METHOD FOR INCREASING YIELD OF 7-DEHYDROCHOLESTEROL IN YEAST BY USING COMPARTMENTALIZATION
20240002897 ยท 2024-01-04
Inventors
- Xueqin Lv (Wuxi, CN)
- Long Liu (Wuxi, CN)
- Jian Chen (Wuxi, CN)
- Guocheng Du (Wuxi, CN)
- Jianghua Li (Wuxi, CN)
- Yanfeng Liu (Wuxi, CN)
- Xiang XIU (Wuxi, CN)
Cpc classification
International classification
Abstract
The invention provides a method for increasing the yield of 7-dehydrocholesterol in yeast by using compartmentalization. The method includes steps of: by taking yeast as a starting strain, expressing heterologous sterol delta 24-reductase and cholestenol delta-isomerase, wherein the yield of 7-DHC in Saccharomyces cerevisiae S288C is detected to be 10.15 mg/L. According to the method of the invention, partial enzymes in a 7-DHC synthesis path are positioned in compartments in Saccharomyces cerevisiae by using a peroxisome and a mitochondrial positioning tag, and a relatively independent 7-DHC synthesis path is formed. Meanwhile, the storage space of precursor substances needed by 7-DHC synthesis is increased, the feedback effect is reduced, the conversion efficiency between enzymes is improved in the same compartment, the loss of the acting substrate is reduced, and finally the yield of the 7-DHC is improved by 4 times and reaches 53.31 mg/L.
Claims
1. A method for increasing the yield of 7-dehydrocholesterol in yeast by using compartmentalization, comprising steps of: expressing heterologous sterol delta 24-reductase and cholestenol delta-isomerase in peroxisomes and mitochondria of a yeast host respectively, and using a peroxisome positioning tag and a mitochondrial positioning tag to localize the enzymes in the 7-dehydrocholesterol synthesis pathway for expression in peroxisomes and mitochondria, respectively.
2. The method according to claim 1, wherein an amino acid sequence of the sterol delta 24-reductase is as shown in SEQ ID NO: 1.
3. The method according to claim 1, wherein an amino acid sequence of the cholestenol delta-isomerase is as shown in SEQ ID NO: 2.
4. The method according to claim 1, wherein the enzymes in the 7-dehydrocholesterol synthesis pathway are hydroxymethylglutaryl-CoA synthase ERG13, mevalonate kinase ERG12, hydroxymethylglutaryl-CoA A reductase HMG1, phosphomevalonate kinase ERG8, mevalonate (diphospho) decarboxylase MVD1, isopentenyl diphosphate -isomerase IDI1, diphosphate farnesyltransferase ERGS, squalene mono oxygenase ERG1, lanosterol synthase ERG7, sterol 14-demethylase ERG11, delta 14-sterol reductase ERG24, methylsterol monooxygenase ERG25, sterol 4-carboxylate 3-dehydrogenase ERG26, 3-ketosteroid reductase ERG27, delta 7-sterol 5-desaturase ERG3, sterol delta 24-reductase DHCR24 and cholestenol delta-isomerase EBP.
5. The method according to claim 4, wherein the NCBI number of hydroxymethylglutaryl-CoA synthase ERG13 is XM_033912304.1, the NCBI number of mevalonate kinase ERG12 is XM_033912620.1, the NCBI number of hydroxymethylglutaryl-CoA A reductase HMG1 is XM_033912352.1, the NCBI number of phosphomevalonate kinase ERG8 is NM_001182727.1, the NCBI number of mevalonate (diphospho) decarboxylase MVD1 is NM_001183220.1, the NCBI number of isopentenyl diphosphate -isomerase IDI1 is NM_001183931.1, the NCBI number of diphosphate farnesyltransferase ERGS is NM_001179321.1, the NCBI number of squalene mono oxygenase ERG1 is NM_001181304.1, the NCBI number of lanosterol synthase ERG7 is NM_001179202.2, the NCBI number of sterol 14-demethylase ERG11 is NM_001179137.1, the NCBI number of delta 14-sterol reductase ERG24 is NM_001183118.1, the NCBI number of methylsterol monooxygenase ERG25 is NM_001181189.3, the NCBI number of sterol 4-carboxylate 3-hydrogenase ERG26 is NM_001180866.1, the NCBI number of 3-ketosteroid reductase ERG27 is NM_001181987.1, the NCBI number of delta 7-sterol ERG3 is NM_001181943.1, the NCBI number of sterol delta 24-reductase DHCR24 is NM_001031288.1, and the NCBI number of cholestenol delta-isomerase EBP is KR709569.1.
6. The method according to claim 1, wherein the peroxisome positioning tag is peroxisome positioning signal peptide PTS1, having a nucleotide sequence as shown in SEQ ID NO: 3.
7. The method according to claim 1, wherein the mitochondrial positioning tag is a mitochondrial positioning signal peptide MMF1, having a nucleotide sequence as shown in SEQ ID NO: 4.
8. The method according to claim 1, wherein the yeast host is Saccharomyces cerevisiae, Pichia pastoris or Candida tropicalis.
9. The method according to claim 8, wherein the yeast host is Saccharomyces cerevisiae S288C.
10. A yeast engineered bacterium, wherein the yeast engineered bacterium expresses heterologous sterol delta 24-reductase and cholestenol delta-isomerase in peroxisomes and mitochondria of a yeast host respectively, and uses a peroxisome positioning tag and a mitochondrial positioning tag to express the enzymes in the 7-dehydrocholesterol synthesis pathway in peroxisomes and mitochondria respectively.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0025] Involved detection methods were as follows.
[0026] 7-DHC in Saccharomyces cerevisiae was tested by high performance liquid chromatography. A Saccharomyces cerevisiae liquid fermented for 60 hours was centrifuged, and resuspended in 10 ml of sterile water, followed by addition of 0.5 mm glass beads, and homogenization using a high-speed homogenizer for 10 minutes. The homogenized mixture was taken out, 1 g of ascorbic acid and 0.5 g of HBT were added, and mixed uniformly. 20 ml of absolute ethanol and 10 ml of 1.5 mol/L potassium hydroxide methanol solution were added in sequence for saponification in water at 80 C. for 2 hours. After the saponification was complete, the extracts (isopropanol:n-hexane=1:3) were ultrasonically agitated for 30 minutes. After the impurities in the lower layer were removed using a separatory funnel, the extract mixture was freeze-dried, and then redissolved using methanol or acetonitrile or a mixture of methanol and acetonitrile, filtered at 0.55 m and analyzed by high performance liquid chromatography. The mobile phase was methanol and water, the detector was an ultraviolet detector, and the detection wavelength was 265 nm.
Example 1: Construction of Saccharomyces cerevisiae CDHC-2
[0027] (a) Artificially synthesized gene fragment P.sub.TEF1-DHCR24-T.sub.cyc1-P.sub.GAP-DIC-T.sub.ADH1 was amplified using Saccharomyces cerevisiae S228C genome as a template and primers 208F-F and 208F-R to obtain gene fragment 208-F, amplified using Saccharomyces cerevisiae S228C genome as a template and primers primer 208R-F and 208R-R to obtain gene fragment 208-R, and amplified using pMHyLp-trp plasmid as a template and primers LoxT-F and LoxT-R to obtain gene fragment LoxT.
[0028] (b) The four fragments P.sub.TEF1-DHCR24-T.sub.cyc1-P.sub.GAP-DIC-T.sub.ADH1, 208F-F, 208-R and LoxT obtained in step (a) were amplified by overlap extension PCR. After being verified to be correct by 1% agarose gel electrophoresis, the fragments were recovered by extraction to obtain a fusion gene fragment 208-F-LoxT-P.sub.TEF1-DHCR24-T.sub.cyc1-P.sub.GAP-DIC-T.sub.ADH1-208-R.
[0029] (c) The gene fragment obtained in step (b) was transformed into the competent strain of Saccharomyces cerevisiae S288C, coated on an SD Trp plate, cultured at for 3 days, and subjected to colony PCR verification using primers YZ-24-DIC-F and YZ-24-DIC-R to obtain strain CDHC-1.
[0030] (d) The strain CDHC-1 obtained in step (c) was made competent, and the plasmid PY26-Cre was transformed into Saccharomyces cerevisiae. After a single colony was grown on an SD Ura screening solid plate, the culture was inoculated into a YPD medium for 12 hours, and cultured on a YPD solid plate containing 5-FOA at for 3 days. Then the grown single colonies were transferred to a YPD solid plate and an SD Ura screening solid plate for comparison and verification. The single colony that grew normally on the YPD plate but cannot grow on the SD Ura screening plate was the correct genetically engineered bacterium, named CDHC-2.
[0031] Primer Sequence:
TABLE-US-00001 208F-F: ccaggttaatgtgttctctgaaattcgc 208F-R: gtaatcatggtcatagctgtttcctgttgtttagcggacgtgtgtatg gt 208R-F: cagcttttgttccctttagtgtttgacgatgtcagtgaatcccgg 208R-R: cttgtagtccaccattgccatttttca LoxT-F: ccatacacacgtccgctaaacaacaggaaacagctatgaccatgatta cg LoxT-R: acctttagtacgggtaattaacgataaaacgacggccagtgccaaggt cg YZ-24-DIC-F: atggatttcgccaatcaaacccat YZ-24-DIC-R: caatgaaacagctggttccattcgaaactaagttctggtgttttaaaa ctaa
Example 2: Construction of Saccharomyces cerevisiae Mitochondrial Compartmentalization
[0032] (a) The Saccharomyces cerevisiae S228C genome was used as a template, and the mitochondrial positioning signal peptide MMF1 was selected. The gene fragment was amplified using primers ERG12-F and ERG12-MMF1-R to obtain gene fragment ERG12-MMF1. The gene fragment was amplified using primers ERG13-F1 and ERG13-MMF1-R1 to obtain gene fragment ERG13-MMF1. The gene fragment was amplified using primers GAL-F1 and GAL-R1 to obtain GAL1 promoter and GAL10 promoter gene fragments GAL1-10. The gene fragment was amplified using primers LoxT-GAL-F and LoxT-GAL-R to obtain gene fragment Lox-Trp. The gene fragment was amplified using primers GAL80F1-F and GAL80F1-R to obtain gene fragment GAL80F1. The gene fragment was amplified using primers GAL80R1-F and GAL80R1-R to obtain GAL80R1. The gene fragment was amplified using primers CYC1-S-F and CYC1-S-R to obtain CYC1. The gene fragment was amplified using primers ADH1-S-F and ADH1-S-R to obtain ADH1. The gene fragment was amplified using primers MMF1-F, MMF1-R, MMF2-F, and MMF2-R to obtain gene fragment MMF1-1 and MMF2-2.
[0033] (b) The CDHC-2 strain obtained in Example 1 was transformed into yeast competent cells. The 10 gene fragments obtained in step (a) were transformed into CDHC-2. Primers YZS-12-13-F and YZS-12-13-R were used for colony PCR verification.
[0034] (c) The correct single colony verified by colony PCR in step (d) was inoculated into SD trp liquid medium and cultured for 16 hours, and then streaked on a YPD solid plate containing 5-FOA at 30 C. for 3 days. Then the grown single colonies were transferred to a YPD solid plate and an SD his screening solid plate for comparison and verification. The single colony that grew normally on the YPD plate but cannot grow on the SD his screening plate was the correct genetically engineered bacterium, named CDHC-3.
[0035] (d) HMG1, ERGS, MVD1, IDI1, ERG9, ERG1, ERG7, ERG11, ERG24, ERG25, ERG26, ERG27, ERG3, DHCR24, and EBP genes were immobilized in mitochondria according to the above steps, and finally the strain CDHC-10 was obtained.
[0036] Primer Sequence:
TABLE-US-00002 ERG12-F1: tcaaggagaaaaaactataatgtctcagaacgtttacattgtat ERG12-MMF1-R: aacggaatttcttaaaaacattatcttttcaatgacaatagaggaa ERG13-F1: tcttaaaaacatttttttaacatcgtaagatcttctaaat ERG13-MMF1-R: ttttgaaaattcaatataaatgaaactctcaactaaactttgttg GAL-F1: agttgagagtttcatttatattgaattttcaaaaattcttactttttt tttgg GAL-R1: taaacgttctgagacattatagttttttctccttgacgttaaagt LoxT-M-F: cttattgaccacacctctaccggcaggaaacagctatgaccatgatta cg LoxT-M-R: aatatcagagcatccataaaacgacggccagtgccaaggtcga GAL80F2-F: acaagttcgtacttttccaggataaatgc GAL80F2-R: ggctttaatttgcggccaccttgcattacaaattgtgagg CYC1-M-F: tgtaatgcaaggtggccgcaaattaaagccttcgagcgtc CYC1-M-R: atctctgagaaggccgaataatcatgtaattagttatgtcac ADH1-M-F: ctctgagaaggccgaagcgaatttcttatgatttatgatttttatt ADH1-M-R: tcatggtcatagctgtttcctgccggtagaggtgtggtcaataag GAL80R2-F: cactggccgtcgttttatggatgctctgatattacacaggttaat GAL80R2-R: accgggtgataggtttgctcaaccat YZM-10-13-F: ggaaaagctgcataaccactttaact YZM-10-13-R: ctgagaaagcaacctgacctacagg MMF1-F: tacatgattattcggccttctcagagatagaaccttgaac MMF1-R: atcttacgatgttaaaaaaatgtttttaagaaattccgtt MMF2-F: attgtcattgaaaagataatgtttttaagaaattccgttttgagaacag MMF2-R: aaatcataagaaattcgcttcggccttctcagagatagaa
Example 3: Construction of Saccharomyces cerevisiae Peroxisome Compartmentalization
[0037] (a) The Saccharomyces cerevisiae S228C genome was used as a template, and the peroxisome positioning signal peptide PTS1 was selected. The gene fragment was amplified using primers ERG12-F and ERG12-PTS1-R to obtain gene fragment ERG12-PTS1. The gene fragment was amplified using primers ERG13-F and ERG13-PTS1-R to obtain gene fragment ERG13-PTS1. The gene fragment was amplified using primers GAL-F and GAL-R to obtain GAL1 promoter and GAL10 promoter gene fragments GAL1-10. The gene fragment was amplified using primers LoxT-GAL-F and LoxT-GAL-R to obtain gene fragment Lox-Trp. The gene fragment was amplified using primers GAL80F3-F and GAL80F3-R to obtain gene fragment GAL80F3. The gene fragment was amplified using primers GAL80R3-F and GAL80R3-R to obtain GAL80R3. The gene fragment was amplified using primers CYC1-F and CYC1-13-R to obtain CYC1. The gene fragment was amplified using primers ADH1-10-F and ADH1-R to obtain ADH1.
[0038] (b) The CDHC-10 strain obtained in Example 2 was transformed into yeast competent cells. The 8 gene fragments obtained in step (a) were transformed into CDHC-6. Primers YZ-10-13-F and YZ-10-13-R were used for colony PCR verification.
[0039] (c) The correct single colony verified by colony PCR in step (d) was inoculated into SD trp liquid medium and cultured for 16 hours, and then streaked on a YPD solid plate containing 5-FOA at 30 C. for 3 days. Then the grown single colonies were transferred to a YPD solid plate and an SD his screening solid plate for comparison and verification. The single colony that grew normally on the YPD plate but cannot grow on the SD his screening plate was the correct genetically engineered bacterium, named CDHC-7.
[0040] (d) HMG1, ERGS, MVD1, IDI1, ERG9, ERG1, ERG7, ERG11, ERG24, ERG25, ERG26, ERG27, ERG3, DHCR24, and EBP genes were immobilized in mitochondria according to the above steps, and finally the strain CDHC-17 was obtained.
[0041] Primer Sequence:
TABLE-US-00003 ERG12-F: tcaaggagaaaaaactataatgtctcagaacgtttacattgtat ERG12-PTS1-R: ttgggaagaggtagaagatccaaattgtatcttttcaatgacaataga ggaagca ERG13-F: acaatttggatcttctacctcttcccaattttttaacatcgtaag ERG13-PTS1-R: ttttgaaaattcaatataaatgaaactctcaactaaactttgttg GAL-F: agttgagagtttcatttatattgaattttcaaaaattcttactttttt tttgg GAL-R: taaacgttctgagacattatagttttttctccttgacgttaaagt LoxT-pts-F: cttattgaccacacctctaccggcaggaaacagctatgaccatgatta cg LoxT-pts-R: gcattactcaattttagactaaaacgacggccagtgccaaggtcg GAL80F3-F: ccaatgctaatccggtcactgccactgc GAL80F3-R: aggctttaatttgcggcctggcaatagaagtctcaatttt CYC1-F: gagacttctattgccaggccgcaaattaaagccttcgagc CYC1-13-R: gtagaagatccaaattgtaatcatgtaattagttatgtcacgctt ADH1-10-F: aatttggatcttctacctcttcccaagcgaatttcttatgattta ADH1-R: tcatggtcatagctgtttcctgccggtagaggtgtggtcaataag GAL80R3-F: gccgtcgttttagtctaaaattgagtaatgccactgcttttccca GAL80R3-R: atgtattgtaaaatatcgattgtgt YZ-10-13-F: ggaaaagctgcataaccactttaact YZ-10-13-R: ctgagaaagcaacctgacctacagg
Example 4: Fermentation and Culture of Successfully Constructed Saccharomyces cerevisiae
[0042] A single colony of Saccharomyces cerevisiae CDHC-10 and a single colony of CDHC-17 were inoculated on a solid YPD plate in 2 ml of YPD medium. After culturing at 30 C. and 220 rpm for 16-20 hours, the colonies were inoculated at 1% of the inoculum size in a 250 mL round-bottomed shake flask containing 25 mL of YPD liquid culture, and cultured at 30 C. and 220 rpm for 60 hours. When fermented to 16 hours, ethanol was added to supplement the carbon source. After 108 hours of fermentation, the precipitate was collected by centrifugation, and the supernatant was removed. The precipitate was resuspended in 10 ml of sterile water, followed by addition of 0.5 mm glass beads, and homogenization using a high-speed homogenizer for 10 minutes. The homogenized mixture was taken out, 1 g of ascorbic acid and 0.5 g of HBT were added, and mixed uniformly. 20 ml of absolute ethanol and 10 ml of 1.5 mol/L potassium hydroxide methanol solution were added in sequence for saponification in water at 80 C. for 2 hours. After the saponification was complete, the extracts (isopropanol:n-hexane=1:3) were ultrasonically agitated for 30 minutes. After the impurities in the lower layer were removed using a separatory funnel, the extract mixture was freeze-dried, and then redissolved using methanol or acetonitrile or a mixture of methanol and acetonitrile, filtered at 0.55 m and analyzed by high performance liquid chromatography. The mobile phase was methanol and water, the detector was an ultraviolet detector, and the detection wavelength was 265 nm.
[0043] After liquid phase analysis, the 7-DHC yield of the successfully constructed mitochondrial compartmentalized strain CDHC-10 was 29.35 mg/L. The 7-DHC yield of the peroxisome compartmentalized strain CDHC-17 successfully constructed on the basis of CDHC-10 was 53.31 mg/L.
[0044] While preferred embodiments of the present invention have been described above, the present invention is not limited thereto. It should be appreciated that some improvements and variations can be made by those skilled in the art without departing from the technical principles of the present invention, which are also contemplated to be within the scope of the present invention.