:160 1:40 CVD02170 4488 1823 61.37532134 1:640 1:80

Example 2

[0111] Although only IgG antibody testing has been described in this Example 1, the principles of the tNLuc assay of the present disclosure should also be applicable to the detection of antibodies of other immunoglobulin isotypes such as IgM and IgA. This might be performed by using their binders as sensor proteins, for example single chain antibodies, nanobodies, or similar molecules specifically recognizing these isotypes. Additionally, the tNLuc strategy employed in the assays of the present disclosure has can be adapted for use in alternative diagnostic approaches to help detect responses to other pathogens and viruses such as SARS, MERS, and/or influenza.

[0112] As illustrated in FIG. 7A, in contrast to IgG detection, a general IgM probe is used to bind IgM molecules. The general IgM probe can be any IgM binder conjugated, in the case of FIG. 7A, to 9 tag. We use a single domain antibody developed by NanoTag Biotechnologies (clone #2F2). Anti-S protein IgM levels in the sera of COVID-19 patients were evaluated using TNLuc-IgM assay of the present disclosure as described in Example 1. The results were plotted against days of symptom onset and the results are shown in FIG. 7B.

TABLE-US-00002 SequenceListing 11Snucleotidesequence (SEQIDNO:1) 1ATGggccatcatcatcatcatcatcatcatATGgtttttacacttgaagattttgtgggt 61gattgggaacaaactgctgcatataatttagatcaagttttagaacagggtggagtgagt 121tctcttttacaaaatcttgcagtctcagttacaccaatacaaagaatagttagaagtgga 181gaaaatgcattaaagatcgatatacatgtaataattccttatgagggactatcagcagac 241caaatggcacaaattgaggaagtattcaaagttgtatatccagtagacgatcatcacttt 301aaagtaatattaccttatggaactttagtaattgatggtgtaacaccaaatatgttaaat 361tattttggtagaccatacgaagggattgcagtttttgatggaaagaaaataaccgtaaca 421ggcactttgtggaatggaaataaaataatagatgaaaggttaattacacctgatTAA 11Saminoacidsequence (SEQIDNO:2) 1MetGlyHisHisHisHisHisHisHisHisMetValPheThrLeuGluAspPheValGly 21AspTrpGluGlnThrAlaAlaTyrAsnLeuAspGlnValLeuGluGlnGlyGlyValSer 41SerLeuLeuGlnAsnLeuAlaValSerValThrProIleGInArgIleValArgSerGly 61GluAsnAlaLeuLysIleAspIleHisValIleIleProTyrGluGlyLeuSerAlaAsp 81GlnMetAlaGlnIleGluGluValPheLysValValTyrProValAspAspHisHisPhe 101LysValIleLeuProTyrGlyThrLeuValIleAspGlyValThrProAsnMetLeuAsn 121TyrPheGlyArgProTyrGluGlyIleAlaValPheAspGlyLysLysIleThrValThr 141GlyThrLeuTrpAsnGlyAsnLysIleIleAspGluArgLeuIleThrProAsp 9nucleotidesequence (SEQIDNO:3) 1GGCTCCATGCTGTTCCGAGTAACCATCAACAGT 9aminoacidsequence (SEQIDNO:4) 1GlySerMetLeuPheArgValThrIleAsnSer 10nucleotidesequence (SEQIDNO:5) 1GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC 10aminoacidsequence (SEQIDNO:6) 1ValSerGlyTrpArgLeuPheLysLysIleSer 9-Gnucleotidesequence (SEQIDNO:7) 1ATGGGCTCCATGCTGTTCCGAGTAACCATCAACAGTggaggtggatccGGTGGTGGAGGG 61AGCacctacaaacttGtcATTaacggtaaaaccctgaaaggtgaaaccaccaccgaagct 121gttgacgctgctaccgcggaaaaagttttcaaacagtacgctaacgacaacggtgttgac 181ggtgaatggacctacgacgacgctaccaaaacctTcaccgtaacggaaGGTGGCGGTAGC 241catcaccaccatcaccacTGA 9-Gaminoacidsequence (SEQIDNO:8) 1MetGlySerMetLeuPheArgValThrIleAsnSerGlyGlyGlySerGlyGlyGlyGly 21SerThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGluAla 41ValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsnGlyValAsp 61GlyGluTrpThrTyrAspAspAlaThrLysThrPheThrValThrGluGlyGlyGlySer 81HisHisHisHisHisHis G-9nucleotidesequence (SEQIDNO:9) 1ATGggccatcatcatcatcatcatGGTGGAGGGAGCacctacaaacttGtcATTaacggt 61aaaaccctgaaaggtgaaaccaccaccgaagctgttgacgctgctaccgcggaaaaagtt 121ttcaaacagtacgctaacgacaacggtgttgacggtgaatggacctacgacgacgctacc 181aaaacctTcaccgtaacggaaGGTGGCGGTAGCggtggcggaggctctGGCTCCATGCTG 241TTCCGAGTAACCATCAACAGTtaa G-9aminoacidsequence (SEQIDNO:10) 1MetGlyHisHisHisHisHisHisGlyGlyGlySerThrTyrLysLeuValIleAsnGly 21LysThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAlaGluLysVal 41PheLysGlnTyrAlaAsnAspAsnGlyValAspGlyGluTrpThrTyrAspAspAlaThr 61LysThrPheThrValThrGluGlyGlyGlySerGlyGlyGlyGlySerGlySerMetLeu 81PheArgValThrIleAsnSer 9-G-39nucleotidesequence (SEQIDNO:11) 1ATGGGCTCCATGCTGTTCCGAGTAACCATCAACAGTggaggtggatccGGTGGTGGAGGG 61AGCacctacaaacttGtcATTaacggtaaaaccctgaaaggtgaaaccaccaccgaagct 121gttgacgctgctaccgcggaaaaagttttcaaacagtacgctaacgacaacggtgttgac 181ggtgaatggacctacgacgacgctaccaaaacctTcaccgtaacggaaGGAGGAGGATCT 241GGAGGTGGATCCGGCTCCATGCTGTTCCGAGTAACCATCAACAGTGGCGGAAGCCATCAT 301CACCACCATCATCACCATTGA 9-G-39aminoacidsequence (SEQIDNO:12) 1MetGlySerMetLeuPheArgValThrIleAsnSerGlyGlyGlySerGlyGlyGlyGly 21SerThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGluAla 41ValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsnGlyValAsp 61GlyGluTrpThrTyrAspAspAlaThrLysThrPheThrValThrGluGlyGlyGlySer 81GlyGlyGlySerGlySerMetLeuPheArgValThrIleAsnSerGlyGlySerHisHis 101HisHisHisHisHisHis 10-RBDnucleotidesequence (SEQIDNO:13) 1ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT 61CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCGGTGGaGTGAGCGGCTGGCGGCTG 121TTCAAGAAGATTAGCGGTGGCGGAGGATCTGGAGGTGGATCCagggtgcagccaaccgag 181tctatcgtgcgctttcctaatatcacaaacctgtgcccatttggcgaggtgttcaacgca 241acccgcttcgccagcgtgtacgcctggaataggaagcggatcagcaactgcgtggccgac 301tatagcgtgctgtacaactccgcctctttcagcacctttaagtgctatggcgtgtccccc 361acaaagctgaatgacctgtgctttaccaacgtctacgccgattctttcgtgatcaggggc 421gacgaggtgcgccagatcgcccccggccagacaggcaagatcgcagactacaattataag 481ctgccagacgatttcaccggctgcgtgatcgcctggaacagcaacaatctggattccaaa 541gtgggcggcaactacaattatctgtaccggctgtttagaaagagcaatctgaagcccttc 601gagagggacatctctacagaaatctaccaggccggcagcaccccttgcaatggcgtggag 661ggctttaactgttatttcccactccagtcctacggcttccagcccacaaacggcgtgggc 721tatcagccttaccgcgtggtggtgctgagctttgagctgctgcacgccccagcaacagtg 781tgcggccccaagaagtccaccaatctggtgaagaacaagtgcgtgaacttcGGCGGAAGC 841CATCATCACCACCATCATCACCATTGA 10-RBDaminoacidsequence (SEQIDNO:14) 1MetArgLeuProGlyAlaMetProAlaLeuAlaLeuLysGlyGluLeuLeuLeuLeuSer 21LeuLeuLeuLeuLeuGluProGlnIleSerGlnGlyGlyGlyValSerGlyTrpArgLeu 41PheLysLysIleSerGlyGlyGlyGlySerGlyGlyGlySerArgValGlnProThrGlu 61SerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGluValPheAsnAla 81ThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsnCysValAlaAsp 101TyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyrGlyValSerPro 121ThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPheValIleArgGly 141AspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAspTyrAsnTyrLys 161LeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsnLeuAspSerLys 181ValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsnLeuLysProPhe 201GluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCysAsnGlyValGlu 221GlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThrAsnGlyValGly 241TyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAlaProAlaThrVal 261CysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsnPheGlyGlySer 281HisHisHisHisHisHisHisHis RBD-10nucleotidesequence (SEQIDNO:15) 1atgttcgtcttcctggtcctgctgcctctggtctcctcacagagggtgcagccaaccgag 61tctatcgtgcgctttcctaatatcacaaacctgtgcccatttggcgaggtgttcaacgca 121acccgcttcgccagcgtgtacgcctggaataggaagcggatcagcaactgcgtggccgac 181tatagcgtgctgtacaactccgcctctttcagcacctttaagtgctatggcgtgtccccc 241acaaagctgaatgacctgtgctttaccaacgtctacgccgattctttcgtgatcaggggc 301gacgaggtgcgccagatcgcccccggccagacaggcaagatcgcagactacaattataag 361ctgccagacgatttcaccggctgcgtgatcgcctggaacagcaacaatctggattccaaa 421gtgggcggcaactacaattatctgtaccggctgtttagaaagagcaatctgaagcccttc 481gagagggacatctctacagaaatctaccaggccggcagcaccccttgcaatggcgtggag 541ggctttaactgttatttcccactccagtcctacggcttccagcccacaaacggcgtgggc 601tatcagccttaccgcgtggtggtgctgagctttgagctgctgcacgccccagcaacagtg 661tgcggccccaagaagtccaccaatctggtgaagaacaagtgcgtgaacttcGGCGGAGGA 721GGATCTGGAGGTGGATCCGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCGGCGGAAGC 781CATCATCACCACCATCATCACCATTGA RBD-10aminoacidsequence (SEQIDNO:16) 1MetPheValPheLeuValLeuLeuProLeuValSerSerGlnArgValGlnProThrGlu 21SerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGluValPheAsnAla 41ThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsnCysValAlaAsp 61TyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyrGlyValSerPro 81ThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPheValIleArgGly 101AspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAspTyrAsnTyrLys 121LeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsnLeuAspSerLys 141ValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsnLeuLysProPhe 161GluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCysAsnGlyValGlu 181GlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThrAsnGlyValGly 201TyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAlaProAlaThrVal 221CysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsnPheGlyGlyGly 241GlySerGlyGlyGlySerValSerGlyTrpArgLeuPheLysLysIleSerGlyGlySer 261HisHisHisHisHisHisHisHis 10-RBD-10nucleotidesequence (SEQIDNO:17) 1ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT 61CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCGGTGGaGTGAGCGGCTGGCGGCTG 121TTCAAGAAGATTAGCGGTGGCGGAGGATCTGGAGGTGGATCCagggtgcagccaaccgag 181tctatcgtgcgctttcctaatatcacaaacctgtgcccatttggcgaggtgttcaacgca 241acccgcttcgccagcgtgtacgcctggaataggaagcggatcagcaactgcgtggccgac 301tatagcgtgctgtacaactccgcctctttcagcacctttaagtgctatggcgtgtccccc 361acaaagctgaatgacctgtgctttaccaacgtctacgccgattctttcgtgatcaggggc 421gacgaggtgcgccagatcgcccccggccagacaggcaagatcgcagactacaattataag 481ctgccagacgatttcaccggctgcgtgatcgcctggaacagcaacaatctggattccaaa 541gtgggcggcaactacaattatctgtaccggctgtttagaaagagcaatctgaagcccttc 601gagagggacatctctacagaaatctaccaggccggcagcaccccttgcaatggcgtggag 661ggctttaactgttatttcccactccagtcctacggcttccagcccacaaacggcgtgggc 721tatcagccttaccgcgtggtggtgctgagctttgagctgctgcacgccccagcaacagtg 781tgcggccccaagaagtccaccaatctggtgaagaacaagtgcgtgaacttcGGCGGAGGA 841GGATCTGGAGGTGGATCCGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCGGCGGAAGC 901CATCATCACCACCATCATCACCATTGA 10-RBD-10aminoacidsequence (SEQIDNO:18) 1MetArgLeuProGlyAlaMetProAlaLeuAlaLeuLysGlyGluLeuLeuLeuLeuSer 21LeuLeuLeuLeuLeuGluProGlnIleSerGlnGlyGlyGlyValSerGlyTrpArgLeu 41PheLysLysIleSerGlyGlyGlyGlySerGlyGlyGlySerArgValGlnProThrGlu 61SerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGluValPheAsnAla 81ThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsnCysValAlaAsp 101TyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyrGlyValSerPro 121ThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPheValIleArgGly 141AspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAspTyrAsnTyrLys 161LeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsnLeuAspSerLys 181ValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsnLeuLysProPhe 201GluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCysAsnGlyValGlu 221GlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThrAsnGlyValGly 241TyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAlaProAlaThrVal 261CysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsnPheGlyGlyGly 281GlySerGlyGlyGlySerValSerGlyTrpArgLeuPheLysLysIleSerGlyGlySer 301HisHisHisHisHisHisHisHis 10-Snucleotidesequence (SEQIDNO:19) 1ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT 61CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCGGTGGaGTGAGCGGCTGGCGGCTG 121TTCAAGAAGATTAGCGGTGGCGGAGGATCTGGAGGTGGATCCtgcgtcaatctgacaact 181cggactcagctgccacctgcttatactaatagcttcaccagaggcgtgtactatcctgac 241aaggtgtttagaagctccgtgctgcactctacacaggatctgtttctgccattctttagc 301aacgtgacctggttccacgccatccacgtgagcggcaccaatggcacaaagcggttcgac 361aatcccgtgctgccttttaacgatggcgtgtacttcgcctctaccgagaagagcaacatc 421atcagaggctggatctttggcaccacactggactccaagacacagtctctgctgatcgtg 481aacaatgccaccaacgtggtcatcaaggtgtgcgagttccagttttgtaatgatcccttc 541ctgggcgtgtactatcacaagaacaataagagctggatggagtccgagtttagagtgtat 601tctagcgccaacaactgcacatttgagtacgtgagccagcctttcctgatggacctggag 661ggcaagcagggcaatttcaagaacctgagggagttcgtgtttaagaatatcgacggctac 721ttcaaaatctactctaagcacacccccatcaacctggtgcgcgacctgcctcagggcttc 781agcgccctggagcccctggtggatctgcctatcggcatcaacatcacccggtttcagaca 841ctgctggccctgcacagaagctacctgacacccggcgactcctctagcggatggaccgcc 901ggcgctgccgcctactatgtgggctacctccagccccggaccttcctgctgaagtacaac 961gagaatggcaccatcacagacgcagtggattgcgccctggaccccctgagcgagacaaag 1021tgtacactgaagtcctttaccgtggagaagggcatctatcagacatccaatttcagggtg 1081cagccaaccgagtctatcgtgcgctttcctaatatcacaaacctgtgcccatttggcgag 1141gtgttcaacgcaacccgcttcgccagcgtgtacgcctggaataggaagcggatcagcaac 1201tgcgtggccgactatagcgtgctgtacaactccgcctctttcagcacctttaagtgctat 1261ggcgtgtcccccacaaagctgaatgacctgtgctttaccaacgtctacgccgattctttc 1321gtgatcaggggcgacgaggtgcgccagatcgcccccggccagacaggcaagatcgcagac 1381tacaattataagctgccagacgatttcaccggctgcgtgatcgcctggaacagcaacaat 1441ctggattccaaagtgggcggcaactacaattatctgtaccggctgtttagaaagagcaat 1501ctgaagcccttcgagagggacatctctacagaaatctaccaggccggcagcaccccttgc 1561aatggcgtggagggctttaactgttatttcccactccagtcctacggcttccagcccaca 1621aacggcgtgggctatcagccttaccgcgtggtggtgctgagctttgagctgctgcacgcc 1681ccagcaacagtgtgcggccccaagaagtccaccaatctggtgaagaacaagtgcgtgaac 1741ttcaacttcaacggcctgaccggcacaggcgtgctgaccgagtccaacaagaagttcctg 1801ccatttcagcagttcggcagggacatcgcagataccacagacgccgtgcgcgacccacag 1861accctggagatcctggacatcacaccctgctctttcggcggcgtgagcgtgatcacaccc 1921ggcaccaatacaagcaaccaggtggccgtgctgtatcaggacgtgaattgtaccgaggtg 1981cccgtggctatccacgccgatcagctgaccccaacatggcgggtgtacagcaccggctcc 2041aacgtcttccagacaagagccggatgcctgatcggagcagagcacgtgaacaattcctat 2101gagtgcgacatcccaatcggcgccggcatctgtgcctcttaccagacccagacaaactct 2161cccGgaagCgccAgCagcgtggcctcccagtctatcatcgcctataccatgtccctgggc 2221gccgagaacagcgtggcctactctaacaatagcatcgccatcccaaccaacttcacaatc 2281tctgtgaccacagagatcctgcccgtgtccatgaccaagacatctgtggactgcacaatg 2341tatatctgtggcgattctaccgagtgcagcaacctgctgctccagtacggcagcttttgt 2401acccagctgaatagagccctgacaggcatcgccgtggagcaggataagaacacacaggag 2461gtgttcgcccaggtgaagcaaatctacaagaccccccctatcaaggactttggcggcttc 2521aatttttcccagatcctgcctgatccatccaagccttctaagcggagctttatcgaggac 2581ctgctgttcaacaaggtgaccctggccgatgccggcttcatcaagcagtatggcgattgc 2641ctgggcgacatcgcagccagggacctgatctgcgcccagaagtttaatggcctgaccgtg 2701ctgccacccctgctgacagatgagatgatcgcacagtacacaagcgccctgctggccggc 2761accatcacatccggatggaccttcggcgcaggagccgccctccagatcccctttgccatg 2821cagatggcctataggttcaacggcatcggcgtgacccagaatgtgctgtacgagaaccag 2881aagctgatcgccaatcagtttaactccgccatcggcaagatccaggacagcctgtcctct 2941acagccagcgccctgggcaagctccaggatgtggtgaatcagaacgcccaggccctgaat 3001accctggtgaagcagctgagcagcaacttcggcgccatctctagcgtgctgaatgacatc 3061ctgagccggctggacCCTCCTgaggcagaggtgcagatcgaccggctgatcaccggccgg 3121ctccagagcctccagacctatgtgacacagcagctgatcagggccgccgagatcagggcc 3181agcgccaatctggcagcaaccaagatgtccgagtgcgtgctgggccagtctaagagagtg 3241gacttttgtggcaagggctatcacctgatgtccttccctcagtctgccccacacggcgtg 3301gtgtttctgcacgtgacctacgtgcccgcccaggagaagaacttcaccacagcccctgcc 3361atctgccacgatggcaaggcccactttccaagggagggcgtgttcgtgtccaacggcacc 3421cactggtttgtgacacagcgcaatttctacgagccccagatcatcaccacagacaacacc 3481ttcgtgagcggcaactgtgacgtggtcatcggcatcgtgaacaataccgtgtatgatcca 3541ctccagcccgagctggacagctttaaggaggagctggataagtatttcaagaatcacacc 3601tcccctgacgtggatctgggcgacatcagcggcatcaatgcctccgtggtgaacatccag 3661aaggagatcgaccgcctgaacgaggtggctaagaatctgaacgagagcctgatcgacctc 3721caggagctgggcaagtatgagcagtacatcaagtggcccGGaGGCAGCGGaGGCTACATC 3781CCCGAGGCCCCtCGCGAtGGaCAGGCtTACGTGCGCAAGGACGGCGAGTGGGTGCTGCTG 3841AGCACCTTCCTGGGCGGAAGCCATCATCACCACCATCATCACCATTGA 10-Saminoacidsequence (SEQIDNO:20) 1MetArgLeuProGlyAlaMetProAlaLeuAlaLeuLysGlyGluLeuLeuLeuLeuSer 21LeuLeuLeuLeuLeuGluProGlnIleSerGlnGlyGlyGlyValSerGlyTrpArgLeu 41PheLysLysIleSerGlyGlyGlyGlySerGlyGlyGlySerCysValAsnLeuThrThr 61ArgThrGlnLeuProProAlaTyrThrAsnSerPheThrArgGlyValTyrTyrProAsp 81LysValPheArgSerSerValLeuHisSerThrGlnAspLeuPheLeuProPhePheSer 101AsnValThrTrpPheHisAlaIleHisValSerGlyThrAsnGlyThrLysArgPheAsp 121AsnProValLeuProPheAsnAspGlyValTyrPheAlaSerThrGluLysSerAsnIle 141IleArgGlyTrpIlePheGlyThrThrLeuAspSerLysThrGlnSerLeuLeuIleVal 161AsnAsnAlaThrAsnValValIleLysValCysGluPheGInPheCysAsnAspProPhe 181LeuGlyValTyrTyrHisLysAsnAsnLysSerTrpMetGluSerGluPheArgValTyr 201SerSerAlaAsnAsnCysThrPheGluTyrValSerGlnProPheLeuMetAspLeuGlu 221GlyLysGlnGlyAsnPheLysAsnLeuArgGluPheValPheLysAsnIleAspGlyTyr 241PheLysIleTyrSerLysHisThrProIleAsnLeuValArgAspLeuProGInGlyPhe 261SerAlaLeuGluProLeuValAspLeuProIleGlyIleAsnIleThrArgPheGlnThr 281LeuLeuAlaLeuHisArgSerTyrLeuThrProGlyAspSerSerSerGlyTrpThrAla 301GlyAlaAlaAlaTyrTyrValGlyTyrLeuGlnProArgThrPheLeuLeuLysTyrAsn 321GluAsnGlyThrIleThrAspAlaValAspCysAlaLeuAspProLeuSerGluThrLys 341CysThrLeuLysSerPheThrValGluLysGlyIleTyrGlnThrSerAsnPheArgVal 361GlnProThrGluSerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGlu 381ValPheAsnAlaThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsn 401CysValAlaAspTyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyr 421GlyValSerProThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPhe 441ValIleArgGlyAspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAsp 461TyrAsnTyrLysLeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsn 481LeuAspSerLysValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsn 501LeuLysProPheGluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCys 521AsnGlyValGluGlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThr 541AsnGlyValGlyTyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAla 561ProAlaThrValCysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsn 581PheAsnPheAsnGlyLeuThrGlyThrGlyValLeuThrGluSerAsnLysLysPheLeu 601ProPheGlnGlnPheGlyArgAspIleAlaAspThrThrAspAlaValArgAspProGln 621ThrLeuGluIleLeuAspIleThrProCysSerPheGlyGlyValSerValIleThrPro 641GlyThrAsnThrSerAsnGlnValAlaValLeuTyrGlnAspValAsnCysThrGluVal 661ProValAlaIleHisAlaAspGlnLeuThrProThrTrpArgValTyrSerThrGlySer 681AsnValPheGlnThrArgAlaGlyCysLeuIleGlyAlaGluHisValAsnAsnSerTyr 701GluCysAspIleProIleGlyAlaGlyIleCysAlaSerTyrGlnThrGlnThrAsnSer 721ProGlySerAlaSerSerValAlaSerGlnSerIleIleAlaTyrThrMetSerLeuGly 741AlaGluAsnSerValAlaTyrSerAsnAsnSerIleAlaIleProThrAsnPheThrIle 761SerValThrThrGluIleLeuProValSerMetThrLysThrSerValAspCysThrMet 781TyrIleCysGlyAspSerThrGluCysSerAsnLeuLeuLeuGlnTyrGlySerPheCys 801ThrGlnLeuAsnArgAlaLeuThrGlyIleAlaValGluGInAspLysAsnThrGlnGlu 821ValPheAlaGlnValLysGlnIleTyrLysThrProProIleLysAspPheGlyGlyPhe 841AsnPheSerGlnIleLeuProAspProSerLysProSerLysArgSerPheIleGluAsp 861LeuLeuPheAsnLysValThrLeuAlaAspAlaGlyPheIleLysGlnTyrGlyAspCys 881LeuGlyAspIleAlaAlaArgAspLeuIleCysAlaGInLysPheAsnGlyLeuThrVal 901LeuProProLeuLeuThrAspGluMetIleAlaGlnTyrThrSerAlaLeuLeuAlaGly 921ThrIleThrSerGlyTrpThrPheGlyAlaGlyAlaAlaLeuGlnIleProPheAlaMet 941GlnMetAlaTyrArgPheAsnGlyIleGlyValThrGlnAsnValLeuTyrGluAsnGln 961LysLeuIleAlaAsnGlnPheAsnSerAlaIleGlyLysIleGInAspSerLeuSerSer 981ThrAlaSerAlaLeuGlyLysLeuGlnAspValValAsnGlnAsnAlaGInAlaLeuAsn 1001ThrLeuValLysGlnLeuSerSerAsnPheGlyAlaIleSerSerValLeuAsnAspIle 1021LeuSerArgLeuAspProProGluAlaGluValGlnIleAspArgLeuIleThrGlyArg 1041LeuGlnSerLeuGlnThrTyrValThrGlnGlnLeuIleArgAlaAlaGluIleArgAla 1061SerAlaAsnLeuAlaAlaThrLysMetSerGluCysValLeuGlyGlnSerLysArgVal 1081AspPheCysGlyLysGlyTyrHisLeuMetSerPheProGlnSerAlaProHisGlyVal 1101ValPheLeuHisValThrTyrValProAlaGInGluLysAsnPheThrThrAlaProAla 1121IleCysHisAspGlyLysAlaHisPheProArgGluGlyValPheValSerAsnGlyThr 1141HisTrpPheValThrGlnArgAsnPheTyrGluProGlnIleIleThrThrAspAsnThr 1161PheValSerGlyAsnCysAspValValIleGlyIleValAsnAsnThrValTyrAspPro 1181LeuGlnProGluLeuAspSerPheLysGluGluLeuAspLysTyrPheLysAsnHisThr 1201SerProAspValAspLeuGlyAspIleSerGlyIleAsnAlaSerValValAsnIleGln 1221LysGluIleAspArgLeuAsnGluValAlaLysAsnLeuAsnGluSerLeuIleAspLeu 1241GlnGluLeuGlyLysTyrGluGlnTyrIleLysTrpProGlyGlySerGlyGlyTyrIle 1261ProGluAlaProArgAspGlyGlnAlaTyrValArgLysAspGlyGluTrpValLeuLeu 1281SerThrPheLeuGlyGlySerHisHisHisHisHisHisHisHis S-10nucleotidesequence (SEQIDNO:21) 1atgttcgtcttcctggtcctgctgcctctggtctcctcacagtgcgtcaatctgacaact 61cggactcagctgccacctgcttatactaatagcttcaccagaggcgtgtactatcctgac 121aaggtgtttagaagctccgtgctgcactctacacaggatctgtttctgccattctttagc 181aacgtgacctggttccacgccatccacgtgagcggcaccaatggcacaaagcggttcgac 241aatcccgtgctgccttttaacgatggcgtgtacttcgcctctaccgagaagagcaacatc 301atcagaggctggatctttggcaccacactggactccaagacacagtctctgctgatcgtg 361aacaatgccaccaacgtggtcatcaaggtgtgcgagttccagttttgtaatgatcccttc 421ctgggcgtgtactatcacaagaacaataagagctggatggagtccgagtttagagtgtat 481tctagcgccaacaactgcacatttgagtacgtgagccagcctttcctgatggacctggag 541ggcaagcagggcaatttcaagaacctgagggagttcgtgtttaagaatatcgacggctac 601ttcaaaatctactctaagcacacccccatcaacctggtgcgcgacctgcctcagggcttc 661agcgccctggagcccctggtggatctgcctatcggcatcaacatcacccggtttcagaca 721ctgctggccctgcacagaagctacctgacacccggcgactcctctagcggatggaccgcc 781ggcgctgccgcctactatgtgggctacctccagccccggaccttcctgctgaagtacaac 841gagaatggcaccatcacagacgcagtggattgcgccctggaccccctgagcgagacaaag 901tgtacactgaagtcctttaccgtggagaagggcatctatcagacatccaatttcagggtg 961cagccaaccgagtctatcgtgcgctttcctaatatcacaaacctgtgcccatttggcgag 1021gtgttcaacgcaacccgcttcgccagcgtgtacgcctggaataggaagcggatcagcaac 1081tgcgtggccgactatagcgtgctgtacaactccgcctctttcagcacctttaagtgctat 1141ggcgtgtcccccacaaagctgaatgacctgtgctttaccaacgtctacgccgattctttc 1201gtgatcaggggcgacgaggtgcgccagatcgcccccggccagacaggcaagatcgcagac 1261tacaattataagctgccagacgatttcaccggctgcgtgatcgcctggaacagcaacaat 1321ctggattccaaagtgggcggcaactacaattatctgtaccggctgtttagaaagagcaat 1381ctgaagcccttcgagagggacatctctacagaaatctaccaggccggcagcaccccttgc 1441aatggcgtggagggctttaactgttatttcccactccagtcctacggcttccagcccaca 1501aacggcgtgggctatcagccttaccgcgtggtggtgctgagctttgagctgctgcacgcc 1561ccagcaacagtgtgcggccccaagaagtccaccaatctggtgaagaacaagtgcgtgaac 1621ttcaacttcaacggcctgaccggcacaggcgtgctgaccgagtccaacaagaagttcctg 1681ccatttcagcagttcggcagggacatcgcagataccacagacgccgtgcgcgacccacag 1741accctggagatcctggacatcacaccctgctctttcggcggcgtgagcgtgatcacaccc 1801ggcaccaatacaagcaaccaggtggccgtgctgtatcaggacgtgaattgtaccgaggtg 1861cccgtggctatccacgccgatcagctgaccccaacatggcgggtgtacagcaccggctcc 1921aacgtcttccagacaagagccggatgcctgatcggagcagagcacgtgaacaattcctat 1981gagtgcgacatcccaatcggcgccggcatctgtgcctcttaccagacccagacaaactct 2041cccGgaagCgccAgCagcgtggcctcccagtctatcatcgcctataccatgtccctgggc 2101gccgagaacagcgtggcctactctaacaatagcatcgccatcccaaccaacttcacaatc 2161tctgtgaccacagagatcctgcccgtgtccatgaccaagacatctgtggactgcacaatg 2221tatatctgtggcgattctaccgagtgcagcaacctgctgctccagtacggcagcttttgt 2281acccagctgaatagagccctgacaggcatcgccgtggagcaggataagaacacacaggag 2341gtgttcgcccaggtgaagcaaatctacaagaccccccctatcaaggactttggcggcttc 2401aatttttcccagatcctgcctgatccatccaagccttctaagcggagctttatcgaggac 2461ctgctgttcaacaaggtgaccctggccgatgccggcttcatcaagcagtatggcgattgc 2521ctgggcgacatcgcagccagggacctgatctgcgcccagaagtttaatggcctgaccgtg 2581ctgccacccctgctgacagatgagatgatcgcacagtacacaagcgccctgctggccggc 2641accatcacatccggatggaccttcggcgcaggagccgccctccagatcccctttgccatg 2701cagatggcctataggttcaacggcatcggcgtgacccagaatgtgctgtacgagaaccag 2761aagctgatcgccaatcagtttaactccgccatcggcaagatccaggacagcctgtcctct 2821acagccagcgccctgggcaagctccaggatgtggtgaatcagaacgcccaggccctgaat 2881accctggtgaagcagctgagcagcaacttcggcgccatctctagcgtgctgaatgacatc 2941ctgagccggctggacCCTCCTgaggcagaggtgcagatcgaccggctgatcaccggccgg 3001ctccagagcctccagacctatgtgacacagcagctgatcagggccgccgagatcagggcc 3061agcgccaatctggcagcaaccaagatgtccgagtgcgtgctgggccagtctaagagagtg 3121gacttttgtggcaagggctatcacctgatgtccttccctcagtctgccccacacggcgtg 3181gtgtttctgcacgtgacctacgtgcccgcccaggagaagaacttcaccacagcccctgcc 3241atctgccacgatggcaaggcccactttccaagggagggcgtgttcgtgtccaacggcacc 3301cactggtttgtgacacagcgcaatttctacgagccccagatcatcaccacagacaacacc 3361ttcgtgagcggcaactgtgacgtggtcatcggcatcgtgaacaataccgtgtatgatcca 3421ctccagcccgagctggacagctttaaggaggagctggataagtatttcaagaatcacacc 3481tcccctgacgtggatctgggcgacatcagcggcatcaatgcctccgtggtgaacatccag 3541aaggagatcgaccgcctgaacgaggtggctaagaatctgaacgagagcctgatcgacctc 3601caggagctgggcaagtatgagcagtacatcaagtggcccGGaGGCAGCGGaGGCTACATC 3661CCCGAGGCCCCtCGCGAtGGaCAGGCtTACGTGCGCAAGGACGGCGAGTGGGTGCTGCTG 3721AGCACCTTCCTGGGCGGAGGAGGATCTGGAGGTGGATCCGTGAGCGGCTGGCGGCTGTTC 3781AAGAAGATTAGCGGCGGAAGCCATCATCACCACCATCATCACCATTGA S-10aminoacidsequence (SEQIDNO:22) 1MetPheValPheLeuValLeuLeuProLeuValSerSerGInCysValAsnLeuThrThr 21ArgThrGlnLeuProProAlaTyrThrAsnSerPheThrArgGlyValTyrTyrProAsp 41LysValPheArgSerSerValLeuHisSerThrGlnAspLeuPheLeuProPhePheSer 61AsnValThrTrpPheHisAlaIleHisValSerGlyThrAsnGlyThrLysArgPheAsp 81AsnProValLeuProPheAsnAspGlyValTyrPheAlaSerThrGluLysSerAsnIle 101IleArgGlyTrpIlePheGlyThrThrLeuAspSerLysThrGlnSerLeuLeuIleVal 121AsnAsnAlaThrAsnValValIleLysValCysGluPheGInPheCysAsnAspProPhe 141LeuGlyValTyrTyrHisLysAsnAsnLysSerTrpMetGluSerGluPheArgValTyr 161SerSerAlaAsnAsnCysThrPheGluTyrValSerGlnProPheLeuMetAspLeuGlu 181GlyLysGlnGlyAsnPheLysAsnLeuArgGluPheValPheLysAsnIleAspGlyTyr 201PheLysIleTyrSerLysHisThrProIleAsnLeuValArgAspLeuProGInGlyPhe 221SerAlaLeuGluProLeuValAspLeuProIleGlyIleAsnIleThrArgPheGlnThr 241LeuLeuAlaLeuHisArgSerTyrLeuThrProGlyAspSerSerSerGlyTrpThrAla 261GlyAlaAlaAlaTyrTyrValGlyTyrLeuGlnProArgThrPheLeuLeuLysTyrAsn 281GluAsnGlyThrIleThrAspAlaValAspCysAlaLeuAspProLeuSerGluThrLys 301CysThrLeuLysSerPheThrValGluLysGlyIleTyrGlnThrSerAsnPheArgVal 321GlnProThrGluSerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGlu 341ValPheAsnAlaThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsn 361CysValAlaAspTyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyr 381GlyValSerProThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPhe 401ValIleArgGlyAspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAsp 421TyrAsnTyrLysLeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsn 441LeuAspSerLysValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsn 461LeuLysProPheGluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCys 481AsnGlyValGluGlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThr 501AsnGlyValGlyTyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAla 521ProAlaThrValCysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsn 541PheAsnPheAsnGlyLeuThrGlyThrGlyValLeuThrGluSerAsnLysLysPheLeu 561ProPheGlnGlnPheGlyArgAspIleAlaAspThrThrAspAlaValArgAspProGln 581ThrLeuGluIleLeuAspIleThrProCysSerPheGlyGlyValSerValIleThrPro 601GlyThrAsnThrSerAsnGlnValAlaValLeuTyrGlnAspValAsnCysThrGluVal 621ProValAlaIleHisAlaAspGlnLeuThrProThrTrpArgValTyrSerThrGlySer 641AsnValPheGlnThrArgAlaGlyCysLeuIleGlyAlaGluHisValAsnAsnSerTyr 661GluCysAspIleProIleGlyAlaGlyIleCysAlaSerTyrGlnThrGlnThrAsnSer 681ProGlySerAlaSerSerValAlaSerGlnSerIleIleAlaTyrThrMetSerLeuGly 701AlaGluAsnSerValAlaTyrSerAsnAsnSerIleAlaIleProThrAsnPheThrIle 721SerValThrThrGluIleLeuProValSerMetThrLysThrSerValAspCysThrMet 741TyrIleCysGlyAspSerThrGluCysSerAsnLeuLeuLeuGlnTyrGlySerPheCys 761ThrGlnLeuAsnArgAlaLeuThrGlyIleAlaValGluGInAspLysAsnThrGlnGlu 781ValPheAlaGlnValLysGlnIleTyrLysThrProProIleLysAspPheGlyGlyPhe 801AsnPheSerGlnIleLeuProAspProSerLysProSerLysArgSerPheIleGluAsp 821LeuLeuPheAsnLysValThrLeuAlaAspAlaGlyPheIleLysGlnTyrGlyAspCys 841LeuGlyAspIleAlaAlaArgAspLeuIleCysAlaGInLysPheAsnGlyLeuThrVal 861LeuProProLeuLeuThrAspGluMetIleAlaGInTyrThrSerAlaLeuLeuAlaGly 881ThrIleThrSerGlyTrpThrPheGlyAlaGlyAlaAlaLeuGlnIleProPheAlaMet 901GlnMetAlaTyrArgPheAsnGlyIleGlyValThrGlnAsnValLeuTyrGluAsnGln 921LysLeuIleAlaAsnGlnPheAsnSerAlaIleGlyLysIleGInAspSerLeuSerSer 941ThrAlaSerAlaLeuGlyLysLeuGlnAspValValAsnGlnAsnAlaGInAlaLeuAsn 961ThrLeuValLysGlnLeuSerSerAsnPheGlyAlaIleSerSerValLeuAsnAspIle 981LeuSerArgLeuAspProProGluAlaGluValGlnIleAspArgLeuIleThrGlyArg 1001LeuGlnSerLeuGlnThrTyrValThrGlnGlnLeuIleArgAlaAlaGluIleArgAla 1021SerAlaAsnLeuAlaAlaThrLysMetSerGluCysValLeuGlyGlnSerLysArgVal 1041AspPheCysGlyLysGlyTyrHisLeuMetSerPheProGlnSerAlaProHisGlyVal 1061ValPheLeuHisValThrTyrValProAlaGInGluLysAsnPheThrThrAlaProAla 1081IleCysHisAspGlyLysAlaHisPheProArgGluGlyValPheValSerAsnGlyThr 1101HisTrpPheValThrGlnArgAsnPheTyrGluProGlnIleIleThrThrAspAsnThr 1121PheValSerGlyAsnCysAspValValIleGlyIleValAsnAsnThrValTyrAspPro 1141LeuGlnProGluLeuAspSerPheLysGluGluLeuAspLysTyrPheLysAsnHisThr 1161SerProAspValAspLeuGlyAspIleSerGlyIleAsnAlaSerValValAsnIleGln 1181LysGluIleAspArgLeuAsnGluValAlaLysAsnLeuAsnGluSerLeuIleAspLeu 1201GlnGluLeuGlyLysTyrGluGlnTyrIleLysTrpProGlyGlySerGlyGlyTyrIle 1221ProGluAlaProArgAspGlyGlnAlaTyrValArgLysAspGlyGluTrpValLeuLeu 1241SerThrPheLeuGlyGlyGlyGlySerGlyGlyGlySerValSerGlyTrpArgLeuPhe 1261LysLysIleSerGlyGlySerHisHisHisHisHisHisHisHis 10-S-10nucleotidesequence (SEQIDNO:23) 1ATGCGGCTTCCGGGTGCGATGCCAGCTCTGGCCCTCAAAGGCGAGCTGCTGTTGCTGTCT 61CTCCTGTTACTTCTGGAACCACAGATCTCTCAGGGCGGTGGaGTGAGCGGCTGGCGGCTG 121TTCAAGAAGATTAGtGGTGGCGGAGGATCTGGAGGTGGATCCtgcgtcaatctgacaact 181cggactcagctgccacctgcttatactaatagcttcaccagaggcgtgtactatcctgac 241aaggtgtttagaagctccgtgctgcactctacacaggatctgtttctgccattctttagc 301aacgtgacctggttccacgccatccacgtgagcggcaccaatggcacaaagcggttcgac 361aatcccgtgctgccttttaacgatggcgtgtacttcgcctctaccgagaagagcaacatc 421atcagaggctggatctttggcaccacactggactccaagacacagtctctgctgatcgtg 481aacaatgccaccaacgtggtcatcaaggtgtgcgagttccagttttgtaatgatcccttc 541ctgggcgtgtactatcacaagaacaataagagctggatggagtccgagtttagagtgtat 601tctagcgccaacaactgcacatttgagtacgtgagccagcctttcctgatggacctggag 661ggcaagcagggcaatttcaagaacctgagggagttcgtgtttaagaatatcgacggctac 721ttcaaaatctactctaagcacacccccatcaacctggtgcgcgacctgcctcagggcttc 781agcgccctggagcccctggtggatctgcctatcggcatcaacatcacccggtttcagaca 841ctgctggccctgcacagaagctacctgacacccggcgactcctctagcggatggaccgcc 901ggcgctgccgcctactatgtgggctacctccagccccggaccttcctgctgaagtacaac 961gagaatggcaccatcacagacgcagtggattgcgccctggaccccctgagcgagacaaag 1021tgtacactgaagtcctttaccgtggagaagggcatctatcagacatccaatttcagggtg 1081cagccaaccgagtctatcgtgcgctttcctaatatcacaaacctgtgcccatttggcgag 1141gtgttcaacgcaacccgcttcgccagcgtgtacgcctggaataggaagcggatcagcaac 1201tgcgtggccgactatagcgtgctgtacaactccgcctctttcagcacctttaagtgctat 1261ggcgtgtcccccacaaagctgaatgacctgtgctttaccaacgtctacgccgattctttc 1321gtgatcaggggcgacgaggtgcgccagatcgcccccggccagacaggcaagatcgcagac 1381tacaattataagctgccagacgatttcaccggctgcgtgatcgcctggaacagcaacaat 1441ctggattccaaagtgggcggcaactacaattatctgtaccggctgtttagaaagagcaat 1501ctgaagcccttcgagagggacatctctacagaaatctaccaggccggcagcaccccttgc 1561aatggcgtggagggctttaactgttatttcccactccagtcctacggcttccagcccaca 1621aacggcgtgggctatcagccttaccgcgtggtggtgctgagctttgagctgctgcacgcc 1681ccagcaacagtgtgcggccccaagaagtccaccaatctggtgaagaacaagtgcgtgaac 1741ttcaacttcaacggcctgaccggcacaggcgtgctgaccgagtccaacaagaagttcctg 1801ccatttcagcagttcggcagggacatcgcagataccacagacgccgtgcgcgacccacag 1861accctggagatcctggacatcacaccctgctctttcggcggcgtgagcgtgatcacaccc 1921ggcaccaatacaagcaaccaggtggccgtgctgtatcaggacgtgaattgtaccgaggtg 1981cccgtggctatccacgccgatcagctgaccccaacatggcgggtgtacagcaccggctcc 2041aacgtcttccagacaagagccggatgcctgatcggagcagagcacgtgaacaattcctat 2101gagtgcgacatcccaatcggcgccggcatctgtgcctcttaccagacccagacaaactct 2161cccGgaagCgccAgCagcgtggcctcccagtctatcatcgcctataccatgtccctgggc 2221gccgagaacagcgtggcctactctaacaatagcatcgccatcccaaccaacttcacaatc 2281tctgtgaccacagagatcctgcccgtgtccatgaccaagacatctgtggactgcacaatg 2341tatatctgtggcgattctaccgagtgcagcaacctgctgctccagtacggcagcttttgt 2401acccagctgaatagagccctgacaggcatcgccgtggagcaggataagaacacacaggag 2461gtgttcgcccaggtgaagcaaatctacaagaccccccctatcaaggactttggcggcttc 2521aatttttcccagatcctgcctgatccatccaagccttctaagcggagctttatcgaggac 2581ctgctgttcaacaaggtgaccctggccgatgccggcttcatcaagcagtatggcgattgc 2641ctgggcgacatcgcagccagggacctgatctgcgcccagaagtttaatggcctgaccgtg 2701ctgccacccctgctgacagatgagatgatcgcacagtacacaagcgccctgctggccggc 2761accatcacatccggatggaccttcggcgcaggagccgccctccagatcccctttgccatg 2821cagatggcctataggttcaacggcatcggcgtgacccagaatgtgctgtacgagaaccag 2881aagctgatcgccaatcagtttaactccgccatcggcaagatccaggacagcctgtcctct 2941acagccagcgccctgggcaagctccaggatgtggtgaatcagaacgcccaggccctgaat 3001accctggtgaagcagctgagcagcaacttcggcgccatctctagcgtgctgaatgacatc 3061ctgagccggctggacCCTCCTgaggcagaggtgcagatcgaccggctgatcaccggccgg 3121ctccagagcctccagacctatgtgacacagcagctgatcagggccgccgagatcagggcc 3181agcgccaatctggcagcaaccaagatgtccgagtgcgtgctgggccagtctaagagagtg 3241gacttttgtggcaagggctatcacctgatgtccttccctcagtctgccccacacggcgtg 3301gtgtttctgcacgtgacctacgtgcccgcccaggagaagaacttcaccacagcccctgcc 3361atctgccacgatggcaaggcccactttccaagggagggcgtgttcgtgtccaacggcacc 3421cactggtttgtgacacagcgcaatttctacgagccccagatcatcaccacagacaacacc 3481ttcgtgagcggcaactgtgacgtggtcatcggcatcgtgaacaataccgtgtatgatcca 3541ctccagcccgagctggacagctttaaggaggagctggataagtatttcaagaatcacacc 3601tcccctgacgtggatctgggcgacatcagcggcatcaatgcctccgtggtgaacatccag 3661aaggagatcgaccgcctgaacgaggtggctaagaatctgaacgagagcctgatcgacctc 3721caggagctgggcaagtatgagcagtacatcaagtggcccGGaGGCAGCGGaGGCTACATC 3781CCCGAGGCCCCtCGCGAtGGaCAGGCtTACGTGCGCAAGGACGGCGAGTGGGTGCTGCTG 3841AGCACCTTCCTGGGCGGAGGAGGATCTGGAGGTGGATCCGTGAGCGGCTGGCGGCTGTTC 3901AAGAAGATTAGCGGCGGAAGCCATCATCACCACCATCATCACCATTGA 10-S-10aminoacidsequence (SEQIDNO:24) 1MetArgLeuProGlyAlaMetProAlaLeuAlaLeuLysGlyGluLeuLeuLeuLeuSer 21LeuLeuLeuLeuLeuGluProGlnIleSerGlnGlyGlyGlyValSerGlyTrpArgLeu 41PheLysLysIleSerGlyGlyGlyGlySerGlyGlyGlySerCysValAsnLeuThrThr 61ArgThrGlnLeuProProAlaTyrThrAsnSerPheThrArgGlyValTyrTyrProAsp 81LysValPheArgSerSerValLeuHisSerThrGlnAspLeuPheLeuProPhePheSer 101AsnValThrTrpPheHisAlaIleHisValSerGlyThrAsnGlyThrLysArgPheAsp 121AsnProValLeuProPheAsnAspGlyValTyrPheAlaSerThrGluLysSerAsnIle 141IleArgGlyTrpIlePheGlyThrThrLeuAspSerLysThrGlnSerLeuLeuIleVal 161AsnAsnAlaThrAsnValValIleLysValCysGluPheGInPheCysAsnAspProPhe 181LeuGlyValTyrTyrHisLysAsnAsnLysSerTrpMetGluSerGluPheArgValTyr 201SerSerAlaAsnAsnCysThrPheGluTyrValSerGlnProPheLeuMetAspLeuGlu 221GlyLysGlnGlyAsnPheLysAsnLeuArgGluPheValPheLysAsnIleAspGlyTyr 241PheLysIleTyrSerLysHisThrProIleAsnLeuValArgAspLeuProGInGlyPhe 261SerAlaLeuGluProLeuValAspLeuProIleGlyIleAsnIleThrArgPheGlnThr 281LeuLeuAlaLeuHisArgSerTyrLeuThrProGlyAspSerSerSerGlyTrpThrAla 301GlyAlaAlaAlaTyrTyrValGlyTyrLeuGlnProArgThrPheLeuLeuLysTyrAsn 321GluAsnGlyThrIleThrAspAlaValAspCysAlaLeuAspProLeuSerGluThrLys 341CysThrLeuLysSerPheThrValGluLysGlyIleTyrGlnThrSerAsnPheArgVal 361GlnProThrGluSerIleValArgPheProAsnIleThrAsnLeuCysProPheGlyGlu 381ValPheAsnAlaThrArgPheAlaSerValTyrAlaTrpAsnArgLysArgIleSerAsn 401CysValAlaAspTyrSerValLeuTyrAsnSerAlaSerPheSerThrPheLysCysTyr 421GlyValSerProThrLysLeuAsnAspLeuCysPheThrAsnValTyrAlaAspSerPhe 441ValIleArgGlyAspGluValArgGlnIleAlaProGlyGlnThrGlyLysIleAlaAsp 461TyrAsnTyrLysLeuProAspAspPheThrGlyCysValIleAlaTrpAsnSerAsnAsn 481LeuAspSerLysValGlyGlyAsnTyrAsnTyrLeuTyrArgLeuPheArgLysSerAsn 501LeuLysProPheGluArgAspIleSerThrGluIleTyrGlnAlaGlySerThrProCys 521AsnGlyValGluGlyPheAsnCysTyrPheProLeuGlnSerTyrGlyPheGlnProThr 541AsnGlyValGlyTyrGlnProTyrArgValValValLeuSerPheGluLeuLeuHisAla 561ProAlaThrValCysGlyProLysLysSerThrAsnLeuValLysAsnLysCysValAsn 581PheAsnPheAsnGlyLeuThrGlyThrGlyValLeuThrGluSerAsnLysLysPheLeu 601ProPheGlnGlnPheGlyArgAspIleAlaAspThrThrAspAlaValArgAspProGln 621ThrLeuGluIleLeuAspIleThrProCysSerPheGlyGlyValSerValIleThrPro 641GlyThrAsnThrSerAsnGlnValAlaValLeuTyrGlnAspValAsnCysThrGluVal 661ProValAlaIleHisAlaAspGlnLeuThrProThrTrpArgValTyrSerThrGlySer 681AsnValPheGlnThrArgAlaGlyCysLeuIleGlyAlaGluHisValAsnAsnSerTyr 701GluCysAspIleProIleGlyAlaGlyIleCysAlaSerTyrGlnThrGlnThrAsnSer 721ProGlySerAlaSerSerValAlaSerGlnSerIleIleAlaTyrThrMetSerLeuGly 741AlaGluAsnSerValAlaTyrSerAsnAsnSerIleAlaIleProThrAsnPheThrIle 761SerValThrThrGluIleLeuProValSerMetThrLysThrSerValAspCysThrMet 781TyrIleCysGlyAspSerThrGluCysSerAsnLeuLeuLeuGlnTyrGlySerPheCys 801ThrGlnLeuAsnArgAlaLeuThrGlyIleAlaValGluGlnAspLysAsnThrGlnGlu 821ValPheAlaGlnValLysGlnIleTyrLysThrProProIleLysAspPheGlyGlyPhe 841AsnPheSerGlnIleLeuProAspProSerLysProSerLysArgSerPheIleGluAsp 861LeuLeuPheAsnLysValThrLeuAlaAspAlaGlyPheIleLysGlnTyrGlyAspCys 881LeuGlyAspIleAlaAlaArgAspLeuIleCysAlaGInLysPheAsnGlyLeuThrVal 901LeuProProLeuLeuThrAspGluMetIleAlaGlnTyrThrSerAlaLeuLeuAlaGly 921ThrIleThrSerGlyTrpThrPheGlyAlaGlyAlaAlaLeuGlnIleProPheAlaMet 941GlnMetAlaTyrArgPheAsnGlyIleGlyValThrGlnAsnValLeuTyrGluAsnGln 961LysLeuIleAlaAsnGlnPheAsnSerAlaIleGlyLysIleGInAspSerLeuSerSer 981ThrAlaSerAlaLeuGlyLysLeuGlnAspValValAsnGlnAsnAlaGInAlaLeuAsn 1001ThrLeuValLysGlnLeuSerSerAsnPheGlyAlaIleSerSerValLeuAsnAspIle 1021LeuSerArgLeuAspProProGluAlaGluValGlnIleAspArgLeuIleThrGlyArg 1041LeuGlnSerLeuGlnThrTyrValThrGlnGlnLeuIleArgAlaAlaGluIleArgAla 1061SerAlaAsnLeuAlaAlaThrLysMetSerGluCysValLeuGlyGlnSerLysArgVal 1081AspPheCysGlyLysGlyTyrHisLeuMetSerPheProGlnSerAlaProHisGlyVal 1101ValPheLeuHisValThrTyrValProAlaGInGluLysAsnPheThrThrAlaProAla 1121IleCysHisAspGlyLysAlaHisPheProArgGluGlyValPheValSerAsnGlyThr 1141HisTrpPheValThrGlnArgAsnPheTyrGluProGlnIleIleThrThrAspAsnThr 1161PheValSerGlyAsnCysAspValValIleGlyIleValAsnAsnThrValTyrAspPro 1181LeuGlnProGluLeuAspSerPheLysGluGluLeuAspLysTyrPheLysAsnHisThr 1201SerProAspValAspLeuGlyAspIleSerGlyIleAsnAlaSerValValAsnIleGln 1221LysGluIleAspArgLeuAsnGluValAlaLysAsnLeuAsnGluSerLeuIleAspLeu 1241GlnGluLeuGlyLysTyrGluGlnTyrIleLysTrpProGlyGlySerGlyGlyTyrIle 1261ProGluAlaProArgAspGlyGlnAlaTyrValArgLysAspGlyGluTrpValLeuLeu 1281SerThrPheLeuGlyGlyGlyGlySerGlyGlyGlySerValSerGlyTrpArgLeuPhe 1301LysLysIleSerGlyGlySerHisHisHisHisHisHisHisHisEnd

REFERENCES

[0113] 1. Tang, Y., Schmitz, J. E., Persing, D. H. & Stratton, C. W. Laboratory Diagnosis of COVID-19: Current Issues and Challenges. J. Clin. Microbiol. 58, e00512-20 (2020). [0114] 2. Peeling, R. W. et al. Serology testing in the COVID-19 pandemic response. Lancet Infect. Dis. 20, e245e249 (2020). [0115] 3. Huang, A. T. et al. A systematic review of antibody mediated immunity to coronaviruses: kinetics, correlates of protection, and association with severity. Nat. Commun. 11, 4704 (2020). [0116] 4. Lisboa Bastos, M. et al. Diagnostic accuracy of serological tests for covid-19: Systematic review and meta-analysis. BMJ 370, (2020). [0117] 5. Andryukov, B. G. Six decades of lateral flow immunoassay: From determining metabolic markers to diagnosing covid-19. AIMS Microbiol. 6, 280-304 (2020). [0118] 6. Whitman, J. D. et al. Evaluation of SARS-CoV-2 serology assays reveals a range of test performance. Nat. Biotechnol. 38, 1174-1183 (2020). [0119] 7. Adams, E. R. et al. Antibody testing for COVID-19: A report from the National COVID Scientific Advisory Panel. Wellcome Open Res. 5, 139 (2020). [0120] 8. Amanat, F. et al. A serological assay to detect SARS-CoV-2 seroconversion in humans. Nat. Med. 26, 1033-1036 (2020). [0121] 9. Stadlbauer, D. et al. SARS-CoV-2 Seroconversion in Humans: A Detailed Protocol for a Serological Assay, Antigen Production, and Test Setup. Curr. Protoc. Microbiol. 57, 1-15 (2020). [0122] 10. Bryan, A. et al. Performance Characteristics of the Abbott Architect SARS-CoV-2 IgG Assay and Seroprevalence in Boise, Idaho. J. Clin. Microbiol. 58, 4-11 (2020). [0123] 11. Rhoads, D. D. et al. Comparison of abbott id now, diasorin simplexa, and CDC fda emergency use authorization methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from individuals diagnosed with covid-19. J. Clin. Microbiol. 58, 17-18 (2020). [0124] 12. Package insert of Elecsys Anti-SARS-CoV-2. (2020). doi:10.1093/cid/ciaa344 [0125] 13. Ainsworth, M. et al. Performance characteristics of five immunoassays for SARS-CoV-2: a head-to-head benchmark comparison. Lancet Infect. Dis. 3099, 1-11 (2020). [0126] 14. Yao, Z., Petschnigg, J., Ketteler, R. & Stagljar, I. Application guide for omics approaches to cell signaling. Nat. Chem. Biol. 11, 387-397 (2015). [0127] 15. Snider, J. et al. Fundamentals of protein interaction network mapping. Mol. Syst. Biol. 11, 848-848 (2015). [0128] 16. Michnick, S. W., Ear, P. H., Manderson, E. N., Remy, I. & Stefan, E. Universal strategies in research and drug discovery based on protein-fragment complementation assays. Nat. Rev. Drug Discov. 6, 569-582 (2007). [0129] 17. Remy, I. & Michnick, S. W. A highly sensitive protein-protein interaction assay based on Gaussia luciferase. Nat. Methods 3, 977-979 (2006). [0130] 18. Azad, T., Tashakor, A. & Hosseinkhani, S. Split-luciferase complementary assay: applications, recent developments, and future perspectives. Anal. Bioanal. Chem. 406, 5541-5560 (2014). [0131] 19. Ohmuro-Matsuyama, Y. & Ueda, H. Protein-Protein Interaction Assays Using Split-NanoLuc. in Bioluminescence-Analytical Applications and Basic Biology (IntechOpen, 2019). doi:10.5772/intechopen.86122 [0132] 20. Dixon, A. S., Kim, S. J., Baumgartner, B. K., Krippner, S. & Owen, S. C. A Tri-part Protein Complementation System Using Antibody-Small Peptide Fusions Enables Homogeneous Immunoassays. Sci. Rep. 7, 1-13 (2017). [0133] 21. Ohmuro-Matsuyama, Y. & Ueda, H. Homogeneous Noncompetitive Luminescent Immunodetection of Small Molecules by Ternary Protein Fragment Complementation. Anal. Chem. 90, 3001-3004 (2018). [0134] 22. Kruger, N. J. Detection of Polypeptides on Immunoblots Using Enzyme-Conjugated or Radiolabeled Secondary Ligands. in The Protein Protocols Handbook (ed. Walker, J. M.) 405-414 (2002). [0135] 23. Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270-273 (2020). [0136] 24. Ju, B. et al. Human neutralizing antibodies elicited by SARS-CoV-2 infection. Nature 584, 115-119 (2020). [0137] 25. Yuan, M. et al. A highly conserved cryptic epitope in the receptor binding domains of SARS-CoV-2 and SARS-CoV. Science (80-.). 368, 630-633 (2020). [0138] 26. Cassidy, J. T. & Nordby, G. L. Human serum immunoglobulin concentrations: Prevalence of immunoglobulin deficiencies. J. Allergy Clin. Immunol. 55, 35-48 (1975). [0139] 27. Gonzalez-Quintela, A. et al. Serum levels of immunoglobulins (IgG, IgA, IgM) in a general adult population and their relationship with alcohol consumption, smoking and common metabolic abnormalities. Clin. Exp. Immunol. 151, 42-(2008). [0140] 28. Hartman, H., Wang, Y., Schroeder, H. W. & Cui, X. Absorbance summation: A novel approach for analyzing high-throughput ELISA data in the absence of a standard. PLoS One 13, 1-12 (2018). [0141] 29. Tan, C. W. et al. A SARS-CoV-2 surrogate virus neutralization test based on antibody-mediated blockage of ACE2-spike protein-protein interaction. Nat. Biotechnol. 38, 1073-1078 (2020). [0142] 30. Mendoza, E. J., Manguiat, K., Wood, H. & Drebot, M. Two Detailed Plaque Assay Protocols for the Quantification of Infectious SARS-CoV-2. Curr. Protoc. Microbiol. 57, 1-15 (2020). [0143] 31. Wang, S., Sakhatskyy, P., Chou, T.-H. W. & Lu, S. Assays for the assessment of neutralizing antibody activities against Severe Acute Respiratory Syndrome (SARS) associated coronavirus (SCV). J. Immunol. Methods 301, 21-30 (2005). [0144] 32. Kim, D. K. et al. A comprehensive, flexible collection of SARS-CoV-2 coding regions. G3 Genes, Genomes, Genet. 10, 3399-3402 (2020). [0145] 33. Abe, K. T. et al. A simple protein-based surrogate neutralization assay for SARS-CoV-2. JCI insight 5, (2020). [0146] 33. Zohar, T. et al. Compromised humoral functional evolution tracks with SARSCoV-2 mortality. Cell 183, 1508-1519.e12 (2020). [0147] 34. Isho, B. et al. Persistence of serum and saliva antibody responses to SARSCoV-2 spike antigens in COVID-19 patients. Sci. Immunol. 5, eabe5511 (2020). [0148] 35. Premkumar, L. et al. The receptor-binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in SARS-CoV-2 patients. Sci. Immunol. 5, eabc8413 (2020). [0149] 36. Long, Q. X. et al. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat. Med. 26,845-848 (2020). [0150] 37. Guo, L. et al. Profiling early humoral response to diagnose novel coronavirus disease (COVID-19). Clin. Infect. Dis. 71,778-785 (2020).

[0151] Although various embodiments of the disclosure have been described and illustrated, it will be apparent to those skilled in the art in light of the present description that numerous modifications and variations can be made. The scope of the invention is defined more particularly in the appended claims.