STRAIN WITH IMPROVED AROMATIC AMINO ACID PRODUCTION CAPACITY BY GLSB GENE INACTIVATION

Abstract

Provided is a mutant strain having improved aromatic amino acid production capability as a result of inactivation or weakening of activity of glutaminase which is expressed by glutaminase B (glsB) gene.

Claims

1. A mutant strain having improved aromatic amino acid production capability due to inactivation or weakening of activity of glutaminase which is expressed by glutaminase B (glsB) gene.

2. The mutant strain of claim 1, wherein the glsB gene consists of the nucleotide sequence of SEQ ID NO: 1.

3. The mutant strain of claim 1, wherein the aromatic amino acid is at least one of L-tryptophan and L-phenylalanine.

4. The mutant strain of claim 1, wherein the inactivation or weakening of activity of glutaminase is achieved by insertion, substitution or deletion of one or more nucleotides in the nucleotide sequence of the glsB gene.

5. The mutant strain of claim 1, which is derived from a strain of the genus Escherichia.

6. The mutant strain of claim 5, wherein the strain of the genus Escherichia is Escherichia coli.

7. A method for producing an aromatic amino acid, comprising steps of: culturing the mutant strain of claim 1 in a medium; and recovering an aromatic amino acid from the cultured mutant strain and the medium.

8. The method of claim 7, wherein the aromatic amino acid is at least one of L-tryptophan and L-phenylalanine.

Description

MODE FOR INVENTION

[0026] Hereinafter, one or more specific embodiments will be described in more detail with reference to examples.

[0027] However, these examples are for illustrating one or more embodiments, and the scope of the present invention is not limited to these examples.

Example 1: Construction of glsB Gene-Deleted Mutant Strains

[0028] glsB gene-inactivated mutant strains were constructed from parent strains (accession numbers: KFCC11660P and KCCM10016) by a one-step inactivation method (One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko K A, Wanner B L., Proc Natl Acad Sci USA. 2000 Jun. 6; 97(12):6640-5).

[0029] The KFCC11660P strain and the KCCM10016 strain are Escherichia coli strains. For homologous recombination of the fourth fragment, pKD46 (GenBank accession number: AY048746), a Red recombinase plasmid, was introduced into each of the strains, and pKD46 was removed before introduction of pCP20.

[0030] The glsB gene was deleted by homologous recombination between the glsB gene and a DNA fragment containing an antibiotic resistance gene, and then the glsB gene was inactivated by removing the antibiotic resistance gene from the recombined DNA fragment. The specific process is as follows.

[0031] (1) Construction of First Fragment

[0032] PCR reaction (total volume: 50 μl) was performed using a pKD13 plasmid (Genbank accession number: AY048744) and a primer pair of glsB PF and glsB PR having a portion of the glsB gene sequence shown in Table 1 below and a portion of the pKD13 plasmid sequence under the following conditions, thus obtaining a first amplified fragment of about 1.4 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 2 min at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. The first fragment contained the kanamycin resistance gene derived from the pKD13 plasmid.

TABLE-US-00001 TABLE 1 SEQD NO Sequence glsB 1 gtggcagtcgccatggataatgcaattttagaaaacatcttgcggcaagtgcggccgctcattggtcagg gtaaagtcgcggattatattccggcgctggctacagtagacggttcccgattggggattgctatctgtacc gttgacggacagctttttcaggccggagacgcgcaagaacgtttttccattcagtctatttccaaagtgctg agtctcgttgtcgccatgcgtcattactccgaagaggaaatctggcaacgcgtcggcaaagatccgtctg gatcaccgttcaattccttagtgcaactggaaatggagcagggtataccgcgtaatccgttcattaatgccg gtgcgctggtggtctgcgatatgttgcaagggcgattaagcgcaccacggcaacgtatgctggaagtcgt gcgcggcttaagcggtgtgtctgatatttcctacgatacggtggtagcgcgttccgaatttgaacattccgc gcgaaatgcggctatcgcctggctgatgaagtcgtttggcaatttccatcatgacgtgacaaccgttctgc aaaactactttcattactgcgctctgaaaatgagctgtgtagagctggcccggacgtttgtctttctggctaat caggggaaagctattcatattgatgaaccagtggtgacgccaatgcaggcgcggcaaattaacgcgctg atggcgaccagtggtatgtaccagaacgcgggggagtttgcctggcgggtggggctaccggcgaaatc tggcgttggtggcggtattgtggcgattgttccgcatgaaatggccatcgctgtctggagtccggaactgg atgatgcaggtaactcgcttgcgggtattgccgttcttgaacaattgacgaaacagttagggcgttcggttt attaa glsB_HF1 2 gatagtgagt tcggcctttc glsB_HR1 3 tttctactcc tggaccgcag glsB_PF 4 ctgcggtcca ggagtagaaa gtgtaggctg gagctgcttc glsB_PR 5 agtggatcga gagactgcat ctgtcaaaca tgagaattaa glsB_HF2 6 atgcagtctc tcgatccact glsB_HR2 7 accgccacga tataacgttg glsB_CF 8 atcaggtgga gaaaaccctg glsB_CR 9 tgaaccagtc cgcaagcaaa

[0033] (2) Construction of Second Fragment

[0034] To obtain an upstream fragment of the glsB gene, PCR reaction (total volume: 50 μl) was performed using the genomic DNA of E. coli MG1655 as a template and the primers glsBHF1 and glsBHR1 shown in Table 1 above under the following conditions, thus obtaining a second amplified fragment of about 0.3 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 30 sec at 72° C., followed by 5 min at 72° C. and 10 min at 12° C.

[0035] (3) Construction of Third Fragment

[0036] To obtain a downstream fragment of the glsB gene, PCR reaction (total volume: 50 μl) was performed using the genomic DNA of E. coli MG1655 as a template and the primers glsBHF2 and glsBHR2 shown in Table 1 above under the following conditions, thus obtaining a third amplified fragment of about 0.3 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 30 sec at 72° C., followed by min at 72° C. and 10 min at 12° C.

[0037] (4) Construction of Fourth Fragment

[0038] The first fragment, second fragment and third fragment amplified in the above experiment could be ligated into a single fragment due to the complementary sequences of the primers during amplification. These fragments were subjected to PCR (total volume: 50 μl) without primers under the following conditions, thus obtaining a fourth amplified single fragment having a size of about 2 kb: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 2 min and 30 sec at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. The fourth fragment contained a portion of the glsB gene and the kanamycin antibiotic resistance gene. Specifically, it consisted of a portion of the 5′ fragment of the glsB gene, the kanamycin antibiotic resistance gene, and a portion of the 3′ fragment of the glsB gene.

[0039] (5) Introduction of Fourth Fragment and Deletion of glsB

[0040] The obtained fourth fragment was introduced by electroporation into each of the KFCC11660P and KCCM10016 strains, which are Escherichia coli strains containing the Red recombinase plasmid pKD46 (GenBank accession number: AY048746). The fourth fragment was replaced with glsB by homologous recombination using the Lambda Red recombination system, whereby glsB was deleted.

[0041] Thereafter, PCR reaction was performed on the cell line showing kanamycin resistance to confirm whether the glsB gene was deleted. The PCR reaction (total volume: 20 μl) was performed using the glsB CF and glsB CR primers shown in Table 1 above under the following conditions: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 55° C., and 3 min at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. It was confirmed that, when the original glsB gene was present, about 1.9 kb (before deletion) was produced, whereas when the fragment was inserted into the chromosome, about 2.3 kb (containing the antibiotic resistance gene) which is an increased length was produced.

[0042] (6) Antibiotic Resistance Gene Removal and Selection

[0043] To remove the antibiotic resistance marker gene from the strain in which deletion of the glsB gene was confirmed, FLP recombination was induced by introducing a pCP20 plasmid into the strain. Thereafter, the glsB-deleted strain was cultured in LB plate medium with or without antibiotics to confirm that the antibiotic resistance marker gene was removed.

Example 2: Evaluation of Aromatic Amino Acid Production of glsB-Deleted Strains

[0044] Each of the E. coli strain KFCC11660PΔglsB obtained by the method of Example 1 and KFCC11660P was cultured in the tryptophan-producing medium shown in Table 3 below.

[0045] In addition, each of the E. coli strain KCCM10016ΔglsB obtained by the method of Example 1 and KCCM10016 was cultured in the phenylalanine-producing medium shown in Table 2 below.

[0046] For culture, 1 vol % of each of the KFCC11660PΔglsB, KFCC11660P, KCCM10016ΔglsB, and KCCM10016 strains was inoculated into a flask containing 10 mL of the tryptophan-producing medium or phenylalanine-producing medium having the composition shown in Table 2 below, and cultured with shaking at 200 rpm at 37° C. for 70 hours. Then, the concentrations of L-amino acids obtained from the strains were compared.

TABLE-US-00002 TABLE 2 Tryptophan-producing Phenylalanine-producing medium medium Component Content Component Content Glucose 80.0 g/L Glucose 80.0 g/L (NH.sub.4).sub.2SO.sub.4 20.0 g/L (NH.sub.4).sub.2SO.sub.4 20.0 g/L K.sub.2HPO.sub.4 0.8 g/L K.sub.2HPO.sub.4 1.0 g/L K.sub.2SO.sub.4 0.4 g/L KH.sub.2PO.sub.4 1.0 g/L MgCl.sub.2 0.8 g/L K.sub.2SO.sub.4 0.4 g/L Fumaric acid 1.0 g/L MgCl.sub.2 1.0 g/L Yeast extract 1.0 g/L Fumaric acid 0.5 g/L (NH.sub.4).sub.6Mo.sub.7O.sub.24 0.12 ppm Yeast extract 1.0 g/L H.sub.3BO.sub.3 0.01 ppm Glutamic acid 0.5 g/L CuSO.sub.4 0.01 ppm CaCl.sub.2 5.00 ppm MnCl.sub.2 2.00 ppm MnCl.sub.2 2.00 ppm ZnSO.sub.4 0.01 ppm ZnSO.sub.4 1.00 ppm CoCl.sub.2 0.10 ppm CoCl.sub.2 0.10 ppm FeCl.sub.2 10.00 ppm FeCl.sub.2 10.00 ppm Thiamine_HCl 20.00 ppm Thiamine_HCl 20.00 ppm L-Tyrosine 200.00 ppm L-Tyrosine 200.00 ppm L-phenylalanine 300.00 ppm CaCO.sub.3 3% CaCO.sub.3 3% — —

[0047] As a result of the above experiment, as shown in Tables 3 and 4 below, it was confirmed that, in the case of the strains in which the glsB gene was inactivated, the production of tryptophan and phenylalanine increased and the production of glutamate significantly decreased.

[0048] Referring to Tables 3 and 4 below, it was confirmed that, when the glsB gene in the KFCC11660P strain was inactivated, the production of L-tryptophan increased by about 10%, and when the glsB gene in the KCCM10016 strain was inactivated, the production of L-phenylalanine increased by about 10%.

TABLE-US-00003 TABLE 3 L-tryptophan L-glutamate Strain (g/L) (relative amount) KFCC11660P 4.21 76.39 KFCC11660PΔglsB 4.62 13.65

TABLE-US-00004 TABLE 4 L-phenylalanine L-glutamate Strain (g/L) (relative amount) KCCM10016 3.47 20.17 KCCM10016ΔglsB 3.81 8.56