SCAFFOLD WITH HIERARCHICAL STRUCTURE, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF

Abstract

A scaffold with hierarchical structure, a preparation method therefor and an application thereof. The scaffold with hierarchical structure has a structure ranging from centimeters to micrometers, and is used in the fields of three-dimensional cell culture, in vitro large-scale amplification, in vitro tissue-like construction, tissue engineering and regenerative medicine, pathological model research, new drug research and development, drug toxicology research and the like.

Claims

1. A scaffold with hierarchical structure, comprising a scaffold body, wherein, there are big interconnected pores with an average pore diameter of 10 to 500 μm; a porosity of the scaffold body is 10% to 95%; and a Young's modulus of 0.1 kPa to 10 MPa.

2. The scaffold with hierarchical structure according to claim 1, wherein, a macro structure of the scaffold body is columnar, blocky, lamellar, cystic or tubular; and/or the scaffold body is a cylinder, a cube or a prism; and/or there are big interconnected pores with an average pore diameter of 80 to 200 μm inside the scaffold body; and/or the porosity of the scaffold body is 50% to 95%; and/or the Young's modulus of the scaffold body is 30 to 500 kPa.

3. The scaffold with hierarchical structure according to claim 1 wherein, the scaffold body further comprises at least one hollow channel; preferably, the hollow channel runs through the top and bottom of the scaffold body; further preferably, the at least one hollow channel is two, three, four or more hollow channels; and/or, further preferably, a diameter of the hollow channel is 0.1 to 5 cm; and/or, a ratio of height to diameter of the scaffold body is (0.1 to 10) : (10 to 0.1), preferably 1:1; and/or, the height of the scaffold body is 0.1 to 8 cm, preferably 1 cm; and/or, the diameter of the scaffold body is 0.1 to 8 cm, preferably 1 cm; and/or, the porosity of the scaffold body is 75% to 95%.

4. The scaffold with hierarchical structure according to claim 1 wherein, the scaffold body comprises a three-dimensional structure with an upper size of 0.5 to 50 cm; preferably, the dimension of the three-dimensional structure is 1 cm×1 cm×0.5 cm; and/or the scaffold body is composed of a microfilament material of about 50 to 800 μm; and/or the scaffold body comprises hollow channels with an interval of 0.1 to 1000 mm.

5. The scaffold with hierarchical structure according to claims 1, wherein, when the scaffold with hierarchical structure is compressed, the scaffold with hierarchical structure exhibits at least 20% to 70% or higher compression strain without permanent deformation or mechanical damage.

6. The scaffold with hierarchical structure according to claim 1, wherein, the scaffold body is made of a biocompatible material; preferably, the biocompatible material is selected from a natural material and/or an artificial synthetic material; further preferably, the natural material is at least one selected from alginate, alginate derivatives, gelatin, gelatin derivatives, agar, matrix gel, collagen, collagen derivatives, hyaluronic acid, hyaluronic acid derivatives, cellulose, cellulose derivatives, proteoglycan, proteoglycan derivatives, glycoprotein, glycoprotein derivatives, chitosan, chitosan derivatives, laminin, fibronectin, fibrin, silk fibroin, silk fibroin derivatives, vitronectin, osteopontin, peptide hydrogel and DNA hydrogel, and preferably the natural material is sodium alginate and/or gelatin; and/or further preferably, the synthetic material is at least one selected from polyglycolic acid, polylactic acid, polylactic acid-glycolic acid copolymer, polyglutamic acid-polyethylene glycol, polycaprolactone, polytrimethylene carbonate, polyglycolic acid, polyethylene glycol-polydioxanone, polyethylene glycol, polytetrafluoroethylene, polyoxyethylene, polyethylene vinyl acetate, polytrimethylene carbonate, poly(p-dioxanone), polyether ether ketone, and derivatives and polymers thereof, and preferably the synthetic material is polyglycolic acid or polylactic acid, and/or further preferably, the crosslinking agent used for preparing the scaffold body is at least one selected from divalent cation, genipin, glutaraldehyde, adopyl diacidhydrizine, epichlorohydrin, carbodiimide, thrombin and derivatives thereof, and preferably the crosslinking agent is calcium chloride; and further preferably, the scaffold body is made of polyglycolic acid and fibrin, and the crosslinking agent is thrombin.

7. A preparation method for the scaffold with hierarchical structure according to claim 1, comprising the following steps: 1) preparing a precursor solution with a biocompatible material and a corresponding crosslinking agent; 2) preparing a three-dimensional structure body using the precursor solution as raw material; 3) freezing the three-dimensional structure body; and 4) drying the frozen three-dimensional structure body to obtaining the scaffold with hierarchical structure, wherein, preferably, a mass percentage concentration of the biocompatible material is 0.1% to 80%, and more preferably 1% to 25%; and/or preferably, a mass percentage concentration of the crosslinking solution is 0.1 mM to 10 M, and preferably 1 mM to 100 mM; and/or preferably, the biocompatible material and the crosslinking agent solution are mixed according to a volume ratio of from 1000:1 to 1:1000, and preferably from 10:1 to 1:10; and/or preferably, the precursor solution is made of a polyglycolic acid solution with a concentration of 1% to 25%, a fibrinogen solution with a concentration of 1% to 25% and a thrombin solution with a concentration of 1 to 2000 mM; and/or preferably, the three-dimensional structure body is subjected to stepwise freezing and more preferably incubated at 4° C. for 0.5 to 24 h, then at −20° C. for 0.5 to 48 h, and then at −80° C. for 0.5 to 48 h; and/or preferably, drying the frozen three-dimensional structure body by vacuum freeze drying, and more preferably under a condition of −4° C. to −80° C. and 1 to 1000 Pa.

8. The scaffold with hierarchical structure prepared by the preparation method according to claim 7.

9. (canceled)

10. A three-dimensional cell culture method, comprising: inoculating cells or a mixture of cells and a biocompatible material into the scaffold with hierarchical structure according to claim 1 for three-dimensional culture; or, further, comprising a step of cell collection and/or detection; wherein preferably, the cells are selected from one or more of the following cells: embryonic stem cells from various sources, pluripotent stem cells, induced pluripotent stem cells, stem cells from various organs, progenitor cells from various organs, mesenchymal stem cells, cells differentiated from various stem cells by induced differentiation, fibroblasts from various organs, epithelial cells from various organs, epidermal cells from various organs, endothelial cells from various organs, muscle cells from various organs, amniotic cells, cone cells, nerve cells, blood cells, red blood cells, white blood cells, platelets, vascular cells, phagocytes, immune cells, lymphocytes, eosinophils, basophils, plasma cells, mast cells, antigen presenting cells, cells of mononuclear phagocyte system, melanocytes, chondrocytes, bone-derived cells, smooth muscle cells, skeletal muscle cells, cardiac muscle cells, secretory cells, adipocytes, ciliated cells, pancreatic cells, renal cells, intestinal mucosa cells, hepatocytes, stem cells or progenitor cells from liver, hepatic macrophages, kupffer cells, astrocytes, biliary epithelial cells, sinusoidal endothelial cells and cells from other tissues and organs, and various tumor cells, various cells for immunotherapy, various cells and cell lines obtained after gene editing, and virus packaging or modification; and further preferably, the cells are stem cells, and more preferably embryonic stem cells or liver stem cells; and/or, preferably, the biocompatible material is at least one material of alginate, alginate derivatives, gelatin, gelatin derivatives, agar, matrix gel, collagen, collagen derivatives, hyaluronic acid, hyaluronic acid derivatives, cellulose, cellulose derivatives, proteoglycan, proteoglycan derivatives, glycoprotein, glycoprotein derivatives, chitosan, chitosan derivatives, laminin, fibronectin and fibrin, silk fibroin, silk fibroin derivatives, vitronectin, osteopontin, peptide hydrogel, and DNA hydrogel, and preferably the biocompatible material is collagen and derivatives thereof.

11. The scaffold with hierarchical structure according to claim 2, wherein, the scaffold body further comprises at least one hollow channel; preferably, the hollow channel runs through the top and bottom of the scaffold body; further preferably, the at least one hollow channel is two, three, four or more hollow channels; and/or, further preferably, a diameter of the hollow channel is 0.1 to 5 cm; and/or, a ratio of height to diameter of the scaffold body is (0.1 to 10) : (10 to 0.1), preferably 1:1; and/or, the height of the scaffold body is 0.1 to 8 cm, preferably 1 cm; and/or, the diameter of the scaffold body is 0.1 to 8 cm, preferably 1 cm; and/or, the porosity of the scaffold body is 75% to 95%.

12. The scaffold with hierarchical structure according to claim 2, wherein, the scaffold body comprises a three-dimensional structure with an upper size of 0.5 to 50 cm; preferably, the dimension of the three-dimensional structure is 1 cm×1 cm×0.5 cm; and/or the scaffold body is composed of a microfilament material of about 50 to 800 μm; and/or the scaffold body comprises hollow channels with an interval of 0.1 to 1000 mm.

13. The scaffold with hierarchical structure according to claim 2, wherein, when the scaffold with hierarchical structure is compressed, the scaffold with hierarchical structure exhibits at least 20% to 70% or higher compression strain without permanent deformation or mechanical damage.

14. The scaffold with hierarchical structure according to claim 3, wherein, when the scaffold with hierarchical structure is compressed, the scaffold with hierarchical structure exhibits at least 20% to 70% or higher compression strain without permanent deformation or mechanical damage.

15. The scaffold with hierarchical structure according to claim 4, wherein, when the scaffold with hierarchical structure is compressed, the scaffold with hierarchical structure exhibits at least 20% to 70% or higher compression strain without permanent deformation or mechanical damage.

16. The scaffold with hierarchical structure according to claim 2, wherein, the scaffold body is made of a biocompatible material; preferably, the biocompatible material is selected from a natural material and/or an artificial synthetic material; further preferably, the natural material is at least one selected from alginate, alginate derivatives, gelatin, gelatin derivatives, agar, matrix gel, collagen, collagen derivatives, hyaluronic acid, hyaluronic acid derivatives, cellulose, cellulose derivatives, proteoglycan, proteoglycan derivatives, glycoprotein, glycoprotein derivatives, chitosan, chitosan derivatives, laminin, fibronectin, fibrin, silk fibroin, silk fibroin derivatives, vitronectin, osteopontin, peptide hydrogel and DNA hydrogel, and preferably the natural material is sodium alginate and/or gelatin; and/or further preferably, the synthetic material is at least one selected from polyglycolic acid, polylactic acid, polylactic acid-glycolic acid copolymer, polyglutamic acid-polyethylene glycol, polycaprolactone, polytrimethylene carbonate, polyglycolic acid, polyethylene glycol-polydioxanone, polyethylene glycol, polytetrafluoroethylene, polyoxyethylene, polyethylene vinyl acetate, polytrimethylene carbonate, poly(p-dioxanone), polyether ether ketone, and derivatives and polymers thereof, and preferably the synthetic material is polyglycolic acid or polylactic acid, and/or further preferably, the crosslinking agent used for preparing the scaffold body is at least one selected from divalent cation, genipin, glutaraldehyde, adopyl diacidhydrizine, epichlorohydrin, carbodiimide, thrombin and derivatives thereof, and preferably the crosslinking agent is calcium chloride; and further preferably, the scaffold body is made of polyglycolic acid and fibrin, and the crosslinking agent is thrombin.

17. The scaffold with hierarchical structure according to claim 3, wherein, the scaffold body is made of a biocompatible material; preferably, the biocompatible material is selected from a natural material and/or an artificial synthetic material; further preferably, the natural material is at least one selected from alginate, alginate derivatives, gelatin, gelatin derivatives, agar, matrix gel, collagen, collagen derivatives, hyaluronic acid, hyaluronic acid derivatives, cellulose, cellulose derivatives, proteoglycan, proteoglycan derivatives, glycoprotein, glycoprotein derivatives, chitosan, chitosan derivatives, laminin, fibronectin, fibrin, silk fibroin, silk fibroin derivatives, vitronectin, osteopontin, peptide hydrogel and DNA hydrogel, and preferably the natural material is sodium alginate and/or gelatin; and/or further preferably, the synthetic material is at least one selected from polyglycolic acid, polylactic acid, polylactic acid-glycolic acid copolymer, polyglutamic acid-polyethylene glycol, polycaprolactone, polytrimethylene carbonate, polyglycolic acid, polyethylene glycol-polydioxanone, polyethylene glycol, polytetrafluoroethylene, polyoxyethylene, polyethylene vinyl acetate, polytrimethylene carbonate, poly(p-dioxanone), polyether ether ketone, and derivatives and polymers thereof, and preferably the synthetic material is polyglycolic acid or polylactic acid, and/or further preferably, the crosslinking agent used for preparing the scaffold body is at least one selected from divalent cation, genipin, glutaraldehyde, adopyl diacidhydrizine, epichlorohydrin, carbodiimide, thrombin and derivatives thereof, and preferably the crosslinking agent is calcium chloride; and further preferably, the scaffold body is made of polyglycolic acid and fibrin, and the crosslinking agent is thrombin.

18. The scaffold with hierarchical structure according to claim 4, wherein, the scaffold body is made of a biocompatible material; preferably, the biocompatible material is selected from a natural material and/or an artificial synthetic material; further preferably, the natural material is at least one selected from alginate, alginate derivatives, gelatin, gelatin derivatives, agar, matrix gel, collagen, collagen derivatives, hyaluronic acid, hyaluronic acid derivatives, cellulose, cellulose derivatives, proteoglycan, proteoglycan derivatives, glycoprotein, glycoprotein derivatives, chitosan, chitosan derivatives, laminin, fibronectin, fibrin, silk fibroin, silk fibroin derivatives, vitronectin, osteopontin, peptide hydrogel and DNA hydrogel, and preferably the natural material is sodium alginate and/or gelatin; and/or further preferably, the synthetic material is at least one selected from polyglycolic acid, polylactic acid, polylactic acid-glycolic acid copolymer, polyglutamic acid-polyethylene glycol, polycaprolactone, polytrimethylene carbonate, polyglycolic acid, polyethylene glycol-polydioxanone, polyethylene glycol, polytetrafluoroethylene, polyoxyethylene, polyethylene vinyl acetate, polytrimethylene carbonate, poly(p-dioxanone), polyether ether ketone, and derivatives and polymers thereof, and preferably the synthetic material is polyglycolic acid or polylactic acid, and/or further preferably, the crosslinking agent used for preparing the scaffold body is at least one selected from divalent cation, genipin, glutaraldehyde, adopyl diacidhydrizine, epichlorohydrin, carbodiimide, thrombin and derivatives thereof, and preferably the crosslinking agent is calcium chloride; and further preferably, the scaffold body is made of polyglycolic acid and fibrin, and the crosslinking agent is thrombin.

19. The scaffold with hierarchical structure according to claim 5, wherein, the scaffold body is made of a biocompatible material; preferably, the biocompatible material is selected from a natural material and/or an artificial synthetic material; further preferably, the natural material is at least one selected from alginate, alginate derivatives, gelatin, gelatin derivatives, agar, matrix gel, collagen, collagen derivatives, hyaluronic acid, hyaluronic acid derivatives, cellulose, cellulose derivatives, proteoglycan, proteoglycan derivatives, glycoprotein, glycoprotein derivatives, chitosan, chitosan derivatives, laminin, fibronectin, fibrin, silk fibroin, silk fibroin derivatives, vitronectin, osteopontin, peptide hydrogel and DNA hydrogel, and preferably the natural material is sodium alginate and/or gelatin; and/or further preferably, the synthetic material is at least one selected from polyglycolic acid, polylactic acid, polylactic acid-glycolic acid copolymer, polyglutamic acid-polyethylene glycol, polycaprolactone, polytrimethylene carbonate, polyglycolic acid, polyethylene glycol-polydioxanone, polyethylene glycol, polytetrafluoroethylene, polyoxyethylene, polyethylene vinyl acetate, polytrimethylene carbonate, poly(p-dioxanone), polyether ether ketone, and derivatives and polymers thereof, and preferably the synthetic material is polyglycolic acid or polylactic acid, and/or further preferably, the crosslinking agent used for preparing the scaffold body is at least one selected from divalent cation, genipin, glutaraldehyde, adopyl diacidhydrizine, epichlorohydrin, carbodiimide, thrombin and derivatives thereof, and preferably the crosslinking agent is calcium chloride; and further preferably, the scaffold body is made of polyglycolic acid and fibrin, and the crosslinking agent is thrombin.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0075] FIG. 1 is a diagram of a scaffold with hierarchical structure according to an embodiment of the present disclosure.

[0076] FIG. 2 is a diagram of scaffolds with hierarchical structure according to some embodiments of the present disclosure.

[0077] FIG. 3 is a diagram showing liver stem cells cultured in the scaffold with hierarchical structure according to Example 1 of the present disclosure. FIG. 3A shows the distribution and clustering of liver stem cells after proliferation in the scaffold for 7 days. FIG. 3B shows transcription levels of liver specific genes in liver stem cells in planar cultures (2D), in 3D scaffolds with hierarchical structure and harvested after hydration of 3D scaffolds, under the same condition.

[0078] FIG. 4 is a schematic diagram of a grid-like structure used in Example 2 of the present disclosure and prepared by single nozzle 3D printing.

[0079] FIG. 5 shows morphology of scaffolds with hierarchical structure prepared by three- dimensional printing in Example 2 of the present disclosure. FIG. 5A is a schematic diagram of the grid-like 3D structure body formed by 3D printing; FIG. 5B is a top view of the scaffold with hierarchical structure prepared by 3D printing technology; FIG. 5C is a side view of the scaffold with hierarchical structure prepared by 3D printing technology; and FIG. 5D shows a micromorphology of the scaffold with hierarchical structure observed by SEM.

[0080] FIG. 6 is a diagram showing embryonic stem cells cultured in the scaffold with hierarchical structure according to Example 2 of the present disclosure. FIG. 6A shows distribution and clustering of embryonic stem cells after 4 days of culture in the scaffold with hierarchical structure under a light microscope; FIG. 6B shows the proliferation of embryonic stem cells in planar cultures (2D) and 3D scaffolds with hierarchical structure after 4 days of culture relative to that at the 0 day; and FIG. 6C shows transcription levels of totipotent genes of liver stem cells in planar cultures (2D), in 3D scaffolds and harvested after hydration of 3D scaffolds, under the same condition.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0081] The following embodiments are used to illustrate the present disclosure but are not used to limit the scope of the present disclosure. If not specified in particular, the technical means used in the Examples are general means known to people skilled in the art, and the raw material used is commercial commodity.

[0082] The percent sign “%” involved in the present disclosure, if not specified in particular, refers to a mass percentage; but for the percentage involved in a solution, it refers to solute grams of the solute in 100 mL solution unless otherwise specified.

[0083] Unless otherwise defined, all technical terms used in the present disclosure have the same meaning as those people skilled in the art would understand.

[0084] The term “crosslinking solution” used in the present disclosure refers to the solution that plays the function of crosslinking a material having biocompatibility in the preparation of the precursor solution, which can be a material known by people skilled in the art that can crosslink the material having biocompatibility to form a solution with a certain viscosity, such as a calcium chloride solution, preferably 1 to 100 mM, for example, a calcium chloride solution with a concentration of 5 mM.

[0085] The term “three-dimensional printing” used in the present disclosure refers to the three-dimensional precise deposition using a raw material compatible with three-dimensional printing through a method matched to an automatic or semi-automatic and computer-aided three-dimensional molding device (such as a three-dimensional printer).

[0086] FIGS. 1 to 2 are two diagrams of scaffolds with hierarchical structure according to Examples of the present disclosure.

Example 1: Preparing a Scaffold with Hierarchical Structure by Casting Mold Method

[0087] The present Example provides a scaffold with hierarchical structure, as shown in FIG. 1, including a scaffold body, wherein, there are big interconnected pores with an average pore diameter of about 100 μm inside the scaffold body, the porosity of the scaffold body is 75%, and the Young's modulus of the scaffold body is 220 kPa. The height of the scaffold body is 6 cm, and the diameter (refer to the outside diameter) of the scaffold body is 6 cm. The scaffold body further includes a hollow channel, and the diameter of the channel is 2 cm.

[0088] The preparation method for the above scaffold with hierarchical structure provided by the present Example, includes the following steps.

[0089] 1. Preparing a biomaterials solution

[0090] 21% polyglycolic acid solution: mixing polyglycolic acid powder (Sigma-Aldrich) with 0.9% sodium chloride solution at a mass ratio of 21:100, stirring the mixture with a magnetic stirrer for about 5 min and meanwhile heating the mixture at 100° C. until the polyglycolic acid powder is uniformly dissolved, and after cooling, sub-packing the mixture and preserving the resultant at 4° C.

[0091] 21% fibrin solution: mixing fibrinogen powder (Sigma-Aldrich) with 0.9% sodium chloride solution at a mass ratio of 21:100, and heating the mixture at 37° C. until the fibrinogen powder is uniformly dissolved.

[0092] 2. Preparing a crosslinking solution

[0093] 600 mM thrombin solution: dissolving thrombin powder in deionized water to prepare 600 mM thrombin solution as the crosslinking solution.

[0094] 3. Preparing a precursor solution

[0095] Mixing the above prepared 21% polyglycolic acid solution, 21% fibrinogen solution and 600 mM thrombin solution uniformly, to obtain the precursor solution with a concentration of 7% polyglycolic acid, 7% fibrinogen and 200 mM thrombin.

[0096] 4. Preparing a three-dimensional structure body by casting mold method

[0097] Pouring the above precursor solution into a preset mold, as shown in FIG. 1, to form a three-dimensional structure body with a hollow cylinder shape, and the three-dimensional structure has an outer diameter of 6 cm, a hollow diameter of 2 cm and a height of 6 cm.

[0098] 5. Freezing the prepared three-dimensional structure body

[0099] Freezing the pregel three-dimensional structure body stepwise. Specifically, the steps are preserving the three-dimensional structure body at 4° C. for 24 h, and then at −20° C. for 48 h.

[0100] 6. Drying the frozen three-dimensional structure body

[0101] Drying the three-dimensional structure body under a condition with a low temperature of −80° C. and a high vacuum of 500 Pa for 24h to form a scaffold with hierarchical structure. Sterilizing the scaffold by UV irradiation for 2 h and preserving it under a sterile condition for subsequent biological application of the scaffold.

[0102] Culturing liver stem cells using the scaffold with hierarchical structure prepared in Example 1, and the specific method is as follows.

[0103] 7. Inoculating liver stem cells into the scaffold with hierarchical structure

[0104] Dispersing liver stem cells (Life Technologies) uniformly in their cell culture medium at a density of 10.sup.4 cells/mL to form a cell suspension. Adding 1 mL of the cell suspension into the three-dimensional cell scaffold dropwise, and keeping it in a cell incubator for 24 h.

[0105] 8. Detecting distribution, proliferation, clustering and metabolic activity of cells in the scaffold

[0106] Providing a sufficient amount of cell culture medium for the scaffold after inoculation of cells, culturing the cells under a conventional cell culture condition (in an incubator, 37° C., 5% CO.sub.2), and replacing fresh medium every 2 to 3 days.

[0107] FIG. 3 is a diagram showing liver stem cells cultured in the scaffold with hierarchical structure prepared by casting mold method according to Example 1.

[0108] FIG. 3A shows morphology of liver stem cells cultured in the scaffold with hierarchical structure after 7 days. Under a light microscope, it can be seen that the cells were uniformly distributed in the scaffold and formed uniform clusters as shown by the arrows in the figure.

[0109] Detecting cells in the three-dimensional structure body by live-dead staining at day 0 and day 7. In the present disclosure, a mixed solution of 2 uM Calcein-AM (Dojindo, C326) and 4.5 uM PI (Dojindo, P346) were used to stain live cells (green color) and dead cells (red color) respectively, and the staining was performed in dark for 15 minutes. Recording and observation were performed with laser scanning confocal microscopy (Laser Scanning Confocal Microscope, LSCM) (Nikon, Z2). After completion of the printing, the survival rate of the cells in the structure was about 98% at day 0.

[0110] Detecting the proliferation of liver stem cells in the scaffold with hierarchical structure on day 3 and day 7 respectively. Under the same initial cell load, culture environment, culture medium and culture conditions, there is no significant difference between the metabolic activity of the liver cells cultured in the scaffold with hierarchical structure prepared by the present disclosure and that in two-dimensional cultures at every detection time point, and the metabolic activity was detected by using the commonly used cell metabolic activity detection kit (CellTiter-Blue® Cell Viability Assay, Promega).

[0111] 9. Detecting functions of liver stem cells in the scaffold

[0112] In order to detect functions of liver stem cells in the scaffold, immunofluorescence staining was used to detect the expression of mature hepatocyte-specific protein makers (such as ALB and MRP2).

[0113] Immunofluorescence staining: washing the structure with phosphate buffer (Phosphate Buffer Saline, PBS) (BI, 02-024-1AC); fixing it in 4% paraformaldehyde at room temperature for 30 minutes, and then washing it 3 times with PBS, each for 5 minutes; blocking it in a mixture containing 0.3% Triton-X (Sigma, X100) and 5% bovine serum albumin (Bovine Serum Albumin, BSA) (Multicell, 800-096-EG) for 1 hour; sucking out the blocking buffer, adding the diluted primary antibody (containing 0.3% Triton-X and 1% BSA), ALB (Abcam, ab83465) and MRP2 (Abcam, ab3373), and incubating at 4° C. overnight. Washing it 3 times with PBS, each for 5 minutes; adding corresponding second antibody, Alexa Fluor® 594 (Abcam, ab150080) and Alexa Fluor® 488 (Abcam, ab150113), incubating it at room temperature in dark for 2 hours, and then washing it 3 times with PBS, each for 5 minutes; and then adding DAPI to stain cell nucleus and incubating it at room temperature in dark for 5 minutes. Observation and recording were performed with laser scanning confocal microscope (Laser Scanning Confocal Microscope, LSCM) (Nikon, Z2).

[0114] 10. Non-destructive collecting of cell clusters in the scaffold and maintenance of phenotype and function of the harvested cell clusters

[0115] The scaffold with hierarchical structure in the present disclosure is composed of a hydrolyzable natural material, which can be hydrolyzed under physiological conditions so that the non-destructive collection of cells in the scaffold is achieved.

[0116] By qPCR technology, detecting the transcription level of genes related to mature hepatocytes in cell clusters in planar cultures, scaffold cultures and harvested after hydrolyzing the scaffold. Results are shown in FIG. 3B, the gene transcription level of cells in 3D scaffold was significantly higher than that in planar culture. The expression level of ALB of cells in 3D scaffold was 15 times higher than that in planar culture, and the expression level of MRP2 of cells in 3D scaffold was 4 times higher than that in planar culture. This indicates that after culturing in the scaffold for 7 days, liver stem cells were significantly differentiated into mature hepatocytes. Meanwhile, there is no difference between the gene expression levels of ALB and MRP2 of the cell clusters harvested after hydration and those of the cells in the 3D scaffold, indicating that the process of obtaining cells by hydrolyzing the scaffold has no effect on the morphology, phenotype and functions of cells.

[0117] qPCR Technology

[0118] Operation steps for extraction of RNA from cells: washing the structure with PBS once, adding 1 ml Trizol (Gibco, 15596026) into each structure, pipetting up and down to mix uniformly, keeping the resultant at room temperature for 10 minutes, then transferring the mixture to 1.5 ml EP tube, adding 200 μl chloroform, shaking the tube rapidly for 30 seconds, and after keeping the mixture at room temperature for 5 minutes, centrifuging at 4° C. and 12000 g for 10 minutes. Removing supernatant, adding isopropyl alcohol of a same volume into the remaining solution, and centrifuging the resultant at 4° C. and 12000 g for 10 minutes. Removing the supernatant, and washing the pellet with 75% ethyl alcohol. After drying, RNA was obtained, and then dissolved in DEPC water. Concentration and purity of RNA were detected by spectrophotometer (Thermo Scientific).

[0119] Operation steps for RNA reverse transcription: using PrimeScript™ II 1st strand cDNA Synthesis Kit (TaKaRa,6210) and operating RNA reverse transcription completely in accordance with the kit instructions. RNA content was adjusted to 5 ng. The primer was Oligo dT Primer. Program for reverse transcription PCR was as follows: 42° C. for 50 min, 95° C. for 5 min, and 4° C. for preservation, and PCR instrument was SimpliAmp™ thermal cycler (ABI).

[0120] Operating steps for fluorescence quantitative PCR: using Maxima SYBR Green qPCR Master Mix (Thermo Scientific, K0251) and a kit, operating the fluorescence quantitative PCR completely in accordance with the kit instruction. After adding the reaction solution as required, and placing the reaction plate in a qPCR instrument for detection. The reaction program was as follows: 95° C. for 10 min, [95° C. for 15 s, 60° C. for 30 s]×40 cycles, 72° C. for 30 s, and 72° C. for 10 min. Obtaining the expression of genes at different time points (FIG. 3B).

[0121] The primer sequences used for qPCR were as follows (5′-3′):

TABLE-US-00001 ALB primer sequences: Forward: GCACAGAATCCTTGGTGAACAG Reverse: ATGGAAGGTGAATGTTTCAGCA MRP2 primer sequences: Forward: TGAGCAAGTTTGAAACGCACAT Reverse: AGCTCTTCTCCTGCCGTCTCT

Example 2: Preparing a Scaffold with Hierarchical Structure by Single Nozzle Three-Dimensional Printing

[0122] This embodiment provides a scaffold with hierarchical structure, as shown in FIGS. 4 to 5, including a scaffold body, wherein, there are big interconnected pores with an average pore diameter of about 100 μm inside the scaffold body, the porosity of the scaffold body is 95%, and the Young's modulus of the scaffold body is 30 kPa. The scaffold body has a three-dimensional structure of 1 cm×1 cm×0.5 cm in size. The scaffold body is composed of microfilaments of about 300 μm. The scaffold body includes hollow channels with an interval of about 1 mm.

[0123] Further, the scaffold body is composed of a hierarchical structure.

[0124] The preparation method for the above scaffold with hierarchical structure provided by the present Example, includes the following steps.

[0125] 1. Preparing a precursor solution with concentration of 7% polyglycolic acid, 7% fibrinogen and 200 mM thrombin according to the same method as in Example 1.

[0126] 2. Preparing a scaffold with hierarchical structure by single nozzle 3D printing

[0127] Preparing the three-dimensional structure by using a single-nozzle extrusion printer, and the single nozzle 3D printer is shown in FIG. 4. Collecting the precursor solution into a sterile syringe, and loading the sterile syringe into the biological three-dimensional printing equipment (Regenovo, Bio-architect X). The printer is equipped with a non-destructive optical coherence tomography (Optical Coherence Tomography, OCT) system, which can realize non- destructive monitoring during the printing process to ensure the quality of the sample and reduce the difference between batches and within a batch. Under a condition with a support speed of 50 mm/s, a contour speed of 50 mm/s, a mesh speed of 50 mm/s and an extrusion speed of 50 μL/s, the printer performed three-dimensional printing on a bottom platform where was sterile and the temperature can be controlled. The temperature of the bottom platform was set to 0° C. and a three-dimensional structure body of hydrogel with a volume of 3 cm/3 cm/1 cm was formed, the schematic diagram of which is shown in FIG. 5A.

[0128] 3. Freezing the prepared three-dimensional structure body

[0129] Freezing the pregel three-dimensional structure body stepwise, the specific steps were preserving the three-dimensional structure body at 4° C. for 24 h, and then at −20° C. overnight.

[0130] 4. Drying the frozen three-dimensional structure body

[0131] Drying the three-dimensional structure body at a condition with a low temperature of −80° C. and a high vacuum of 500 Pa for 24h, to form a scaffold with hierarchical structure. Sterilizing the scaffold by UV irradiation for 2 h and preserving it under a sterile condition for subsequent biological application. The macro structure of the frozen scaffold with hierarchical structure after drying is shown in FIG. 5B (top view) and FIG. 5C (side view). Observation of the microstructure of the big interconnected pores of the scaffold was performed with scanning electron microscopy (Scanning Electron Microscopy, SEM). The diameters of the big interconnected pores in the scaffold were 100 to 300 μm, as shown in FIG. 5D.

[0132] Culturing embryonic stem cells using the scaffold with hierarchical structure prepared in the present Example, and the specific method is as follows.

[0133] 5. Inoculating embryonic stem cells into the scaffold with hierarchical structure

[0134] Dispersing embryonic stem cells (Life Technologies) uniformly in their cell culture medium at a density of 10.sup.4 cells/mL to form a cell suspension, adding 1 mL of cell suspension into the three-dimensional cell scaffold dropwise, and by a dynamic culturing method, rotating the scaffold added with the cell suspension at a speed of 5000 RPM on a horizontal vibrating screen (Beijing Hinsr Technology Co., Ltd., WD-9405F), and keeping it for 12 h under the cell culture condition (in an incubator, 37° C., 5% CO2).

[0135] 6. Detecting distribution, proliferation, clustering and metabolic activity of cells in the scaffold

[0136] Providing a sufficient amount of cell culture medium for the scaffold after inoculation of cells, culturing it under a conventional cell culture condition (in an incubator, 37° C., 5% CO.sub.2), and replacing fresh medium every 2 to 3 days. FIG. 6A shows morphology of embryonic stem cells cultured in the scaffold with hierarchical structure for 7 days, and the arrows point to the embryonic stem cell clusters. Under a light microscope, it can be observed that the cells were uniformly distributed in the scaffolds and formed clusters having uniform size.

[0137] Detecting cells in the three-dimensional structure body by live-dead staining on day 0 and day 7. In the present disclosure, a mixed solution of 2 uM Calcein-AM (Dojindo, C326) and 4.5 uM PI (Dojindo, P346) were used to stain live cells (green color) and dead cells (red color) respectively, and the staining was performed in dark for 15 minutes. Recording and observation were performed using laser scanning confocal microscopy (Laser Scanning Confocal Microscope, LSCM) (Nikon, Z2). After completion of the printing, the survival rate of the cells in the structure was about 99% at day 0.

[0138] FIG. 6B shows the proliferation of embryonic stem cells in the scaffold with hierarchical structure printed by three-dimensional printing. Under the same initial cell load, culture environment, culture medium and culture conditions, the liver cells cultured in the scaffold with hierarchical structure prepared by the present disclosure have a significant increase in metabolic activity over that in two-dimensional cultures at every detection time point, and the metabolic activity was detected by using the commonly used cell metabolic activity detection kit (CellTiter-Blue® Cell Viability Assay, Promega).

[0139] 7. Detecting the totipotency of embryonic stem cells in the scaffold

[0140] In order to detect the totipotency of embryonic stem cells in the scaffold, the expression of classical protein markers for totipotency (such as OCT4 and Ecad) were detected by immunofluorescence staining.

[0141] Immunofluorescence staining: washing the structure with phosphate buffer (Phosphate Buffer Saline, PBS) (BI, 02-024-1AC); fixing the resultant in 4% paraformaldehyde at room temperature for 30 minutes, and then washing it 3 times with PBS, each for 5 minutes; blocking it in a mixture containing 0.3% Triton-X (Sigma, X100) and 5% bovine serum albumin (Bovine Serum Albumin, BSA) (Multicell, 800-096-EG) for 1 hour; sucking out the blocking buffer, adding the diluted primary antibody (containing 0.3% Triton-X and 1% BSA), OCT4 (Abcam, ab19857) and E-cadherin (Abcam, ab231303), and incubating at 4° C. overnight. Washing the resultant 3 times with PBS, each for 5 minutes; adding corresponding second antibody, Alexa Fluor® 594 (Abcam, ab150080) and Alexa Fluor® 488 (Abcam, ab150113), incubating at room temperature in dark for 2 hours, and then washing 3 times with PBS, each for 5 minutes; and then adding DAPI to stain cell nucleus and incubating at room temperature in dark for 5 minutes. Observation and recording were performed with laser scanning confocal microscope (Laser Scanning Confocal Microscope, LSCM) (Nikon, Z2).

[0142] 8. Non-destructive collecting of cell clusters in the scaffold and maintenance of phenotype and functions of the harvested cell clusters

[0143] The scaffold with hierarchical structure in the present disclosure is composed of a hydrolyzable natural material, and it can be hydrolyzed under physiological conditions so that the non-destructive collection of cells in the scaffold is achieved.

[0144] By qPCR technology, detecting the transcription level of classical totipotentcy-related genes in planar cultures, clusters in scaffold and clusters harvested after hydrolyzing the scaffold. Results are shown in FIG. 6C, there was no significant difference in the transcription level of totipotency genes of cells between planar cultures, scaffold cultures and cell clusters harvested after hydrolyzing the scaffold, indicating that the process of culturing cells in the scaffold with hierarchical structure, and hydrolyzing the scaffold to harvest the cells has no effect on the morphology, phenotype and totipotency of cells.

[0145] qPCR technology: Operation steps for extraction of RNA from cells: washing the structure with PBS once, adding 1 ml Trizol (Gibco, 15596026) into each structure, pipetting up and down to mix uniformly, keeping the resultant at room temperature for 10 minutes, then transferring the mixture to 1.5 ml EP tube, adding 200 μl chloroform, shaking the tube rapidly for 30 seconds, and after keeping it at room temperature for 5 minutes, centrifuging at 4° C. and 12000 g for 10 minutes. Removing supernatant, adding isopropyl alcohol of a same volume into the remaining solution, and centrifuging the resultant at 4° C. and 12000 g for 10 minutes. Removing the supernatant, and washing the pellet with 75% absolute ethyl alcohol. After drying, RNA was obtained, and then dissolved in DEPC water. Concentration and purity of RNA were detected by spectrophotometer (Thermo Scientific).

[0146] Operation steps for RNA reverse transcription: using PrimeScript™ II 1st strand cDNA Synthesis Kit (TaKaRa, 6210) and operating RNA reverse transcription completely in accordance with the kit instructions. RNA content was adjusted to 5 ng. The primer was Oligo dT Primer. Program Reverse transcription PCR was as follows: 42° C. for 50 min, 95° C. for 5 min, and 4° C. for preservation, and the PCR instrument was a SimpliAmp™ thermal cycle instrument (ABI).

[0147] Operating steps for fluorescence quantitative PCR: using Maxima SYBR Green qPCR Master Mix (Thermo Scientific, K0251) and a kit, and operating fluorescence quantitative PCR completely in accordance with the kit instruction. After adding the reaction solution as required, and placing the reaction plate in a qPCR instrument for detection. The reaction program was as follows: 95° C. for 10 min, [95° C. for 15 s, 60° C. for 30 s]× 40 cycles, 72° C. for 30 s, and 72° C. for 10 min. The expression of genes was obtained at different time points (FIG. 6B).

[0148] The primer sequences used for qPCR were as follows (5′-3′):

TABLE-US-00002 OCT4 primer sequences: Forward: GAAGCAGAAGAGGATCACCTTG Reverse: TTCTTAAGGCTGAGCTGCAAG Nanog primer sequences: Forward: CCTCAGCCTCCAGCAGATGC Reverse: CCGCTTGCACTTCACCCTTTG

[0149] Although the present disclosure has been described in detail with general description and specific embodiments, some modifications or improvements can be made on the basis of the present disclosure, which are obvious for people skilled in the art. Therefore, these modifications or improvements made without deviating from the spirit of the present disclosure belong to the scope of protection required by the present disclosure.

INDUSTRIAL APPLICABILITY

[0150] The present disclosure provides a scaffold with hierarchical structure and preparation method therefor and application thereof. The scaffold with hierarchical structure provided by the present disclosure has a structure from centimeter scale to micron scale, which can be used in fields of three-dimensional cell culture, in vitro large-scale amplification, in vitro tissue-like construction, tissue engineering and regenerative medicine, pathological model research, new drug development and drug toxicology research. The scaffold with hierarchical structure has the characteristics of customizable macro structure, adjustable hierarchical structure and pore size, high porosity, permeability, cell load and elastic modulus, good mechanical properties and cell functions and non-destructive collection of cells, and has good economic value and application prospect.