MONO-HYDROXY OR DI-HYDROXY DERIVATIVES OF POLYUNSATURATED FATTY ACIDS, PRODUCTION METHOD THEREFOR, AND USE THEREOF
20240000680 ยท 2024-01-04
Inventors
- Jeong Woo Seo (Daejeon, KR)
- Jong Jae Yl (Daejeon, KR)
- Sun Yeon Heo (Daejeon, KR)
- JungHyun JU (Daejeon, KR)
- Chul Ho Kim (Daejeon, KR)
- Baek Rock Oh (Daejeon, KR)
- Gil Yong LEE (Hwaseong, KR)
- Kyung Min Lee (Seoul, KR)
- Hee Won CHO (Incheon, KR)
Cpc classification
C12N9/0069
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to an enzyme for producing hydroxy derivatives of polyunsaturated fatty acids, a method for producing hydroxy derivatives of polyunsaturated fatty acids using the same, and an SPMs complex composition containing the hydroxy derivatives of polyunsaturated fatty acids.
The enzyme may produce hydroxy derivatives of polyunsaturated fatty acids in a single reaction, and thus may be very usefully used for in vitro production. In addition, the SPMs complex composition containing the hydroxy derivatives of polyunsaturated fatty acids promotes collagen production, inhibits the production of NO and expression of TNF- and IL-6, increases the expression of filaggrin and loricrin, and thus may be usefully used for preventing or alleviating skin aging or wrinkles, strengthening skin barrier, or preventing, alleviating or treating skin diseases comprising atopic dermatitis.
Claims
1. An enzyme for producing mono- or di-hydroxy derivatives of polyunsaturated fatty acids having an amino acid sequence having at least 90% homology with an amino acid sequence represented by SEQ ID NO: 1 or 2.
2. The enzyme of claim 1, wherein the polyunsaturated fatty acid is docosahexaenoic acid (DHA) or eicosapentaenoic acid (EPA).
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. A method for producing mono- or di-hydroxy derivatives of polyunsaturated fatty acids in vitro, the method comprising: reacting the enzyme of claim 1 with polyunsaturated fatty acids.
8. The method of claim 7, further comprising: recovering mono- or di-hydroxy derivatives from a reaction product of the enzyme and the polyunsaturated fatty acids.
9. The method of claim 7, wherein the reacting is performed under a condition of 10 C. to 40 C. and pH 4 to pH 10.
10. The method of claim 7, wherein the polyunsaturated fatty acid is docosahexaenoic acid (DHA) or eicosapentaenoic acid (EPA).
11. (canceled)
12. (canceled)
13. A complex composition for improving skin condition, wherein the complex composition contains 17-hydroxydocosahexaenoic acid, Resolvin D5, and Protectin DX as active ingredients.
14. The complex composition of claim 13, wherein the improvement of the skin condition is at least one kind selected from the group consisting of prevention or alleviation of skin wrinkles, prevention or alleviation of skin aging, prevention or alleviation of skin inflammation, skin regeneration, and skin barrier strengthening.
15. (canceled)
16. The complex composition of claim 13, wherein the composition i) promotes collagen synthesis in cells, ii) inhibits collagen decomposition, and iii) inhibits expression or activity of matrix metalloproteinase-1 (MMP-1).
17. The complex composition of claim 13, wherein the composition has antioxidant activity.
18. The complex composition of claim 13, wherein the composition inhibits an inflammatory factor.
19. The complex composition of claim 13, wherein the composition increases expression of filaggrin and Loricrin.
20. The complex composition of claim 13, wherein the 17-hydroxydocosahexaenoic acid, Resolvin D5, and Protectin DX are contained in a weight ratio of 3 to 85:10 to 60:6 to 50.
21. The complex composition of claim 13, wherein the composition is a cosmetic composition.
22. The complex composition of claim 13, wherein the composition is a food composition.
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
Description
BRIEF DESCRIPTION OF DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
BEST MODE
[0053] Hereinafter, the present invention will be described in detail.
[0054] 1. Enzyme for Producing Mono- or Di-Hydroxy Derivatives of Polyunsaturated Fatty Acids
[0055] An aspect of the present invention provides an enzyme for producing or mono- or di-hydroxy derivatives of polyunsaturated fatty acids.
[0056] In addition, another aspect of the present invention provides a nucleic acid molecule encoding the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids.
[0057] The enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention includes an amino acid sequence represented by SEQ ID NO: 1 or 2, and may be variants or fragments of amino acids having different sequences by deletion, insertion, substitution, or a combination of amino acid residues, within a range that does not affect the function of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids. Amino acid exchange has been known in the pertinent field at protein and peptide levels without changing entirely the activity of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids. In some cases, the amino acid exchange may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like. Accordingly, the present invention includes a protein having an amino acid sequence substantially identical to the protein comprising the amino acid sequence represented by SEQ ID NO: 1 or 2, and variants or active fragments thereof. The substantially identical proteins mean proteins having homology with the amino acid sequence of at least 90%, preferably at least 93%, and most preferably at least 95%, but are not limited thereto, and the proteins having homology of at least 90% with the amino acid sequence and identical enzyme activity are included in the scope of the present invention.
[0058] The gene of the enzyme for producing the mono- or di-hydroxy derivative of polyunsaturated fatty acids preferably consists of a nucleotide sequence represented by SEQ ID NO: 3 or 4. However, the nucleic acid molecules encoding the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention, and variants or active fragments thereof may have various modifications made in an encoding region within a range without changing the amino acid sequence of the enzyme expressed from the encoding region and the variant or active fragment thereof. Various mutations may be made within a range without affecting the expression of the gene even in portions other than the encoding region, and such mutant genes are also included in the scope of the present invention. Accordingly, the present invention includes a gene consisting of a nucleotide sequence substantially identical to the nucleic acid molecule of SEQ ID NO: 3 or 4 and fragments of the gene. The genes consisting of the substantially identical nucleotide sequences mean genes having sequence homology of 80% or more, preferably 90% or more, most preferably 95% or more, but are not limited thereto, and genes having sequence homology of 80% or more and having the identical enzyme activity of the encoded protein are included in the present invention. As such, the gene of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention may be mutated by substitution, deletion, and insertion of at least one nucleotide, or a combination thereof, as long as the gene encodes a protein having equivalent activity thereto, and these mutants are also included in the scope of the present invention.
[0059] The amino acid sequence represented by SEQ ID NO: 1 included in the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids is preferably encoded by a gene consisting of the nucleotide sequence represented by SEQ ID NO: 3, and the amino acid sequence represented by SEQ ID NO: 2 is preferably encoded by a gene consisting of the nucleotide sequence represented by SEQ ID NO: 4, but the present invention is not limited thereto. The amino acid sequence may also be encoded by a gene consisting of another nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 3 or 4 as long as the amino acid sequence may encode the protein of the present invention having the identical amino acid sequence. These nucleotide sequences may be single-stranded or double-stranded, and may be DNA molecules or RNA molecules.
[0060] In a specific example of the present invention, the present inventors had isolated and purified the protein having the amino acid sequence represented by SEQ ID NO: 1 or 2 to find the functions of the protein having the amino acid sequence represented by SEQ ID NO: 1 or 2 (see
[0061] 2. Expression Vector and Transformant of Enzyme for Producing Mono- or Di-Hydroxy Derivatives of Polyunsaturated Fatty Acids
[0062] Another aspect of the present invention provides a recombinant expression vector and a transformant introduced with the expression vector comprising a gene of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention.
[0063] The recombinant expression vector of the present invention includes the gene of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids.
[0064] The expression vector includes a plasmid vector, a cosmid vector, a bacteriophage vector, a viral vector, and the like, but is not limited thereto.
[0065] The recombinant expression vector may combine expression regulatory sequences such as promoters, terminators, enhancers, etc., or sequences for secretion appropriately depending on the purpose according to a type of host cell to produce the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention.
[0066] The expression vector may further include a selection marker for selecting a host cell into which the vector has been introduced, and may include an origin of replication in the case of a replicable expression vector.
[0067] In addition, the recombinant expression vector may include a sequence for facilitating purification of the expressed protein, and specifically, may be linked with a gene encoding a tag for isolation and purification so as to be operable to the gene encoding the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention. At this time, the tag for isolation and purification may use GST, poly-Arg, FLAG, histidine-tag (His-tag), c-myc, or the like alone or may also use by sequentially linking two or more of the tags.
[0068] The gene encoding the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids may be cloned through a restriction enzyme cleavage site. When a gene encoding a protein cleavage enzyme recognition site is used in the vector, the gene is linked with the gene of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids in frame. When the enzyme is obtained and then cleaved by the protein cleavage enzyme, an original type enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids may be produced.
[0069] In a specific example of the present invention, the gene (the gene comprising the nucleotide sequence represented by SEQ ID NO: 3 or 4) of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention are inserted into a plasmid vector pET28a(+) to prepare a recombinant cloning vector. In addition to the pET28a(+) used in the preparation of the cloning vector, various vectors for prokaryotic cells or eukaryotic cells (such as pPIC and pPICZ, etc.) are known, and thus, various expression vectors other than the vectors may be used depending on the purpose of expression.
[0070] The recombinant expression vector of the present invention includes the gene of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids, and thus may be effectively used as a vector capable of producing the gene of the enzyme.
[0071] In addition, the transformant of the present invention is introduced with the recombinant expression vector comprising the gene encoding the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids.
[0072] The recombinant expression vector according to the present invention is transformed into any one suitable host cell selected from the group consisting of bacteria, yeast, E. coli, fungi, plant cells, and animal cells depending on the purpose of expression to prepare a transformant. For example, the host cell may be E. coli (E. coli BL21 (DE3), DH5a, etc.), yeast cells (Saccharomyces genus, Pichia genus, etc.), or the like. At this time, appropriate culturing methods and medium conditions, etc. may be easily selected by those skilled in the art from known techniques in the art depending on a type of host cell.
[0073] As a method for introducing the recombinant expression vector for the preparation of the transformant of the present invention, known techniques, that is, a heat shock method, an electric shock method, and the like may be used.
[0074] In a specific example of the present invention, the transformant was prepared by transforming, into E. coli, the recombinant expression vector comprising the gene encoding the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention by using E. coli as a host cell.
[0075] Since the protein expressed from the transformant is a protein of a novel sequence having the activity of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids, the transformant is mass-cultured to express the gene, thereby facilitating the mass-production of the enzyme for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids.
[0076] 3. Method for Producing Mono- or Di-Hydroxy Derivatives of Polyunsaturated Fatty Acids In Vitro
[0077] Yet another aspect of the present invention provides a method for producing mono- or di-hydroxy derivatives of polyunsaturated fatty acids in vitro.
[0078] The method for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids in vitro of the present invention includes reacting polyunsaturated fatty acids with the enzyme for producing the mono- or di-hydroxy derivatives described in the item of 1. Enzyme for Producing Mono- or Di-hydroxy Derivatives of Polyunsaturated Fatty Acids. The polyunsaturated fatty acids are fatty acids containing three or more double bonds between carbons, specifically omega-3 fatty acids, more specifically docosahexaenoic acid or eicosapentaenoic acid, but are not limited thereto. As described above, when the polyunsaturated fatty acids are used as a substrate of the enzyme for producing the mono- or di-hydroxy derivatives, the substrate includes multiple double bonds into which hydroxyl groups may be introduced to achieve the production of the mono- or di-hydroxy derivatives.
[0079] The method for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids in vitro of the present invention further includes recovering mono- or di-hydroxy derivatives from a reaction product of the enzyme and the polyunsaturated fatty acids.
[0080] The recovering may be achieved by performing a method commonly performed in the art, such as centrifugation and filtration, and may be achieved by additionally performing a purification process in a general manner. For example, the purification process may be performed alone or in combination with techniques, such as solvent precipitation, dialysis, gel filtration, ion exchange, and chromatography such as reverse phase column chromatography.
[0081] The reacting of the polyunsaturated fatty acids with the enzyme for producing the mono- or di-hydroxy derivatives may be performed in a temperature range of 10 C. to 40 C., preferably in a temperature range of 15 C. to 35 C., but is not limited thereto. In addition, the reacting may be performed in a range of pH 4 to pH 10, preferably in a range of pH 7 to pH 9, but is not limited thereto. When the reacting is performed in the range of the temperature and pH, the activity of the enzyme for producing the mono- or di-hydroxy derivatives is maximized to more effectively produce the mono- or di-hydroxy derivatives.
[0082] 4. Method for Producing Mono- or Di-Hydroxy Derivatives of Polyunsaturated Fatty Acids In Vivo
[0083] Another aspect of the present invention provides a method for producing mono- or di-hydroxy derivatives of polyunsaturated fatty acids in vivo.
[0084] The method for producing the mono- or di-hydroxy derivatives of polyunsaturated fatty acids in vivo of the present invention includes culturing the transformant described in the item of 2. Expression Vector and Transformant of Enzyme for Producing Mono- or Di-Hydroxy Derivatives of Polyunsaturated Fatty Acids in the presence of polyunsaturated fatty acids and isolating mono- or di-hydroxy derivatives of polyunsaturated fatty acids from the cultured culture.
[0085] In the transformant introduced with the recombinant expression vector containing the gene encoding the enzyme for producing the mono- or di-hydroxy derivatives, the enzyme for producing the mono- or di-hydroxy derivatives may be expressed. With respect to the enzyme for producing the mono- or di-hydroxy derivatives present in the transformant, a detailed description thereof will be omitted by citing the description of the item of 1. Enzyme for Producing Mono- or Di-Hydroxy Derivatives of Polyunsaturated Fatty Acids.
[0086] In the transformant, the enzyme for producing the mono- or di-hydroxy derivatives is expressed. As a result, by using the same, the transformant is cultured in a culture medium containing polyunsaturated fatty acids as a substrate to produce the mono- or di-hydroxy derivatives without a separate process of isolating the enzyme.
[0087] The culturing of the transformant may be performed according to an appropriate medium and culturing conditions known in the art. Those skilled in the art may easily adjust and use the medium and culturing conditions according to a type of transformant to be selected. The culturing method may include a batch type, a continuous type, a fed-batch type, or a combination thereof.
[0088] The medium may contain various carbon sources, nitrogen sources, and trace element ingredients.
[0089] The carbon sources may include, for example, carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose, fats such as soybean oil, sunflower oil, castor oil, and coconut oil, fatty acids such as palmitic acid, stearic acid, and linoleic acid, alcohols such as glycerol and ethanol, organic acids such as acetic acid, or combinations thereof. The culturing may be performed using glucose as the carbon source. The nitrogen sources may include organic nitrogen sources such as peptone, yeast extract, broth, malt extract, corn steep liquor (CSL), and soybean milk, inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, or combinations thereof. As a supply source of phosphorus, the medium may contain, for example, potassium dihydrogen phosphate, dipotassium hydrogen phosphate and sodium-containing salts corresponding thereto, and metal salts such as magnesium sulfate or iron sulfate.
[0090] In addition, amino acids, vitamins, suitable precursors, and the like may be included in the medium. The medium or individual ingredients may be added to the culture medium in a batch or continuous type.
[0091] In addition, during the culturing, production of bubbles may be inhibited by using an anti-foaming agent such as fatty acid polyglycol ester.
[0092] Composition for Improving Skin Condition or Preventing or Treating Skin Disease
[0093] On the other hand, yet another aspect of the present invention provides a composition for improving skin conditions or preventing or treating skin diseases.
[0094] In a specific embodiment, the present invention provides a composition for improving skin condition containing 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX as active ingredients.
[0095] The 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX are lipoxygenase (LOX) metabolite derived from an omega-3 fatty acid, that is, docosahexaenoic acid (DHA), and is a specialized proresolving mediator (SPM).
[0096] The 17-hydroxydocosahexaenoic acid (17-HDHA) is () 17-hydroxy (dihydroxy)-4Z, 7Z, 10Z, 13Z, 15E, 19Z-docosahexaenoic acid (docosahexaenoic acid), and is represented by the structure of Formula 1 below.
##STR00001##
[0097] The Resolvin D5 (RvD5) is 7S, 17S-dihydroxy-4Z, 8E, 10Z, 13Z, 15E, 19Z-docosahexaenoic acid (docosahexaenoic acid), and is represented by the structure of Formula 2 below.
##STR00002##
[0098] The Protectin DX (PDX) is 10S, 17S-dihydroxy-4Z,7Z,11E,13Z,15E,19Z-docosahexaenoic acid and is an isomer of Protectin Dl, and is represented by the structure of Formula 3 below.
##STR00003##
[0099] The 17-HDHA, Resolvin D5, and Protectin DX may be biosynthesized by treating the enzyme of SEQ ID NO: 1 or 2 of the present invention to docosahexaenoic acid, chemically synthesized, or commercially purchased, but are not limited thereto.
[0100] In a specific example of the present invention, as a result of treating human dermal fibroblasts with a complex composition containing 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX, it was identified that the expression of inflammatory factors increased by UV irradiation was suppressed and procollagen synthesis was increased. In particular, it was identified that the complex composition of the present invention synergistically induced the collagen synthesis effect and the inflammation inhibitory effect compared to the single compound. Furthermore, in human application experiments, it was identified that the complex composition of the present invention relieved xeroderma and itching caused by atopic dermatitis by restoring the damaged skin barrier and reducing transdermal moisture loss.
[0101] Accordingly, the composition of the present invention may be for improving skin condition.
[0102] As used herein, the term skin condition may be skin aging due to ultraviolet rays, spots, freckles, skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, weak rash or acne.
[0103] The skin aging shows symptoms such as reduction in elasticity of the skin, reduction in shine, generation of wrinkles, decreased regeneration, or severe drying, and includes both intrinsic and extrinsic aging caused by the passage of time or external environments. In particular, the skin aging may be photoaging, and the photoaging refers to skin damage that occurs when the skin is repeatedly or long-term exposed to ultraviolet rays.
[0104] In addition, the wrinkle means a wrinkle occurring in all body parts comprising the face, and includes both static rhytides and dynamic rhytides.
[0105] As used herein, the term improving skin condition is a concept that includes all of prevention or alleviation of skin wrinkles, prevention or alleviation of skin aging, prevention or alleviation of skin inflammation, proliferation and regeneration of skin cells, contraction or reduction of pores, improvement of skin barrier function, alleviation of skin irritation, antioxidant, and collagen synthesis enhancement.
[0106] As used herein, the meaning of containing as an active ingredient is containing an effective amount to the extent that may exhibit a skin improvement effect, for example, wrinkle alleviation, inflammation alleviation, skin regeneration, atopic dermatitis alleviation, or skin barrier strengthening and improvement.
[0107] According to one embodiment of the present invention, the composition may promote collagen synthesis in cells or inhibit collagen decomposition by inhibiting the expression or activity of matrix metalloproteinase (MMP). The composition may, for example, inhibit the decomposition of the extracellular matrix by inhibiting the expression or activity of MMP-1 that decomposes type 1 collagen.
[0108] According to one embodiment of the present invention, the composition may have antioxidant activity. The composition may inhibit the formation of lipid peroxide. According to another embodiment of the present invention, the composition may inhibit an inflammatory factor. The composition may inhibit NO, TNF-, and IL-6, which are inflammation initiators.
[0109] The TNF- (tumor necrosis factor-a) and IL-6 (Interleukin-6) are representative inflammation-inducing cytokines. TNF- is a pro-inflammatory cytokine produced by lymphocytes activated by lipopolysaccharide (LPS), an endotoxin in the cell membrane of Gram-negative bacteria, and IL-6 is secreted by macrophages and T cells to stimulate the immune response to promote inflammation.
[0110] The complex composition containing 17-HDHA, Resolvin D5, and Protectin DX of the present invention may implement excellent anti-inflammatory action by suppressing the expression of inflammatory cytokines TNF- and IL-6, and has an excellent antioxidant effect of inhibiting the production of lipid peroxides due to oxidative stress occurring in the skin, thereby improving skin resistance ability to external stimuli.
[0111] According to yet another embodiment of the present invention, the composition may be to strengthen the skin barrier.
[0112] The stratum corneum, which is the outermost layer of the epidermis of the skin barrier, is mainly composed of non-nucleated flat corneocytes. The multi-lamellar lipid membrane formed of intercellular lipids such as ceramide, cholesterol, and fatty acids synthesized by keratinocytes of the skin barrier maintained through the division and differentiation process of normal epidermal cells acts as a protective barrier to prevent the moisture in the skin from evaporating. Among these intercellular lipids, omega hydroxy ceramide is chemically covalently linked with involucrin, a protein of the outer layer of corneocytes, to form a corneocyte lipid envelope (CLE), so as to play a role in physically stabilizing intercellular lipids in the form of a multi-layered lipid membrane, thereby strengthening the barrier function.
[0113] The composition of the present invention is delivered to the stratum corneum through skin application and promotes the differentiation of keratinocytes, thereby producing an effect of increasing the thickness of the epidermal layer. Moreover, the composition has an excellent effect of restoring damage to the skin barrier, and thus may be usefully used for the treatment and prevention of skin diseases caused by damage to the skin barrier. Skin diseases caused by damage to the skin barrier include, but are not limited to, atopic dermatitis, xeroderma, psoriasis, ichthyosis, acne, and the like.
[0114] In addition, the skin barrier strengthening effect was identified by increasing the expression of filaggrin and loricrin. Filaggrin is one of several structural proteins expressed by keratinocytes in the differentiation stage and is involved in differentiation from the basal layer of the epidermis to the stratum corneum. It is used as a major indicator of skin moisture retention and skin membrane function as it also forms the main agent of natural moisture factor (NMF) essential for maintaining moisture in the skin tissue. The complex composition containing 17-HDHA, Resolvin D5, and Protectin DX according to the present invention has excellent skin barrier protection, strengthening, and improvement functions as the gene expression of filaggrin or loricrin is significantly increased.
[0115] The complex composition containing 17-HDHA, Resolvin D5, and Protectin DX of the present invention may implement a remarkably improved IL-6 expression inhibitory effect and procollagen synthesis effect, particularly in comparison with using each of these compounds at the same concentration due to the complex synergistic action of 17-HDHA, Resolvin D5, and Protectin DX, which are contained as active ingredients (
[0116] In one embodiment of the present invention, the complex contains the 17-HDHA, Resolvin D5, and Protectin DX in a weight ratio of 3 to 85:10 to 60:5 to 50, for example, in a weight ratio of 3:10:5, in a weight ratio of 5:60:50, and in a weight ratio of 85:10:5, but is not limited thereto. In one example of the present invention, the skin improvement effect was identified using a complex composition containing 17-HDHA, Resolvin D5, and Protectin DX in weight ratios of 3:47:50, 25:56:19, and 84:10:6.
[0117] On the other hand, the composition for improving skin condition may be used as a cosmetic composition, a pharmaceutical composition, or a food composition.
[0118] Accordingly, in one aspect, the present invention provides a cosmetic composition for improving skin condition containing 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX as active ingredients.
[0119] The complex composition containing the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX, and the content related to skin condition improvement are the same as described above.
[0120] When the complex composition of the present invention is used as a cosmetic composition, components commonly used in cosmetic compositions are included in addition to the 17-HDHA, Resolvin D5, and Protectin DX, for example, a sulfating agent, a stabilizer, a solubilizer, a vitamin, customary adjuvants such as pigments and fragrances, and carriers.
[0121] The cosmetic composition of the present invention may be prepared as any formulation commonly prepared in the art. The cosmetic composition may be formulated as, for example, a solution, a suspension (anhydrous and aqueous), an anhydrous product (oils and glycols), an emulsion, a paste, a gel, a mask, a pack, a powder, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powdered foundation, an emulsion foundation, a wax foundation, a spray or the like, but is not limited thereto. More specifically, the cosmetic composition may be prepared as a formulation such as a softening toner (skin), a nutrient toner (milk lotion), a nutrient cream, a massage cream, essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder. In this connection, the accessibility of the cosmetic composition may be further improved, and the chronic recurrence of atopic dermatitis may be prevented by implementing a moisturizing effect.
[0122] When the formulation of the cosmetic composition is a paste, a cream or a gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or the like may be used as the carrier ingredient.
[0123] When the formulation of the cosmetic composition is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powders may be used as the carrier ingredient, and in particular, when the formulation is a spray, a propellent such as chlorofluorohydrocarbon, propane/butane or dimethyl ether may be contained.
[0124] When the formulation of the cosmetic composition is a solution or an emulsion, a solvent, a solubilizing agent or an emulsifier may be used as the carrier ingredient, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan fatty acid esters.
[0125] When the formulation of the cosmetic composition is a suspension, a liquid diluent such as water, ethanol and propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth or the like may be used as the carrier ingredient.
[0126] When the formulation of the cosmetic composition is a surfactant-containing cleanser, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulphosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetain, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oils, a lanolin derivative or ethoxylated glycerol fatty acid ester or the like may be used as the carrier ingredient.
[0127] When the cosmetic composition is in the form of a soap, it may be prepared by comprising a skin moisturizer, an emulsifier, a water softener, etc. as an additive. As a base material of the soap, vegetable oils such as coconut oil, palm oil, soybean oil, olive oil, palm kernel oil, jojoba, etc., or animal fats such as beef tallow, pork lard, brisket, fish oil, etc. may be used. As a moisturizer, glycerin, detipritol, propylene glycol, butylene glycol, hexyl glycol, isopropyl myristate, aloe vera, sorbitol, etc. may be used. As an emulsifier, natural oil, wax, hydrocarbons, etc. may be used, and as a water softener, tetrasodium EDTA, etc. may be used, but is not limited thereto.
[0128] The soap may further include an antibacterial agent, a foam inhibitor, a solvent, a corrosion inhibitor, a fragrance, a colorant, a sequestering agent, a preservative, and the like as additives.
[0129] When the composition of the present invention is used as a cosmetic composition, the 17-HDHA, Resolvin D5, and Protectin DX in the composition may be contained in a concentration of 30 M or more, specifically 35 M or more, more specifically 40 M or more. However, this varies depending on the form in which the cosmetic composition is prepared and its specific application site (face or hand) or application dose, and thus is not limited thereto.
[0130] Yet another aspect of the present invention provides a pharmaceutical composition for preventing or treating a skin disease, wherein the pharmaceutical composition contains 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX as active ingredients.
[0131] The skin disease may be a skin wound, skin scar, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, athlete's foot, erythema, urticaria, psoriasis, weak rash, acne or hair loss.
[0132] The complex composition containing the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX, and the content related to skin diseases are the same as described above.
[0133] When the composition is used as a pharmaceutical composition, the composition may further include a pharmaceutically acceptable carrier or additive, in addition to the 17-HDHA, Resolvin D5, and Protectin DX.
[0134] The pharmaceutically acceptable means that an object to be applied (prescribed) does not have toxicity beyond adaptable without inhibiting the activity of an active ingredient. The carrier is defined as a compound that facilitates the addition of the compound into cells or tissues.
[0135] The 17-HDHA, Resolvin D5, and Protectin DX of the present invention may be administered alone or in combination with any convenient carrier, etc., and such a dose formulation may be a single-dose or repeat-dose formulation. The pharmaceutical composition may be a solid formulation or a liquid formulation. The solid formulation includes powders, granules, tablets, capsules, and suppositories, but is not limited thereto. The solid formulation may include a carrier, a flavoring agent, a binder, a preservative, a disintegrant, a lubricant, a filler, and the like, but is not limited thereto. The liquid formulation includes solutions such as water and propylene glycol solutions, suspensions, and emulsions, but is not limited thereto, and may be prepared by adding suitable coloring agents, flavoring agents, stabilizers, viscosifying agents, etc. For example, the powders may be prepared by simply mixing a suitable pharmaceutically acceptable carrier such as lactose, starch, microcrystalline cellulose, etc. with the 17-HDHA, Resolvin D5, and Protectin DX, which are the active ingredients of the present invention. The granules may be prepared by mixing the 17-HDHA, Resolvin D5, and Protectin DX of the present invention, a suitable pharmaceutically acceptable carrier, and a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone, and hydroxypropyl cellulose, and then using a wet granulation method using a solvent such as water, ethanol, and isopropanol or a dry granulation method using compressive force. In addition, the tablets may be prepared by mixing the granules with a suitable pharmaceutically acceptable lubricant such as magnesium stearate, and then tableting the mixture using a tablet machine.
[0136] The 17-HDHA, Resolvin D5, and Protectin DX of the present invention may be administered with an oral agent, injections (e.g., intramuscular injection, intraperitoneal injection, intravenous injection, infusion, subcutaneous injection, and implant), an inhalation agent, a nasal administering agent, a vaginal agent, a rectal administering agent, a sublingual agent, a transdermal agent, a topical agent, or the like depending on a disease to be treated and a condition of a subject, but is not limited thereto. The derivatives may be formulated in a suitable dosage unit formulation comprising a pharmaceutically acceptable carrier, an additive, and a vehicle, which are conventionally used according to a route of administration and non-toxic.
[0137] The pharmaceutical composition of the present invention may be administered at a daily dose of about 0.0001 mg/kg to about 10 g/kg, and about 0.001 mg/kg to about 1 g/kg. However, the dose may vary depending on a degree of purification of the mixture, a patient's condition (age, gender, weight, etc.), and the severity of the condition being treated. If necessary, for convenience, the total daily dose may be divided and administered several times during a day.
[0138] When the composition of the present invention is used as a pharmaceutical composition, the 17-HDHA, Resolvin D5, and Protectin DX in the composition may be contained in a concentration of 30 4M or more, specifically 35 4M or more, more specifically 40 4M or more.
[0139] Yet another aspect of the present invention provides a food composition for improving skin condition, wherein the food composition contains 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX as active ingredients.
[0140] The complex composition containing the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX, and the content related to skin condition improvement are the same as described above.
[0141] When the composition is used as a food composition, the composition may contain acceptable food supplement additives, and may further include suitable carriers, excipients, and diluents commonly used in the preparation of food.
[0142] In the present invention, the food refers to a natural product or processed product containing one or more nutrients, and specifically, refers to a state that may be eaten directly through a certain processing process, and as a general meaning, is used as a meaning comprising all of various foods, functional foods, beverages, food additives, and beverage additives. Examples of the food include various foods, beverages, gum, tea, vitamin complexes, functional foods, and the like. In addition, the food of the present invention includes special nutritional foods (e.g., formulas, infant foods, etc.), processed meat products, fish meat products, tofu, muk, noodles (e.g., ramen, noodles, etc.), health supplement foods, seasoning foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery (e.g., snacks), dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, salted foods (various kimchi, pickles, etc.), beverages (e.g., fruit, vegetable beverages, soy milk, fermented beverages, ice cream, etc.), natural seasonings (e.g., ramen soup, etc.), vitamin complexes, alcoholic beverages, liquors, and other health supplements, but is not limited thereto. The functional foods, beverages, food additives or beverage additives may be prepared by general preparation methods.
[0143] The term functional food refers to food that is designed and processed to sufficiently express a body regulation function on the body with respect to biological defense rhythm control, disease prevention and recovery, etc. of a food group or food composition that has an added value to act and express the function of the corresponding food for a specific purpose by using physical, biochemical, and biotechnological methods, etc., and specifically, may be a health functional food.
[0144] The term health functional food used in the present invention refers to food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills by using raw materials or ingredients having functionalities useful to the human body. Here, the function refers to adjusting nutrients to the structure and function of the human body or to obtaining effects useful for health applications such as physiological action. The health functional food of the present invention may be prepared by methods which are commonly used in the art and may be prepared by adding raw materials and ingredients which are commonly added in the art in preparation. In addition, the formulation of the health functional food may also be prepared without limitation as long as the formulation is recognized as a health functional food. The food composition of the present invention may be prepared in various types of formulations, and unlike general drugs, the food composition has an advantage that there is no side effect that may occur when taking the drug in a long term by using the food as a raw material, and has excellent portability, but the health functional food of the present invention may be taken as supplements for enhancing a skin improvement effect.
[0145] In addition, the functional food may include sitologically acceptable food supplement additives, and may further include suitable carriers, excipients, and diluents commonly used in the preparation of functional foods.
[0146] In addition, in the food composition, the 17-HDHA, Resolvin D5, and Protectin DX in the composition may be contained in a concentration of 30 M or more, specifically 35 M or more, more specifically 40 M or more.
[0147] The food composition of the present invention may contain sweetening agents, flavoring agents, physiologically active ingredients, minerals, etc., in addition to the active ingredients. The sweetening agent may be used in an amount to give a suitable sweet taste of the food, and may be natural or synthetic. Specifically, when a natural sweetening agent is used, examples of the natural sweetening agent may include sugar sweetening agents such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose. The flavoring agent may be used to improve taste or flavor, and both natural and synthetic flavoring agents may be used. Specifically, the natural flavoring agents are used. In the case of using the natural flavoring agents, the purpose of nutrient enhancement may be combined in addition to flavoring. The natural flavoring agents may be obtained from apples, lemons, tangerines, grapes, strawberries, peaches, and the like, or obtained from green tea leaves, solomon's seal, bamboo leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, flavoring agents obtained from ginseng (red ginseng), bamboo shoots, aloe vera, and ginkgo may be used. The natural flavoring agents may be liquid concentrates or solid extracts. In some cases, the synthetic flavoring agents may be used, and the synthetic flavoring agents may use esters, alcohols, aldehydes, terpenes, and the like. As the physiologically active ingredients, catechins such as catechin, epicatechin, gallocatechin, and epigallocatechin, and vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine, and riboflavin may be used. As the minerals, calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium, zinc, and the like may be used.
[0148] In addition, the food composition of the present invention may contain a preservative, an emulsifier, an acidulant, a thickener, and the like, if necessary, in addition to the sweetening agent, and the like. These preservatives, emulsifiers, and the like are preferably added and used in a very trace amount as long as the application to be added may be achieved. The trace amount means a range of about 0.0005 wt % to about 0.5 wt % based on the total weight of the food composition when expressed numerically. Preservatives that may be used may include sodium calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, ethylenediaminetetraacetic acid (EDTA), and the like. Examples of the emulsifier that may be used may include acacia gum, carboxymethylcellulose, xanthan gum, pectin, and the like. Examples of the acidulant that may be used may include citric acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, etc. These acidulants may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the proliferation of microorganisms in addition to the purpose of enhancing taste. As the thickening agent that may be used, a suspending agent, a settling agent, a gel-forming agent, a swelling agent, and the like may be included.
[0149] Hereinafter, the present invention will be described in detail by Examples.
[0150] However, the following Examples are specifically illustrative of the present invention, and the contents of the present invention are not limited to the following Examples.
Example 1
[0151] Preparation of Protein Comprising Amino Acid Sequence Represented by SEQ ID NO: 1 or 2
[0152] [1-1] Preparation of Vector for Expressing Protein
[0153] A nucleotide sequence represented by SEQ ID NOs: 3 and 4 encoding each of amino acids of SEQ ID NOs: 1 and 2 were synthesized by requesting Bioneer Co., Ltd. Pre-denaturation was performed at 94 C. for 5 minutes using primer pairs of SEQ ID NOs: 5 to 8 using the respective synthesized nucleotide sequence as a template, and then PCR was performed by repeating cycles 20 times of reacting at 94 C. for 30 seconds, at 61 C. for 30 seconds, and at 72 C. for 2 minutes to amplify each gene of SEQ ID NOs: 3 and 4.
TABLE-US-00001 TABLE1 SEQ ID Proteins Primernucleotidesequences(5>3) NOs Amino Forward CATATGATGTTTGGCATCTTCGACAAG 5 acidof G SEQID Revere CTCGAGTTAGATAGAGATACTGTTCGG 6 NO:1 GATCCCC Amino Forward CATATGATGACAGGTGGGATGTTTGGA 7 acidof C SEQID Revere CTCGAGTTAGATGGAAATACTGTTGGG 8 NO:2 AATTCCTTTG
[0154] PCR products containing the nucleotide sequence represented by SEQ ID NOs: 3 and 4 amplified as described above were inserted into a plasmid vector pET28a(+) (Novagen, USA), respectively, to prepare a recombinant expression vector. It was identified that the nucleotide sequence represented by SEQ ID NOs: 3 and 4 were properly inserted through nucleotide sequencing analysis (Solgent).
[0155] [1-2] Expression and Purification of Protein
[0156] The recombinant expression vector prepared in Example [1-1] was transformed into E. coli BL21 (DE3), and the respective transformant was inoculated into 3 ml of an LB medium, and seed-cultured at 37 C. until the absorbance at 600 nm became 2.0. Then, a main culturing was performed by adding the seed-incubated culture medium to 500 ml of the LB medium. When the absorbance at 600 nm became 0.6, IPTG (isopropyl-1-thio--D-galactopyranoside) was added to a final concentration of 1 mM to induce the overexpression of the protein having the amino acid sequence represented by SEQ ID NO: 1 and the protein having the amino acid sequence represented by SEQ ID NO: 2. In the process of inducing overexpression as described above, the culture temperature was maintained at 37 C. before adding IPTG, and the culture temperature was lowered to 20 C. after adding IPTG.
[0157] A supernatant was isolated by centrifuging the culture medium of the transformant in which the overexpression was induced, and cells of the transformant were lyzed from a pellet in which the supernatant was isolated to obtain a cell lysate of the transformant.
[0158] As a result of performing SDS-PAGE on 100 l of the cell lysate obtained as described above, as illustrated in
[0159] With respect to the cell lysate identified that the protein having the amino acid sequence represented by SEQ ID NO: 1 and the protein having the amino acid sequence represented by SEQ ID NO: 2 as described above were overexpressed, the protein having the amino acid sequence represented by SEQ ID NO: 1 and the protein having the amino acid sequence represented by SEQ ID NO: 2 were isolated and purified using Ni-NTA adsorption chromatography.
Example 2
[0160] Identification of Protein ActivityIdentification of Production Activity of Mono- or Di-Hydroxy Derivatives
[0161] With respect to the protein having the amino acid sequence represented by SEQ ID NO: 1 and the protein having the amino acid sequence represented by SEQ ID NO: 2, purified and isolated in Example [1-2], each of 6 KU or 10 KU of the protein and 100 M of docosahexaenoic acid (DHA) was reacted at pH 7 and room temperature for 30 minutes, a reaction product was reduced by adding 1 M of sodium borohydride so that the final concentration became 50 mM, and then the reaction was terminated by adding 5 l/ml of acetic acid.
[0162] After the reaction product was purified using a solid phase cartridge (SPE, C18 500 mg), the types of compounds in the reaction product were analyzed using normal phase HPLC.
[0163] Specifically, the normal phase HPLC analysis was performed by developing 20 ml of a mobile phase consisting of 95% n-heptane, 5% isopropanol, 0.1% acetic acid, and 0.1% 2,2-dimethoxypropane on a supelcosil LC-Diol column (Supelco, 25 cm3 mm, 5 m) at a flow rate of 0.5 ml/min for 40 minutes, and finally detecting the compounds in the reaction product using a diode array detector (DAD).
[0164] As a result, as illustrated in
TABLE-US-00002 TABLE 2 Contents Enzymes Secondary structures (ratios) Derivatives produced by 17S-monohydroxy-DHA 1.03 mg a protein having the (25.06%) amino acid sequence 7S,17S-di-hydroxy-DHA 2.43 mg represented by SEQ ID (Resolvin D5) (59.04%) NO: 1 10S,17S-dihydroxy-DHA 0.66 mg (Protectin DX) (15.98%) Derivatives produced by 17S-monohydroxy-DHA 0.53 mg a protein having the (20.98%) amino acid sequence 7S,17S-di-hydroxy-DHA 1.79 mg represented by SEQ ID (Resolvin D5) (71.45%) NO: 2 10S,17S-dihydroxy-DHA 0.19 mg (Protectin DX) (7.44%)
Example 3
[0165] Amino Acid Sequence Analysis of Protein
[0166] With respect to the protein having the amino acid sequence represented by SEQ ID NO: 1 and the protein having the amino acid sequence represented by SEQ ID NO: 2, as compared to human 5LOX (AAA36183), human 12LOX (AAA51533), human 15LOX (AAA36183), soybean 15LOX (AAA33986), potato LOX (AAB81595), and red algae PhLOX2 (AGN54275), homology analysis and system analysis of amino acid sequences were performed.
[0167] As a result, as illustrated in
[0168] In addition, as may be understood from
[0169] In addition, as a result of analyzing a secondary structure of the protein having the amino acid sequence represented by SEQ ID NO: 1 and the protein having the amino acid sequence represented by SEQ ID NO: 2, it was identified that -helixes, extended strands, and random coils existed at ratios shown in Table 3 below, respectively.
TABLE-US-00003 TABLE 3 Secondary Enzymes structures Ratios Protein having the amino acid -helixes 33.14% sequence represented by SEQ ID extended 26.33% NO: 1 strands random 40.53% coils Protein having the amino acid -helixes 31.83% sequence represented by SEQ ID extended 29.17% NO: 2 strands random 39.00% coils
Example 4
[0170] Identification of Effect of Reaction Product Produced by Enzyme Activity of Protein of Present InventionInhibition of Skin Aging and Wrinkle Alleviation
[0171] As in Example 2 above, the product obtained by reacting docosahexaenoic acid with the protein having the amino acid sequence represented by SEQ ID NO: 1 of the present invention (SPM 1) and the product obtained by reacting docosahexaenoic acid with the protein having the amino acid sequence represented by SEQ ID NO: 2 (SPM 2) was treated with human dermal fibroblasts to identify cytotoxicity, MMP-1 expression and procollagen synthesis effects, and was treated with human keratinocytes to identify changes in cytotoxicity, TNF- expression and IL-6 expression.
[0172] [4-1] Identification of Cytotoxicity
[0173] Cell viability was identified by treating human dermal fibroblasts and human keratinocytes with the SPM 1 and SPM 2 at concentrations of 0.001, 0.01, 0,1, and 1 ppm, respectively.
[0174] As a result, as illustrated in
[0175] [4-2] Identification of TNF- and IL-6 Expression Inhibitory Activity Improvement Effect
[0176] Human keratinocytes were aliquoted in a 48-well plate at a concentration of 410.sup.4 cells/well and cultured for 24 hours at 5% CO.sub.2 and 37 C., then the medium was removed and starvation state was maintained with DMEM Serum Free media for 24 hours.
[0177] The SPM 1 and SPM 2 were diluted with DMEM (2% FBS) to make 1 ppm, and then diluted sequentially to 0.1, 0.01 and 0.001 ppm, and then cultured as above and treated with human keratinocytes from which the medium was removed for 1 hour. Then, for TNF- or IL-6 expression, the medium was exchanged with 250 l of DPBS (WelGENE), irradiated with 160 mJ/cm.sup.2 of UVB, and then treated with the SPM 1 and SPM 2 again and cultured for 24 hours. In addition, after collecting the medium, the amount of TNF- was measured using Human TNF- DuoSet ELISA (R&D system), and the amount of IL-6 was measured using Human IL-6 DuoSet ELISA (R&D system), respectively. The cells adhering to the bottom were washed with DPBS, dissolved with 1N NaOH, and the amount of protein was measured through BCA analysis to measure the amount of TNF- or IL-6 synthesized per a given protein. In this connection, the effect of the two reaction products SPM 1 and SPM 2 was identified by using a case in which nothing was treated as a negative control group and a case in which 10 ppm of dexamethasone was treated as a positive control group.
[0178] First, in the case of TNF-, as illustrated in
[0179] Next, in the case of IL-6, as illustrated in
[0180] From the above results, it may be understood that all products produced from DHA by the protein of the present invention have an effect of terminating inflammation.
[0181] [4-3] Identification of Procollagen Synthesis Ability Improvement Effect
[0182] Collagen, a major component of the extracellular matrix, is synthesized in the form of a precursor called procollagen. The procollagen is known to be cut and isolated from collagen molecules when a polymerization reaction occurs. By measuring the amount of procollagen, the degree of collagen biosynthesis in the cells may be estimated.
[0183] Human dermal fibroblasts were treated with SPM 1 and SPM 2 at concentrations of 0.01, 0,1 and 1 ppm, respectively, and cultured for 24 hours, and then the cultured cell medium was collected and procollagen typel c-peptide (PIP) EIA kit (TAKARA, MK101) was used to measure the amount of procollagen. In this connection, the effect of the two reaction products SPM 1 and SPM 2 was identified by using a case in which nothing was treated as a negative control group and a case in which 26.2 ppm of retinyl palmitate was treated as a positive control group.
[0184] As a result, as illustrated in
[0185] [4-4] Identification of Collagenase (MMP-1) Expression Inhibitory Ability Improvement Effect
[0186] MMPs (matrix metalloproteinases) are enzymes with proteolytic activity, and by decomposing proteins constituting the extracellular matrix, they have an important effect on the binding of cells and proteins constituting the extracellular matrix. There are 28 types of MMPs, of which MMP-1 is an enzyme that decomposes collagen. In this example, the expression level of MMP-1 in cells was identified.
[0187] After culturing human dermal fibroblasts for 24 hours, the medium was exchanged with DPBS (WelGENE) at a concentration of 250 l/well, and irradiated with 100 mJ/cm.sup.2 of UVB. Then, the SPM 1 and SPM 2 were treated with DMEM (2% FBS) diluted to a concentration of 0.01, 0,1 and 1 ppm, respectively, and cultured for 48 hours. After collecting the cultured cell medium, the amount of MMP-1 was measured using a human total MMP-1 ELISA kit (R&D systems, DY901). At this connection, the effect of the two reaction products SPM 1 and SPM 2 was identified by using a case in which nothing was treated as a negative control group and a case in which 6 ppm of retinoic acid was treated as a positive control group.
[0188] As a result, as illustrated in
Example 5
[0189] Production of SPMs Complex Compositions and Preparation of Single Compounds
[0190] [5-1] Complex Composition of 17-HDHA, Resolvin D5 and Protectin DX (Hereinafter, Referred to as SPMs Complex Composition)
[0191] Lipoxygenase having the amino acid sequence represented by SEQ ID NO: 1 was added to various concentrations of docosahexaenoic acid (DHA) and reacted at pH 7 and room temperature for 30 minutes. The reaction product was reduced by adding 1 M of sodium borohydride so that the final concentration became 50 mM, and then the reaction was terminated by adding 5 l/ml of acetic acid. After the reaction product was purified using a solid phase cartridge (SPE, C18 500 mg), types of compounds in the reaction product were analyzed using normal phase HPLC.
[0192] As a result, it was identified that 17S-HDHA, Resolvin D5 (7S, 17S-diHDHA), and Protectin DX (10S, 17S-diHDHA) were produced from DHA. Therefrom, Complexes 1 to 3, which are SPMs complex compositions present in a mixed state in a ratio as described in Table 4 below, respectively, were produced.
TABLE-US-00004 TABLE 4 Complex 1 Complex 2 Complex 3 17S-HDHA 3 25 84 Resolvin 47 56 10 D5 Protectin 50 19 6 DX
[0193] [5-2] Isolation and Purification of 17-HDHA, Resolvin D5 and Protectin DX
[0194] 17S-HDHA, Resolvin D5 (7S, 17S-diHDHA), and Protectin DX (10S, 17S-diHDHA) were used by isolating and purifying each product from the SPMs complex composition of Example [5-1] above through prep HPLC equipped with a C18 column or a Diol column.
Example 6
[0195] Identification of Synergistic IL-6 Expression Inhibition Effect by SPMs Complex Composition
[0196] In order to identify the synergistic anti-inflammation relieving effect of the SPMs complex composition, the complex compositions (Complexes 1 to 3) of 17-HDHA, Resolvin D5, and Protectin DX and each SPM single material were treated with HaCaT cells, which are human keratinocytes to identify changes in IL-6 expression.
[0197] [6-1] Experimental Method
[0198] Specifically, first, human keratinocytes were aliquoted in a 48-well plate at a concentration of 410.sup.4 cells/well and cultured at 5% CO2, 37 C. for 24 hours, and then the medium was removed and the starvation state was maintained with DMEM Serum Free media for 24 hours.
[0199] The SPMs complex composition was diluted with DMEM (FBS 2%) to make 0.5, 1, 2, and 5 g/ml, and then cultured as above and treated with human keratinocytes from which the medium was removed for 1 hour. Then, for IL-6 expression, the medium was exchanged with 250 l of DPBS (WelGENE), irradiated with 160 mJ/cm.sup.2 of UVB, and then treated with SPMs again and cultured for 24 hours. In addition, after collecting the medium, the amount of IL-6 was measured using Human IL-6 DuoSet ELISA (R&D system). The cells adhering to the bottom were washed with DPBS, dissolved with 1N NaOH, and the amount of protein was measured through BCA analysis to measure the amount of IL-6 synthesized per a given protein. In this connection, the IL-6 expression inhibitory effect of the SPMs complex composition of the present invention and each single component was identified by using a case in which nothing was treated as Con() and a case in which 10 M of hydrocortisone was treated as Con(+) after UVB irradiation.
[0200] [6-2] Identification of IL-6 Inhibitory Effect of SPM Single Component
[0201] As a result, as shown in Table 5 and
[0202] Therefrom, it may be understood that 17-HDHA, Protectin DX, and Resolvin D5 all have inflammation relieving efficacy.
TABLE-US-00005 TABLE 5 IL-6 expression Concentrations (% of control) Samples UVB (g/ml) Average Untreated 23.64 control Con() + 100 Con(+) H.C. + 10 M 31.23 17S-HDHA + 0.1 89.63 + 1 83 + 2 89.17 + 5 81.66 PDX + 0.1 95.36 + 1 102.69 + 2 88.13 + 5 86.72 RvD5 + 0.1 99.58 + 1 109.86 + 2 99.49 + 5 83.38
[0203] [6-3] Identification of IL-6 Inhibitory Effect of SPMs Complex Composition
[0204] In addition, as shown in Table 3 and
[0205] Therefrom, it may be understood that the SPMs complex compositions of the present invention all have excellent inflammation relieving efficacy.
TABLE-US-00006 TABLE 6 IL-6 expression Concentrations (% of control) Samples UVB (g/ml) Average Untreated 15.62 control Con() + 100 Con(+) H.C. + 10 M 42.82 Composition 1 + 0.1 74.66 (17S-HDHA:RvD5:PDX = + 1 72.49 3:47:50) + 2 72.98 + 5 64.93 Composition 2 + 0.1 71.28 (17S-HDHA:RvD5:PDX = + 1 64.98 25:56:19) + 2 66.18 + 5 62.03 Composition 3 + 0.1 80.61 (17S-HDHA:RvD5:PDX = + 1 78.63 84:10:6) + 2 70.52 + 5 68.19
[0206] [6-4] Identification of Synergistic IL-6 Inhibitory Effect of SPMs Complex Composition
[0207] As shown in Table 7 and
TABLE-US-00007 TABLE 7 UVB 20 mJ/cm.sup.2 Con 17S- Compo- Compo- Compo- () HDHA PDX RvD5 sition 1 sition 2 sition 3 100 89.17 88.13 99.49 72.98 66.18 70.52
[0208] Therefrom, it may be understood that the SPMs complex composition of the present invention has a significantly increased inflammatory relieving effect compared to a single component. In addition, the above results mean that due to the synergistic effect of 17S-HDHA, PDX and RvD5, the amount used may be reduced when using them as a complex composition rather than when using them alone. Therefrom, it may be understood that the potential side effects that may occur when SPM is used in excess may be prevented.
Example 7
[0209] Identification of Synergistic Procollagen Synthesis Effect by SPMs Complex Composition
[0210] Collagen, a major component of the extracellular matrix, is synthesized in the form of a precursor called procollagen. The procollagen is known to be cut and isolated from collagen molecules when a polymerization reaction occurs. By measuring the amount of procollagen, the degree of collagen biosynthesis in the cells may be estimated.
[0211] [7-1] Experimental Method
[0212] Human dermal fibroblasts were treated with the SPM single material and its complex compositions (compositions 1 to 3) at concentrations of 0.1, 1, 2, and 5 g/ml, respectively, and cultured for 24 hours, and then the cultured cell medium was collected and procollagen typel -peptide (PIP) EIA kit (TAKARA, MK101) was used to measure the amount of procollagen. In this connection, the effect of the SPM single component and its complex compositions (compositions 1 to 3) was identified by using a case in which nothing was treated as an untreated control group and a case in which 50 M of retinyl palmitate was treated as Con(+).
[0213] [7-2] Identification of Procollagen Synthesis Effect of SPM Single Component
[0214] As shown in Table 8 and
[0215] Therefrom, it may be understood that 17-HDHA, Protectin DX, and Resolvin D5 all improve the synthesis ability of procollagen.
TABLE-US-00008 TABLE 8 Procollagen synthesis Concentrations (% of control) Samples (g/ml) Average Untreated 100 control Con(+) R.P. 50 M 249.88 17S-HDHA 0.01 212.76 0.1 237.76 1 235.8 2 255.32 PDX 0.01 237.15 0.1 244.1 1 251.41 2 254.1 RvD5 0.01 245.68 0.1 248 1 249.34 2 255.32
[0216] [7-3] Identification of Procollagen Synthesis Effect of SPMs Complex Composition
[0217] In addition, in the case of the SPMs complex compositions, as shown in Table 9 and
[0218] Therefrom, it may be understood that all of the SPMs complex compositions of the present invention significantly improve the procollagen synthesis ability.
TABLE-US-00009 TABLE 9 Procollagen synthesis Concentrations (% of control) Samples (g/ml) Average Untreated 100 control Con(+) R.P. 50 M 240.2 Composition 1 0.01 218.2 (17S-HDHA:RvD5:PDX = 0.1 259.3 3:47:50) 1 289.5 2 302.7 Composition 2 0.01 225.6 (17S-HDHA:RvD5:PDX = 0.1 265.2 25:56:19) 1 302 2 307.1 Composition 3 0.01 220.7 (17S-HDHA:RvD5:PDX = 0.1 267.3 84:10:6) 1 301.1 2 304.4
[0219] [7-4] Identification of Synergistic Procollagen Synthesis Effect of SPMs Complex Composition
[0220] As shown in Table 10 and
TABLE-US-00010 TABLE 10 Untreated 17S- Compo- Compo- Compo- control HDHA PDX RvD5 sition 1 sition 2 sition 3 100 255.32 254.1 255.32 302.7 307.1 304.4
[0221] Therefrom, it may be understood that the SPMs complex composition of the present invention has a significantly increased procollagen synthesis ability compared to a single component. In addition, the above results mean that due to the synergistic effect of 17S-HDHA, PDX and RvD5, the amount used may be reduced when using them as a complex composition rather than when using them alone. Therefrom, it may be understood that the potential side effects that may occur when SPM is used in excess may be prevented.
Example 8
[0222] Identification of Collagenase (MMP-1) Expression Inhibitory Ability Improvement Effect by SPMs Complex Composition
[0223] MMPs (matrix metalloproteinases) are enzymes with proteolytic activity, and by decomposing proteins constituting the extracellular matrix, they have an important effect on the binding of cells and proteins constituting the extracellular matrix. There are 28 types of MMPs, of which MMP-1 is an enzyme that decomposes collagen. In this example, the expression level of MMP-1 in cells was identified.
[0224] Specifically, after culturing human dermal fibroblasts for 24 hours, the medium was exchanged with DPBS (WelGENE) at a concentration of 250 l/well, and irradiated with 100 mJ/cm.sup.2 of UVB. Then, the composition 2 was treated with DMEM (2% FBS) diluted to a concentration of 0.1, 1, 2, and 5 ppm, respectively, and cultured for 48 hours. After collecting the cultured cell medium, the amount of MMP-1 was measured using a human total MMP-1 ELISA kit (R&D systems, DY901). At this connection, the effect of composition 2 was identified by using a case in which nothing was treated as a negative control group and a case in which 20 M of retinoic acid was treated as a positive control group.
[0225] As a result, as illustrated in
[0226] Therefrom, it may be understood that the SPMs complex composition of the present invention is excellent in the effect of alleviating skin wrinkles.
Example 9
[0227] Identification of TNF- Expression Inhibitory Ability Improvement Effect by SPMs Complex Composition
[0228] As a representative inflammatory cytokine, TNF- is known to exacerbate inflammatory skin diseases when its expression amount is increased. TNF-, a tumor necrosis factor, is an important factor that plays the most central role in many inflammatory responses, and regulation of TNF- expression plays an important role in inflammatory diseases. Accordingly, in order to identify the inflammation relieving effect of the SPMs complex composition of the present invention, the expression pattern of TNF- was identified.
[0229] Specifically, human keratinocytes were aliquoted in a 48-well plate at a concentration of 410.sup.4 cells/well and cultured for 24 hours at 5% CO.sub.2 and 37 C., then the medium was removed and starvation state was maintained with DMEM Serum Free media for 24 hours.
[0230] The composition 2 was diluted with DMEM (2% FBS) to make 0.5, 1, 2, and 5 g/ml, and then cultured as above and treated with human keratinocytes from which the medium was removed for 1 hour. Then, for TNF- expression, the medium was exchanged with 250 l of DPBS (WelGENE), irradiated with 160 mJ/cm.sup.2 of UVB, and then treated with the SPMs again and cultured for 24 hours. In addition, after collecting the medium, the amount of TNF- was measured using Human TNF- DuoSet ELISA (R&D system), respectively. The cells adhering to the bottom were washed with DPBS, dissolved with 1N NaOH, and the amount of protein was measured through BCA analysis to measure the amount of TNF- synthesized per a given protein. In this connection, the effect of the SPMs complex composition was identified by using a case in which nothing was treated as a negative control group and a case in which 10 M of hydrocortisone was treated as a positive control group.
[0231] As a result, in the case of TNF-, as illustrated in
[0232] Therefrom, it may be understood that the SPMs complex composition of the present invention is excellent in an effect of terminating inflammation.
Example 10
[0233] Identification of Improvement Effect in NO Production Reduction Ability by SPMs Complex Composition
[0234] Nitric oxide (NO), a type of reactive oxygen species that is known to play an important role in inducing inflammation, is a highly reactive biogenic molecule. NO, a key molecule involved in the inflammatory response, is an inflammatory mediator and accelerates the inflammatory response, further exacerbating the inflammatory response. Accordingly, the amount of NO production was identified with respect to the stimulus induced by fine dust.
[0235] Specifically, the amount of NO generated from the cells was measured using the Griess Reagent System to measure the nitrite concentration present in the cell culture medium, and the NO concentration in the culture medium was determined using a standard curve for each concentration of sodium nitrite.
[0236] As a result, as illustrated in
[0237] Therefrom, it may be understood that the SPMs complex composition of the present invention has an effect of alleviating inflammation.
Example 11
[0238] Identification of Improvement Effect in Reduction Ability of Lipid Peroxide Production by SPMs Complex Composition
[0239] Lipid peroxidation of cells is one of the mechanisms of cellular damage occurring in aging or disease states in animals and plants, and the degree of cellular damage may be identified by measuring total malondialdehyde (MDA), a product of lipid peroxidation. Accordingly, the MDA production by the SPMs complex composition was identified for the stimulus induced by fine dust.
[0240] Specifically, the amount of total malondialdehyde (MDA), a product of lipid peroxidation, was reacted with thiobarbituric acid (TBA), and the MDA-TBA adduct was measured by the TBARS method.
[0241] As a result, as illustrated in
[0242] Therefrom, it may be understood that the SPMs complex composition of the present invention has an effect of inhibiting skin aging.
Example 12
[0243] Identification of Improvement Effect of Skin Barrier Improvement Ability by SPMs Complex Composition
[0244] Filaggrin, loricrin, and involucrin are known as core proteins constituting the skin barrier. Among them, filaggrin is a protein produced by decomposition of profilagrin, which constitutes keratohyalin granule (KG) present in granule cells of the epidermis, and plays an important role in the skin barrier by aggregating keratin filaments in keratinocytes. Accordingly, it was attempted to identify the skin barrier strengthening effect by identifying he expression of filaggrin and loricrin by the sample.
[0245] Human keratinocytes were cultured in DMEM medium under the same conditions as in Example 9. In order to identify the gene expression related to skin barrier improvement ability, the cultured cells were treated with the SPMs complex composition of the present invention by concentration and cultured, and then RNA was extracted and RT-PCR was performed. The amplified gene was analyzed using the Gel documentation system and Image J program.
[0246] As a result, as illustrated in
[0247] Therefrom, it may be understood that the SPMs complex composition of the present invention has the effect of strengthening the skin barrier.
Example 13
[0248] Human Efficacy Evaluation Using SPMs Cream
[0249] A cream (Cream S) was produced with the composition shown in Table 11 below using the SPMs complex composition. For the comparative experiment, ceramide cream (Cream C) and base cream (Cream B) were also produced with the following composition.
TABLE-US-00011 TABLE 11 Cream S Cream C Cream B SPMs complex 2.00 composition Ceramide AC45 1.00 Glycerin 5.00 5.00 5.00 1,2-hexanediol 2.00 2.00 2.00 Oil Appropriate Appropriate Appropriate amount amount amount Preservative Appropriate Appropriate Appropriate amount amount amount Purified water Appropriate Appropriate Appropriate amount amount amount (Unit: parts by weight)
[0250] [13-1] Identification of Skin Barrier Improvement Efficacy by SPMs Cream
[0251] The human efficacy evaluation for skin barrier improvement was conducted on 12 women (mean age 45 years5.54). The forearm was used as the test site, and the physical damage was divided into 3 sites of the test site and the control site (no application) and applied to 4 sites. Then, Cream S (SPM cream), Cream C (Ceramide cream), and Cream B (Base cream) were to be used twice a day for 1 week on each designed site, and the device measurement was performed compared to the control site (no application). Measurements and efficacy questionnaire evaluation were conducted before skin damage, immediately after skin damage, 1 day, 4 days, and 7 days after using the test product. The skin barrier improvement effect was identified by measuring TEWL (Transepidermal Water Loss) using Tewameter TM300.
[0252] As a result, as illustrated in
[0253] [13-2] Identification of Atopic Dermatitis Improvement Efficacy by SPMs Cream
[0254] A human efficacy evaluation was conducted for relieving itching caused by dryness in 22 test subjects. After measuring the skin moisture, 11 people were randomly assigned to each of the test products Cream S and Cream C by matching the mean values between the groups to make them use each product. The forearm and dryness lesion sites were used as test sites, and device measurement and efficacy questionnaire evaluation were conducted before product use, 2 weeks after product use, and 4 weeks after product use.
[0255] The improvement effect of atopic dermatitis was identified by measuring skin moisture using Comeometer CM825, measuring skin moisture loss using Tewameter TM300, and evaluating improvement in itchiness (VAS).
[0256] Identification of Skin Moisturizing Effect
[0257] As illustrated in
[0258] Identification of Skin Barrier Improvement Effect at Lesion Site
[0259] As illustrated in
[0260] Identification of Itching Alleviation Effect
[0261] As illustrated in
[0262] Therefrom, it may be understood that the SPM cream of the present invention exhibits the effects of moisturizing the skin, improving the skin barrier, and alleviating itching at an equivalent level or higher than ceramide, which is commonly used as a functional material for alleviating skin pruritus and itching and preventing moisture loss caused by xeroderma such as atopic dermatitis, and for improving skin barrier.
[0263] [13-3] Identification of Effect of Alleviating Eye Wrinkles and Improving Skin Moisture by SPMs Cream
[0264] The human efficacy evaluation was conducted for 20 selected test subjects for alleviation of eye wrinkles and improvement of skin moisture of Cream A and Cream S. The eye area was used as the test site, and 10 test subjects were instructed to use Cream A and the remaining 10 subjects were instructed to use Cream S twice a day for 8 weeks, respectively. Before using the test product, after 4 weeks of use, and after 8 weeks of use, the effect of alleviating wrinkles and improving skin moisture was identified through device measurement on the test subjects.
[0265] Specifically, Antera 3D CS was used to measure eye wrinkles, and a Comeometer was used to measure skin moisture.
[0266] Identification of Effect of Alleviating Eye Wrinkles
[0267] As illustrated in
[0268] Identification of Eye Moisturizing Effect
[0269] As illustrated in
[0270] Therefrom, it may be understood that the SPM cream of the present invention exhibits an effect of increasing the amount of moisture in the skin around the eyes and alleviating the skin wrinkles around the eyes at an equivalent level or higher than retinol, which is a noticed raw material for wrinkle alleviation.
[0271] As described above, while preferred examples of the present invention have been illustratively described, the scope of the present invention is not limited only to the specific examples described above, and the present invention will be able to be appropriately modified by those skilled in the art within the appended claims of the present invention.