CHICKEN ANEMIA VIRUS (CAV)-BASED VECTORS

Abstract

This invention relates generally to compositions for making C A Vectors and uses thereof.

Claims

1. A genetic element comprising: a promoter element; a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector), and a protein binding sequence that specifically binds a CAV capsid polypeptide (e.g., a CAV VP1 molecule), e.g., with an affinity/specificity of less than about 10 M (e.g., less than about 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 M, e.g., less than about 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nM).

2. A genetic element comprising: a promoter element; a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector), and a protein binding sequence; wherein the genetic element is capable of being packaged (e.g., specifically packaged) by a CAV VP1 molecule.

3. A genetic element comprising: a promoter element; a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector), and a protein binding sequence that specifically binds to a CAV capsid polypeptide; wherein the exogenous effector is: (a) codon optimized for expression in a human cell, (b) a human polypeptide or nucleic acid, (c) binds a human polypeptide or nucleic acid, or (d) has an activity in a human cell, e.g., modulates (e.g., increases or decreases) the activity and/or level of a human gene in the human cell).

4. A genetic element comprising: a promoter element; a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector), and a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-374 of SEQ ID NO: 1, and/or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 2195-2319 of SEQ ID NO: 100.

5. A genetic element comprising: a promoter element; a nucleic acid sequence encoding an exogenous effector (e.g., a therapeutic exogenous effector), and at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, or 3,000 nucleotides having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a contiguous portion of a e.

6. A genetic element comprising: a protein binding sequence that specifically binds a CAV capsid polypeptide e.g., with an affinity/specificity of less than about 10 M (e.g., less than about 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 M, e.g., less than about 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nM), wherein the genetic element does not comprise one or more of: (i) a full length CAV VP1 gene (e.g., wherein the genetic element comprises one or more fragments of the CAV VP1 gene, e.g., less than about 500, 400, 300, 200, or 100 nucleotides of CAV VP1 gene sequence); (ii) a full length CAV VP2 gene (e.g., wherein the genetic element comprises one or more fragments of the CAV VP2 gene, e.g., less than about 500, 400, 300, 200, or 100 nucleotides of CAV VP2 gene sequence); or (ii) a full length CAV Apoptin gene (e.g., wherein the genetic element comprises one or more fragments of the CAV Apoptin gene, e.g., less than about 500, 400, 300, 200, or 100 nucleotides of CAV Apoptin gene sequence).

7. A genetic element comprising: a protein binding sequence that specifically binds a CAV capsid polypeptide e.g., with an affinity/specificity of less than about 10 M (e.g., less than about 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 M, e.g., less than about 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nM), wherein the genetic element comprises one or more of: (i) a nonfunctional CAV VP1 gene or a fragment thereof (e.g., a contiguous fragment of at least 25, 50, 100, 200, 300, 400, 500 or more bp), e.g., comprising a stop codon within the sequence of the CAV VP1 coding sequence, e.g., at the 5 end of the CAV VP1 coding sequence; (ii) a nonfunctional CAV VP2 gene or a fragment thereof (e.g., a contiguous fragment of at least 25, 50, 100, 200, 300, 400, 500 or more bp), e.g., comprising a stop codon within the sequence of the CAV VP2 coding sequence, e.g., at the 5 end of the CAV VP2 coding sequence; or (ii) a nonfunctional CAV Apoptin gene or a fragment thereof (e.g., a contiguous fragment of at least 25, 50, 100, 200, 300, 400, 500 or more bp), e.g., comprising a stop codon within the sequence of the CAV Apoptin coding sequence, e.g., at the 5 end of the CAV Apoptin coding sequence.

8. A nucleic acid construct comprising the nucleic acid sequence of a genetic element of any of claims 1-7.

9. A nucleic acid construct (e.g., a plasmid) comprising one, two, or all three of: (a) a CAV VP1 gene, or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; (b) a CAV VP2 gene, or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and/or (c) a CAV Apoptin gene, or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; wherein the nucleic acid construct does not comprise a CAV packaging signal, and/or wherein the nucleic acid construct is incapable of being packaged by a CAV VP1 molecule.

10. A host cell (e.g., a vertebrate cell, e.g., (i) a mammalian cell, e.g., a human cell; or (ii) an avian cell, e.g., a chicken cell) comprising a genetic element of any of claims 1-7, or a nucleic acid construct of claim 8 or 9.

11. A CAVector comprising: a) a proteinaceous exterior comprising a CAV VP1 molecule; b) a genetic element comprising: (i) a promoter element, (ii) a nucleic acid sequence encoding an exogenous effector, and (iii) a protein binding sequence that specifically binds the CAV VP1 molecule.

12. A CAVector comprising: a) a genetic element of any of claims 1-7, and b) a proteinaceous exterior, e.g., a proteinaceous exterior comprising a CAV VP1 molecule.

13. A CAVector comprising: a) a genetic element of any of claims 1-7, and b) a capsid, e.g., a capsid comprising a CAV VP1 molecule.

14. A complex comprising: a CAV VP1 molecule bound to a genetic element, wherein the genetic element comprises: (i) a promoter element, (ii) a nucleic acid sequence encoding an exogenous effector, and (iii) a protein binding sequence.

15. A method of delivering an exogenous effector to a target cell (e.g., a vertebrate cell, e.g., a mammalian cell, e.g., a human cell), the method comprising introducing into the cell a CAVector of any of claims 11-13.

16. A method of delivering an exogenous effector to a target cell (e.g., a vertebrate cell, e.g., a mammalian cell, e.g., a human cell), the method comprising: (a) assessing the target cell, or a subject comprising the target cell, for the presence of an unwanted immune response to CAV, e.g., an anti-CAV antibody, e.g., a CAV neutralizing antibody; and (b) introducing into the cell a CAVector of any of claims 11-13.

17. A method of selecting a subject for receiving a CAVector, the method comprising assessing the subject for the presence of an unwanted immune response to CAV, e.g., an anti-CAV antibody, e.g., a CAV neutralizing antibody.

18. A method of modulating a biological activity in a subject in need thereof, the method comprising introducing into the subject a CAVector of any of claims 11-13, e.g., wherein the disease or disorder is cancer.

19. A method of treating a disease or disorder in a subject in need thereof, the method comprising introducing into the subject a CAVector of any of claims 11-13, e.g., wherein the disease or disorder is cancer.

20. A method of treating a disease or disorder in a subject in need thereof, the method comprising: (a) assessing the subject for the presence of an unwanted immune response to CAV, e.g., an anti-CAV antibody, e.g., a CAV neutralizing antibody; and (b) introducing into the subject a CAVector of any of claims 11-13.

21. A method of vaccinating a subject in need thereof, the method comprising introducing into the subject a CAVector of any of claims 11-13, wherein the exogenous effector comprises an antigen from an infectious agent (e.g., a virus or bacteria).

22. A method of making a CAVector, comprising: a) providing a host cell comprising a genetic element of any of claims 1-7, and b) incubating the host cell under conditions suitable for enclosure of the genetic element in a proteinaceous exterior (e.g., a proteinaceous exterior comprising a CAV VP1 molecule), thereby making the CAVector.

23. A method of storing a composition comprising a CAVector, the method comprising maintaining a composition comprising a CAVector (e.g., a CAVector as described herein) at a temperature between 1-5 C., 5-10 C., 10-15 C., 15-20 C., or 20-25 C. for a period of at least about 1 week, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or 2 years, or a period of about 1-2 weeks, 2-3 weeks, 3-4 weeks, 1-2 months, 2-3 months, 3-4 months, 4-5 months, 5-6 months, 6-7 months, 7-8 months, 8-9 months, 9-10 months, 10-11 months, 11-12 months, 12-18 months, 18-24 months, or 2-3 years.

24. A method of cooling a composition comprising a CAVector, the method comprising lowering the temperature of a composition comprising a CAVector (e.g., a CAVector as described herein) to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 C., or to between 1-5 C. (e.g., about 4 C.).

25. A method of heating a composition comprising a CAVector, the method comprising raising the temperature of a composition comprising a CAVector (e.g., a CAVector as described herein) to about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 C., or to between 20-25 C. or 25-30 C. (e.g., about 25 C.).

26. A method of heating a composition comprising a CAVector, the method comprising raising the temperature of a composition comprising a CAVector (e.g., a CAVector as described herein) to about 35, 36, 37, 38, 39, or 40 C., or to between 30-35 C. or 35-40 C. (e.g., about 37 C.).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0462] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0463] FIG. 1 is a series of diagrams showing that only cells transfected with in vitro circularized (IVC) CAV DNA were able to produce increasing titers of CAV genomes over repeated passages, as a function of passage number (P0, P1, P2, and P4). In contrast, p637 negative control samples (consisting of wild-type CAV with a deletion in VP1) and plasmid CAV samples showed decreasing titers over repeated passages. Passages P1 and P2 were analyzed by western blotting and only showed expression of CAV VP2 and VP3 (a.k.a. apoptin) in IVC CAV samples. Passage P3 was carried out but not analyzed.

[0464] FIG. 2 is a series of diagrams showing total DNA copies of constructs found in cells exposed to passage P2 lysates from cells receiving IVC CAV DNA versus negative control plasmid p637. The graph shows qPCR results confirming that P3 material (Output) increased CAV DNA copies compared to P2 lysate (Input) when derived from cells that were transfected by IVC CAV DNA, but not by negative control plasmid p637.

[0465] FIG. 3 is a graph showing qPCR analysis of lysate from passage P3. Lysate from P3 cells was subjected to isopycnic centrifugation using CsCl and the resulting fractions analyzed by qPCR. CAV DNA is detected at a peak density of 1.32 g/mL.

[0466] FIG. 4 is a graph showing CAV copy numbers at various times post-infection. Following isolation by isopycnic centrifugation, purified CAV (labeled as IVC) or mock-infected cell lysate (Neg), was dialyzed, diluted with culture medium as indicated and added to fresh MDCC-MSB1 cells. Samples were taken daily, and CAV copy numbers were quantified by qPCR.

[0467] FIG. 5 is a series of electron micrographs showing CAV particles rescued from synthetic genomic DNA. Scale bars indicate the magnification of each image. Arrows indicate some of the CAV particles visible in the image on the left. Particles were measured to be approximately 24 nm in diameter.

[0468] FIG. 6A is a diagram showing schematics of exemplary CAV tandem constructs. pRTx-966 includes (i) repeats, promoter, ORFs, and hairpin, and (ii) repeats, promoter, ORFs, and hairpin. pRTx-1113 includes (i) truncated repeats, promoter, ORFs, and hairpin, and (ii) repeats, promoter, ORFs, and hairpin. pRTx-1114 includes (i) further truncated repeats, promoter, ORFs, and hairpin, and (ii) repeats, promoter, ORFs, and hairpin. pRTx-1115 includes (i) the promoter, ORFs, and hairpin, and (ii) repeats, promoter, ORFs, and hairpin. pRTx-1116 includes (i) ORFs, and hairpin, and (ii) repeats, promoter, ORFs, and hairpin. pRTx-1117 includes (i) a truncated ORF region comprising only a 3 fragment of the region, and hairpin, and (ii) repeats, promoter, ORFs, and hairpin. pRTx-1118 includes (i) repeats, promoter, ORFs, and hairpin, and (ii) repeats, promoter, and ORFs. pRTx-1119 includes (i) repeats, promoter, ORFs, and hairpin, and (ii) repeats, promoter, and a truncated ORF region comprising only a 5 fragment of the region. pRTx-1120 includes (i) repeats, promoter, ORFs, and hairpin, and (ii) repeats. pRTx-1118 includes (i) repeats, promoter, ORFs, and hairpin, and (ii) a truncated repeats region.

[0469] FIG. 6B is a graph showing CAV qPCR on cell suspension transfected with the CAV tandem constructs shown in FIG. 6A. 200 ul of cell suspension was collected at P0 day 2, P0 day 3, and P1 day 2. Viral DNA was extracted, and CAV genomes were quantified by qPCR.

[0470] FIG. 6C is a diagram showing a Southern blot for samples from cells transfected with the CAV tandem constructs shown in FIG. 6A. Samples were collected on P1 day 2. Cell pellets were lysed from a 10 ml culture. DNA was extracted and digested with enzymes that cut backbone (B) or non-replicated plasmid (D, DpnI).

[0471] FIG. 7 is a graph showing binding of CAV to human cell lines. The y-axis indicates CAV viral genomes (vg) normalized to the MDCC cell control. Each circle represents a biological replicate. Error bars represent standard deviation. As shown, of the human cell lines, CAV bound most strongly to Raji cells, followed by EKVX cells, MRC5 cells, and MCF7 cells.

[0472] FIGS. 8A-8B are a series of diagrams showing the genome organization of CAV and a set of exemplary CAVectors. (A) A linearized representation of the WT CAV genome drawn to scale, including the 5 UTR, VP2 open reading frame, Apoptin open reading frame, VP1 open reading frame, and 3 UTR. The CAV genome is 2.3 kb in length. (B) Linearized representations of the various CAVector constructs generated and tested. For each CAVector, a Nano-luciferase (nLuc) reporter cassette was inserted into the CAV genome, replacing a fragment of the genome equal in length to the reporter cassette, as shown. The Nano-luciferase reporter comprises an SV40 promoter, the nano-luciferase ORF, and an SV40 terminator sequence. The sequences for the exemplary CAVectors shown in this figure are listed in Tables 2-9.

[0473] FIGS. 9A-9C are a series of diagrams showing transduction of MDCC cells with CAVector supernatant. (A) Schematic of transduction assay. In brief, 1e5 cells were incubated with CAVector supernatant for 30 minutes, followed by three washes and the day 0 luminescence measurement. After 24 hours, cells were washed again three times and the day 1 luminescence measurement was obtained. After another 24 hours, cells were washed again three times and the day 2 luminescence measurement was obtained. (B) Negative control transductions with CAVector+pRTX-637. As shown, no luminescence was detected at any of Days 0, 1, or 2 in the negative control samples. (C) Transductions with CAVectors produced in cells co-transfected with pRTX-966 (the full tandem CAV construct). Significance was calculated using a two-way ANOVA with multiple comparisons (*=p<0.05, **=p<0.01, ***=p<0.001). The nLuc4, nLuc5, and nLuc7 CAVectors showed significant increase of luminescence on day 2. The nLuc6 CAVector showed significant increase of luminescence starting on day 1.

[0474] FIGS. 10A-10B are a series of diagrams showing purification of CAVectors from supernatant and analysis thereof in a normalized transduction assay. (A) DNase protection assay on purified CAVector particles. Purified particles were treated with or without DNase and then genomes were quantified by qPCR using an nluc probe. (B) Transduction assay with normalized CAVector genomes. CAVectors nLuc4, nLuc5, nLuc6, and nLuc7 showed increased nano-luciferase luminescence at day 2.

[0475] FIGS. 11A-11B are a series of graphs showing transduction of human cells by CAVectors. (A) CAVector transduction of Jurkat cells at an MOI of 3. (B) CAVector transduction of Raji cells at an MOI of 3. Significance was calculated using a two-way ANOVA with multiple comparisons (*=p<0.05, **=p<0.01, ***=p<0.001).

[0476] FIG. 12 is a table showing the titer, endotoxin levels, and BCA levels for cells producing either CAVectors carrying an nLuc transgene, wild-type CAV (negative control), or AAV2 (positive control).

[0477] FIG. 13A-13C are a series of diagrams showing that CAVectors are neutralized by VP1-neutralizing antibodies. (A) Neutralization assay with WT CAV. (B) Neutralizing antibodies in chicken sera specifically recognize VP1. (C) Neutralization of CAVector with chicken serum but not IVIG.

[0478] FIG. 14 is a graph showing plasmid containing a full WT CAV genome (pCAV) rescuing Nluc6 CAVector production compared to a sample using a CAV genome in which VP1 was deleted. Addition of VP1-neutralizing antibodies prevented this rescue.

[0479] FIGS. 15A-15C are a series of diagrams showing the plasmid maps for exemplary tandem constructs each comprising CAV and/or CAVector genetic element regions arranged in tandem. Each construct includes an Ampicillin resistance cassette and an origin of replication. FIG. 15A shows the plasmid map for pCAV-nLuc6_CAV, the sequence of which is listed in annotated form in Table 14. This construct includes a CAVector genetic element sequence comprising, in order from 5 to 3, CAV repeats, inactive CAV VP-encoding sequences, an SV40p_nLuc insert, and CAV hairpin sequences. The CAVector genetic element sequence is positioned 5 relative to a wild-type CAV genetic element sequence comprising, in order from 5 to 3, CAV repeats, CAV VP-encoding sequences, and CAV hairpin sequences. FIG. 15B shows the plasmid map for pCAV-nLuc6_CAV3NCR, the sequence of which is listed in annotated form in Table 15. This construct includes the same nLuc6 CAVector genetic element sequence positioned 5 relative to a truncated wild-type CAV genetic element sequence comprising only CAV repeats and CAV VP-encoding sequences. FIG. 15C shows the plasmid map for pCAV-nLuc6_CAVPromORFs3NCR (the latter portion of which is diagrammed as CAV), the sequence of which is listed in annotated form in Table 16. This construct includes the same nLuc6 CAVector genetic element sequence positioned 5 relative to a truncated wild-type CAV genetic element sequence comprising only CAV repeats.

[0480] FIGS. 16A-16D are a series of graphs showing levels of nLuc copies or wild-type CAV genome copies detected in the indicated tissues of mice administered either wild-type CAV, a CAVector encoding nano-luciferase, or an AAV2 encoding nano-luciferase.

[0481] FIGS. 17A-17C are a series of diagrams showing the results of in vitro neutralization assays for CAVector or AAV2, as indicated. FIG. 17A shows neutralization of CAVector in mice administered either nLuc CAVector, wild-type CAV, or AAV2-nLuc intramuscularly, or neutralization of CAVector by chicken serum. FIG. 17B shows neutralization of AAV2 in mice administered either nLuc CAVector, wild-type CAV, or AAV2-nLuc intramuscularly, or neutralization of CAVector by chicken serum. FIG. 17C shows the 50% GMT (which stands for geometric mean neutralizing reciprocal titer) for CAV (middle column) or AAV2 (right column) in mice receiving the indicated vectors.

[0482] FIG. 18 is a series of diagrams showing assembly of CAV VP1 proteins into virus-like particle (VLP) structures in vitro.

[0483] FIG. 19A-19D are a series of graphs showing that CAVectors have CAV-like density and are neutralized by immune serum but not by human serum samples. (A) Density of CAV wildtype and vector particles following ultracentrifugation in a cesium chloride linear gradient and DNase-resistant qPCR of CAV and nanoluciferase (Nluc) amplicons. (B) After dialysis, gradient fractions shown in panel A were assayed for transduction of MDCC-MSB1 cells within minutes of adding vector to cells (day 0) or after 48 hours (day 2). () indicates a negative control. (C) Neutralization of CAVector by chicken immune serum is readily observed, while neutralization by human IVIG and individual human serum samples is undetectable except for a weak signal in one sample (donor 38). (D) AAV2-nluc is neutralized by IVIG and 3 of 10 individual human serum samples, but not chicken serum.

[0484] FIG. 20 is a series of graphs showing detection of CAVector transgene nLuc in mouse tissues by qPCR 3 weeks after intramuscular injection. Detection of CAVector transgene nLuc in mouse tissues by qPCR 3 weeks after injection. Each symbol represents one mouse. Horizontal line is the geometric mean of each value and error bars represent the geometric standard deviation. Mice were administered the indicated samples by various routes (SR, IV, IP, IM) and their tissues were collected 3 weeks later.

[0485] FIG. 21A-21C is a series of diagrams showing that entry of CAVector into a cell is a dynamin- and pH-dependent process. (A) Illustration of common viral entry pathways denoting inhibitors that act at different steps. (B) MDCC-MSB1 cells were pretreated with inhibitors or DMSO control at the indicated concentrations prior to infection. Cells were then transduced in the presence of inhibitor and luminescence was read 20 hours later. (C) For comparison, inhibition of AAV2-nluc entry was similarly studied using Expi293 cells pretreated with inhibitors or DMSO control. Each symbol represents one of two biological replicates. PM: plasma membrane.

[0486] FIG. 22A-22B are graphs showing that CAVector retains transduction potency at up to 65 C. and in storage at 4 C. (A) CAVector nLuc 6 was incubated at the indicated temperature for 15 minutes and residual transduction potency was measured by luminescence assay 36 hours after the addition of heat-treated virus to MDCC-MSB1 cells. Each symbol represents one sample. A neutralization sample (NAb) was included as a negative control, as well as a no-vector control (). (B) A CAVector suspension purified by isopycnic CsCl centrifugation and dialysis was stored for 6 months at 4 C. in buffered saline and assayed for transduction activity. Transduction assays at 0, 3, and 6 months are shown in chronological order, including an uninfected negative control, at the indicated MOIs.

[0487] FIG. 23A-23C are a series of diagrams showing the recovery of CAVector using a tandem plasmid. FIG. 23A is a diagram depicting the tandem plasmid. FIG. 23B is a graph depicting quantification of vector genomes following DNase treatment. FIG. 23C is a graph showing an increase of luminescence demonstrating the vector particles are capable of transduction.

[0488] The following detailed description of the embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments that are presently exemplified. It should be understood, however, that the invention is not limited to the precise arrangement and instrumentalities of the embodiments shown in the drawings.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0489] The present invention will be described with respect to particular embodiments and with reference to certain figures but the invention is not limited thereto but only by the claims. Terms as set forth hereinafter are generally to be understood in their common sense unless indicated otherwise.

[0490] Where the term comprising is used in the present description and claims, it does not exclude other elements. For the purposes of the present invention, the term consisting of is considered to be a preferred embodiment of the term comprising of. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is to be understood to preferably also disclose a group which consists only of these embodiments.

[0491] Where an indefinite or definite article is used when referring to a singular noun, e.g. a, an or the, this includes a plural of that noun unless something else is specifically stated.

[0492] The wording compound, composition, product, etc. for treating, modulating, etc. is to be understood to refer a compound, composition, product, etc. per se which is suitable for the indicated purposes of treating, modulating, etc. The wording compound, composition, product, etc. for treating, modulating, etc. additionally discloses that, as an embodiment, such compound, composition, product, etc. is for use in treating, modulating, etc.

[0493] The wording compound, composition, product, etc. for use in . . . , use of a compound, composition, product, etc in the manufacture of a medicament, pharmaceutical composition, veterinary composition, diagnostic composition, etc. for . . . , or compound, composition, product, etc. for use as a medicament . . . indicates that such compounds, compositions, products, etc. are to be used in therapeutic methods which may be practiced on the human or animal body. They are considered as an equivalent disclosure of embodiments and claims pertaining to methods of treatment, etc. If an embodiment or a claim thus refers to a compound for use in treating a human or animal being suspected to suffer from a disease, this is considered to be also a disclosure of a use of a compound in the manufacture of a medicament for treating a human or animal being suspected to suffer from a disease or a method of treatment by administering a compound to a human or animal being suspected to suffer from a disease. The wording compound, composition, product, etc. for treating, modulating, etc. is to be understood to refer a compound, composition, product, etc. per se which is suitable for the indicated purposes of treating, modulating, etc.

[0494] If hereinafter examples of a term, value, number, etc. are provided in parentheses, this is to be understood as an indication that the examples mentioned in the parentheses can constitute an embodiment. In some instances, if it is stated that in embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAV VP1-encoding nucleotide sequence of Table 1A, then some embodiments relate to nucleic acid molecules comprising a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1-encoding nucleic acid sequence as listed in Table 1A.

[0495] The term amplification, as used herein, refers to replication of a nucleic acid molecule or a portion thereof, to produce one or more additional copies of the nucleic acid molecule or a portion thereof (e.g., a genetic element or a genetic element region). In some embodiments, amplification results in partial replication of a nucleic acid sequence. In some embodiments, amplification occurs via rolling circle replication.

[0496] As used herein, the term CAVector refers to a vehicle comprising a genetic element, e.g., a circular DNA, enclosed in a proteinaceous exterior, e.g, the genetic element is substantially protected from digestion with DNAse I by a proteinaceous exterior, and one or both of the genetic element and the proteinaceous exterior comprise a CAV component (for example, a fragment or homolog of a wild-type CAV sequence, e.g., as described herein). A synthetic CAVector, as used herein, generally refers to a CAVector that is not naturally occurring, e.g., has a sequence that is different relative to a wild-type virus (e.g., a wild-type CAV as described herein). In some embodiments, the synthetic CAVector is engineered or recombinant, e.g., comprises a genetic element that comprises a difference or modification relative to a wild-type viral genome (e.g., a wild-type CAV genome as described herein). In some embodiments, enclosed within a proteinaceous exterior encompasses 100% coverage by a proteinaceous exterior, as well as less than 100% coverage, e.g., 95%, 90%, 85%, 80%, 70%, 60%, 50% or less. For example, gaps or discontinuities (e.g., that render the proteinaceous exterior permeable to water, ions, peptides, or small molecules) may be present in the proteinaceous exterior, so long as the genetic element is retained in the proteinaceous exterior or protected from digestion with DNAse I, e.g., prior to entry into a host cell. In some embodiments, the CAVector is purified, e.g., it is separated from its original source and/or substantially free (>50%, >60%, >70%, >80%, >90%) of other components. In some embodiments, the CAVector is capable of introducing the genetic element into a target cell (e.g., via infection). In some embodiments, the CAVector is an infective synthetic CAV viral particle. A CAV component, as used herein, generally refers to a polypeptide or nucleic acid molecule comprising an activity of a polypeptide or nucleic acid molecule, respectively, encoded by or comprised by a CAV genome, and/or comprising a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polypeptide encoded by a CAV genome, e.g., a wild-type CAV genome (e.g., as described herein, e.g., as listed in Table 1A, 1B, or 17) or a nucleic acid element comprised in a CAV genome, respectively, or a functional fragment thereof.

[0497] As used herein, the term antibody molecule refers to a protein, e.g., an immunoglobulin chain or fragment thereof, comprising at least one immunoglobulin variable domain sequence. The term antibody molecule encompasses full-length antibodies and antibody fragments (e.g., scFvs). In some embodiments, an antibody molecule is a multispecific antibody molecule, e.g., the antibody molecule comprises a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In embodiments, the multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody molecule is generally characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.

[0498] As used herein, a downstream replication-facilitating sequence (dRFS) refers to a fragment of the sequence of a genetic element (e.g., as described herein), that, when positioned downstream of a genetic element sequence (e.g., the genetic element is 5 relative to the dRFS), increases replication of the genetic element sequence compared to an otherwise similar genetic element sequence in the absence of the dRFS. Generally, the resultant replicated strand is a functional genetic element that can be enclosed in a proteinaceous exterior to form an CAVector (e.g., as described herein). In some embodiments, a dRFS comprises a displacement site for a Rep protein (e.g., an CAV Rep protein). In some embodiments, a dRFS comprises an CAV 3 UTR sequence or a fragment thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto). In some embodiments, a dRFS comprises a 5 UTR (e.g., comprising a hairpin loop). In some embodiments, a dRFS comprises an origin of replication.

[0499] As used herein, an upstream replication-facilitating sequence (uRFS) refers to a fragment of the sequence of a genetic element (e.g., as described herein), that, when positioned upstream of a genetic element sequence (e.g., the genetic element is 3 relative to the uRFS) increases replication of the genetic element sequence compared to an otherwise similar genetic element sequence in the absence of the uRFS. Generally, the resultant replicated strand is a functional genetic element that can be enclosed in a proteinaceous exterior to form an CAVector (e.g., as described herein). In some embodiments, an uRFS comprises a binding and/or recognition site for a Rep protein (e.g., an CAV Rep protein). In some embodiments, an uRFS comprises an CAV 5 UTR sequence or a fragment thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto). In some embodiments, an uRFS comprises a 5 UTR (e.g., comprising a hairpin loop). In some embodiments, an uRFS comprises an origin of replication.

[0500] As used herein, a nucleic acid encoding refers to a nucleic acid sequence encoding an amino acid sequence or a functional polynucleotide (e.g., a non-coding RNA, e.g., an siRNA or miRNA).

[0501] An exogenous agent (e.g., an effector, a nucleic acid (e.g., RNA), a gene, payload, protein) as used herein refers to an agent that is either not comprised by, or not encoded by, a corresponding wild-type virus, e.g., a wild-type CAV, e.g., as described herein. In some embodiments, the exogenous agent does not naturally exist, such as a protein or nucleic acid that has a sequence that is altered (e.g., by insertion, deletion, or substitution) relative to a naturally occurring protein or nucleic acid. In some embodiments, the exogenous agent does not naturally exist in the host cell. In some embodiments, the exogenous agent exists naturally in the host cell but is exogenous to the virus. In some embodiments, the exogenous agent exists naturally in the host cell, but is not present at a desired level or at a desired time. In some embodiments, the exogenous agent does not naturally exist in the target cell. In some embodiments, the exogenous agent exists naturally in the target cell but is exogenous to the virus. In some embodiments, the exogenous agent exists naturally in the target cell, but is not present at a desired level or at a desired time. In embodiments, introduction of the exogenous agent into a target cell results in an unnatural level of the agent in the target cell (e.g., a level greater than the endogenous levels of the agent in the cell).

[0502] A heterologous agent or element (e.g., an effector, a nucleic acid sequence, an amino acid sequence), as used herein with respect to another agent or element (e.g., an effector, a nucleic acid sequence, an amino acid sequence), refers to agents or elements that are not naturally found together, e.g., in a wild-type virus, e.g., a CAV. In some embodiments, a heterologous nucleic acid sequence may be present in the same nucleic acid as a naturally occurring nucleic acid sequence (e.g., a sequence that is naturally occurring in the CAV). In some embodiments, a heterologous agent or element is exogenous relative to an CAV from which other (e.g., the remainder of) elements of the CAVector are based.

[0503] As used herein, the term genetic element refers to a nucleic acid molecule that is or can be enclosed within (e.g, protected from DNAse I digestion by) a proteinaceous exterior, e.g., to form a CAVector as described herein. It is understood that the genetic element can be produced as naked DNA and optionally further assembled into a proteinaceous exterior. It is also understood that a CAVector can insert its genetic element into a cell, resulting in the genetic element being present in the cell and the proteinaceous exterior not necessarily entering the cell. In some embodiments, the genetic element comprises a nucleic acid sequence encoding an effector (e.g., an exogenous effector). In some embodiments, the genetic element is single-stranded. In some embodiments the genetic element is circular. In some embodiments, the genetic element comprises one or more sequences of a CAV (e.g., as described herein), e.g., a packaging signal from a CAV as described herein.

[0504] As used herein, genetic element construct refers to a nucleic acid construct (e.g., a plasmid, bacmid, cosmid, or minicircle) comprising at least one (e.g., two) genetic element sequence(s), or fragment thereof. In some embodiments, a tandem construct as described herein is a genetic element construct comprising two or more genetic element sequences, or fragments thereof, arranged in tandem (e.g., as described herein). In some embodiments, a genetic element construct comprises at least one full length genetic element sequence. In some embodiments, a genetic element comprises a full length genetic element sequence and a partial genetic element sequence. In some embodiments, a genetic element comprises two or more partial genetic element sequences (e.g., in 5 to 3 order, a 5-truncated genetic element sequence arranged in tandem with a 3-truncated genetic element sequence.

[0505] The term genetic element region, as used herein, refers to a region of a construct that comprises the sequence of a genetic element. In some embodiments, the genetic element region comprises a sequence having sufficient identity to a wild-type CAV sequence, or a fragment thereof, to be enclosed by a proteinaceous exterior, thereby forming a CAVector (e.g., a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the wild-type CAV sequence or fragment thereof). In embodiments, the genetic element region comprises a protein binding sequence, e.g., as described herein (e.g., a 5 UTR, 3 UTR, and/or a GC-rich region as described herein, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto). In some embodiments, the genetic element region can undergo rolling circle replication. In some embodiments, the genetic element region comprises an uRFS. In some embodiments, the genetic element region comprises a dRFS. In some embodiments, the genetic element comprises a Rep protein binding site. In some embodiments, the genetic element comprises a Rep protein displacement site. In some embodiments, the construct comprising a genetic element region is not enclosed in a proteinaceous exterior, but a genetic element produced from the construct can be enclosed in a proteinaceous exterior. In some embodiments, the construct comprising the genetic element region further comprises a second uRFS or a second dRFS. In some embodiments, the construct comprising the genetic element region further comprises a vector backbone.

[0506] As used herein with reference to a VP1-, VP2-, or Apoptin-coding gene, or a fragment thereof, nonfunctional refers to a gene or fragment thereof that does not produce a protein, or that produces a protein that lacks at least one activity (e.g., all activities) compared to its wild-type counterpart. In some embodiments, a nonfunctional gene comprises a premature stop codon. In some embodiments, a nonfunctional gene comprises a frameshift mutation. In some embodiments, a nonfunctional gene lacks a start codon. In some embodiments, the activity is a binding activity or an enzymatic activity.

[0507] As used herein, a functional fragment of a full-length protein or polypeptide refers to a polypeptide having one or more activities (e.g., all activities) of the full-length protein or polypeptide, and which lacks at least one amino acid (e.g., at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, or 1000 amino acids) relative to the full-length protein or polypeptide. In some embodiments, the activity is a binding activity or an enzymatic activity. As used herein, a functional fragment of a full-length nucleic acid sequence that binds a protein refers to a nucleic acid sequence that binds to at least one protein bound by the full-length nucleic acid sequence. In some embodiments, the full-length nucleic acid sequence comprises a 5 UTR sequence, e.g., as described herein.

[0508] As used herein, the term promoter element refers to a regulatory nucleic acid sequence comprising a sequence having the functionality of a promoter. In some embodiments, the promoter element comprises a promoter as described herein. In some embodiments, the promoter element binds to and/or recruits an RNA polymerase molecule, e.g., such that the RNA polymerase can transcribe an RNA molecule from a nucleic acid sequence downstream of the promoter element. In some embodiments, the promoter element comprises a constitutive promoter, a cell-specific promoter, or a tissue-specific promoter, e.g., as described herein. In some embodiments, the promoter element comprises an inducible promoter, e.g., as described herein.

[0509] As used herein, the term VP1 molecule refers to a polypeptide having an activity and/or a structural feature of a CAV VP1 protein (e.g., a CAV VP1 protein as described herein, or a functional fragment thereof. A VP1 molecule may, in some instances, comprise one or more of (e.g., 1, 2, 3 or 4 of): a first region comprising. In some instances, the VP1 molecule comprises, in N-terminal to C-terminal order, the first, second, third, and fourth regions. A VP1 molecule may, in some instances, comprise a polypeptide encoded by a CAV VP1 nucleic acid. A VP1 molecule may, in some instances, further comprise a heterologous sequence, e.g., from a CAV VP1 protein, e.g., as described herein. In some embodiments, a VP1 molecule is encoded by a CAV genome (e.g., a wild-type CAV genome, e.g., as described herein). In some embodiments, a VP1 molecule is a polypeptide encoded by a CAV VP1 nucleic acid (e.g., a VP1 gene, e.g., as described herein). In some embodiments, a VP1 molecule is a splice variant or comprises a post-translational modification.

[0510] As used herein, the term VP2 molecule refers to a polypeptide having an activity and/or a structural feature of a CAV VP2 protein (e.g., a CAV VP2 protein as described herein, or a functional fragment thereof. In some embodiments, a VP2 molecule is encoded by a CAV genome (e.g., a wild-type CAV genome, e.g., as described herein). In some embodiments, a VP2 molecule is a polypeptide encoded by a CAV VP2 nucleic acid (e.g., a VP2 gene, e.g., as described herein). In some embodiments, a VP2 molecule is a splice variant or comprises a post-translational modification.

[0511] As used herein, the term Apoptin molecule refers to a polypeptide having an activity and/or a structural feature of a CAV Apoptin protein (e.g., a CAV Apoptin protein as described herein, or a functional fragment thereof. In some embodiments, an Apoptin molecule is encoded by a CAV genome (e.g., a wild-type CAV genome, e.g., as described herein). In some embodiments, an Apoptin molecule is a polypeptide encoded by a CAV Apoptin nucleic acid (e.g., an Apoptin gene). In some embodiments, an Apoptin molecule is a splice variant or comprises a post-translational modification.

[0512] As used herein, the term CAV capsid polypeptide refers to a polypeptide present in the capsid of a wild-type CAV, or a polypeptide having an activity and/or a structural feature of said polypeptide. In some embodiments, the CAV capsid polypeptide is a VP1 molecule.

[0513] As used herein, the term VP1 nucleic acid refers to a nucleic acid that encodes a VP1 molecule, or the reverse complement thereof. The nucleic acid may be single stranded or double stranded. In some embodiments, the VP1 nucleic acid comprises a CAV VP1 gene, e.g., as described herein. A VP1 gene generally refers to a nucleic acid sequence encoding a wild-type VP1 molecule, or the reverse complement thereof. In some embodiments, a VP1 gene comprises a sense strand. In some embodiments, a VP1 gene comprises an antisense strand. In some embodiments, a VP1 gene is double-stranded.

[0514] As used herein, the term VP2 nucleic acid refers to a nucleic acid that encodes a VP2 molecule, or the reverse complement thereof. The nucleic acid may be single stranded or double stranded. In some embodiments, the VP2 nucleic acid comprises a CAV VP2 gene, e.g., as described herein. A VP2 gene generally refers to a nucleic acid sequence encoding a wild-type VP2 molecule, or the reverse complement thereof. In some embodiments, a VP2 gene comprises a sense strand. In some embodiments, a VP2 gene comprises an antisense strand. In some embodiments, a VP2 gene is double-stranded.

[0515] As used herein, the term Apoptin nucleic acid refers to a nucleic acid that encodes a Apoptin molecule, or the reverse complement thereof. The nucleic acid may be single stranded or double stranded. In some embodiments, the Apoptin nucleic acid comprises a CAV Apoptin gene, e.g., as described herein. An Apoptin gene generally refers to a nucleic acid sequence encoding a wild-type Apoptin molecule, or the reverse complement thereof. In some embodiments, an Apoptin gene comprises a sense strand. In some embodiments, an Apoptin gene comprises an antisense strand. In some embodiments, an Apoptin gene is double-stranded.

[0516] As used herein, the term CAV genome sequence refers to a nucleic acid sequence comprising a full-length genome sequence from a wild-type CAV, e.g., as described herein, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, a CAV genome comprises a CAV genome sequence as described herein (e.g., a wild-type CAV genome sequence, e.g., as listed in any of Tables 1A and 1B or Table 17).

[0517] As used herein, the term CAV UTR refers to a nucleic acid sequence comprising an untranslated region (UTR) sequence (e.g., the sequence of a 5 UTR or a 3 UTR) from a CAV (e.g., a wild-type CAV, e.g., as described herein, e.g., as listed in Table 1A, 1B, or 17), or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto.

[0518] As used herein, the term proteinaceous exterior refers to an exterior component that is predominantly (e.g., >50%, >60%, >70%, >80%, >90%) protein. In some embodiments, a proteinaceous exterior encloses a nucleic acid molecule, e.g., a genetic element, e.g., as described herein. In some embodiments, the proteinaceous exterior comprises a capsid. In some embodiments, the proteinaceous exterior forms the capsid, or a portion thereof, of a viral particle.

[0519] As used herein, the term protein binding sequence refers to a nucleic acid sequence capable of binding to (e.g., specifically binding to) a protein, e.g., a component of a proteinaceous exterior, e.g., as described herein. In some embodiments, the protein binding sequence binds to the component of the proteinaceous exterior with sufficient affinity to promote enclosure of the genetic element comprising the protein binding sequence within the proteinaceous exterior. In some embodiments, the protein binding sequence binds directly to the proteinaceous exterior protein. In some embodiments, the protein binding sequence binds indirectly to the proteinaceous exterior protein (e.g., the protein binding sequence binds to a protein, nucleic acid molecule, or other moiety associated with the proteinaceous exterior protein).

[0520] As used herein, the term regulatory nucleic acid refers to a nucleic acid sequence that modifies expression, e.g., transcription and/or translation, of a DNA sequence that encodes an expression product. In embodiments, the expression product comprises RNA or protein.

[0521] As used herein, the term regulatory sequence refers to a nucleic acid sequence that modifies transcription of a target gene product. In some embodiments, the regulatory sequence is a promoter or an enhancer.

[0522] As used herein, the term Rep or replication protein refers to a protein, e.g., a viral protein, that promotes viral genome replication. In some embodiments, the replication protein is an CAV Rep protein.

[0523] As used herein, the term Rep binding site refers to a nucleic acid sequence within a nucleic acid molecule that is recognized and bound by a Rep protein (e.g., an CAV Rep protein). In some embodiments, a Rep binding site comprises a 5 UTR (e.g., comprising a hairpin loop). In some embodiments, a Rep binding site comprises an origin of replication (ORI).

[0524] As used herein, the term Rep displacement site refers to a nucleic acid sequence within a nucleic acid molecule that is capable of causing a Rep protein (e.g., an CAV Rep protein) associated with (e.g., bound to) the nucleic acid molecule to release the nucleic acid molecule upon reaching the Rep displacement site. In some embodiments, a Rep displacement site comprises a 5 UTR (e.g., comprising a hairpin loop). In some embodiments, a Rep displacement site comprises an origin of replication (ORI).

[0525] As used herein, the term specifically binds refers to a first molecule (e.g., a capsid protein, e.g., a VP1 protein) that binds to a second molecule (e.g., a nucleic acid comprising a protein binding sequence, e.g., a packaging signal) more strongly than to a nonspecific control molecule (e.g., a nucleic acid lacking the protein binding sequence). In some embodiments, the first molecule shows a detectable level of binding to the nonspecific control molecule. In some embodiments, the K.sub.D of the first molecule for the second molecule is lower than the K.sub.D of the first molecule for the nonspecific control molecule by a factor of 5, 10, 20, 50, or 100.

[0526] As used herein, a substantially non-pathogenic organism, particle, or component, refers to an organism, particle (e.g., a virus or a CAVector, e.g., as described herein), or component thereof that does not cause or induce an unacceptable disease or pathogenic condition, e.g., in a host organism, e.g., a mammal, e.g., a human. In some embodiments, administration of a CAVector to a subject can result in minor reactions or side effects that are acceptable as part of standard of care.

[0527] As used herein, the term non-pathogenic refers to an organism or component thereof that does not cause or induce a unacceptable disease or pathogenic condition, e.g., in a host organism, e.g., a mammal, e.g., a human.

[0528] As used herein, a substantially non-integrating genetic element refers to a genetic element, e.g., a genetic element in a virus or CAVector, e.g., as described herein, wherein less than about 0.01%, 0.05%, 0.1%, 0.5%, or 1% of the genetic element that enter into a host cell (e.g., a eukaryotic cell) or organism (e.g., a mammal, e.g., a human) integrate into the genome. In some embodiments the genetic element does not detectably integrate into the genome of, e.g., a host cell. In some embodiments, integration of the genetic element into the genome can be detected using techniques as described herein, e.g., nucleic acid sequencing, PCR detection and/or nucleic acid hybridization. In some embodiments, integration frequency is determined by quantitative gel purification assay of genomic DNA separated from free vector, e.g., as described in Wang et al. (2004, Gene Therapy 11: 711-721, incorporated herein by reference in its entirety).

[0529] A subsequence as used herein refers to a nucleic acid sequence or an amino acid sequence that is comprised in a larger nucleic acid sequence or amino acid sequence, respectively. In some instances, a subsequence may comprise a domain or functional fragment of the larger sequence. In some instances, the subsequence may comprise a fragment of the larger sequence capable of forming secondary and/or tertiary structures when isolated from the larger sequence similar to the secondary and/or tertiary structures formed by the subsequence when present with the remainder of the larger sequence. In some instances, a subsequence can be replaced by another sequence (e.g., a subsequence comprising an exogenous sequence or a sequence heterologous to the remainder of the larger sequence, e.g., a corresponding subsequence from a different CAV).

[0530] This invention relates generally to CAVectors, e.g., synthetic CAVectors, and uses thereof. The present disclosure provides CAVectors, compositions comprising CAVectors, and methods of making or using CAVectors. CAVectors are generally useful as delivery vehicles, e.g., for delivering a therapeutic agent to a eukaryotic cell. Generally, an CAVector will include a genetic element comprising a nucleic acid sequence (e.g., encoding an effector, e.g., an exogenous effector or an endogenous effector) enclosed within a proteinaceous exterior. A CAVector may include one or more deletions of sequences (e.g., regions or domains as described herein) relative to a CAV sequence (e.g., as described herein). CAVectors can be used as a vehicle for delivering the genetic element, or an effector encoded therein (e.g., a polypeptide or nucleic acid effector, e.g., as described herein), into eukaryotic cells, e.g., to treat a disease or disorder in a subject comprising the cells.

TABLE OF CONTENTS

[0531] I. Compositions and Methods for Making CAVectors [0532] A. Components and Assembly of CAVectors [0533] i. VP1 molecules for assembly of CAVectors [0534] ii. VP2 molecules for assembly of CAVectors [0535] B. Genetic Element Constructs [0536] i. Plasmids [0537] ii. Circular genetic element constructs [0538] iii. In vitro circularization [0539] iv. Cis/trans constructs [0540] v. Expression cassettes [0541] vi. Design and production of a genetic element construct [0542] C. Effectors [0543] D. Host Cells [0544] i. Introduction of genetic elements into host cells [0545] ii. Methods for providing CAV protein(s) in cis or trans [0546] iii. Helpers [0547] iv. Exemplary cell types [0548] E. Culture Conditions [0549] F. Harvest and Purification [0550] II. CAVectors [0551] A. CAVs [0552] B. VP1 molecules [0553] C. VP2 molecules [0554] D. Genetic elements [0555] E. Protein binding sequences [0556] F. 5 UTR Regions [0557] G. GC-rich regions [0558] H. Effectors [0559] I. Regulatory Sequences [0560] J. Replication Proteins [0561] K. Other Sequences [0562] L. Proteinaceous exterior [0563] III. Genetic element constructs [0564] IV. Compositions [0565] V. Host cells [0566] VI. Methods of use [0567] VII. Administration/Delivery

I. Compositions and Methods for Making CAVectors

[0568] The present disclosure provides, in some aspects, genetic element constructs that can be used for producing CAVectors, e.g., as described herein.

[0569] Components and Assembly of CAVectors

[0570] The compositions and methods herein can be used to produce CAVectors. As described herein, an CAVector generally comprises a genetic element (e.g., a single-stranded, circular DNA molecule, e.g., comprising a 5 UTR region as described herein) enclosed within a proteinaceous exterior (e.g., comprising a polypeptide encoded by an CAV VP1 nucleic acid, e.g., as described herein). In some embodiments, the genetic element comprises one or more sequences encoding CAV ORFs (e.g., one or more of an CAV VP1, VP2, and/or Apoptin). As used herein, an CAV ORF or ORF molecule (e.g., an CAV VP1, VP2, and/or Apoptin) includes a polypeptide comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a corresponding CAV ORF sequence, e.g., as described herein). In embodiments, the genetic element comprises a sequence encoding an CAV VP1, or a splice variant or functional fragment thereof (e.g., a jelly-roll region, e.g., as described herein). In some embodiments, the proteinaceous exterior comprises a polypeptide encoded by an CAV VP1 nucleic acid (e.g., an CAV VP1 molecule or a splice variant or functional fragment thereof).

[0571] In some embodiments, a CAVector is assembled by enclosing a genetic element (e.g., as described herein) within a proteinaceous exterior (e.g., as described herein). In some embodiments, the genetic element is enclosed within the proteinaceous exterior in a host cell (e.g., as described herein). In some embodiments, the host cell expresses one or more polypeptides comprised in the proteinaceous exterior (e.g., a polypeptide encoded by a CAV VP1 nucleic acid, e.g., an VP1 molecule). For example, in some embodiments, the host cell comprises a nucleic acid sequence encoding a CAV VP1 molecule, e.g., a splice variant or a functional fragment of a CAV VP1 polypeptide (e.g., a wild-type CAV VP1 protein or a polypeptide encoded by a wild-type CAV VP1 nucleic acid, e.g., as described herein). In embodiments, the nucleic acid sequence encoding the CAV VP1 molecule is comprised in a genetic element construct (e.g., a plasmid, viral vector, virus, minicircle, bacmid, or artificial chromosome) comprised in the host cell. In embodiments, the nucleic acid sequence encoding the CAV VP1 molecule is integrated into the genome of the host cell.

[0572] In some embodiments, the host cell comprises the genetic element and/or a genetic element construct comprising the sequence of the genetic element. In some embodiments, the genetic element construct is selected from a plasmid, viral nucleic acid, minicircle, bacmid, or artificial chromosome. In some embodiments, the genetic element is excised from the genetic element construct and, optionally, converted from a double-stranded form to a single-stranded form (e.g., by denaturation). In some embodiments, the genetic element is generated by a polymerase based on a template sequence in the genetic element construct. In some embodiments, the polymerase produces a single-stranded copy of the genetic element sequence, which can optionally be circularized to form a genetic element as described herein. In other embodiments, the genetic element construct is a double-stranded minicircle produced by circularizing the nucleic acid sequence of the genetic element in vitro. In embodiments, the in vitro-circularized (IVC) minicircle is introduced into the host cell, where it is converted to a single-stranded genetic element suitable for enclosure in a proteinaceous exterior, as described herein.

[0573] VP1 Molecules, e.g., for Assembly of CAVectors

[0574] A CAVector can be made, for example, by enclosing a genetic element within a proteinaceous exterior. The proteinaceous exterior of a CAVector generally comprises a polypeptide encoded by an CAV VP1 nucleic acid (e.g., an CAV VP1 molecule or a splice variant or functional fragment thereof, e.g., as described herein). In embodiments, the proteinaceous exterior comprises one or both of a CAV VP1 arginine-rich region and/or jelly-roll region. In some embodiments, the proteinaceous exterior comprises an CAV VP1 jelly-roll region (e.g., as described herein). In some embodiments, the proteinaceous exterior comprises an CAV VP1 arginine-rich region (e.g., as described herein).

[0575] In some embodiments, the CAVector comprises a VP1 molecule and/or a nucleic acid encoding a VP1 molecule. Generally, a VP1 molecule comprises a polypeptide having the structural features and/or activity of an CAV VP1 protein (e.g., an CAV VP1 protein as described herein), or a functional fragment thereof. In some embodiments, the VP1 molecule comprises a truncation relative to an CAV VP1 protein (e.g., an CAV VP1 protein as described herein). In some embodiments, the VP1 molecule is truncated by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 amino acids of the CAV VP1 protein. In some embodiments, an VP1 molecule comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a CAV VP1 protein, e.g., as described herein. A VP1 molecule can generally bind to a nucleic acid molecule, such as DNA (e.g., a genetic element, e.g., as described herein), e.g., at a protein binding sequence therein.

[0576] Without wishing to be bound by theory, a VP1 molecule may be capable of binding to other VP1 molecules, e.g., to form a proteinaceous exterior (e.g., as described herein). Such a VP1 molecule may be described as having the capacity to form a capsid. In some embodiments, the proteinaceous exterior may enclose a nucleic acid molecule (e.g., a genetic element as described herein, e.g., produced using a tandem construct as described herein). In some embodiments, a plurality of VP1 molecules may form a multimer, e.g., to produce a proteinaceous exterior. In some embodiments, the multimer may be a homomultimer. In other embodiments, the multimer may be a heteromultimer.

[0577] Other CAV Polypeptides, e.g., for Assembly of CAVectors

[0578] In some embodiments, producing an CAVector using the compositions or methods described herein may involve expression of a CAV VP2 molecule (e.g., as described herein), or a splice variant or functional fragment thereof. In some embodiments, the CAVector comprises a VP2 molecule, or a splice variant or functional fragment thereof, and/or a nucleic acid encoding a VP2 molecule, or a splice variant or functional fragment thereof. In some embodiments, the CAVector does not comprise a VP2 molecule, or a splice variant or functional fragment thereof, and/or a nucleic acid encoding a VP2 molecule, or a splice variant or functional fragment thereof. In some embodiments, producing the CAVector comprises expression of a VP2 molecule, or a splice variant or functional fragment thereof, but the VP2 molecule is not incorporated into the CAVector.

[0579] In some embodiments, producing an CAVector using the compositions or methods described herein may involve expression of a CAV Apoptin molecule (e.g., as described herein), or a splice variant or functional fragment thereof. In some embodiments, the CAVector comprises a Apoptin molecule, or a splice variant or functional fragment thereof, and/or a nucleic acid encoding a Apoptin molecule, or a splice variant or functional fragment thereof. In some embodiments, the CAVector does not comprise a Apoptin molecule, or a splice variant or functional fragment thereof, and/or a nucleic acid encoding a Apoptin molecule, or a splice variant or functional fragment thereof. In some embodiments, producing the CAVector comprises expression of a Apoptin molecule, or a splice variant or functional fragment thereof, but the Apoptin molecule is not incorporated into the CAVector.

[0580] Genetic Element Constructs, e.g., for Assembly of CAVectors

[0581] The genetic element of a CAVector as described herein may be produced from a genetic element construct that comprises a genetic element region and optionally other sequence such as vector backbone. Generally, the genetic element construct comprises a CAV 5 UTR (e.g., as described herein). A genetic element construct may be any genetic element construct suitable for delivery of the sequence of the genetic element into a host cell in which the genetic element can be enclosed within a proteinaceous exterior. In some embodiments, the genetic element construct comprises a promoter. In some embodiments, the genetic element construct is a linear nucleic acid molecule. In some embodiments, the genetic element construct is a circular nucleic acid molecule (e.g., a plasmid, bacmid, or a minicircle, e.g., as described herein). In some embodiments, the genetic element construct comprises baculovirus sequences (e.g., such that an insect cell comprising the genetic element construct can produce a baculovirus comprising the genetic element sequence of the genetic element construct, or a fragment thereof). The genetic element construct may, in some embodiments, be double-stranded. In other embodiments, the genetic element is single-stranded. In some embodiments, the genetic element construct comprises DNA. In some embodiments, the genetic element construct comprises RNA. In some embodiments, the genetic element construct comprises one or more modified nucleotides.

[0582] In some embodiments, the genetic element construct comprises one copy of the genetic element sequence. In some embodiments, the genetic element comprises a plurality of copies of the genetic element sequence (e.g., two copies of the genetic element sequence). In some embodiments, the genetic comprises one full-length copy of the genetic element sequence and at least one partial genetic element sequence. In some embodiments, two copies of the genetic element sequence (e.g., the full length and/or partial genetic element sequences) are positioned in tandem within the genetic element construct (e.g., as described herein).

[0583] In some aspects, the present disclosure provides a method for replication and propagation of the CAVector as described herein (e.g., in a cell culture system), which may comprise one or more of the following steps: (a) introducing (e.g., transfecting) a genetic element (e.g., linearized) into a cell line sensitive to CAVector infection; (b) harvesting the cells and optionally isolating cells showing the presence of the genetic element; (c) culturing the cells obtained in step (b) (e.g., for at least three days, such as at least one week or longer), depending on experimental conditions and gene expression; and (d) harvesting the cells of step (c), e.g., as described herein.

[0584] Plasmids

[0585] In some embodiments, the genetic element construct is a plasmid. The plasmid will generally comprise the sequence of a genetic element as described herein as well as an origin of replication suitable for replication in a host cell (e.g., a bacterial origin of replication for replication in bacterial cells) and a selectable marker (e.g., an antibiotic resistance gene). In some embodiments, the sequence of the genetic element can be excised from the plasmid. In some embodiments, the plasmid is capable of replication in a bacterial cell. In some embodiments, the plasmid is capable of replication in a mammalian cell (e.g., a human cell). In some embodiments, a plasmid is at least 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 bp in length. In some embodiments, the plasmid is less than 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10,000 bp in length. In some embodiments, the plasmid has a length between 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-4000, or 4000-5000 bp. In some embodiments, the genetic element can be excised from a plasmid (e.g., by in vitro circularization), for example, to form a minicircle, e.g., as described herein. In embodiments, excision of the genetic element separates the genetic element sequence from the plasmid backbone (e.g., separates the genetic element from a bacterial backbone).

[0586] Circular Genetic Element Constructs

[0587] In some embodiments, the genetic element construct is a circular genetic element construct, e.g., lacking a backbone (e.g., lacking a bacterial origin of replication and/or selectable marker). In embodiments, the genetic element is a double-stranded circular genetic element construct. In embodiments, the double-stranded circular genetic element construct is produced by in vitro circularization (IVC), e.g., as described herein. In embodiments, the double-stranded circular genetic element construct can be introduced into a host cell, in which it can be converted into or used as a template for generating single-stranded circular genetic elements, e.g., as described herein. In some embodiments, the circular genetic element construct does not comprise a plasmid backbone or a functional fragment thereof. In some embodiments, the circular genetic element construct is at least 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, or 4500 bp in length. In some embodiments, the circular genetic element construct is less than 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5500, or 6000 bp in length. In some embodiments, the circular genetic element construct is between 2000-2100, 2100-2200, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700-2800, 2800-2900, 2900-3000, 3000-3100, 3100-3200, 3200-3300, 3300-3400, 3400-3500, 3500-3600, 3600-3700, 3700-3800, 3800-3900, 3900-4000, 4000-4100, 4100-4200, 4200-4300, 4300-4400, or 4400-4500 bp in length. In some embodiments, the circular genetic element construct is a minicircle.

[0588] In Vitro Circularization

[0589] In some instances, the genetic element to be packaged into a proteinaceous exterior is a single stranded circular DNA. The genetic element may, in some instances, be introduced into a host cell via a genetic element construct having a form other than a single stranded circular DNA. For example, the genetic element construct may be a double-stranded circular DNA. The double-stranded circular DNA may then be converted into a single-stranded circular DNA in the host cell (e.g., a host cell comprising a suitable enzyme for rolling circle replication, e.g., a CAV Rep protein). In some embodiments, the double-stranded circular DNA is produced by in vitro circularization (IVC), e.g., as described herein.

[0590] Generally, in vitro circularized DNA constructs can be produced by digesting a plasmid comprising the sequence of a genetic element to be packaged, such that the genetic element sequence is excised as a linear DNA molecule. The resultant linear DNA can then be ligated, e.g., using a DNA ligase, to form a double-stranded circular DNA. In some instances, a double-stranded circular DNA produced by in vitro circularization can undergo rolling circle replication, e.g., as described herein. Without wishing to be bound by theory, it is contemplated that in vitro circularization results in a double-stranded DNA construct that can undergo rolling circle replication without further modification, thereby being capable of producing single-stranded circular DNA of a suitable size to be packaged into an CAVector, e.g., as described herein. In some embodiments, the double-stranded DNA construct is smaller than a plasmid (e.g., a bacterial plasmid). In some embodiments, the double-stranded DNA construct is excised from a plasmid (e.g., a bacterial plasmid) and then circularized, e.g., by in vitro circularization.

[0591] Cis/Trans Constructs

[0592] In some embodiments, a genetic element construct as described herein comprises one or more sequences encoding one or more CAV ORFs, e.g., proteinaceous exterior components (e.g., polypeptides encoded by one or more of an CAV VP1, VP2, and/or Apoptin nucleic acid, e.g., as described herein). For example, the genetic element construct may comprise a nucleic acid sequence encoding a CAV VP1 molecule. Such genetic element constructs can be suitable for introducing the genetic element and the CAV ORF(s) into a host cell in cis. In other embodiments, a genetic element construct as described herein does not comprise sequences encoding one or more CAV ORFs, e.g., proteinaceous exterior components (e.g., polypeptides encoded by a CAV VP1 nucleic acid, e.g., as described herein). For example, the genetic element construct may not comprise a nucleic acid sequence encoding a CAV VP1 molecule. Such genetic element constructs can be suitable for introducing the genetic element into a host cell, with the one or more CAV ORFs to be provided in trans (e.g., via introduction of a second genetic element construct encoding one or more of the CAV ORFs, or via a CAV ORF cassette integrated into the genome of the host cell).

[0593] In some embodiments, the genetic element construct comprises a sequence encoding an CAV VP1 molecule, or a splice variant or functional fragment thereof (e.g., a jelly-roll region, e.g., as described herein). In embodiments, the portion of the genetic element that does not comprise the sequence of the genetic element comprises the sequence encoding the CAV VP1 molecule, or splice variant or functional fragment thereof (e.g., in a cassette comprising a promoter and the sequence encoding the CAV VP1 molecule, or splice variant or functional fragment thereof). In further embodiments, the portion of the construct comprising the sequence of the genetic element comprises a sequence encoding a CAV VP1 molecule, or a splice variant or functional fragment thereof (e.g., a jelly-roll region, e.g., as described herein). In embodiments, enclosure of such a genetic element in a proteinaceous exterior (e.g., as described herein) produces a replication-component CAVector (e.g., a CAVector that upon infecting a cell, enables the cell to produce additional copies of the CAVector without introducing further genetic element constructs, e.g., encoding one or more CAV ORFs as described herein, into the cell).

[0594] In other embodiments, the genetic element does not comprise a sequence encoding a CAV VP1 molecule, or a splice variant or functional fragment thereof (e.g., a jelly-roll region, e.g., as described herein). In embodiments, enclosure of such a genetic element in a proteinaceous exterior (e.g., as described herein) produces a replication-incompetent CAVector (e.g., a CAVector that, upon infecting a cell, does not enable the infected cell to produce additional CAVectors, e.g., in the absence of one or more additional constructs, e.g., encoding one or more CAV ORFs as described herein).

[0595] Expression Cassettes

[0596] In some embodiments, a genetic element construct comprises one or more cassettes for expression of a polypeptide or noncoding RNA (e.g., a miRNA or an siRNA). In some embodiments, the genetic element construct comprises a cassette for expression of an effector (e.g., an exogenous or endogenous effector), e.g., a polypeptide or noncoding RNA, as described herein. In some embodiments, the genetic element construct comprises a cassette for expression of a CAV protein (e.g., a CAV VP1, VP2, and/or Apoptin, or a functional fragment thereof). The expression cassettes may, in some embodiments, be located within the genetic element sequence. In embodiments, an expression cassette for an effector is located within the genetic element sequence. In embodiments, an expression cassette for a CAV protein is located within the genetic element sequence. In other embodiments, the expression cassettes are located at a position within the genetic element construct outside of the sequence of the genetic element (e.g., in the backbone). In embodiments, an expression cassette for a CAV protein is located at a position within the genetic element construct outside of the sequence of the genetic element (e.g., in the backbone).

[0597] A polypeptide expression cassette generally comprises a promoter and a coding sequence encoding a polypeptide, e.g., an effector (e.g., an exogenous or endogenous effector as described herein) or a CAV protein (e.g., a sequence encoding a CAV VP1, VP2, and/or Apoptin, or a functional fragment thereof). Exemplary promoters that can be included in an polypeptide expression cassette (e.g., to drive expression of the polypeptide) include, without limitation, constitutive promoters (e.g., CMV, RSV, PGK, EF1a, or SV40), cell or tissue-specific promoters (e.g., skeletal -actin promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, liver albumin promoter, hepatitis B virus core promoter, osteocalcin promoter, bone sialoprotein promoter, CD2 promoter, immunoglobulin heavy chain promoter, T cell receptor a chain promoter, neuron-specific enolase (NSE) promoter, or neurofilament light-chain promoter), and inducible promoters (e.g., zinc-inducible sheep metallothionine (MT) promoter; the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; the T7 polymerase promoter system, tetracycline-repressible system, tetracycline-inducible system, RU486-inducible system, rapamycin-inducible system), e.g., as described herein. In some embodiments, the expression cassette further comprises an enhancer, e.g., as described herein.

[0598] Design and Production of a Genetic Element Construct

[0599] Various methods are available for synthesizing a genetic element construct. For instance, the genetic element construct sequence may be divided into smaller overlapping pieces (e.g., in the range of about 100 bp to about 10 kb segments or individual ORFs) that are easier to synthesize. These DNA segments are synthesized from a set of overlapping single-stranded oligonucleotides. The resulting overlapping synthons are then assembled into larger pieces of DNA, e.g., the genetic element construct. The segments or ORFs may be assembled into the genetic element construct, e.g., by in vitro recombination or unique restriction sites at 5 and 3 ends to enable ligation.

[0600] The genetic element construct can be synthesized with a design algorithm that parses the construct sequence into oligo-length fragments, creating suitable design conditions for synthesis that take into account the complexity of the sequence space. Oligos are then chemically synthesized on semiconductor-based, high-density chips, where over 200,000 individual oligos are synthesized per chip. The oligos are assembled with an assembly techniques, such as BioFab, to build longer DNA segments from the smaller oligos. This is done in a parallel fashion, so hundreds to thousands of synthetic DNA segments are built at one time.

[0601] Each genetic element construct or segment of the genetic element construct may be sequence verified. In some embodiments, high-throughput sequencing of RNA or DNA can take place using AnyDot.chips (Genovoxx, Germany), which allows for the monitoring of biological processes (e.g., miRNA expression or allele variability (SNP detection). Other high-throughput sequencing systems include those disclosed in Venter, J., et al. Science 16 Feb. 2001; Adams, M. et al, Science 24 Mar. 2000; and M. J, Levene, et al. Science 299:682-686, January 2003; as well as US Publication Application No. 20030044781 and 2006/0078937. Overall such systems involve sequencing a target nucleic acid molecule having a plurality of bases by the temporal addition of bases via a polymerization reaction that is measured on a molecule of nucleic acid, i.e., the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. In some embodiments, shotgun sequencing is performed.

[0602] A genetic element construct can be designed such that factors for replicating or packaging may be supplied in cis or in trans, relative to the genetic element. For example, when supplied in cis, the genetic element may comprise one or more genes encoding a CAV VP1, VP2, and/or Apoptin, e.g., as described herein. In some embodiments, replication and/or packaging signals can be incorporated into a genetic element, for example, to induce amplification and/or encapsulation. In some embodiments, an effector is inserted into a specific site in the genome. In some embodiments, one or more viral ORFs are replaced with an effector.

[0603] In another example, when replication or packaging factors are supplied in trans, the genetic element may lack genes encoding one or more of a CAV VP1, VP2, and/or Apoptin, e.g., as described herein; this protein or proteins may be supplied, e.g., by another nucleic acid. In some embodiments, minimal cis signals (e.g., 5 UTR, 3 UTR, and/or GC-rich region) are present in the genetic element. In some embodiments, the genetic element does not encode replication or packaging factors (e.g., replicase and/or capsid proteins). Such factors may, in some embodiments, be supplied by one or more nucleic acids (e.g., a viral nucleic acid, a plasmid, or a nucleic acid integrated into the host cell genome). In some embodiments, the second nucleic acid expresses proteins and/or RNAs sufficient to induce amplification and/or packaging, but may lack its own packaging signals. In some embodiments, the genetic element and the second nucleic acid are introduced into the host cell (e.g., concurrently or separately), resulting in amplification and/or packaging of the genetic element but not of the second nucleic acid.

[0604] In some embodiments, the genetic element construct may be designed using computer-aided design tools.

[0605] General methods of making nucleic acid molecules such as genetic element constructs are described in, for example, Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012).

[0606] Rolling Circle Amplification

[0607] Without wishing to be bound by theory, rolling circle amplification may occur via Rep protein binding to a Rep binding site (e.g., comprising a 5 UTR, e.g., comprising a hairpin loop and/or an origin of replication, e.g., as described herein) positioned 5 relative to (or within the 5 region of) a genetic element region. The Rep protein may then proceed through the genetic element region, resulting in the synthesis of the genetic element. The released genetic element may then be circularized and then enclosed within a proteinaceous exterior to form an CAVector.

[0608] Tandem Constructs

[0609] In some embodiments, the genetic element construct is a tandem construct. Tandem constructs as described herein generally comprise a first genetic element region, which, when not connected to the remainder of the genetic element construct and/or converted to a circular, single-stranded DNA molecule, can be enclosed within a proteinaceous exterior, thereby producing a CAVector. The tandem constructs may further comprise a second genetic element region, or a portion thereof. In some embodiments, the tandem constructs described herein can be used to produce a genetic element suitable for enclosure in a proteinaceous exterior (e.g., comprising a polypeptide encoded by an VP1 nucleic acid), e.g., by rolling circle amplification. In some embodiments, a genetic element suitable for enclosure in the proteinaceous exterior is produced via rolling circle amplification of the first genetic element region.

[0610] In some embodiments, a tandem construct is a genetic element construct comprising a first copy of a genetic element sequence (e.g., a genetic element region) and at least a portion of a second copy of a genetic element sequence (e.g., comprising an uRFS or a dRFS). In some embodiments, the second copy comprises the full sequence of the genetic element. In some embodiments, the second copy comprises a partial sequence of the genetic element (e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the genetic element sequence, e.g., from the 5 end or the 3 end of the genetic element sequence). In some embodiments, the genetic element sequence of the first copy and the genetic element sequence of the second copy are, or are derived from, the same genetic element sequence (e.g., the same CAV sequence). In some embodiments, the genetic element sequence of the first copy and the genetic element sequence of the second copy are, or are derived from, different genetic element sequences (e.g., sequences from different CAVs). In some embodiments, the first copy of the genetic element sequence and the second copy of the genetic element sequence are positioned adjacent to each other on the genetic element construct. In other embodiments, the first copy of the genetic element sequence and the second copy of the genetic element sequence may be separated, e.g., by a spacer region. In some embodiments, the second copy of the genetic element sequence or portion thereof (e.g., comprising an uRFS) is positioned 5 relative to the first copy of the genetic element sequence. In some embodiments, the second copy of the genetic element sequence or portion thereof (e.g., comprising a dRFS) is positioned 3 relative to the first copy of the genetic element sequence.

Effectors

[0611] The compositions and methods described herein can be used to produce a genetic element of an CAVector comprising a sequence encoding an effector (e.g., an exogenous effector or an endogenous effector), e.g., as described herein. The effector may be, in some instances, an endogenous effector or an exogenous effector. In some embodiments, the effector is a therapeutic effector. In some embodiments, the effector comprises a polypeptide (e.g., a therapeutic polypeptide or peptide, e.g., as described herein). In some embodiments, the effector comprises a non-coding RNA (e.g., an miRNA, siRNA, shRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, or gRNA). In some embodiments, the effector comprises a regulatory nucleic acid, e.g., as described herein.

[0612] In some embodiments, the effector-encoding sequence may be inserted into the genetic element e.g., at a non-coding region, e.g., a noncoding region disposed 3 of the open reading frames and 5 of the GC-rich region of the genetic element, in the 5 noncoding region upstream of the TATA box, in the 5 UTR, in the 3 noncoding region downstream of the poly-A signal, or upstream of the GC-rich region. In some embodiments, the effector-encoding sequence may be inserted into the genetic element, e.g., in a coding sequence (e.g., in a sequence encoding a CAV VP1, VP2, and/or Apoptin, e.g., as described herein). In some embodiments, the effector-encoding sequence replaces all or a part of the open reading frame. In some embodiments, the genetic element comprises a regulatory sequence (e.g., a promoter or enhancer, e.g., as described herein) operably linked to the effector-encoding sequence.

[0613] In some embodiments, the genetic element comprising the effector is produced from a genetic element construct (e.g., a tandem construct) as described herein, e.g., by rolling circle replication of a genetic element sequence disposed thereon. In some embodiments, the genetic element construct comprises exactly one copy of the effector-encoding sequence. In some embodiments, the genetic element construct comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) copies of the effector-encoding sequence. In some embodiments, the genetic element construct comprises one full-length copy of the effector-encoding sequence and at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or more) partial copies of the effector-encoding sequence (e.g., partial copies comprising a 5 truncation or 3 truncation of the effector-encoding sequence).

Host Cells

[0614] The CAVectors described herein can be produced, for example, in a host cell. Generally, a host cell is provided that comprises a CAVector genetic element and the components of an CAVector proteinaceous exterior (e.g., a polypeptide encoded by an CAV VP1 nucleic acid or an CAV VP1 molecule). The host cell is then incubated under conditions suitable for enclosure of the genetic element within the proteinaceous exterior (e.g., culture conditions as described herein). In some embodiments, the host cell is further incubated under conditions suitable for release of the CAVector from the host cell, e.g., into the surrounding supernatant. In some embodiments, the host cell is lysed for harvest of CAVectors from the cell lysate. In some embodiments, an CAVector may be introduced to a host cell line grown to a high cell density.

[0615] Introduction of Genetic Elements into Host Cells

[0616] A genetic element or genetic element construct may be introduced into a host cell. In some embodiments, the genetic element itself is introduced into the host cell. In some embodiments, a genetic element construct comprising the sequence of the genetic element (e.g., as described herein) is introduced into the host cell. A genetic element or genetic element construct can be introduced into a host cell, for example, using methods known in the art. For example, a genetic element or genetic element construct can be introduced into a host cell by transfection (e.g., stable transfection or transient transfection). In embodiments, the genetic element or genetic element construct is introduced into the host cell by lipofectamine transfection. In embodiments, the genetic element or genetic element construct is introduced into the host cell by calcium phosphate transfection. In some embodiments, the genetic element or genetic element construct is introduced into the host cell by electroporation. In some embodiments, the genetic element or genetic element construct is introduced into the host cell using a gene gun. In some embodiments, the genetic element or genetic element construct is introduced into the host cell by nucleofection. In some embodiments, the genetic element or genetic element construct is introduced into the host cell by PEI transfection. In some embodiments, the genetic element or genetic element construct is introduced into the host cell by contacting the host cell with a viral vector comprising the genetic element or genetic element construct. In some embodiments, the genetic element is introduced into the host cell by contacting the host cell with a CAVector comprising the genetic element

[0617] In embodiments, the genetic element construct is capable of replication once introduced into the host cell. In embodiments, the genetic element can be produced from the genetic element construct once introduced into the host cell. In some embodiments, the genetic element is produced in the host cell by a polymerase, e.g., using the genetic element construct as a template.

[0618] In some embodiments, the genetic elements or vectors comprising the genetic elements are introduced (e.g., transfected) into cell lines that express a viral polymerase protein in order to achieve expression of the CAVector. To this end, cell lines that express a CAVector polymerase protein may be utilized as appropriate host cells. Host cells may be similarly engineered to provide other viral functions or additional functions.

[0619] To prepare the CAVector disclosed herein, a genetic element construct may be used to transfect cells that provide CAVector proteins and functions required for replication and production. Alternatively, cells may be transfected with a second construct (e.g., a virus) providing CAVector proteins and functions before, during, or after transfection by the genetic element or vector comprising the genetic element disclosed herein. In some embodiments, the second construct may be useful to complement production of an incomplete viral particle. The second construct (e.g., virus) may have a conditional growth defect, such as host range restriction or temperature sensitivity, e.g., which allows the subsequent selection of transfectant viruses. In some embodiments, the second construct may provide one or more replication proteins utilized by the host cells to achieve expression of the CAVector. In some embodiments, the host cells may be transfected with vectors encoding viral proteins such as the one or more replication proteins. In some embodiments, the second construct comprises an antiviral sensitivity.

[0620] The genetic element or vector comprising the genetic element disclosed herein can, in some instances, be replicated and produced into CAVectors using techniques known in the art. For example, various viral culture methods are described, e.g., in U.S. Pat. Nos. 4,650,764; 5,166,057; 5,854,037; European Patent Publication EP 0702085A1; U.S. patent application Ser. No. 09/152,845; International Patent Publications PCT WO97/12032; WO96/34625; European Patent Publication EP-A780475; WO 99/02657; WO 98/53078; WO 98/02530; WO 99/15672; WO 98/13501; WO 97/06270; and EPO 780 47SA1, each of which is incorporated by reference herein in its entirety.

[0621] Methods for Providing CAV Protein(s) in Cis or Trans

[0622] In some embodiments (e.g., cis embodiments described herein), the genetic element construct further comprises one or more expression cassettes comprising a coding sequence for an CAV ORF (e.g., a CAV VP1, VP2, and/or Apoptin, or a functional fragment thereof). In embodiments, the genetic element construct comprises an expression cassette comprising a coding sequence for an CAV VP1, or a splice variant or functional fragment thereof. Such genetic element constructs, which comprise expression cassettes for the effector as well as the one or more CAV ORFs, may be introduced into host cells. Host cells comprising such genetic element constructs may, in some instances, be capable of producing the genetic elements and components for proteinaceous exteriors, and for enclosure of the genetic elements within proteinaceous exteriors, without requiring additional genetic element constructs or integration of expression cassettes into the host cell genome. In other words, such genetic element constructs may be used for cis CAVector production methods in host cells, e.g., as described herein.

[0623] In some embodiments (e.g., trans embodiments described herein), the genetic element does not comprise an expression cassette comprising a coding sequence for one or more CAV ORFs (e.g., an CAV VP1, VP2, and/or Apoptin, or a functional fragment thereof). In embodiments, the genetic element construct does not comprise an expression cassette comprising a coding sequence for an CAV VP1, or a splice variant or functional fragment thereof. Such genetic element constructs, which comprise expression cassettes for the effector but lack expression cassettes for one or more CAV ORFs (e.g., CAV VP1 or a splice variant or functional fragment thereof), may be introduced into host cells. Host cells comprising such genetic element constructs may, in some instances, require additional genetic element constructs or integration of expression cassettes into the host cell genome for production of one or more components of the CAVector (e.g., the proteinaceous exterior proteins). In some embodiments, host cells comprising such genetic element constructs are incapable of enclosure of the genetic elements within proteinaceous exteriors in the absence of an additional nucleic construct encoding an CAV VP1 molecule. In other words, such genetic element constructs may be used for trans CAVector production methods in host cells, e.g., as described herein.

[0624] Helpers

[0625] In some embodiments, a helper construct is introduced into a host cell (e.g., a host cell comprising a genetic element construct or a genetic element as described herein). In some embodiments, the helper construct is introduced into the host cell prior to introduction of the genetic element construct. In some embodiments, the helper construct is introduced into the host cell concurrently with the introduction of the genetic element construct. In some embodiments, the helper construct is introduced into the host cell after introduction of the genetic element construct. In some embodiments, the helper construct is introduced into the host cell via a helper virus comprising the helper construct.

[0626] Exemplary Cell Types

[0627] Exemplary host cells suitable for production of CAVectors include, without limitation, eukaryotic cells (e.g., avian cells, mammalian cells, and insect cells). In some embodiments, the host cell is a human cell or cell line. In some embodiments, the host cell is an avian cell or cell line (e.g., a chicken cell or cell line, e.g., MDCC-MSB1 cells; or a duck cell or cell line, e.g., EB66 cells or AGE.CR cells). In some embodiments, the cell is an immune cell or cell line, e.g., a T cell or cell line, a cancer cell line, a hepatic cell or cell line, a neuron, a glial cell, a skin cell, an epithelial cell, a mesenchymal cell, a blood cell, an endothelial cell, an eye cell, a gastrointestinal cell, a progenitor cell, a precursor cell, a stem cell, a lung cell, a cardiac cell, or a muscle cell. In some embodiments, the host cell is an animal cell (e.g., a mouse cell, rat cell, rabbit cell, hamster cell, or insect cell).

[0628] In some embodiments, the host cell is a lymphoid cell. In some embodiments, the host cell is a T cell or an immortalized T cell. In embodiments, the host cell is a Jurkat cell. In embodiments, the host cell is a MOLT-4 cell. In some embodiments, the host cell is a B cell or an immortalized B cell. In embodiments, the host cell is a Raji cell.

[0629] In some embodiments, the host cell comprises a genetic element construct, e.g., a tandem construct (e.g., as described herein).

[0630] In embodiments, the host cell is a Raji cell, EKVX cell, MRC5 cell, or MCF7 cell. In embodiments, the host cell is a HEK293T cell, HEK293F cell, A549 cell, Jurkat cell, Chang cell, HeLa cell Phoenix cell, MRC-5 cell, NCI-H292 cell, or Wi38 cell. In some embodiments, the host cell is a non-human primate cell (e.g., a Vero cell, CV-1 cell, or LLCMK2 cell). In some embodiments, the host cell is a murine cell (e.g., a McCoy cell). In some embodiments, the host cell is a hamster cell (e.g., a CHO cell or BHK 21 cell). In some embodiments, the host cell is a MARC-145, MDBK, RK-13, or EEL cell. In some embodiments, the host cell is an epithelial cell (e.g., a cell line of epithelial lineage).

[0631] In some embodiments, the CAVector is cultivated in continuous animal cell line (e.g., immortalized cell lines that can be serially propagated). According to one embodiment of the invention, the cell lines may include porcine cell lines. The cell lines envisaged in the context of the present invention include immortalised porcine cell lines such as, but not limited to the porcine kidney epithelial cell lines PK-15 and SK, the monomyeloid cell line 3D4/31 and the testicular cell line ST.

Culture Conditions

[0632] Host cells comprising a genetic element and components of a proteinaceous exterior can be incubated under conditions suitable for enclosure of the genetic element within the proteinaceous exterior, thereby producing an CAVector. Suitable culture conditions include those described. In some embodiments, the host cells are incubated in liquid media (e.g., RPMI (e.g., supplemented with FBS, e.g., 10% FBS), EX-CELL EBx GRO-I serume-free medium (e.g., supplemented with 1-glutamine), HyClone CDM4Avian medium (e.g., supplemented with 1-glutamine), Optipro SFM, Grace's Supplemented (TNM-FH), IPL-41, TC-100, Schneider's Drosophila, SF-900 II SFM, or EXPRESS-FIVE SFM). In some embodiments, the host cells are incubated in adherent culture. In some embodiments, the host cells are incubated in suspension culture. In some embodiments, the host cells are incubated in a tube, bottle, microcarrier, or flask. In some embodiments, the host cells are incubated in a dish or well (e.g., a well on a plate). In some embodiments, the host cells are incubated under conditions suitable for proliferation of the host cells. In some embodiments, the host cells are incubated under conditions suitable for the host cells to release CAVectors produced therein into the surrounding supernatant.

[0633] The production of CAVector-containing cell cultures according to the present invention can be carried out in different scales (e.g., in flasks, roller bottles or bioreactors). The media used for the cultivation of the cells to be infected generally comprise the standard nutrients required for cell viability, but may also comprise additional nutrients dependent on the cell type. Optionally, the medium can be protein-free and/or serum-free. Depending on the cell type the cells can be cultured in suspension or on a substrate. In some embodiments, different media is used for growth of the host cells and for production of CAVectors.

Harvest and Purification

[0634] CAVectors produced by host cells can be harvested, e.g., according to methods known in the art. For example, CAVectors released into the surrounding supernatant by host cells in culture can be harvested from the supernatant. In some embodiments, the supernatant is separated from the host cells to obtain the CAVectors. In some embodiments, the host cells are lysed before or during harvest. In some embodiments, the CAVectors are harvested from the host cell lysates. In some embodiments, the CAVectors are harvested from both the host cell lysates and the supernatant. In some embodiments, the purification and isolation of CAVectors is performed according to known methods in virus production, for example, as described in Rinaldi, et al., DNA Vaccines: Methods and Protocols (Methods in Molecular Biology), 3rd ed. 2014, Humana Press (incorporated herein by reference in its entirety). In some embodiments, the CAVector may be harvested and/or purified by separation of solutes based on biophysical properties, e.g., size, density, charge. In one embodiment, CAVectors are purified from cells or cell culture by density gradient centrifugation and/or ultracentrifugation, e.g., sucrose density gradient centrifugation or cesium chloride density gradient centrifugation. For example, a CAVector preparation is enriched or purified by (a) optionally lysing host cells from the host cell culture, (b) optionally eliminating cellular debris from the host cell culture to generate a soluble fraction of the cell culture, (c) performing density gradient centrifugation and/or ultracentrifugation on the soluble fraction, and (d) collecting the enriched CAVector preparation from the density gradient. Other steps, such as sucrose cushion centrifugation/ultracentrifugation, ion exchange chromatography, and/or tangential flow filtration, may be performed prior to formulation with a pharmaceutical excipient.

[0635] Harvested CAVectors can be purified and/or enriched, e.g., to produce a CAVector preparation. In some embodiments, the harvested CAVectors are isolated from other constituents or contaminants present in the harvest solution, e.g., using methods known in the art for purifying viral particles (e.g., purification by sedimentation, chromatography, and/or ultrafiltration). In some embodiments, the purification steps comprise removing one or more of serum, host cell DNA, host cell proteins, particles lacking the genetic element, and/or phenol red from the preparation. In some embodiments, the harvested CAVectors are enriched relative to other constituents or contaminants present in the harvest solution, e.g., using methods known in the art for enriching viral particles.

[0636] In some embodiments, the resultant preparation or a pharmaceutical composition comprising the preparation will be stable over an acceptable period of time and temperature, and/or be compatible with the desired route of administration and/or any devices this route of administration will require, e.g., needles or syringes.

II. CAVectors

[0637] In some aspects, the invention described herein comprises compositions and methods of using and making CAVectors, CAVector preparations, and therapeutic compositions. In some embodiments, the CAVectors are made using a genetic element construct as described herein. In some embodiments, the CAVector comprises one or more nucleic acids or polypeptides comprising a sequence, structure, and/or function that is based on a CAV (e.g., a CAV as described herein), or fragments or portions thereof, or other substantially non-pathogenic virus, e.g., a symbiotic virus, commensal virus, native virus. In some embodiments, a CAV-based CAVector comprises at least one element exogenous to that CAV, e.g., an exogenous effector or a nucleic acid sequence encoding an exogenous effector disposed within a genetic element of the CAVector. In some embodiments, a CAV-based CAVector comprises at least one element heterologous to another element from that CAV, e.g., an effector-encoding nucleic acid sequence that is heterologous to another linked nucleic acid sequence, such as a promoter element. In some embodiments, an CAVector comprises a genetic element (e.g., circular DNA, e.g., single stranded DNA), which comprise at least one element that is heterologous relative to the remainder of the genetic element and/or the proteinaceous exterior (e.g., an exogenous element encoding an effector, e.g., as described herein). A CAVector may be a delivery vehicle (e.g., a substantially non-pathogenic delivery vehicle) for a payload into a host, e.g., a human. In some embodiments, the CAVector is capable of replicating in a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell. In some embodiments, the CAVector is substantially non-pathogenic and/or substantially non-integrating in the mammalian (e.g., human) cell. In some embodiments, the CAVector is replication-deficient. In some embodiments, the CAVector is replication-competent.

[0638] In an aspect, the invention includes a CAVector comprising (i) a genetic element comprising a promoter element, a sequence encoding an effector, (e.g., an endogenous effector or an exogenous effector, e.g., a payload), and a protein binding sequence (e.g., an exterior protein binding sequence, e.g., a packaging signal), wherein the genetic element is a single-stranded DNA, and has one or both of the following properties: is circular and/or integrates into the genome of a eukaryotic cell at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic element that enters the cell; and (ii) a proteinaceous exterior; wherein the genetic element is enclosed within the proteinaceous exterior; and wherein the CAVector is capable of delivering the genetic element into a eukaryotic cell.

[0639] In some embodiments, the protein binding sequence comprises a packaging signal, e.g., suitable to permit packaging of the genetic element into a proteinaceous exterior comprising a CAV VP1 molecule. In embodiments, the protein binding sequence (e.g., the packaging signal) comprises the nucleic acid sequence AGCCCTGAAAAGGGGGGGGGGCTAAAGCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATT CCCCCCCAGACCCCCCCTTTATATAGCACTCAATAAACGCAGAAAATAGATTTATCGCACTA TC (SEQ ID NO: 17), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, or a reverse complement thereof.

[0640] In some embodiments of the CAVector described herein, the genetic element integrates at a frequency of less than about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the genetic element that enters a cell. In some embodiments, less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, or 5% of the genetic elements from a plurality of the CAVectors administered to a subject will integrate into the genome of one or more host cells in the subject. In some embodiments, the genetic elements of a population of CAVectors, e.g., as described herein, integrate into the genome of a host cell at a frequency less than that of a comparable population of AAV viruses, e.g., at about a 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more lower frequency than the comparable population of AAV viruses.

[0641] In an aspect, the invention includes a CAVector comprising: (i) a genetic element comprising a promoter element and a sequence encoding an effector (e.g., an endogenous effector or an exogenous effector, e.g., a payload), and a protein binding sequence (e.g., an exterior protein binding sequence), wherein the genetic element has at least 75% (e.g., at least 75, 76, 77, 78, 79, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) sequence identity to a wild-type CAV sequence, e.g., a wild-type CAV sequence as described herein; and (ii) a proteinaceous exterior; wherein the genetic element is enclosed within the proteinaceous exterior; and wherein the CAVector is capable of delivering the genetic element into a eukaryotic cell.

[0642] In one aspect, the invention includes an CAVector comprising: [0643] a) a genetic element comprising (i) a sequence encoding an exterior protein (e.g., a non-pathogenic exterior protein), (ii) an exterior protein binding sequence that binds the genetic element to the non-pathogenic exterior protein, and (iii) a sequence encoding an effector (e.g., an endogenous or exogenous effector); and [0644] b) a proteinaceous exterior that is associated with, e.g., envelops, encapsidates, or encloses, the genetic element.

[0645] In some embodiments, the CAVector includes sequences or expression products from (or having >70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% homology to) a non-enveloped, circular, single-stranded DNA virus. Animal circular single-stranded DNA viruses generally refer to a subgroup of single strand DNA (ssDNA) viruses, which infect eukaryotic non-plant hosts, and have a circular genome. Thus, animal circular ssDNA viruses are distinguishable from ssDNA viruses that infect prokaryotes (i.e. Microviridae and Inoviridae) and from ssDNA viruses that infect plants (i.e. Geminiviridae and Nanoviridae). They are also distinguishable from linear ssDNA viruses that infect non-plant eukaryotes (i.e. Parvoviridiae).

[0646] In some embodiments, the CAVector modulates a host cellular function, e.g., transiently or long term. In certain embodiments, the cellular function is stably altered, such as a modulation that persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or longer or any time therebetween. In certain embodiments, the cellular function is transiently altered, e.g., such as a modulation that persists for no more than about 30 mins to about 7 days, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time therebetween.

[0647] In some embodiments, the genetic element comprises a promoter element. In embodiments, the promoter element is selected from an RNA polymerase II-dependent promoter, an RNA polymerase III-dependent promoter, a PGK promoter, a CMV promoter, an EF-1 promoter, an SV40 promoter, a CAGG promoter, or a UBC promoter, TTV viral promoters, Tissue specific, U6 (pollIII), minimal CMV promoter with upstream DNA binding sites for activator proteins (TetR-VP16, Gal4-VP16, dCas9-VP16, etc). In embodiments, the promoter element comprises a TATA box. In embodiments, the promoter element is endogenous to a wild-type CAV, e.g., as described herein.

[0648] In some embodiments, the genetic element comprises one or more of the following characteristics: single-stranded, circular, negative strand, and/or DNA. In embodiments, the genetic element comprises an episome. In some embodiments, the portions of the genetic element excluding the effector have a combined size of about 1-5 kb (e.g., about 2.8-4 kb, about 2.8-3.2 kb, about 3.6-3.9 kb, or about 2.8-2.9 kb), less than about 5 kb (e.g., less than about 2.9 kb, 3.2 kb, 3.6 kb, 3.9 kb, or 4 kb), or at least 100 nucleotides (e.g., at least 1 kb). In certain embodiments, the portions of the genetic element excluding the effector have a combined size of about 0.5-1 kb, 1-1.5 kb, 1.5-2 kb, 2-2.5 kb, 2.5-3 kb, or 3-3.5 kb.

[0649] The CAVectors, compositions comprising CAVectors, methods using such CAVectors, etc., as described herein are, in some instances, based in part on the examples which illustrate how different effectors, for example miRNAs (e.g. against IFN or miR-625), shRNA, etc and protein binding sequences, for example DNA sequences that bind to capsid protein such as Q99153, are combined with proteinaceious exteriors, for example a capsid disclosed in Arch Virol (2007) 152: 1961-1975, to produce CAVectors which can then be used to deliver an effector to cells (e.g., animal cells, e.g., human cells or non-human animal cells such as pig or mouse cells). In embodiments, the effector can silence expression of a factor such as an interferon. The examples further describe how CAVectors can be made by inserting effectors into sequences derived, e.g., from an CAV. It is on the basis of these examples that the description hereinafter contemplates various variations of the specific findings and combinations considered in the examples. For example, the skilled person will understand from the examples that the specific miRNAs are used just as an example of an effector and that other effectors may be, e.g., other regulatory nucleic acids or therapeutic peptides. Similarly, the specific capsids used in the examples may be replaced by substantially non-pathogenic proteins described hereinafter. The specific CAV sequences described in the examples may also be replaced by the CAV sequences described hereinafter. These considerations similarly apply to protein binding sequences, regulatory sequences such as promoters, and the like. Independent thereof, the person skilled in the art will in particular consider such embodiments which are closely related to the examples.

[0650] In some embodiments, a CAVector, or the genetic element comprised in the CAVector, is introduced into a cell (e.g., a human cell). In some embodiments, the effector (e.g., an RNA, e.g., an miRNA), e.g., encoded by the genetic element of an CAVector, is expressed in a cell (e.g., a human cell), e.g., once the CAVector or the genetic element has been introduced into the cell. In embodiments, introduction of the CAVector, or genetic element comprised therein, into a cell modulates (e.g., increases or decreases) the level of a target molecule (e.g., a target nucleic acid, e.g., RNA, or a target polypeptide) in the cell, e.g., by altering the expression level of the target molecule by the cell. In embodiments, introduction of the CAVector, or genetic element comprised therein, decreases level of interferon produced by the cell. In embodiments, introduction of the CAVector, or genetic element comprised therein, into a cell modulates (e.g., increases or decreases) a function of the cell. In embodiments, introduction of the CAVector, or genetic element comprised therein, into a cell modulates (e.g., increases or decreases) the viability of the cell. In embodiments, introduction of the CAVector, or genetic element comprised therein, into a cell decreases viability of a cell (e.g., a cancer cell).

[0651] In some embodiments, a CAVector (e.g., a synthetic CAVector) described herein induces an antibody prevalence of less than 70% (e.g., less than about 60%, 50%, 40%, 30%, 20%, or 10% antibody prevalence). In embodiments, antibody prevalence is determined according to methods known in the art. In embodiments, antibody prevalence is determined by detecting antibodies against an CAV (e.g., as described herein), or an CAVector based thereon, in a biological sample, e.g., according to the anti-TTV antibody detection method described in Tsuda et al. (1999; J. Virol. Methods 77: 199-206; incorporated herein by reference) and/or the method for determining anti-TTV IgG seroprevalence described in Kakkola et al. (2008; Virology 382: 182-189; incorporated herein by reference). Antibodies against an CAV or an CAVector based thereon can also be detected by methods in the art for detecting anti-viral antibodies, e.g., methods of detecting anti-AAV antibodies, e.g., as described in Calcedo et al. (2013; Front. Immunol. 4(341): 1-7; incorporated herein by reference).

[0652] In some embodiments, a replication deficient, replication defective, or replication incompetent genetic element does not encode all of the necessary machinery or components required for replication of the genetic element. In some embodiments, a replication defective genetic element does not encode a replication factor. In some embodiments, a replication defective genetic element does not encode one or more ORFs (e.g., CAV VP1, VP2, and/or Apoptin, e.g., as described herein). In some embodiments, the machinery or components not encoded by the genetic element may be provided in trans (e.g., using a virus or plasmid, or encoded in a nucleic acid also comprised by the host cell and/or surrounding medium, e.g., integrated into the genome of the host cell), e.g., such that the replication deficient, replication defective, or replication incompetent genetic element can undergo replication in the presence of the machinery or components provided in trans.

[0653] In some embodiments, a packaging deficient, packaging defective, or packaging incompetent genetic element cannot be packaged into a proteinaceous exterior (e.g., wherein the proteinaceous exterior comprises a capsid or a portion thereof, e.g., comprising a polypeptide encoded by a CAV VP1 nucleic acid, e.g., as described herein). In some embodiments, a packaging deficient genetic element is packaged into a proteinaceous exterior at an efficiency less than 10% (e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, or 0.001%) compared to a wild-type CAV (e.g., as described herein). In some embodiments, the packaging defective genetic element cannot be packaged into a proteinaceous exterior even in the presence of factors (e.g., VP1, VP2, and/or Apoptin) that would permit packaging of the genetic element of a wild-type CAV (e.g., as described herein). In some embodiments, a packaging deficient genetic element is packaged into a proteinaceous exterior at an efficiency less than 10% (e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, or 0.001%) compared to a wild-type CAV (e.g., as described herein), even in the presence of factors (e.g., CAV VP1, VP2, and/or Apoptin) that would permit packaging of the genetic element of a wild-type CAV (e.g., as described herein).

[0654] In some embodiments, a packaging competent genetic element can be packaged into a proteinaceous exterior (e.g., wherein the proteinaceous exterior comprises a capsid or a portion thereof, e.g., comprising a polypeptide encoded by an VP1 nucleic acid, e.g., as described herein). In some embodiments, a packaging competent genetic element is packaged into a proteinaceous exterior at an efficiency of at least 20% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, or higher) compared to a wild-type CAV (e.g., as described herein). In some embodiments, the packaging competent genetic element can be packaged into a proteinaceous exterior in the presence of factors (e.g., VP1, VP2, and/or Apoptin) that would permit packaging of the genetic element of a wild-type CAV (e.g., as described herein). In some embodiments, a packaging competent genetic element is packaged into a proteinaceous exterior at an efficiency of at least 20% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, or higher) compared to a wild-type CAV (e.g., as described herein) in the presence of factors (e.g., VP1, VP2, and/or Apoptin) that would permit packaging of the genetic element of a wild-type CAV (e.g., as described herein).

Chicken Anemia Viruses (CAV)

[0655] In some embodiments, a CAVector, e.g., as described herein, comprises sequences or expression products derived from or similar to a wild-type chicken anemia virus (CAV). In some embodiments, a CAVector includes one or more sequences or expression products that are exogenous relative to a wild-type CAV. In some embodiments, a CAVector includes one or more sequences or expression products that are endogenous relative to the wild-type CAV. In some embodiments, a CAVector includes one or more sequences or expression products that are heterologous relative to one or more other sequences or expression products in the CAVector. CAVs generally have single-stranded circular DNA genomes with negative polarity. CAVs have not generally been linked to any human disease, nor are thought to infect human cells (see, e.g., Shulman and Davidson 2017, Ann. Rev. Virol. 4: 159-180; and Fatoba and Adeleke 2019, Acta Virologica 63: 19-25; each of which is incorporated by reference herein in their entirety).

[0656] In some embodiments, the genetic element comprises a nucleotide sequence encoding an amino acid sequence or a functional fragment thereof or a sequence having at least about 60%, 70% 80%, 85%, 90% 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences described herein, e.g., a CAV polypeptide sequence.

[0657] In some embodiments, an CAVector as described herein comprises one or more nucleic acid molecules (e.g., a genetic element as described herein) comprising a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a CAV nucleic acid sequence, e.g., as described herein, or a fragment thereof.

[0658] In some embodiments, a CAVector as described herein comprises one or more nucleic acid molecules (e.g., a genetic element as described herein) comprising a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more of a 5 UTR, repeat region, CAAT signal, TATA box, VP2 gene, Apoptin gene, VP1, 3 UTR, GC-rich region, polyA signal sequence, or any combination thereof, of a CAV, e.g., as described herein. In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein, e.g., a VP1, VP2, and/or Apoptin sequence of any of the CAVs described herein. In embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a CAV VP1 protein (or a splice variant or functional fragment thereof) or a polypeptide encoded by an CAV VP1 nucleic acid.

[0659] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 1A, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the repeat region nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAAT signal nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the TATA box nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the GC-rich nucleotide sequence of Table 1A. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the polyA signal nucleotide sequence of Table 1A.

[0660] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 1B, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 1B. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 1B.

[0661] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 2, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-6 of the full nucleic acid sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 995-2319 of the full nucleic acid sequence of Table 2. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 7-994 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 2. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 2.

[0662] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 3, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-206 of the full nucleic acid sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1195-2319 of the full nucleic acid sequence of Table 3. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 207-1194 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 3. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 3.

[0663] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 4, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-406 of the full nucleic acid sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1395-2319 of the full nucleic acid sequence of Table 4. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 407-1394 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 4. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 4.

[0664] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 5, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-606 of the full nucleic acid sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1595-2319 of the full nucleic acid sequence of Table 5. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 607-1594 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 5. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 5.

[0665] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 6, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-806 of the full nucleic acid sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1795-2319 of the full nucleic acid sequence of Table 6. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 807-1794 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 6. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 6.

[0666] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 7, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-1006 of the full nucleic acid sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1995-2319 of the full nucleic acid sequence of Table 7. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1007-1994 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 7. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 7.

[0667] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 8, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-1206 of the full nucleic acid sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 2195-2319 of the full nucleic acid sequence of Table 8. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1207-2194 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 8. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 8.

[0668] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 9, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-1271 of the full nucleic acid sequence of Table 9. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1272-2319 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, or 950-987 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nLuc insert nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 9. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 9.

[0669] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 10, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-546 of the full nucleic acid sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 2133-2319 of the full nucleic acid sequence of Table 10. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 547-2134 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, 950-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, or 1500-1587 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the iCRE insert nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 10. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 10.

[0670] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 11, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-606 of the full nucleic acid sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1798-2319 of the full nucleic acid sequence of Table 11. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 607-1797 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, 950-1000, 1000-1100, or 1100-1190 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the GFP insert nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 11. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 11.

[0671] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 12, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-606 of the full nucleic acid sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 2015-2319 of the full nucleic acid sequence of Table 12. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 607-2014 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, 950-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, or 1400-1407 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Glue insert nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 12. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 12.

[0672] In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the full nucleic acid sequence of Table 13, or a contiguous sequence of 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, or 2300-2319 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-606 of the full nucleic acid sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1790-2319 of the full nucleic acid sequence of Table 13. In embodiments, the nucleic acid molecule does not comprise a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 607-1789 of the full nucleic acid sequence of Table 1B, or a contiguous sequence of between 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 100-150, 150-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-950, 950-1000, 1000-1100, or 1100-1182 nucleotides therein. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the mCherry insert nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 5 UTR nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP2 nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the Apoptin nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the VP1 nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP2 nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the Apoptin nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity to a polypeptide encoded by the VP1 nucleotide sequence of Table 13. In embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the 3 UTR nucleotide sequence of Table 13.

[0673] In some embodiments, the genetic element comprises a nucleotide sequence encoding an amino acid sequence or a functional fragment thereof or a sequence having at least about 60%, 70% 80%, 85%, 90% 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of the amino acid sequences described herein, e.g., a CAV amino acid sequence, e.g., as listed in or encoded by a sequence listed in any of Tables 1-17.

[0674] In some embodiments, a CAVector as described herein comprises one or more nucleic acid molecules (e.g., a genetic element as described herein) comprising a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a CAV sequence, e.g., as described herein, or a fragment thereof. In embodiments, the CAVector comprises a nucleic acid sequence selected from a sequence as shown in any of Tables 1-17, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In embodiments, the CAVector comprises a polypeptide comprising an amino acid sequence encoded by a sequence as shown in any of Tables 1-17, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto.

[0675] In some embodiments, a CAVector as described herein comprises one or more nucleic acid molecules (e.g., a genetic element as described herein) comprising a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more of a 5 UTR, repeat region, CAAT signal, TATA box, VP2 gene, Apoptin gene, VP1, 3 UTR, GC-rich region, polyA signal sequence, or any combination thereof, of any of the CAVs described herein. In some embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein (e.g., a VP1 molecule), a VP2 molecule, and/or a Apoptin molecule of any of the CAVs described herein. In embodiments, the nucleic acid molecule comprises a sequence encoding a capsid protein comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a CAV VP1 molecule (e.g., an VP1 amino acid sequence as shown in any of Tables 1-17, or an VP1 amino acid sequence encoded by a nucleic acid sequence as shown in any of Tables 1-17).

[0676] In some embodiments, a CAVector comprises a genetic element comprising a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP1 molecule encoded by a CAV genome sequence listed in any of Tables 1-17. In some embodiments, a CAVector comprises a genetic element comprising a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP2 molecule encoded by a CAV genome sequence listed in any of Tables 1-17. In some embodiments, a CAVector comprises a genetic element comprising a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Apoptin molecule encoded by a CAV genome sequence listed in any of Tables 1-17.

[0677] In some embodiments, a CAVector comprises a genetic element that does not comprise a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP1 molecule encoded by a CAV genome sequence listed in any of Tables 1-17. In some embodiments, a CAVector comprises a genetic element that does not comprise a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP2 molecule encoded by a CAV genome sequence listed in any of Tables 1-17. In some embodiments, a CAVector comprises a genetic element that does not comprise a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Apoptin molecule encoded by a CAV genome sequence listed in any of Tables 1-17.

TABLE-US-00001 TABLE1A Exemplarychickenanemiavirus(CAV)nucleicacidsequence NameCAVisolateCuxhaven1 Genus/CladeGyrovirus AccessionNumberM55918 FullSequence:2313bp CGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGGACGAAT 60 CGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTGGCCCCC 120 CTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACGTCATCC 180 GTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGCGTACAG 240 GGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGAAAATGG 300 GCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATACGCAAG 360 GCGGTCCGGGTGGATGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGAATCGGC 420 GCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAATTTCAAA 480 TGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCACCAACAA 540 GTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTGGAATTA 600 CAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAA 660 CTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCGATCAAC 720 CCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCGAGCTAA 780 AAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAACCGCAAAAAGGCGTATAAGAC 840 TGTAAGATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGAAGAGGA 900 CGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAG 960 CGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGT 1020 GTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTC 1080 ACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTAC 1140 GGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAAC 1200 CTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCT 1260 AAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCC 1320 TCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCT 1380 TGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGG 1440 GGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAG 1500 GGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGAC 1560 GATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCGATGACG 1620 GGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATG 1680 CCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATG 1740 AATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCA 1800 CTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAAC 1860 CACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCG 1920 CTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACT 1980 AATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGC 2040 ACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGC 2100 GTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGG 2160 GCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAAGCCCCC 2220 CCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATAGCACTC 2280 AATAAACGCAGAAAATAGATTTATCGCACTATC 2313 (SEQIDNO:1) PutativeDomain Baserange 5UTR 1-374 RepeatRegion 138-254 CAATSignal 255-260 TATABox 317-322 VP2 374-1024 Apoptin 480-845 VP1 847-2196 3UTR 2197-2313 GC-RichRegion 2200-2266 PolyASignalSequence 2281-2286

TABLE-US-00002 TABLE1B Alternateexemplarychickenanemiavirus(CAV)nucleicacidsequence NameCAVisolateCuxhaven1 Genus/CladeGyrovirus AccessionNumberM55918 FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGATGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAAATGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGAT 660 CTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCG 720 ATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCG 780 AGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAACCGCAAAAAGGCGTA 840 TAAGACTGTAAGATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGA 900 AGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGG 960 AGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACG 1020 TATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATC 1080 TTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCAC 1140 ATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCA 1200 ATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGAC 1260 GGGTCTAAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAAC 1320 GTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACG 1380 GACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATG 1440 TTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAG 1500 AATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGT 1560 CGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCG 1620 ATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCT 1680 GCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGC 1740 TGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:100) Annotations: PutativeDomain Baserange 5UTR 1-379 VP2 380-1030 Apoptin 485-851 VP1 853-2202 3UTR 2203-2319

TABLE-US-00003 TABLE2 CAV-nLuc1nucleicacidsequence NameCAV-nLuc1mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 60 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 120 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 180 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 240 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 300 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 360 TCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACC 420 AAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTC 480 CGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCA 540 TCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGG 600 TGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCG 660 ACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGT 720 TCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACG 780 AGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCG 840 GCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGAGTTTGGACAAAC 900 CACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTT 960 ATTTGTAACCATTATAAGCTGCAATAAACAAGTTCCTTTCACAACCCCCGCCCCGGTACG 1020 TATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATC 1080 TTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCAC 1140 ATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCA 1200 ATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGAC 1260 GGGTCTAAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAAC 1320 GTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACG 1380 GACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATG 1440 TTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAG 1500 AATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGT 1560 CGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCG 1620 ATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCT 1680 GCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGC 1740 TGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:2) Annotations: PutativeDomain Baserange nLucinsert 7-994 5UTR 1-6 VP2 995-1030 Apoptin N/A VP1 995-2202 3UTR 2203-2319

TABLE-US-00004 TABLE3 CAV-nLuc2nucleicacidsequence NameCAV-nLuc2mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGT 240 CCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA 300 GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATT 360 AGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTT 420 CCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCG 480 CCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTT 540 GCAAAAAGCTGCCACCATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGAC 600 AGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAA 660 TCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAA 720 GATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGAT 780 CGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCA 840 CTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCC 900 GTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAA 960 CGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGT 1020 AACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATAC 1080 ATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAA 1140 ATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTGCCTCA 1200 ATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGAC 1260 GGGTCTAAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAAC 1320 GTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACG 1380 GACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATG 1440 TTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAG 1500 AATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGT 1560 CGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCG 1620 ATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCT 1680 GCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGC 1740 TGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCC 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATCCCTTTATATA 2319 (SEQIDNO:3) Annotations: PutativeDomain Baserange nLucinsert 207-1194 5UTR 1-206 VP2 N/A Apoptin N/A VP1 1194-2202 3UTR 2203-2319

TABLE-US-00005 TABLE4 CAV-nLuc3nucleicacidsequence NameCAV-nLuc3mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCCTGTGGAATGTGTG 420 TCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCA 480 TCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTAT 540 GCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCC 600 GCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTAT 660 TTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTT 720 TTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGGTCTTCACACTCGAAGATTTC 780 GTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGT 840 GTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTG 900 AGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGC 960 GGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCAT 1020 CACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATG 1080 ATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACT 1140 GTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGAC 1200 GGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGC 1260 ATTCTGGCGTAATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA 1320 AAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCT 1380 GCAATAAACAAGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATG 1440 TTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAG 1500 AATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGT 1560 CGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCG 1620 ATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCT 1680 GCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGC 1740 TGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:4) Annotations: PutativeDomain Baserange nLucinsert 407-1394 5UTR 1-379 VP2 380-406 Apoptin N/A VP1 1394-2202 3UTR 2203-2319

TABLE-US-00006 TABLE5 CAV-nLuc4nucleicacidsequence NameCAV-nLuc4mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 660 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 720 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 780 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 840 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 900 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 960 TCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACC 1020 AAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTC 1080 CGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCA 1140 TCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGG 1200 TGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCG 1260 ACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGT 1320 TCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACG 1380 AGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCG 1440 GCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGAGTTTGGACAAAC 1500 CACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTT 1560 ATTTGTAACCATTATAAGCTGCAATAAACAAGTTACCGGTGGCAAAAAGGCGGACAACCG 1620 ATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCT 1680 GCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGC 1740 TGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:5) Annotations: PutativeDomain Baserange nLucinsert 607-1594 5UTR 1-379 VP2 380-606 Apoptin 486-606 VP1 1595-2202 3UTR 2203-2319

TABLE-US-00007 TABLE6 CAV-nLuc5nucleicacidsequence NameCAV-nLuc5mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGAT 660 CTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCG 720 ATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCG 780 AGCTAAAAGAAAGCTTGATTACCACTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGT 840 CCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA 900 GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATT 960 AGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTT 1020 CCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCG 1080 CCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTT 1140 GCAAAAAGCTGCCACCATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGAC 1200 AGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAA 1260 TCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAA 1320 GATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGAT 1380 CGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCA 1440 CTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCC 1500 GTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAA 1560 CGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGT 1620 AACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATAC 1680 ATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAA 1740 ATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:6) Annotations: PutativeDomain Baserange nLucinsert 807-1794 5UTR 1-379 VP2 380-806 Apoptin 486-806 VP1 1795-2202 3UTR 2203-2319

TABLE-US-00008 TABLE7 CAV-nLuc6nucleicacidsequence NameCAV-nLuc6mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGAT 660 CTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCG 720 ATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCG 780 AGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAACCGCAAAAAGGCGTA 840 TAAGACTGTAAGTTGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGA 900 AGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGG 960 AGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCTGTGGAATGTGTG 1020 TCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCA 1080 TCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTAT 1140 GCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCC 1200 GCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTAT 1260 TTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTT 1320 TTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGGTCTTCACACTCGAAGATTTC 1380 GTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGT 1440 GTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTG 1500 AGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGC 1560 GGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCAT 1620 CACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATG 1680 ATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACT 1740 GTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGAC 1800 GGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGC 1860 ATTCTGGCGTAATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA 1920 AAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCT 1980 GCAATAAACAAGTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:7) Annotations: PutativeDomain Baserange nLucinsert 1007-1994 5UTR 1-379 VP2 380-1006 Apoptin 486-851 VP1 853-1006;1995-2202 3UTR 2203-2319

TABLE-US-00009 TABLE8 CAV-nLuc7nucleicacidsequence NameCAV-nLuc7mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGAT 660 CTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCG 720 ATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCG 780 AGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAACCGCAAAAAGGCGTA 840 TAAGACTGTAAGTTGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGA 900 AGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGG 960 AGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACG 1020 TATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATC 1080 TTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCAC 1140 ATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCA 1200 ATGAACCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 1260 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 1320 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 1380 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 1440 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 1500 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 1560 TCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACC 1620 AAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTC 1680 CGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCA 1740 TCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGG 1800 TGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCG 1860 ACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGT 1920 TCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACG 1980 AGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCG 2040 GCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGAGTTTGGACAAAC 2100 CACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTT 2160 ATTTGTAACCATTATAAGCTGCAATAAACAAGTTAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:8) Annotations: PutativeDomain Baserange nLucinsert 1207-2194 5UTR 1-379 VP2 380-1030 Apoptin 486-851 VP1 853-1206;2195-2202 3UTR 2203-2319

TABLE-US-00010 TABLE9 CAV-nLuc8nucleicacidsequence NameCAV-nLuc8mutant Genus/CladeGyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGATGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAAATGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGAT 660 CTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCG 720 ATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCG 780 AGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAACCGCAAAAAGGCGTA 840 TAAGACTGTAAGATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGA 900 AGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGG 960 AGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACG 1020 TATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATC 1080 TTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCAC 1140 ATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCA 1200 ATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGAC 1260 GGGTCTAAATCCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAG 1380 CAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCC 1440 CAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAG 1500 TCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGC 1560 CCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGC 1620 TATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCAC 1680 CATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCT 1740 GGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGT 1800 AACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGT 1860 CATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAA 1920 GGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGT 1980 AATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGC 2040 CGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTAT 2100 CGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGT 2160 GACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGAGTTTGGA 2220 CAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATT 2280 GCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT 2319 Annotations: PutativeDomain Baserange nLucinsert 1272-2319 5UTR 1-379 VP2 380-1030 Apoptin 486-851 VP1 853-1271 3UTR N/A

TABLE-US-00011 TABLE10 CRE-CAVectornucleicacidsequence Name CRE-CAVector Genus/Clade Gyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 660 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 720 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 780 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 840 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 900 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 960 TGCCCAAGAAGAAGAGGAAAGTCTCCAACCTGCTGACTGTGCACCAAAACCTGCCTGCCC 1020 TCCCTGTGGATGCCACCTCTGATGAAGTCAGGAAGAACCTGATGGACATGTTCAGGGACA 1080 GGCAGGCCTTCTCTGAACACACCTGGAAGATGCTCCTGTCTGTGTGCAGATCCTGGGCTG 1140 CCTGGTGCAAGCTGAACAACAGGAAATGGTTCCCTGCTGAACCTGAGGATGTGAGGGACT 1200 ACCTCCTGTACCTGCAAGCCAGAGGCCTGGCTGTGAAAACCATCCAACAGCACCTGGGCC 1260 AGCTCAACATGCTGCACAGGAGATCTGGCCTGCCTCGCCCTTCTGACTCCAATGCTGTGT 1320 CCCTGGTGATGAGGAGAATCAGAAAGGAGAATGTGGATGCTGGGGAGAGAGCCAAGCAGG 1380 CCCTGGCCTTTGAACGCACTGACTTTGACCAAGTCAGATCCCTGATGGAGAACTCTGACA 1440 GATGCCAGGACATCAGGAACCTGGCCTTCCTGGGCATTGCCTACAACACCCTGCTGCGCA 1500 TTGCCGAAATTGCCAGAATCAGAGTGAAGGACATCTCCCGCACCGATGGTGGGAGAATGC 1560 TGATCCACATTGGCAGGACCAAGACCCTGGTGTCCACAGCTGGTGTGGAGAAGGCCCTGT 1620 CCCTGGGGGTTACCAAGCTGGTGGAGAGATGGATCTCTGTGTCTGGTGTGGCTGATGACC 1680 CCAACAACTACCTGTTCTGCCGGGTCAGAAAGAATGGTGTGGCTGCCCCTTCTGCCACCT 1740 CCCAACTGTCCACCCGCGCCCTGGAAGGGATCTTTGAGGCCACCCACCGCCTGATCTATG 1800 GTGCCAAGGATGACTCTGGGCAGAGATACCTGGCCTGGTCTGGCCACTCTGCCAGAGTGG 1860 GTGCTGCCAGGGACATGGCCAGGGCTGGTGTGTCCATCCCTGAAATCATGCAGGCTGGTG 1920 GCTGGACCAATGTGAACATAGTGATGAACTACATCAGAAACCTGGACTCTGAGACTGGGG 1980 CCATGGTGAGGCTGCTCGAGGATGGGGACTGATAAGATACATTGATGAGTTTGGACAAAC 2040 CACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTT 2100 ATTTGTAACCATTATAAGCTGCAATAAACAAGTTGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:10) Annotations: PutativeDomain Baserange iCREinsert 547-2134 5UTR 1-379 VP2 380-546 Apoptin 486-546 VP1 2135-2202 3UTR 2203-2319

TABLE-US-00012 TABLE11 GFP-CAVectornucleicacidsequence Name GFP-CAVector Genus/Clade Gyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 660 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 720 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 780 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 840 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 900 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 960 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCG 1020 ACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCA 1080 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCG 1140 TGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGC 1200 ACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCA 1260 AGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGA 1320 ACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGC 1380 TGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCA 1440 TCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACC 1500 ACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACC 1560 TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGC 1620 TGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAATAAG 1680 ATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTG 1740 TGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:11) Annotations: PutativeDomain Baserange GFPinsert 607-1797 5UTR 1-379 VP2 380-606 Apoptin 486-606 VP1 1798-2202 3UTR 2203-2319

TABLE-US-00013 TABLE12 Gluc-CAVectornucleicacidsequence Name Gluc-CAVector Genus/Clade Gyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAACTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 660 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 720 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 780 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 840 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 900 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 960 CGTCTAAAGTGTATGACCCAGAGCAGAGAAAACGAATGATCACCGGCCCCCAATGGTGGG 1020 CTCGGTGCAAGCAGATGAATGTGCTTGATAGCTTTATAAACTACTATGATAGTGAGAAAC 1080 ACGCAGAAAATGCCGTGATATTCTTGCATGGGAACGCAGCATCTTCTTACCTTTGGAGGC 1140 ATGTTGTTCCACATATCGAACCAGTAGCCAGGTGCATCATCCCAGATTTGATTGGTATGG 1200 GGAAATCTGGCAAGAGTGGCAACGGTAGTTATCGACTGCTTGACCATTATAAGTATCTGA 1260 CCGCCTGGTTCGAGCTCCTTAACCTTCCAAAAAAAATAATTTTTGTGGGCCATGACTGGG 1320 GCGCATGTCTTGCATTCCACTACAGTTATGAACATCAAGATAAGATTAAGGCCATAGTAC 1380 ACGCAGAGTCCGTGGTTGACGTTATCGAGTCTTGGGATGAATGGCCTGATATTGAAGAGG 1440 ACATAGCACTTATTAAGAGCGAGGAGGGAGAGAAGATGGTTCTTGAAAACAACTTTTTTG 1500 TCGAAACCATGTTGCCAAGCAAGATAATGCGAAAGCTGGAACCAGAGGAATTCGCAGCCT 1560 ATCTTGAGCCGTTCAAGGAGAAAGGGGAGGTAAGACGCCCGACATTGTCATGGCCTCGAG 1620 AAATCCCCCTCGTCAAAGGTGGTAAACCAGATGTGGTTCAAATTGTCAGGAACTATAACG 1680 CCTACCTCAGGGCGTCAGATGACCTCCCCAAAATGTTTATAGAGTCTGATCCGGGATTTT 1740 TCTCTAATGCCATAGTAGAGGGTGCTAAGAAGTTCCCTAACACTGAATTTGTAAAAGTTA 1800 AAGGGCTCCATTTCTCACAGGAAGATGCGCCAGATGAAATGGGCAAATACATTAAAAGTT 1860 TCGTAGAGCGGGTACTGAAAAATGAGCAGTAATAAGATACATTGATGAGTTTGGACAAAC 1920 CACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTT 1980 ATTTGTAACCATTATAAGCTGCAATAAACAAGTTGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:12) Annotations: PutativeDomain Baserange Glucinsert 607-2014 5UTR 1-379 VP2 380-606 Apoptin 486-606 VP1 2015-2202 3UTR 2203-2319

TABLE-US-00014 TABLE13 mCherry-CAVectornucleicacidsequence Name mCherry-CAVector Genus/Clade Gyrovirus FullSequence:2319bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATGG 60 ACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGGTG 120 GCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACG 180 TCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTCACGC 240 GTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGTTTCGA 300 AAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTAGGTATA 360 CGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGA 420 ATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAAT 480 TTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGTTCAGGCCAC 540 CAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTG 600 GAATTACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC 660 AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGC 720 TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG 780 CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT 840 GGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTC 900 CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCATGG 960 TGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGC 1020 ACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCC 1080 CCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCG 1140 CCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCG 1200 CCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGA 1260 TGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCG 1320 AGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGC 1380 AGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCC 1440 TGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGG 1500 TCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACA 1560 TCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCG 1620 CCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGTAAGATACATTGA 1680 TGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTG 1740 TGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTTTGCAACACTC 1800 ACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCC 1860 TTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTG 1920 GTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTG 1980 GACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAG 2040 TTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTG 2100 GTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTC 2160 AACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAA 2220 GCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATA 2280 GCACTCAATAAACGCAGAAAATAGATTTATCGCACTATC 2319 (SEQIDNO:13) Annotations: PutativeDomain Baserange mCherryinsert 607-1789 5UTR 1-379 VP2 380-606 Apoptin 486-606 VP1 1790-2202 3UTR 2203-2319

[0678] In embodiments, the chimeric CAVector comprises a plurality of polypeptides (e.g., CAV VP1, VP2, and/or Apoptin) comprising sequences from a plurality of different CAVs (e.g., as described herein). For example, a chimeric CAVector may comprise an VP1 molecule from one CAV (e.g., a VP1 molecule, or an VP1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto) and a VP2 molecule from or having similarity to a different CAV. In another example, a chimeric CAVector may comprise a first VP1 molecule from or similar to one CAV and a second VP1 molecule from or similar to a different CAV.

[0679] In some embodiments, the CAVector comprises a chimeric polypeptide (e.g., CAV VP1, VP2, and/or Apoptin), e.g., comprising at least one portion from one CAV (e.g., as described herein) and at least one portion from a different CAV (e.g., as described herein). In embodiments, the CAVector comprises a chimeric VP1 molecule comprising at least one portion of an VP1 molecule from one CAV (e.g., as described herein), or an VP1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least one portion of an VP1 molecule from a different CAV (e.g., as described herein), or an VP1 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the chimeric VP1 molecule comprises an VP1 jelly-roll domain from one CAV, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an VP1 amino acid subsequence (e.g., as described herein) from a different CAV, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In embodiments, the chimeric VP1 molecule comprises an VP1 arginine-rich region from one CAV, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and an VP1 amino acid subsequence (e.g., as described herein) from a different CAV, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0680] In embodiments, the CAVector comprises a chimeric VP2 molecule comprising at least one portion of a VP2 molecule from one CAV (e.g., as described herein), or a VP2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least one portion of a VP2 molecule from a different CAV (e.g., as described herein), or a VP2 molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto. In embodiments, the CAVector comprises a chimeric Apoptin molecule comprising at least one portion of an Apoptin molecule from one CAV (e.g., as described herein), or an Apoptin molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto, and at least one portion of an Apoptin molecule from a different CAV (e.g., as described herein), or an Apoptin molecule having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0681] In some embodiments, a CAVector can be produced using a tandem construct, e.g., as described herein. Non-limiting examples of CAV tandem construct sequences are provided in Tables 14-16 below. In some embodiments, a genetic element construct (e.g., a tandem construct) described herein comprises one or more of a 5 UTR, repeat region, CAAT signal, TATA box, VP2-encoding sequence, Apoptin-encoding sequence, VP1-encoding sequence, 3 UTR, GC-rich region, or polyA signal sequence from a CAV genetic element sequence listed in any of Tables 14-16. In some embodiments, a genetic element construct (e.g., a tandem construct) described herein comprises one or more of a VP1 fragment (e.g., a start-less VP1 fragment), VP2 fragment (e.g., start-less VP2 fragment), and/or Apoptin fragment (e.g., start-less Apoptin fragment) from a CAV genetic element sequence listed in any of Tables 14-16. In some embodiments, a genetic element construct (e.g., a tandem construct) described herein comprises one or more of a promoter (e.g., an SV40 promoter), an SV40 polyA sequence, a hairpin region, an origin of replication (e.g., a pUC origin), or a resistance gene (e.g., an AmpR gene) from a tandem construct sequence listed in any of Tables 14-16.

TABLE-US-00015 TABLE14 ExemplaryCAVtandemplasmidpCAV-nLuc6_CAV Sequence:6794bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATG GACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGG TGGCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGT ACGTCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTC ACGCGTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGT TTCGAAAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTA GGTATACGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGG GCAGTGAATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGG CAAGTAATTTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGT TCAGGCCACCAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATT GGTATCGCTGGAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCC CACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGG ACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAG TACAGGGTAAGCGAGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAAC CGCAAAAAGGCGTATAAGACTGTAAGTTGGCAAGACGAGCTCGCAGACCGAGAGGCCGA TTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAA ATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACA ACCCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAG AAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCT CCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCA TGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTAT TCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCA TGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTG GACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGT AACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATG TCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTT AAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACT GGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCA TCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAA CGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGA GTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTG ATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTTACGCTTTACGT AGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAA AGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAG CTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTA CTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAAGCCCCCCCCCCTTAAACCCCCC CCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATAGCACTCAATAAACGCAGAAAA TAGATTTATCGCACTATCGAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGT ACACAGAAAGTCAAGATGGACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGG GGGCCGGAGGCCCCCCGGTGGCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACG TCATCCGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCC CGTACAGGGGGGTACGTCACGCGTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCC ACGTTGCGAAAGTGACGTTTCGAAAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGC ACATACCGGTCGGCAGTAGGTATACGCAAGGCGGTCCGGGTGGATGCACGGGAACGGCG GACAACCGGCCGCTGGGGGCAGTGAATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCC AGCGGAGCCGCGCAGGGGCAAGTAATTTCAAATGAACGCTCTCCAAGAAGATACTCCAC CCGGACCATCAACGGTGTTCAGGCCACCAACAAGTTCACGGCCGTTGGAAACCCCTCAC TGCAGAGAGATCCGGATTGGTATCGCTGGAATTACAATCACTCTATCGCTGTGTGGCTG CGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTG GTTTCAAGAATGTGCCGGACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGA TCCTGCGACCCCTCCGAGTACAGGGTAAGCGAGCTAAAAGAAAGCTTGATTACCACTAC TCCCAGCCGACCCCGAACCGCAAAAAGGCGTATAAGACTGTAAGATGGCAAGACGAGCT CGCAGACCGAGAGGCCGATTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCG ACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTT TTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCC CAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCT GCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCA AGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGC AAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGC GGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCAT CGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTT AATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCT GTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCA GCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAG TACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCGATGACGGGGGGCAT TGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAG ACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGC ACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGG TGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACC ACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTC GGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAA TTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCA CAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGC GTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTG GGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAAGCCC CCCCCCCTTAAACCCCCCCCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATAGCA CTCAATAAACGCAGAAAATAGATTTATCGCACTATCTGAATGAGACGCACGCTTCCTCG CTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAA GGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAA AAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGG CTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCC GACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTG TTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCG CTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCT GGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATC GTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAAC AGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAA CTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCT TCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGT TTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTT GATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGG TCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTT AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAG TGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCG TCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATA CCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAG GGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATT GCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTC CCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCT TCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATG GCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGG TGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCC CGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTC GATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGG AAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTA TTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTC CGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGGAGATCTCCCGATC CCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTG CTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAAC AAGGCAAGGCTTGACCGACAATTCTCTGGCTAACTAGAGAACCCACTGCTTACTAGGCG TCTCAGAAT (SEQIDNO:14) Annotations: Name Start End CAVector-nLuc6 1 2319 CAVrepeatregion 260 Start-lessVP2fragment 380 1006 Start-lessVP3(Apoptin) 486 851 Start-lessVP1upstream 853 1006 fragment SV40promoter 1007 1350 NanoLuc 1357 1872 SV40poly(A) 1873 1994 DownstreamVP1fragment 1995 2202 HairpinRegion 2206 2272 CAV(wt) 2320 4638 CAVrepeatregion 2463 2579 VP2 2699 3349 VP3(Apoptin) 2805 3170 VP1 3172 4521 HairpinRegion 4525 4591 pUCorigin 4770 5443 AmpRGene 5588 6547

TABLE-US-00016 TABLE15 ExemplaryCAVtandemplasmidpCAV-nLuc6_CAVA3NCR Sequence:6673bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATG GACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGG TGGCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGT ACGTCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTC ACGCGTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGT TTCGAAAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTA GGTATACGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGG GCAGTGAATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGG CAAGTAATTTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGT TCAGGCCACCAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATT GGTATCGCTGGAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCC CACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGG ACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAG TACAGGGTAAGCGAGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAAC CGCAAAAAGGCGTATAAGACTGTAAGTTGGCAAGACGAGCTCGCAGACCGAGAGGCCGA TTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAA ATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACA ACCCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAG AAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCT CCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCA TGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTAT TCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCA TGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTG GACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGT AACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATG TCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTT AAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACT GGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCA TCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAA CGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGA GTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTG ATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTTACGCTTTACGT AGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAA AGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAG CTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTA CTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAAGCCCCCCCCCCTTAAACCCCCC CCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATAGCACTCAATAAACGCAGAAAA TAGATTTATCGCACTATCGAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGT ACACAGAAAGTCAAGATGGACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGG GGGCCGGAGGCCCCCCGGTGGCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACG TCATCCGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCC CGTACAGGGGGGTACGTCACGCGTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCC ACGTTGCGAAAGTGACGTTTCGAAAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGC ACATACCGGTCGGCAGTAGGTATACGCAAGGCGGTCCGGGTGGATGCACGGGAACGGCG GACAACCGGCCGCTGGGGGCAGTGAATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCC AGCGGAGCCGCGCAGGGGCAAGTAATTTCAAATGAACGCTCTCCAAGAAGATACTCCAC CCGGACCATCAACGGTGTTCAGGCCACCAACAAGTTCACGGCCGTTGGAAACCCCTCAC TGCAGAGAGATCCGGATTGGTATCGCTGGAATTACAATCACTCTATCGCTGTGTGGCTG CGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTG GTTTCAAGAATGTGCCGGACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGA TCCTGCGACCCCTCCGAGTACAGGGTAAGCGAGCTAAAAGAAAGCTTGATTACCACTAC TCCCAGCCGACCCCGAACCGCAAAAAGGCGTATAAGACTGTAAGATGGCAAGACGAGCT CGCAGACCGAGAGGCCGATTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCG ACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTT TTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCC CAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCT GCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCA AGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGC AAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGC GGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCAT CGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTT AATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCT GTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCA GCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAG TACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCGATGACGGGGGGCAT TGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAG ACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGC ACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGG TGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACC ACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTC GGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAA TTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCA CAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGC GTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTG GGCGAACAGCACCATGTACTGGGGGACGCAGCCCTGATGAATGAGACGCACGCTTCCTC GCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAA AGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCA AAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAG GCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACC CGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCT GTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC GCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGC TGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTAT CGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAA CAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA ACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACC TTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGG TTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTT TGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTG GTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTT TAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCA GTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCC GTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAA GGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGT TGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCAT TGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTT CCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCC TTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTAT GGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTG GTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCAT TGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTT CGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTT TCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACG GAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTT ATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTT CCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGGAGATCTCCCGAT CCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCT GCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAA CAAGGCAAGGCTTGACCGACAATTCTCTGGCTAACTAGAGAACCCACTGCTTACTAGGC GTCTCA(SEQIDNO:15) Annotations: Name Start End CAVector-nLuc6 1 2319 CAVrepeatregion 144 260 Start-lessVP2fragment 380 1006 Start-lessVP3(Apoptin) 486 851 Start-lessVP1upstream 853 1006 fragment SV40promoter 1007 1350 NanoLuc 1357 1872 SV40poly(A) 1873 1994 DownstreamVP1fragment 1995 2202 HairpinRegion 2206 2272 CAVA3NCR 2320 4521 CAVrepeatregion 2463 2579 VP2 2699 3349 VP3(Apoptin) 2805 3170 VP1 3172 4521 pUCorigin 4653 5326 AmpRGene 5471 6430

TABLE-US-00017 TABLE16 ExemplaryCAVtandemplasmidpCAV-nLuc6_CAVAPromAORFA3NCR Sequence:4793bp GAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGTACACAGAAAGTCAAGATG GACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGGGGGCCGGAGGCCCCCCGG TGGCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACGTCATCCGTACAGGGGGGT ACGTCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCCCGTACAGGGGGGTACGTC ACGCGTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCCACGTTGCGAAAGTGACGT TTCGAAAATGGGCGGCGCAAGCCTCTCTATATATTGAGCGCACATACCGGTCGGCAGTA GGTATACGCAAGGCGGTCCGGGTGGTTGCACGGGAACGGCGGACAACCGGCCGCTGGGG GCAGTGAATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGG CAAGTAATTTCAATTGAACGCTCTCCAAGAAGATACTCCACCCGGACCATCAACGGTGT TCAGGCCACCAACAAGTTCACGGCCGTTGGAAACCCCTCACTGCAGAGAGATCCGGATT GGTATCGCTGGAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCC CACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGG ACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAG TACAGGGTAAGCGAGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAAC CGCAAAAAGGCGTATAAGACTGTAAGTTGGCAAGACGAGCTCGCAGACCGAGAGGCCGA TTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAA ATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACA ACCCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAG AAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCT CCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCA TGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTAT TCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGCCACCA TGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTG GACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGT AACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATG TCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTT AAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACT GGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCA TCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAA CGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAATAAGATACATTGATGA GTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTG ATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTTACGCTTTACGT AGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAA AGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAG CTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTA CTGGGGGACGCAGCCCTGAAAAGGGGGGGGGGCTAAAGCCCCCCCCCCTTAAACCCCCC CCTGGGGGGGATTCCCCCCCAGACCCCCCCTTTATATAGCACTCAATAAACGCAGAAAA TAGATTTATCGCACTATCGAATTCCGAGTGGTTACTATTCCATCACCATTCTAGCCTGT ACACAGAAAGTCAAGATGGACGAATCGCTCGACTTCGCTCGCGATTCGTCGAAGGCGGG GGGCCGGAGGCCCCCCGGTGGCCCCCCTCCAACGAGTGGAGCACGTACAGGGGGGTACG TCATCCGTACAGGGGGGTACGTCATCCGTACAGGGGGGTACGTCACAAAGAGGCGTTCC CGTACAGGGGGGTACGTCACGCGTACAGGGGGGTACGTCACAGCCAATCAAAAGCTGCC ACGTTGCGAAAGTGACGTTTCGAAAATGGGCGGCGCAAGCCTCTCTGAATGAGACGCAC GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGC TCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACA TGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTT TTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTG GCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGC GCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCG GTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCC ACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTG GTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGC CAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGT AGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGA AGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG GGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAA TGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATG CTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCT GACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCC AGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTA TTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAG CTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGG TTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTC ATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTC TGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTT GCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTG CTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAG ATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCA CCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGG GCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTA TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAA TAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGGAGAT CTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGC CAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTA AGCTACAACAAGGCAAGGCTTGACCGACAATTCTCTGGCTAACTAGAGAACCCACTGCT TACTAGGCGTCTCA(SEQIDNO:16) Annotations: Name Start End CAVector-nLuc6 1 2319 CAVrepeatregion 144 260 Start-lessVP2fragment 380 1006 Start-lessVP3(Apoptin) 486 851 Start-lessVP1upstream 853 1006 fragment SV40promoter 1007 1350 NanoLuc 1357 1872 SV40poly(A) 1873 1994 DownstreamVP1fragment 1995 2202 HairpinRegion 2206 2272 CAV-APromAORFA3NCR 2320 2641 CAVrepeatregion 2463 2579 pUCorigin 2773 3446 AmpRGene 3591 4550

[0682] Additional exemplary CAV genome sequences, for which sequences or subsequences comprised therein can be utilized in the compositions and methods described herein (e.g., to form a genetic element of an CAVector, as part of a genetic element construct for producing a CAVector, or as the genetic element sequence in a tandem construct, e.g., as described herein) are listed below in Table 17. In some embodiments, a CAVector comprises a genetic element comprising one or more of (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of) a 5 UTR, repeat region, CAAT signal, TATA box, VP2-encoding sequence, Apoptin-encoding sequence, VP1-encoding sequence, 3 UTR, GC-rich region, or polyA signal sequence from a CAV genome sequence listed in Table 17, or a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0683] In some embodiments, a CAVector comprises a genetic element comprising a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP1 molecule encoded by a CAV genome sequence listed in Table 17. In some embodiments, a CAVector comprises a genetic element comprising a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP2 molecule encoded by a CAV genome sequence listed in Table 17. In some embodiments, a CAVector comprises a genetic element comprising a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Apoptin molecule encoded by a CAV genome sequence listed in Table 17.

[0684] In some embodiments, a CAVector comprises a genetic element that does not comprise a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP& molecule encoded by a CAV genome sequence listed in Table 17. In some embodiments, a CAVector comprises a genetic element that does not comprise a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a VP2 molecule encoded by a CAV genome sequence listed in Table 17. In some embodiments, a CAVector comprises a genetic element that does not comprise a nucleic acid sequence encoding a polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an Apoptin molecule encoded by a CAV genome sequence listed in Table 17.

TABLE-US-00018 TABLE 17 Listing of Exemplary Wild-Type CAV Isolates # Sequence Name Length & Topology Accession No(s) 1 1. Chicken anemia virus 2,298 bp circular DNA MN103406.1 GI:1808996461 isolate GX1904B, complete genome 2 2. Chicken anemia virus 2,298 bp circular DNA MN103405.1 GI:1808996453 isolate GX1805, complete genome 3 3. Chicken anemia virus 2,298 bp circular DNA MN103404.1 GI:1808996446 isolate GX1905, complete genome 4 4. Chicken anemia virus 2,298 bp circular DNA MN103403.1 GI:1808996438 isolate GX1904P, complete genome 5 5. Chicken anemia virus 2,298 bp circular DNA MN103402.1 GI:1808996431 isolate GX1904A, complete genome 6 6. Chicken anemia virus 2,298 bp circular DNA MN299317.1 GI:1785996135 isolate 1619TW, complete genome 7 7. Chicken anemia virus 2,298 bp circular DNA MN299316.1 GI:1785996131 isolate 1852TW, complete genome 8 8. Chicken anemia virus 2,298 bp circular DNA MN299315.1 GI:1785996127 isolate 1535TW, complete genome 9 9. Chicken anemia virus 2,298 bp circular DNA MN299313.1 GI:1785996121 isolate 1777TW, complete genome 10 10. Chicken anemia virus 2,298 bp circular DNA MN299312.1 GI:1785996117 isolate 1716TW, complete genome 11 11. Chicken anemia virus 2,298 bp circular DNA MN299311.1 GI:1785996113 isolate 1725PT, complete genome 12 12. Chicken anemia virus 2,298 bp circular DNA MN299310.1 GI:1785996109 isolate 1637TW, complete genome 13 13. Chicken anemia virus 2,298 bp circular DNA MN299309.1 GI:1785996105 isolate 1510TW, complete genome 14 14. Chicken anemia virus 2,298 bp linear DNA MK887171.1 GI:1777083749 isolate N1, complete genome 15 15. Chicken anemia virus 2,298 bp linear DNA MK887170.1 GI:1777083745 isolate N2, complete genome 16 16. Chicken anemia virus 2,298 bp linear DNA MK887169.1 GI:1777083741 isolate N3, complete genome 17 17. Chicken anemia virus 2,298 bp linear DNA MK887168.1 GI:1777083737 isolate N4, complete genome 18 18. Chicken anemia virus 2,298 bp linear DNA MK887167.1 GI:1777083733 isolate N5, complete genome 19 19. Chicken anemia virus 2,298 bp linear DNA MK887166.1 GI:1777083729 isolate N6, complete genome 20 20. Chicken anemia virus 2,298 bp linear DNA MK887165.1 GI:1777083725 isolate N7, complete genome 21 21. Chicken anemia virus 2,298 bp linear DNA MK887164.1 GI:1777083721 isolate N8, complete genome 22 22. Chicken anemia virus 2,298 bp circular DNA MK770259.1 GI:1755994599 isolate XH16, complete genome 23 23. Chicken anemia virus 1,823 bp circular DNA MK423874.1 GI:1729913537 isolate Vietnam/VP1/18, complete genome 24 24. Chicken anemia virus 1,823 bp circular DNA MK423873.1 GI:1729913533 isolate Vietnam/PT1/17, complete genome 25 25. Chicken anemia virus 1,823 bp circular DNA MK423872.1 GI:1729913529 isolate Vietnam/HN3/17, complete genome 26 26. Chicken anemia virus 1,823 bp circular DNA MK423871.1 GI:1729913525 isolate Vietnam/HN1/17, complete genome 27 27. Chicken anemia virus 1,823 bp circular DNA MK423870.1 GI:1729913521 isolate Vietnam/HP1/17, complete genome 28 28. Chicken anemia virus 1,823 bp circular DNA MK423869.1 GI:1729913517 isolate Vietnam/HB1/17, complete genome 29 29. Chicken anemia virus 1,823 bp circular DNA MK423868.1 GI:1729913513 isolate Vietnam/BN1/17, complete genome 30 30. Chicken anemia virus 1,823 bp circular DNA MK423867.1 GI:1729913509 isolate Vietnam/BN2/16, complete genome 31 31. Chicken anemia virus 1,823 bp circular DNA MK423866.1 GI:1729913505 isolate Vietnam/HN2/16, complete genome 32 32. Chicken anemia virus 2,298 bp circular DNA MK484616.1 GI:1682038571 isolate GX1810, complete genome 33 33. Chicken anemia virus 2,298 bp circular DNA MK484615.1 GI:1682038567 isolate GX1804, complete genome 34 34. Chicken anemia virus 2,298 bp circular DNA MK484614.1 GI:1682038563 isolate GX1801, complete genome 35 35. Chicken anemia virus 2,298 bp circular DNA MK089243.1 GI:1658264359 isolate 17SY0902, complete genome 36 36. Chicken anemia virus 2,298 bp circular DNA MK089242.1 GI:1658264355 isolate 17JL0314, complete genome 37 37. Chicken anemia virus 2,298 bp circular DNA MK089241.1 GI:1658264351 isolate 17JL0310, complete genome 38 38. Chicken anemia virus 2,298 bp circular DNA MK089240.1 GI:1658264347 isolate 17CC0509, complete genome 39 39. Chicken anemia virus 2,298 bp circular DNA MK386570.1 GI:1616393965 isolate 1705PT, complete genome 40 40. Chicken anemia virus 2,298 bp circular DNA MK376316.1 GI:1616393961 isolate 1636TW, complete genome 41 41. Chicken anemia virus 2,298 bp circular DNA MK376315.1 GI:1616393957 isolate 1623TW, complete genome 42 42. Chicken anemia virus 2,298 bp circular DNA MK360817.1 GI:1616393949 isolate 1520TW, complete genome 43 43. Chicken anemia virus 2,298 bp circular DNA MK358456.1 GI:1616393943 isolate 1504TW, complete genome 44 44. Chicken anemia virus 2,298 bp circular DNA MH536106.1 GI:1586080948 isolate G17.3.1, complete genome 45 45. Chicken anemia virus 2,298 bp circular DNA MH536105.1 GI:1586080944 isolate G17.33.5, complete genome 46 46. Chicken anemia virus 2,298 bp circular DNA MH536104.1 GI:1586080940 isolate G17.33.3, complete genome 47 47. Chicken anemia virus 2,298 bp circular DNA MG827100.1 GI:1496531976 isolate CAV-SK4-2017, complete genome 48 48. Chicken anemia virus 2,298 bp circular DNA MG827099.1 GI:1496531972 isolate CAV-GZ2-2016, complete genome 49 49. Chicken anemia virus 2,298 bp circular DNA MG827098.1 GI:1496531968 isolate CAV-CA1-2015, complete genome 50 50. Chicken anemia virus 2,291 bp linear DNA MH186142.1 GI:1493076326 strain CIAV-Shanxi7, complete genome 51 51. Chicken anemia virus 2,291 bp linear DNA MH186141.1 GI:1493076321 strain CIAV-Guangdong11, complete genome 52 52. Chicken anemia virus 2,295 bp linear DNA MH186140.1 GI:1493076316 strain CIAV-Anhui8, complete genome 53 53. Chicken anemia virus 2,293 bp linear DNA MH186139.1 GI:1493076311 strain CIAV-Hebei2, complete genome 54 54. Chicken anemia virus 2,293 bp linear DNA MH186138.1 GI:1493076306 strain CIAV-Hebei12, complete genome 55 55. Chicken anemia virus 2,295 bp linear DNA MH186137.1 GI:1493076301 strain CIAV- Heilongjiang16, complete genome 56 56. Chicken anemia virus 2,298 bp circular DNA MH001570.1 GI:1436168173 isolate CAV-EG-28, complete genome 57 57. Chicken anemia virus 2,298 bp circular DNA MH001569.1 GI:1436168169 isolate CAV-EG-25, complete genome 58 58. Chicken anemia virus 2,298 bp circular DNA MH001568.1 GI:1436168165 isolate CAV-EG-15, complete genome 59 59. Chicken anemia virus 2,298 bp circular DNA MH001567.1 GI:1436168161 isolate CAV-EG-21, complete genome 60 60. Chicken anemia virus 2,298 bp circular DNA MH001566.1 GI:1436168157 isolate CAV-EG-24, complete genome 61 61. Chicken anemia virus 2,298 bp circular DNA MH001565.1 GI:1436168153 isolate CAV-EG-14, complete genome 62 62. Chicken anemia virus 2,298 bp circular DNA MH001564.1 GI:1436168149 isolate CAV-EG-26, complete genome 63 63. Chicken anemia virus 2,298 bp circular DNA MH001563.1 GI:1436168145 isolate CAV-EG-27, complete genome 64 64. Chicken anemia virus 2,298 bp circular DNA MH001562.1 GI:1436168141 isolate CAV-EG-23, complete genome 65 65. Chicken anemia virus 2,298 bp circular DNA MH001561.1 GI:1436168137 isolate CAV-EG-22, complete genome 66 66. Chicken anemia virus 2,298 bp circular DNA MH001560.1 GI:1436168133 isolate CAV-EG-13, complete genome 67 67. Chicken anemia virus 2,298 bp circular DNA MH001559.1 GI:1436168129 isolate CAV-EG-11, complete genome 68 68. Chicken anemia virus 2,298 bp circular DNA MH001558.1 GI:1436168125 isolate CAV-EG-12, complete genome 69 69. Chicken anemia virus 2,298 bp circular DNA MH001557.1 GI:1436168121 isolate CAV-EG-10, complete genome 70 70. Chicken anemia virus 2,298 bp circular DNA MH001556.1 GI:1436168117 isolate CAV-EG-7, complete genome 71 71. Chicken anemia virus 2,298 bp circular DNA MH001555.1 GI:1436168113 isolate CAV-EG-6, complete genome 72 72. Chicken anemia virus 2,298 bp circular DNA MH001554.1 GI:1436168109 isolate CAV-EG-4, complete genome 73 73. Chicken anemia virus 2,298 bp circular DNA MH001553.1 GI:1436168105 isolate CAV-EG-2, complete genome 74 74. UNVERIFIED: Chicken 2,293 bp linear DNA MF614011.1 GI:1420860182 anemia virus strain SDAUC-Vac, complete genome 75 75. Chicken anemia virus 2,298 bp circular DNA MG846491.1 GI:1360474804 strain RS/BR/15/1R, complete genome 76 76. Chicken anemia virus 2,298 bp circular DNA KY486155.1 GI:1325381006 isolate LN15170, complete genome 77 77. Chicken anemia virus 2,298 bp circular DNA KY486154.1 GI:1325381002 isolate LN15169, complete genome 78 78. Chicken anemia virus 2,298 bp circular DNA KY486153.1 GI:1325380998 isolate JS15166, complete genome 79 79. Chicken anemia virus 2,298 bp circular DNA KY486152.1 GI:1325380994 isolate JS15165, complete genome 80 80. Chicken anemia virus 2,298 bp circular DNA KY486151.1 GI:1325380990 isolate NX15140, complete genome 81 81. Chicken anemia virus 2,298 bp circular DNA KY486150.1 GI:1325380986 isolate NX15091, complete genome 82 82. Chicken anemia virus 2,298 bp circular DNA KY486149.1 GI:1325380982 isolate JL15120, complete genome 83 83. Chicken anemia virus 2,298 bp circular DNA KY486148.1 GI:1325380978 isolate JL14028, complete genome 84 84. Chicken anemia virus 2,298 bp circular DNA KY486147.1 GI:1325380974 isolate JL14026, complete genome 85 85. Chicken anemia virus 2,298 bp circular DNA KY486146.1 GI:1325380970 isolate JL14024, complete genome 86 86. Chicken anemia virus 2,298 bp circular DNA KY486145.1 GI:1325380966 isolate JL14023, complete genome 87 87. Chicken anemia virus 2,298 bp circular DNA KY486144.1 GI:1325380962 isolate HLJ15170, complete genome 88 88. Chicken anemia virus 2,298 bp circular DNA KY486143.1 GI:1325380958 isolate HLJ15169, complete genome 89 89. Chicken anemia virus 2,298 bp circular DNA KY486142.1 GI:1325380954 isolate HLJ15166, complete genome 90 90. Chicken anemia virus 2,298 bp circular DNA KY486141.1 GI:1325380950 isolate HLJ15165, complete genome 91 91. Chicken anemia virus 2,298 bp circular DNA KY486140.1 GI:1325380946 isolate HLJ15140, complete genome 92 92. Chicken anemia virus 2,298 bp circular DNA KY486139.1 GI:1325380942 isolate HLJ15125, complete genome 93 93. Chicken anemia virus 2,298 bp circular DNA KY486138.1 GI:1325380938 isolate HLJ15109, complete genome 94 94. Chicken anemia virus 2,298 bp circular DNA KY486137.1 GI:1325380934 isolate HLJ15108, complete genome 95 95. Chicken anemia virus 2,298 bp circular DNA KY486136.1 GI:1325380930 isolate HLJ14101, complete genome 96 96. Chicken anemia virus 2,263 bp circular DNA KY053900.1 GI:1249091115 isolate CAV/NAM/TANUVAS/09, complete genome 97 97. Chicken anemia virus 2,298 bp circular DNA KX447637.1 GI:1216618959 isolate LY-2, complete genome 98 98. Chicken anemia virus 2,298 bp circular DNA KX447636.1 GI:1216618955 isolate LY-1, complete genome 99 99. Chicken anemia virus 2,298 bp circular DNA KX447635.1 GI:1216618951 isolate HB160430, complete genome 100 100. Chicken anemia virus 2,298 bp circular DNA KX447634.1 GI:1216618947 isolate BS-C2, complete genome 101 101. Chicken anemia virus 2,298 bp circular DNA KX447633.1 GI:1216618943 isolate BS-C1, complete genome 102 102. Chicken anemia virus 2,298 bp circular DNA KY024579.1 GI:1124881742 strain RS/BR/15, complete genome 103 103. Chicken anemia virus 2,298 bp circular DNA KU645525.1 GI:1078570421 isolate CIAV-Mouse, complete genome 104 104. Chicken anemia virus 2,298 bp circular DNA KU645524.1 GI:1078570417 isolate CIAV-Dog, complete genome 105 105. Chicken anemia virus 2,298 bp circular DNA KU645523.1 GI:1078570413 isolate SD1505, complete genome 106 106. Chicken anemia virus 2,298 bp circular DNA KU645522.1 GI:1078570409 isolate SD1518, complete genome 107 107. Chicken anemia virus 2,298 bp circular DNA KU645521.1 GI:1078570405 isolate SD1514, complete genome 108 108. Chicken anemia virus 2,298 bp circular DNA KU645520.1 GI:1078570401 isolate HN1405, complete genome 109 109. Chicken anemia virus 2,298 bp circular DNA KU645519.1 GI:1078570397 isolate SD1508, complete genome 110 110. Chicken anemia virus 2,298 bp circular DNA KU645518.1 GI:1078570393 isolate JS1501, complete genome 111 111. Chicken anemia virus 2,298 bp circular DNA KU645517.1 GI:1078570389 isolate SD1513, complete genome 112 112. Chicken anemia virus 2,298 bp circular DNA KU645516.1 GI:1078570385 isolate HB1517, complete genome 113 113. Chicken anemia virus 2,298 bp circular DNA KU645515.1 GI:1078570381 isolate SD1515, complete genome 114 114. Chicken anemia virus 2,298 bp circular DNA KU645514.1 GI:1078570377 isolate HB1404, complete genome 115 115. Chicken anemia virus 2,298 bp circular DNA KU645513.1 GI:1078570373 isolate BJ1406, complete genome 116 116. Chicken anemia virus 2,298 bp circular DNA KU645512.1 GI:1078570369 isolate HN1504, complete genome 117 117. Chicken anemia virus 2,298 bp circular DNA KU645511.1 GI:1078570365 isolate LN1402, complete genome 118 118. Chicken anemia virus 2,298 bp circular DNA KU645510.1 GI:1078570361 isolate SD1509, complete genome 119 119. Chicken anemia virus 2,298 bp circular DNA KU645509.1 GI:1078570357 isolate JS1503, complete genome 120 120. Chicken anemia virus 2,298 bp circular DNA KU645508.1 GI:1078570353 isolate SD1502, complete genome 121 121. Chicken anemia virus 2,298 bp circular DNA KU645507.1 GI:1078570349 isolate SD1507, complete genome 122 122. Chicken anemia virus 2,298 bp circular DNA KU645506.1 GI:1078570345 isolate SD1512, complete genome 123 123. Chicken anemia virus 2,298 bp circular DNA KU641015.1 GI:1073547898 isolate SD1511, complete genome 124 124. Chicken anemia virus 2,298 bp circular DNA KU641014.1 GI:1073547894 isolate JN1503, complete genome 125 125. Chicken anemia virus 2,298 bp circular DNA KU641013.1 GI:1073547890 isolate LN1401, complete genome 126 126. Chicken anemia virus 2,298 bp circular DNA KU598851.1 GI:1073547886 isolate SD1510, complete genome 127 127. Chicken anemia virus 2,298 bp linear DNA KU050680.1 GI:1021673541 strain GD-101, complete genome 128 128. Chicken anemia virus 2,298 bp linear DNA KU050679.1 GI:1021673537 strain GD-104, complete genome 129 129. Chicken anemia virus 2,298 bp linear DNA KU050678.1 GI:1021673533 strain GD-103, complete genome 130 130. Chicken anemia virus 2,298 bp linear DNA KU050677.1 GI:1021673529 strain GD-102, complete genome 131 131. Chicken anemia virus 2,298 bp circular DNA KU221054.1 GI:1004125710 isolate SD1403, complete genome 132 132. Chicken anemia virus 2,298 bp circular DNA KU845735.1 GI:1002623535 isolate CIAV-F10, complete genome 133 133. Chicken anemia virus 2,298 bp circular DNA KU845734.1 GI:1002623531 isolate FAdV-N22, complete genome 134 134. Chicken anemia virus 2,298 bp circular DNA KJ872514.1 GI:701168412 isolate CAV-18, complete genome 135 135. Chicken anemia virus 2,298 bp circular DNA KJ872513.1 GI:701168408 isolate CAV-10, complete genome 136 136. Chicken anemia virus 2,298 bp circular DNA KJ728830.1 GI:660450622 isolate 22, complete sequence 137 137. Chicken anemia virus 2,298 bp circular DNA KJ728829.1 GI:660450618 isolate 20, complete sequence 138 138. Chicken anemia virus 2,298 bp circular DNA KJ728828.1 GI:660450614 isolate 19, complete sequence 139 139. Chicken anemia virus 2,298 bp circular DNA KJ728827.1 GI:660450610 isolate 18, complete sequence 140 140. Chicken anemia virus 2,298 bp circular DNA KJ728826.1 GI:660450606 isolate 17, complete sequence 141 141. Chicken anemia virus 2,298 bp circular DNA KJ728825.1 GI:660450602 isolate 16, complete sequence 142 142. Chicken anemia virus 2,298 bp circular DNA KJ728824.1 GI:660450598 isolate 14, complete sequence 143 143. Chicken anemia virus 2,298 bp circular DNA KJ728823.1 GI:660450594 isolate 13, complete sequence 144 144. Chicken anemia virus 2,298 bp circular DNA KJ728822.1 GI:660450590 isolate 12, complete sequence 145 145. Chicken anemia virus 2,298 bp circular DNA KJ728821.1 GI:660450586 isolate 10, complete sequence 146 146. Chicken anemia virus 2,298 bp circular DNA KJ728820.1 GI:660450582 isolate 9, complete sequence 147 147. Chicken anemia virus 2,298 bp circular DNA KJ728819.1 GI:660450578 isolate 8, complete sequence 148 148. Chicken anemia virus 2,298 bp circular DNA KJ728818.1 GI:660450574 isolate 7, complete sequence 149 149. Chicken anemia virus 2,298 bp circular DNA KJ728817.1 GI:660450570 isolate 6, complete sequence 150 150. Chicken anemia virus 2,298 bp circular DNA KJ728816.1 GI:660450566 isolate 4, complete sequence 151 151. Chicken anemia virus 2,298 bp circular DNA KJ728815.1 GI:660450562 isolate 2, complete sequence 152 152. Chicken anemia virus 2,298 bp circular DNA KJ728814.1 GI:660450558 isolate 1, complete sequence 153 153. Chicken anemia virus 1,812 bp linear DNA KJ621019.1 GI:648091733 isolate VRDC/CAV/MH/C32/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 154 154. Chicken anemia virus 1,814 bp linear DNA KJ621018.1 GI:648091729 isolate VRDC/CAV/HR/C31/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 155 155. Chicken anemia virus 1,812 bp linear DNA KJ621017.1 GI:648091725 isolate VRDC/CAV/AP/C30/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 156 156. Chicken anemia virus 1,826 bp linear DNA KJ621016.1 GI:648091721 isolate VRDC/CAV/HR/C29/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 157 157. Chicken anemia virus 1,822 bp linear DNA KJ621015.1 GI:648091717 isolate VRDC/CAV/HR/C28/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 158 158. Chicken anemia virus 1,817 bp linear DNA KJ621014.1 GI:648091713 isolate VRDC/CAV/HR/C27/11 VP2 Protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 159 159. Chicken anemia virus 1,821 bp linear DNA KJ621013.1 GI:648091709 isolate VRDC/CAV/HR/C26/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 160 160. Chicken anemia virus 1,816 bp linear DNA KJ621012.1 GI:648091705 isolate VRDC/CAV/HR/C25/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 161 161. Chicken anemia virus 1,820 bp linear DNA KJ621011.1 GI:648091701 isolate VRDC/CAV/HR/C24/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 162 162. Chicken anemia virus 1,811 bp linear DNA KJ621010.1 GI:648091697 isolate VRDC/CAV/HR/C23/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 163 163. Chicken anemia virus 1,807 bp linear DNA KJ621009.1 GI:648091693 isolate VRDC/CAV/HR/C22/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 164 164. Chicken anemia virus 1,833 bp linear DNA KJ621008.1 GI:648091689 isolate VRDC/CAV/HR/C21/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 165 165. Chicken anemia virus 1,822 bp linear DNA KJ621007.1 GI:648091685 isolate VRDC/CAV/HR/C20/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 166 166. Chicken anemia virus 1,822 bp linear DNA KJ621006.1 GI:648091681 isolate VRDC/CAV/HR/C19/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 167 167. Chicken anemia virus 1,811 bp linear DNA KJ621005.1 GI:648091677 isolate VRDC/CAV/HR/C18/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 168 168. Chicken anemia virus 1,825 bp linear DNA KJ621004.1 GI:648091673 isolate VRDC/CAV/HR/C17/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 169 169. Chicken anemia virus 1,816 bp linear DNA KJ621003.1 GI:648091669 isolate VRDC/CAV/AP/C16/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 170 170. Chicken anemia virus 1,786 bp linear DNA KJ621002.1 GI:648091665 isolate VRDC/CAV/CHD/C14/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 171 171. Chicken anemia virus 1,806 bp linear DNA KJ621001.1 GI:648091661 isolate VRDC/CAV/HR/C13/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 172 172. Chicken anemia virus 1,838 bp linear DNA KJ621000.1 GI:648091657 isolate VRDC/CAV/HR/C12/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 173 173. Chicken anemia virus 1,822 bp linear DNA KJ620999.1 GI:648091653 isolate VRDC/CAV/HR/C11/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 174 174. Chicken anemia virus 1,807 bp linear DNA KJ620998.1 GI:648091649 isolate VRDC/CAV/HR/C10/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 175 175. Chicken anemia virus 1,803 bp linear DNA KJ620997.1 GI:648091645 isolate VRDC/CAV/HR/C9/11 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 176 176. Chicken anemia virus 1,874 bp linear DNA KJ620989.1 GI:648091593 isolate VRDC/CAV/TN/C1/08 VP2 protein (VP2), apoptin (VP3), and capsid protein (VP1) genes, complete cds 177 177. Chicken anemia virus 2,295 bp circular DNA KF224938.1 GI:545561491 strain GD-N-12, complete genome 178 178. Chicken anemia virus 2,298 bp circular DNA KF224937.1 GI:545561487 strain GD-M-12, complete genome 179 179. Chicken anemia virus 2,298 bp circular DNA KF224936.1 GI:545561483 strain GD-L-12, complete genome 180 180. Chicken anemia virus 2,298 bp circular DNA KF224935.1 GI:545561479 strain GD-K-12, complete genome 181 181. Chicken anemia virus 2,298 bp circular DNA KF224934.1 GI:545561475 strain GD-J-12, complete genome 182 182. Chicken anemia virus 2,298 bp circular DNA KF224933.1 GI:545561471 strain GD-I-12, complete genome 183 183. Chicken anemia virus 2,298 bp circular DNA KF224932.1 GI:545561467 strain GD-H-12, complete genome 184 184. Chicken anemia virus 2,298 bp circular DNA KF224931.1 GI:545561463 strain GD-G-12, complete genome 185 185. Chicken anemia virus 2,298 bp circular DNA KF224930.1 GI:545561459 strain GD-F-12, complete genome 186 186. Chicken anemia virus 2,298 bp circular DNA KF224929.1 GI:545561455 strain GD-E-12, complete genome 187 187. Chicken anemia virus 2,298 bp circular DNA KF224928.1 GI:545561451 strain GD-D-12, complete genome 188 188. Chicken anemia virus 2,298 bp circular DNA KF224927.1 GI:545561447 strain GD-C-12, complete genome 189 189. Chicken anemia virus 2,298 bp circular DNA KF224926.1 GI:545561443 strain GD-B-12, complete genome 190 190. Chicken anemia virus 2,295 bp linear DNA KC414026.1 GI:472320341 strain CAT-CAV, complete genome 191 191. Chicken anemia virus 2,292 bp circular DNA JX964755.1 GI:429510192 isolate GXC060821, complete genome 192 192. Chicken anemia virus 2,298 bp circular DNA JX260426.1 GI:403495278 isolate GD-1-12, complete genome 193 193. Chicken anemia virus, 2,316 bp circular DNA JQ690762.1 GI:387600189 complete genome 194 194. Chicken anemia virus 2,298 bp circular DNA JF507715.1 GI:345104687 isolate CIAV89-69, complete genome 195 195. Chicken anemia virus 2,298 bp linear DNA HM134240.1 GI:299474029 VP2, VP3, and VP1 genes, complete cds 196 196. Chicken anemia virus 2,298 bp circular DNA FJ172347.1 GI:205364143 isolate SDLY08, complete genome 197 197. Chicken anemia virus 2,279 bp linear DNA EF683159.1 GI:152207654 vaccine strain 3711/chicken/Australia VP2 gene,complete cds; VP3 gene, complete cds; and VP1 gene, complete cds 198 198. Chicken anemia virus 2,298 bp circular DNA EF176599.1 GI:121592425 isolate C14, complete genome 199 199. Chicken anemia virus 2,298 bp circular DNA DQ991394.1 GI:116248476 isolate 01-4201, complete genome 200 200. Chicken anemia virus 2,298 bp circular DNA AF311900.3 GI:114229361 isolate 98D06073, complete genome 201 201. Chicken anemia virus 2,298 bp circular DNA DQ217401.1 GI:78068049 isolate SMSC-1P123WT, complete genome 202 202. Chicken anemia virus 2,298 bp circular DNA DQ217400.1 GI:78068045 isolate SMSC-1P9WT, complete genome 203 203. Chicken anemia virus 2,298 bp circular DNA DQ141673.1 GI:72536139 isolate SD22, complete genome 204 204. Chicken anemia virus 2,298 bp circular DNA DQ141672.1 GI:72536135 isolate HN9, complete genome 205 205. Chicken anemia virus 2,298 bp circular DNA DQ141671.1 GI:72536131 isolate SH16, complete genome 206 206. Chicken anemia virus 2,298 bp circular DNA DQ141670.1 GI:72536127 isolate SH11, complete genome 207 207. Chicken anemia virus 2,298 bp circular DNA DQ124936.1 GI:71738206 isolate AH4 from China, complete genome 208 208. Chicken anemia virus 2,298 bp circular DNA DQ124935.1 GI:71738202 isolate AH6 from China, complete genome 209 209. Chicken anemia virus 2,298 bp circular DNA DQ124934.1 GI:71738198 isolate BJ0401 from China, complete genome 210 210. Chicken anemia virus 2,298 bp circular DNA AY839944.2 GI:68580448 strain LF4, complete genome 211 211. Chicken anemia virus 2,298 bp circular DNA AY843527.2 GI:68577214 isolate TJBD33, complete genome 212 212. Chicken anemia virus 2,298 bp circular DNA AY999018.1 GI:62823175 isolate SD24, complete genome 213 213. Chicken anemia virus 2,298 bp circular DNA AY846844.1 GI:56791774 strain TJBD40, complete genome 214 214. Chicken anemia virus 2,298 bp linear DNA AB119448.1 GI:45126694 genes for VP2, VP3, VP1, complete cds 215 215. Chicken anemia virus 2,298 bp circular DNA AF311892.2 GI:32527857 isolate 98D02152, complete genome 216 216. Chicken anemia virus 2,298 bp circular DNA AY040632.1 GI:22073877 isolate 3-1P60, complete genome 217 217. Chicken anemia virus 2,298 bp circular DNA AF390102.1 GI:21666303 attenuated isolate SMSC- 1P60, complete genome 218 218. Chicken anemia virus 2,298 bp circular DNA AF395114.1 GI:20378212 strain BD-3, complete genome 219 219. Chicken anemia virus 2,298 bp circular DNA AF390038.1 GI:19851825 isolate 3-1 from Malaysia, complete genome 220 220. Chicken anemia virus 2,298 bp circular DNA AF475908.1 GI:18874693 from China, complete genome 221 221. Chicken anaemia virus 2,297 bp circular DNA AJ297685.2 GI:18643934 complete genome, clone 34 222 222. Chicken anaemia virus 2,298 bp circular DNA AJ297684.2 GI:18643933 complete genome, clone 33 223 223. Chicken anemia virus 2,298 bp circular DNA AF285882.1 GI:15076979 isolate SMSC-1 from Malaysia, complete genome 224 224. Chicken anemia virus 2,294 bp linear DNA AF313470.1 GI:11321455 VP2, VP3, and VP1 genes, complete cds 225 225. Chicken anemia virus 2,298 bp circular DNA AB027470.1 GI:4903007 DNA, complete genome, strain: TR20 226 226. Chicken anemia virus 2,298 bp circular DNA L14767.1 GI:4186172 unknown genes 227 227. Chicken anemia virus 2,319 bp circular DNA U66304.1 GI:2558685 cloned isolate 10, complete genome 228 228. Sequence 1 from 2,319 bp circular DNA A48606.1 GI:2302375 Patent WO9603507 229 229. Chicken anemia virus 2,298 bp circular DNA U65414.1 GI:1490881 complete genome: VP2, VP3 and VP1 genes, complete cds 230 230. Chicken anemia virus 2,298 bp circular DNA D10068.1 GI:221116 DNA, complete genome

VP1 Molecules

[0685] In some embodiments, the CAVector comprises a proteinaceous exterior comprising a CAV VP1 molecule. Generally, an VP1 molecule comprises a polypeptide having the structural features and/or activity of an CAV VP1 protein (e.g., an CAV VP1 protein as described herein). In some embodiments, the VP1 molecule comprises a truncation relative to an CAV VP1 protein (e.g., an CAV VP1 protein as described herein). An VP1 molecule may be capable of binding to other VP1 molecules, e.g., to form a proteinaceous exterior (e.g., as described herein), e.g., a capsid. In some embodiments, the proteinaceous exterior may enclose a nucleic acid molecule (e.g., a genetic element as described herein). In some embodiments, a plurality of VP1 molecules may form a multimer, e.g., to form a proteinaceous exterior. In some embodiments, the multimer may be a homomultimer. In other embodiments, the multimer may be a heteromultimer.

[0686] An VP1 molecule may, in some embodiments, comprise one or more of: an arginine rich region, e.g., a region having at least 60% basic residues (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% basic residues; e.g., between 60%-90%, 60%-80%, 70%-90%, or 70-80% basic residues), and a jelly-roll domain.

[0687] Arginine-Rich Region

[0688] An arginine rich region has at least 70% (e.g., at least about 70, 80, 90, 95, 96, 97, 98, 99, or 100%) sequence identity to an arginine-rich region sequence described herein or a sequence of at least about 40 amino acids comprising at least 60%, 70%, or 80% basic residues (e.g., arginine, lysine, or a combination thereof).

[0689] Jelly Roll Domain

[0690] A jelly-roll domain or region comprises (e.g., consists of) a polypeptide (e.g., a domain or region comprised in a larger polypeptide) comprising one or more (e.g., 1, 2, or 3) of the following characteristics: [0691] (i) at least 30% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, or more) of the amino acids of the jelly-roll domain are part of one or more -sheets; [0692] (ii) the secondary structure of the jelly-roll domain comprises at least four (e.g., at least 4, 5, 6, 7, 8, 9, 10, 11, or 12) -strands; and/or [0693] (iii) the tertiary structure of the jelly-roll domain comprises at least two (e.g., at least 2, 3, or 4) -sheets; and/or [0694] (iv) the jelly-roll domain comprises a ratio of -sheets to -helices of at least 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1.

[0695] In certain embodiments, a jelly-roll domain comprises two -sheets.

[0696] In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the -sheets comprises about eight (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) -strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the -sheets comprises eight -strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the -sheets comprises seven -strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the -sheets comprises six -strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the -sheets comprises five -strands. In certain embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the -sheets comprises four -strands.

[0697] In some embodiments, the jelly-roll domain comprises a first -sheet in antiparallel orientation to a second -sheet. In certain embodiments, the first -sheet comprises about four (e.g., 3, 4, 5, or 6) f-strands. In certain embodiments, the second -sheet comprises about four (e.g., 3, 4, 5, or 6) -strands. In embodiments, the first and second -sheet comprise, in total, about eight (e.g., 6, 7, 8, 9, 10, 11, or 12) -strands.

[0698] In certain embodiments, a jelly-roll domain is a component of a capsid protein (e.g., an VP1 molecule as described herein). In certain embodiments, a jelly-roll domain has self-assembly activity. In some embodiments, a polypeptide comprising a jelly-roll domain binds to another copy of the polypeptide comprising the jelly-roll domain. In some embodiments, a jelly-roll domain of a first polypeptide binds to a jelly-roll domain of a second copy of the polypeptide.

[0699] Exemplary VP1 Sequences

[0700] Exemplary CAV VP1 amino acid sequences, and the sequences of exemplary VP1 domains, include, without limitation, those encoded by the VP1 nucleic acid sequences listed in Tables 1-17. In some embodiments, a polypeptide (e.g., an VP1 molecule) described herein comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more CAV VP1 molecules, e.g., as described in any of Tables 1-17, or a functional fragment thereof. In some embodiments, a CAVector described herein comprises an VP1 molecule comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the arginine-rich region of one or more CAV VP1 molecules, e.g., as described in any of Tables 1-17. In some embodiments, a CAVector described herein comprises an VP1 molecule comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the jelly roll domain of one or more CAV VP1 molecules, e.g., as described in any of Tables 1-17. In some embodiments, a CAVector described herein comprises a nucleic acid molecule (e.g., a genetic element) encoding an VP1 molecule comprising an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one or more CAV VP1 molecules, e.g., as described in any of Tables 1-17, or a functional fragment thereof.

[0701] In some embodiments, the one or more CAV VP1 subsequences comprises one or more of an arginine (Arg)-rich domain and/or a jelly-roll domain (e.g., as listed in any of Tables 1-17), or sequences having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity thereto. In some embodiments, the VP1 molecule comprises a plurality of subsequences from different CAVs (e.g., any combination of VP1 subsequences, such as arginine-rich region sequences and/or jelly roll domain sequences, selected from the CAV subsequences listed in any table herein).

[0702] In some embodiments, a VP1 molecule comprises at least one difference (e.g., a mutation, chemical modification, or epigenetic alteration) relative to a wild-type VP1 protein, e.g., as described herein (e.g., as listed in Table 1A, 1B, or 17).

Genetic Elements

[0703] In some embodiments, the CAVector comprises a genetic element (e.g., a genetic element enclosed in a proteinaceous exterior, e.g., comprising a CAV capsid protein, e.g., a VP1 molecule). In some embodiments, the genetic element has one or more of the following characteristics: is substantially non-integrating with a host cell's genome, is an episomal nucleic acid, is a single stranded DNA, is circular, is about 1 to 10 kb, exists within the nucleus of the cell, can be bound by endogenous proteins, produces and/or encodes an effector, such as a polypeptide or nucleic acid (e.g., an RNA, iRNA, microRNA) that targets a gene, activity, or function of a host or target cell. In one embodiment, the genetic element is a substantially non-integrating DNA. In some embodiments, the genetic element comprises a packaging signal, e.g., a protein binding sequence as described herein, e.g., sequence that binds a capsid protein. In some embodiments, the packaging signal comprises the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, outside of the packaging or capsid-binding sequence, the genetic element has less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% sequence identity to a wild type CAV nucleic acid sequence, e.g., has less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% sequence identity to an CAV nucleic acid sequence, e.g., as described herein, e.g., in any of Tables 1-17. In some embodiments, outside of the packaging or capsid-binding sequence, the genetic element has less than 500 450, 400, 350, 300, 250, 200, 150, or 100 contiguous nucleotides that are at least 70%, 75%, 80%, 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to an CAV nucleic acid sequence. In certain embodiments, the genetic element is a circular, single stranded DNA that comprises a promoter sequence, a sequence encoding a therapeutic effector, and a capsid binding protein.

[0704] In some embodiments, the genetic element has a length less than 20 kb (e.g., less than about 19 kb, 18 kb, 17 kb, 16 kb, 15 kb, 14 kb, 13 kb, 12 kb, 11 kb, 10 kb, 9 kb, 8 kb, 7 kb, 6 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, or less). In some embodiments, the genetic element has, independently or in addition to, a length greater than 1000b (e.g., at least about 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, 3.8 kb, 3.9 kb, 4 kb, 4.1 kb, 4.2 kb, 4.3 kb, 4.4 kb, 4.5 kb, 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5 kb, or greater). In some embodiments, the genetic element has a length of about 2.5-4.6, 2.8-4.0, 3.0-3.8, or 3.2-3.7 kb. In some embodiments, the genetic element has a length of about 1.5-2.0, 1.5-2.5, 1.5-3.0, 1.5-3.5, 1.5-3.8, 1.5-3.9, 1.5-4.0, 1.5-4.5, or 1.5-5.0 kb. In some embodiments, the genetic element has a length of about 2.0-2.5, 2.0-3.0, 2.0-3.5, 2.0-3.8, 2.0-3.9, 2.0-4.0, 2.0-4.5, or 2.0-5.0 kb. In some embodiments, the genetic element has a length of about 2.5-3.0, 2.5-3.5, 2.5-3.8, 2.5-3.9, 2.5-4.0, 2.5-4.5, or 2.5-5.0 kb. In some embodiments, the genetic element has a length of about 3.0-5.0, 3.5-5.0, 4.0-5.0, or 4.5-5.0 kb. In some embodiments, the genetic element has a length of about 1.5-2.0, 2.0-2.5, 2.5-3.0, 3.0-3.5, 3.1-3.6, 3.2-3.7, 3.3-3.8, 3.4-3.9, 3.5-4.0, 4.0-4.5, or 4.5-5.0 kb. In some embodiments, the genetic element has a length between about 3.6-3.9 kb. In some embodiments, the genetic element has a length between about 2.8-2.9 kb. In some embodiments, the genetic element has a length between about 2.0-3.2 kb.

[0705] In some embodiments, the genetic element comprises one or more of the features described herein, e.g., a sequence encoding a substantially non-pathogenic protein, a protein binding sequence, one or more sequences encoding a regulatory nucleic acid, one or more regulatory sequences, one or more sequences encoding a replication protein, and other sequences.

[0706] In embodiments, the genetic element was produced from a double-stranded circular DNA (e.g., produced by in vitro circularization). In some embodiments, the genetic element was produced by rolling circle replication from the double-stranded circular DNA. In embodiments, the rolling circle replication occurs in a cell (e.g., a host cell, e.g., an avian cell (e.g., an MDCC cell) or a mammalian cell, e.g., a human cell, e.g., a HEK293T cell, an A549 cell, or a Jurkat cell). In embodiments, the genetic element can be amplified exponentially by rolling circle replication in the cell. In embodiments, the genetic element can be amplified linearly by rolling circle replication in the cell. In embodiments, the double-stranded circular DNA or genetic element is capable of yielding at least 2, 4, 8, 16, 32, 64, 128, 256, 518, 1024 or more times the original quantity by rolling circle replication in the cell. In embodiments, the double-stranded circular DNA was introduced into the cell, e.g., as described herein.

[0707] In some embodiments, the double-stranded circular DNA and/or the genetic element does not comprise one or more bacterial plasmid elements (e.g., a bacterial origin of replication or a selectable marker, e.g., a bacterial resistance gene, e.g., an ampicillin resistance gene). In some embodiments, the double-stranded circular DNA and/or the genetic element does not comprise a bacterial plasmid backbone.

[0708] In one embodiment, the invention includes a genetic element comprising a nucleic acid sequence (e.g., a DNA sequence) encoding (i) a substantially non-pathogenic exterior protein, (ii) an exterior protein binding sequence that binds the genetic element to the substantially non-pathogenic exterior protein, and (iii) a regulatory nucleic acid. In such an embodiment, the genetic element may comprise one or more sequences with at least about 60%, 70% 80%, 85%, 90% 95%, 96%, 97%, 98% and 99% nucleotide sequence identity to any one of the nucleotide sequences to a native viral sequence (e.g., a native CAV sequence, e.g., as described herein).

Protein Binding Sequence

[0709] A strategy employed by many viruses is that the viral capsid protein recognizes a specific protein binding sequence in its genome. For example, in viruses with unsegmented genomes, such as the L-A virus of yeast, there is a secondary structure (stem-loop) and a specific sequence at the 5 end of the genome that are both used to bind the viral capsid protein. However, viruses with segmented genomes, such as Reoviridae, Orthomyxoviridae (influenza), Bunyaviruses and Arenaviruses, need to package each of the genomic segments. Some viruses utilize a complementarity region of the segments to aid the virus in including one of each of the genomic molecules. Other viruses have specific binding sites for each of the different segments. See for example, Curr Opin Struct Biol. 2010 February; 20(1): 114-120; and Journal of Virology (2003), 77(24), 13036-13041.

[0710] In some embodiments, the genetic element encodes a protein binding sequence that binds to a protein comprised in a proteinaceous exterior (e.g., a capsid protein, e.g., a CAV VP1 molecule). In some embodiments, the protein binding sequence facilitates packaging the genetic element into the proteinaceous exterior. In some embodiments, the protein binding sequence specifically binds an arginine-rich region of the protein comprised in the proteinaceous exterior. In some embodiments, the genetic element comprises a protein binding sequence having the nucleic acid sequence AGCCCTGAAAAGGGGGGGGGGCTAAAGCCCCCCCCCCTTAAACCCCCCCCTGGGGGGGATT CCCCCCCAGACCCCCCCTTTATATAGCACTCAATAAACGCAGAAAATAGATTTATCGCACTA TC (SEQ ID NO: 17), or a reverse complement thereof. In some embodiments, the genetic element comprises a protein binding sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a 5 UTR, 3 UTR, or GC-rich domain of a CAV sequence, e.g., as described herein, e.g., in any of Tables 1-17.

5 UTR Regions

[0711] In some embodiments, a nucleic acid molecule as described herein (e.g., a genetic element, genetic element construct, or genetic element region) comprises a 5 UTR sequence, e.g., as described herein (e.g., in any of Tables 1-16, or a 5 UTR of a CAV genome listed in Table 17), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0712] In embodiments, the 5 UTR sequence comprises the nucleic acid sequence of the 5 UTR listed in Table 1A, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95% sequence identity to the 5 UTR listed in Table 1A. In embodiments, the 5 UTR sequence comprises the nucleic acid sequence of the 5 UTR listed in Table 1B, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95% sequence identity to the 5 UTR listed in Table 1B. In embodiments, the 5 UTR sequence comprises the nucleic acid sequence of the 5 UTR of a CAV genome listed in Table 17, or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least 95% sequence identity to the 5 UTR of a CAV genome listed in Table 17.

GC-Rich Regions

[0713] In some embodiments, a genetic element or genetic element construct as described herein comprises a nucleic acid sequence (e.g., a contiguous sequence having a length of 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 nucleotides) having a GC content of at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In embodiments, the genetic element or genetic element construct comprises a nucleic acid sequence (e.g., a contiguous sequence having a length of 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 nucleotides) having at least about 75% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a GC-rich sequence of a CAV genome described herein (e.g., in Table 1A or 1B, or as listed in Table 17). In some embodiments, the GC-rich region forms a hairpin.

Effectors

[0714] In some embodiments, the genetic element may include one or more sequences that encode an effector, e.g., a functional effector, e.g., an endogenous effector or an exogenous effector, e.g., a therapeutic effector. In some embodiments, the effector is a polypeptide or nucleic acid. In some embodiments, the effector has one or more of the following properties: (i) codon optimized for expression in a human cell, (ii) is a human polypeptide or nucleic acid, (iii) binds to a human polypeptide or nucleic acid, or (iv) has an activity in a human cell, e.g., modulates (e.g., increases or decreases) the activity and/or level of a human gene in the human cell).

[0715] The effector may modulate a biological activity, for example increasing or decreasing enzymatic activity, gene expression, cell signaling, and cellular or organ function. Effector activities may also include binding regulatory proteins to modulate activity of the regulator, such as transcription or translation. Effector activities also may include activator or inhibitor functions. For example, the effector may induce enzymatic activity. In some embodiments, the effector comprises an enzyme. In some embodiments, the exogenous effector comprises an antigen from an infectious agent (e.g., a virus or bacteria). In some embodiments, the effector is a cytotoxic or cytolytic RNA or protein. In some embodiments, the functional nucleic acid is a non-coding RNA. In some embodiments, the functional nucleic acid is a coding RNA. In some embodiments, the effector triggers increased substrate affinity in an enzyme, e.g., fructose 2,6-bisphosphate activates phosphofructokinase 1 and increases the rate of glycolysis in response to the insulin. In another example, the effector may inhibit substrate binding to a receptor and inhibit its activation, e.g., naltrexone and naloxone bind opioid receptors without activating them and block the receptors' ability to bind opioids. Effector activities may also include modulating protein stability/degradation and/or transcript stability/degradation. For example, proteins may be targeted for degradation by the polypeptide co-factor, ubiquitin, onto proteins to mark them for degradation. In another example, the effector inhibits enzymatic activity by blocking the enzyme's active site, e.g., methotrexate is a structural analog of tetrahydrofolate, a coenzyme for the enzyme dihydrofolate reductase that binds to dihydrofolate reductase 1000-fold more tightly than the natural substrate and inhibits nucleotide base synthesis.

[0716] In some embodiments, the sequence encoding an effector is part of the genetic element, e.g., it can be inserted at an insert site as described herein. In embodiments, the sequence encoding an effector is inserted into the genetic element at a noncoding region, e.g., a noncoding region disposed 3 of the open reading frames and 5 of the GC-rich region of the genetic element, in the 5 noncoding region upstream of the TATA box, in the 5 UTR, in the 3 noncoding region downstream of the poly-A signal, or upstream of the GC-rich region. In some embodiments, the sequence encoding an effector replaces part or all of an open reading frame (e.g., an ORF as described herein, e.g., a CAV VP1, VP2, and/or Apoptin).

[0717] In some embodiments, the sequence encoding an effector comprises 100-2000, 100-1000, 100-500, 100-200, 200-2000, 200-1000, 200-500, 500-1000, 500-2000, or 1000-2000 nucleotides. In some embodiments, the sequence encoding an effector comprises at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 nucleotides. In some embodiments, the effector is a nucleic acid or protein payload, e.g., as described herein.

[0718] Regulatory Nucleic Acids

[0719] In some embodiments, the effector is a regulatory nucleic acid. Regulatory nucleic acids modify expression of an endogenous gene and/or an exogenous gene. In one embodiment, the regulatory nucleic acid targets a host gene. The regulatory nucleic acids may include, but are not limited to, a nucleic acid that hybridizes to an endogenous gene (e.g., miRNA, siRNA, mRNA, lncRNA, RNA, DNA, an antisense RNA, gRNA as described herein elsewhere), nucleic acid that hybridizes to an exogenous nucleic acid such as a viral DNA or RNA, nucleic acid that hybridizes to an RNA, nucleic acid that interferes with gene transcription, nucleic acid that interferes with RNA translation, nucleic acid that stabilizes RNA or destabilizes RNA such as through targeting for degradation, and nucleic acid that modulates a DNA or RNA binding factor. In embodiments, the regulatory nucleic acid encodes an miRNA. In some embodiments, the regulatory nucleic acid is endogenous to a wild-type CAV. In some embodiments, the regulatory nucleic acid is exogenous to a wild-type CAV.

[0720] In some embodiments, the regulatory nucleic acid comprises RNA or RNA-like structures typically containing 5-500 base pairs (depending on the specific RNA structure, e.g., miRNA 5-30 bps, lncRNA 200-500 bps) and may have a nucleobase sequence identical (or complementary) or nearly identical (or substantially complementary) to a coding sequence in an expressed target gene within the cell, or a sequence encoding an expressed target gene within the cell.

[0721] In some embodiments, the regulatory nucleic acid comprises a nucleic acid sequence, e.g., a guide RNA (gRNA). In some embodiments, the DNA targeting moiety comprises a guide RNA or nucleic acid encoding the guide RNA. A gRNA short synthetic RNA can be composed of a scaffold sequence necessary for binding to the incomplete effector moiety and a user-defined 20 nucleotide targeting sequence for a genomic target. In practice, guide RNA sequences are generally designed to have a length of between 17-24 nucleotides (e.g., 19, 20, or 21 nucleotides) and complementary to the targeted nucleic acid sequence. Custom gRNA generators and algorithms are available commercially for use in the design of effective guide RNAs. Gene editing has also been achieved using a chimeric single guide RNA (sgRNA), an engineered (synthetic) single RNA molecule that mimics a naturally occurring crRNA-tracrRNA complex and contains both a tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective in genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985-991.

[0722] The regulatory nucleic acid comprises a gRNA that recognizes specific DNA sequences (e.g., sequences adjacent to or within a promoter, enhancer, silencer, or repressor of a gene).

[0723] Certain regulatory nucleic acids can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules comprise RNA or RNA-like structures typically containing 15-50 base pairs (such as about 18-25 base pairs) and having a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell. RNAi molecules include, but are not limited to: short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), meroduplexes, and dicer substrates (U.S. Pat. Nos. 8,084,599 8,349,809 and 8,513,207).

[0724] Long non-coding RNAs (lncRNA) are defined as non-protein coding transcripts longer than 100 nucleotides. This somewhat arbitrary limit distinguishes lncRNAs from small regulatory RNAs such as microRNAs (miRNAs), short interfering RNAs (siRNAs), and other short RNAs. In general, the majority (78%) of lncRNAs are characterized as tissue-specific. Divergent lncRNAs that are transcribed in the opposite direction to nearby protein-coding genes (comprise a significant proportion 20% of total lncRNAs in mammalian genomes) may possibly regulate the transcription of the nearby gene.

[0725] The genetic element may encode regulatory nucleic acids with a sequence substantially complementary, or fully complementary, to all or a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acids may complement sequences at the boundary between introns and exons to prevent the maturation of newly-generated nuclear RNA transcripts of specific genes into mRNA for transcription. The regulatory nucleic acids that are complementary to specific genes can hybridize with the mRNA for that gene and prevent its translation. The antisense regulatory nucleic acid can be DNA, RNA, or a derivative or hybrid thereof.

[0726] The length of the regulatory nucleic acid that hybridizes to the transcript of interest may be between 5 to 30 nucleotides, between about 10 to 30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0727] The genetic element may encode a regulatory nucleic acid, e.g., a micro RNA (miRNA) molecule identical to about 5 to about 25 contiguous nucleotides of a target gene. In some embodiments, the miRNA sequence targets a mRNA and commences with the dinucleotide AA, comprises a GC-content of about 30-70% (about 30-60%, about 40-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the mammal in which it is to be introduced, for example as determined by standard BLAST search.

[0728] siRNAs and shRNAs resemble intermediates in the processing pathway of the endogenous microRNA (miRNA) genes (Bartel, Cell 116:281-297, 2004). In some embodiments, siRNAs can function as miRNAs and vice versa (Zeng et al., Mol Cell 9:1327-1333, 2002; Doench et al., Genes Dev 17:438-442, 2003). MicroRNAs, like siRNAs, use RISC to downregulate target genes, but unlike siRNAs, most animal miRNAs do not cleave the mRNA. Instead, miRNAs reduce protein output through translational suppression or polyA removal and mRNA degradation (Wu et al., Proc Natl Acad Sci USA 103:4034-4039, 2006). Known miRNA binding sites are within mRNA 3 UTRs; miRNAs seem to target sites with near-perfect complementarity to nucleotides 2-8 from the miRNA's 5 end (Rajewsky, Nat Genet 38 Suppl:S8-13, 2006; Lim et al., Nature 433:769-773, 2005). This region is known as the seed region. Because siRNAs and miRNAs are interchangeable, exogenous siRNAs downregulate mRNAs with seed complementarity to the siRNA (Birmingham et al., Nat Methods 3:199-204, 2006. Multiple target sites within a 3 UTR give stronger downregulation (Doench et al., Genes Dev 17:438-442, 2003).

[0729] Lists of known miRNA sequences can be found in databases maintained by research organizations, such as Wellcome Trust Sanger Institute, Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are readily designed and produced by technologies known in the art. In addition, there are computational tools that increase the chance of finding effective and specific sequence motifs (Lagana et al., Methods Mol. Bio., 2015, 1269:393-412).

[0730] The regulatory nucleic acid may modulate expression of RNA encoded by a gene. Because multiple genes can share some degree of sequence homology with each other, in some embodiments, the regulatory nucleic acid can be designed to target a class of genes with sufficient sequence homology. In some embodiments, the regulatory nucleic acid can contain a sequence that has complementarity to sequences that are shared amongst different gene targets or are unique for a specific gene target. In some embodiments, the regulatory nucleic acid can be designed to target conserved regions of an RNA sequence having homology between several genes thereby targeting several genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the regulatory nucleic acid can be designed to target a sequence that is unique to a specific RNA sequence of a single gene.

[0731] In some embodiments, the genetic element may include one or more sequences that encode regulatory nucleic acids that modulate expression of one or more genes.

[0732] In one embodiment, the gRNA described elsewhere herein are used as part of a CRISPR system for gene editing. For the purposes of gene editing, the CAVector may be designed to include one or multiple guide RNA sequences corresponding to a desired target DNA sequence; see, for example, Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308. At least about 16 or 17 nucleotides of gRNA sequence generally allow for Cas9-mediated DNA cleavage to occur; for Cpf1 at least about 16 nucleotides of gRNA sequence is needed to achieve detectable DNA cleavage.

Therapeutic Effectors (e.g., Peptides or Polypeptides)

[0733] In some embodiments, the genetic element comprises a therapeutic expression sequence, e.g., a sequence that encodes a therapeutic peptide or polypeptide. In some embodiments, the genetic element includes a sequence encoding a protein e.g., a therapeutic protein. Some examples of therapeutic proteins may include, but are not limited to, a hormone, a cytokine, an enzyme, an antibody (e.g., one or a plurality of polypeptides encoding at least a heavy chain or a light chain), a transcription factor, a receptor (e.g., a membrane receptor), a ligand, a membrane transporter, a secreted protein, a peptide, a carrier protein, a structural protein, a nuclease, or a component thereof.

[0734] In some embodiments, the genetic element includes a sequence encoding a peptide e.g., a therapeutic peptide. The peptides may be linear or branched. The peptide has a length from about 5 to about 500 amino acids, about 15 to about 400 amino acids, about 20 to about 325 amino acids, about 25 to about 250 amino acids, about 50 to about 200 amino acids, or any range therebetween. Some examples of peptides include, but are not limited to, fluorescent tag or marker, antigen, peptide therapeutic, synthetic or analog peptide from naturally-bioactive peptide, agonist or antagonist peptide, anti-microbial peptide, a targeting or cytotoxic peptide, a degradation or self-destruction peptide, and degradation or self-destruction peptides. Peptides useful in the invention described herein also include antigen-binding peptides, e.g., antigen binding antibody or antibody-like fragments, such as single chain antibodies, nanobodies (see, e.g., Steeland et al. 2016. Nanobodies as therapeutics: big opportunities for small antibodies. Drug Discov Today: 21(7):1076-113). Such antigen binding peptides may bind a cytosolic antigen, a nuclear antigen, or an intra-organellar antigen.

[0735] In some embodiments, the genetic element comprises a sequence that encodes small peptides, peptidomimetics (e.g., peptoids), amino acids, and amino acid analogs. Such therapeutics generally have a molecular weight less than about 5,000 grams per mole, a molecular weight less than about 2,000 grams per mole, a molecular weight less than about 1,000 grams per mole, a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. Such therapeutics may include, but are not limited to, a neurotransmitter, a hormone, a drug, a toxin, a viral or microbial particle, a synthetic molecule, and agonists or antagonists thereof.

[0736] In some embodiments, the composition or CAVector described herein includes a polypeptide linked to a ligand that is capable of targeting a specific location, tissue, or cell.

[0737] In some embodiments, the polypeptide encoded by the therapeutic expression sequence may be a functional variant or fragment thereof of any of the above, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence which disclosed in a table herein by reference to its UniProt ID.

[0738] In some embodiments, the therapeutic expression sequence may encode an antibody or antibody fragment that binds any of the above, e.g., an antibody against a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence which disclosed in a table herein by reference to its UniProt ID. The term antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity. An antibody fragment refers to a molecule that includes at least one heavy chain or light chain and binds an antigen. Examples of antibody fragments include but are not limited to Fv, Fab, Fab, Fab-SH, F(ab).sub.2; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments.

[0739] Exemplary Intracellular Polypeptide Effectors

[0740] In some embodiments, the effector comprises a cytosolic polypeptide or cytosolic peptide. In some embodiments, the effector comprises cytosolic peptide is a DPP-4 inhibitor, an activator of GLP-1 signaling, or an inhibitor of neutrophil elastase. In some embodiments, the effector increases the level or activity of a growth factor or receptor thereof (e.g., an FGF receptor, e.g., FGFR3). In some embodiments, the effector comprises an inhibitor of n-myc interacting protein activity (e.g., an n-myc interacting protein inhibitor); an inhibitor of EGFR activity (e.g., an EGFR inhibitor); an inhibitor of IDH1 and/or IDH2 activity (e.g., an IDH1 inhibitor and/or an IDH2 inhibitor); an inhibitor of LRP5 and/or DKK2 activity (e.g., an LRP5 and/or DKK2 inhibitor); an inhibitor of KRAS activity; an activator of HTT activity; or inhibitor of DPP-4 activity (e.g., a DPP-4 inhibitor).

[0741] In some embodiments, the effector comprises a regulatory intracellular polypeptide. In some embodiments, the regulatory intracellular polypeptide binds one or more molecule (e.g., protein or nucleic acid) endogenous to the target cell. In some embodiments, the regulatory intracellular polypeptide increases the level or activity of one or more molecule (e.g., protein or nucleic acid) endogenous to the target cell. In some embodiments, the regulatory intracellular polypeptide decreases the level or activity of one or more molecule (e.g., protein or nucleic acid) endogenous to the target cell.

[0742] Exemplary Secreted Polypeptide Effectors

[0743] Exemplary secreted therapeutics are described herein, e.g., in the tables below.

TABLE-US-00019 TABLE 18A Exemplary cytokines and cytokine receptors Cytokine Cytokine receptor(s) Entrez Gene ID UniProt ID IL-1, IL-1, or a IL-1 type 1 receptor, IL-1 type 3552, 3553 P01583, P01584 heterodimer thereof 2 receptor IL-1Ra IL-1 type 1 receptor, IL-1 type 3454, 3455 P17181, P48551 2 receptor IL-2 IL-2R 3558 P60568 IL-3 IL-3 receptor + c (CD131) 3562 P08700 IL-4 IL-4R type I, IL-4R type II 3565 P05112 IL-5 IL-5R 3567 P05113 IL-6 IL-6R (sIL-6R) gp130 3569 P05231 IL-7 IL-7R and sIL-7R 3574 P13232 IL-8 CXCR1 and CXCR2 3576 P10145 IL-9 IL-9R 3578 P15248 IL-10 IL-10R1/IL-10R2 complex 3586 P22301 IL-11 IL-11R 1 gp130 3589 P20809 IL-12 (e.g., p35, p40, or a IL-12R1 and IL-12R2 3593, 3592 P29459, P29460 heterodimer thereof) IL-13 IL-13R11 and IL-13R12 3596 P35225 IL-14 IL-14R 30685 P40222 IL-15 IL-15R 3600 P40933 IL-16 CD4 3603 Q14005 IL-17A IL-17RA 3605 Q16552 IL-17B IL-17RB 27190 Q9UHF5 IL-17C IL-17RA to IL-17RE 27189 Q9P0M4 e SEF 53342 Q8TAD2 IL-17F IL-17RA, IL-17RC 112744 Q96PD4 IL-18 IL-18 receptor 3606 Q14116 IL-19 IL-20R1/IL-20R2 29949 Q9UHD0 IL-20 L-20R1/IL-20R2 and 50604 Q9NYY1 IL-22R1/IL-20R2 IL-21 IL-21R 59067 Q9HBE4 IL-22 IL-22R 50616 Q9GZX6 IL-23 (e.g., p19, p40, or a IL-23R 51561 Q9NPF7 heterodimer thereof) IL-24 IL-20R1/IL-20R2 and 11009 Q13007 IL-22R1/IL-20R2 IL-25 IL-17RA and IL-17RB 64806 Q9H293 IL-26 IL-10R2 chain and IL-20R1 55801 Q9NPH9 chain IL-27 (e.g., p28, EBI3, or WSX-1 and gp130 246778 Q8NEV9 a heterodimer thereof) IL-28A, IL-28B, and IL29 IL-28R1/IL-10R2 282617, 282618 Q8IZI9, Q8IU54 IL-30 IL6R/gp130 246778 Q8NEV9 IL-31 IL-31RA/OSMR 386653 Q6EBC2 IL-32 9235 P24001 IL-33 ST2 90865 O95760 IL-34 Colony-stimulating factor 1 146433 Q6ZMJ4 receptor IL-35 (e.g., p35, EBI3, or IL-12R2/gp130; 10148 Q14213 a heterodimer thereof) IL-12R2/IL-12R2; gp130/gp130 IL-36 IL-36Ra 27179 Q9UHA7 IL-37 IL-18R and IL-18BP 27178 Q9NZH6 IL-38 IL-1R1, IL-36R 84639 Q8WWZ1 IFN- IFNAR 3454 P17181 IFN- IFNAR 3454 P17181 IFN- IFNGR1/IFNGR2 3459 P15260 TGF- TR-I and TR-II 7046, 7048 P36897, P37173 TNF- TNFR1, TNFR2 7132, 7133 P19438, P20333

[0744] In some embodiments, an effector described herein comprises a cytokine of Table 18A, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, an effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 50 by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding cytokine receptor with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher or lower than the Kd of the corresponding wild-type cytokine for the same receptor under the same conditions. In some embodiments, the effector comprises a fusion protein comprising a first region (e.g., a cytokine polypeptide of Table 18A or a functional variant or fragment) and a second, heterologous region. In some embodiments, the first region is a first cytokine polypeptide of Table 18A. In some embodiments, the second region is a second cytokine polypeptide of Table 18A, wherein the first and second cytokine polypeptides form a cytokine heterodimer with each other in a wild-type cell. In some embodiments, the polypeptide of Table 18A or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence. In some embodiments, an CAVector encoding a cytokine of Table 18A, or a functional variant thereof, is used for the treatment of a disease or disorder described herein.

[0745] In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a cytokine of Table 18A. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a cytokine receptor of Table 18A. In some embodiments, the antibody molecule comprises a signal sequence.

[0746] Exemplary cytokines and cytokine receptors are described, e.g., in Akdis et al., Interleukins (from IL-1 to IL-38), interferons, transforming growth factor , and TNF-: Receptors, functions, and roles in diseases October 2016 Volume 138, Issue 4, Pages 984-1010, which is herein incorporated by reference in its entirety, including Table I therein.

TABLE-US-00020 TABLE 18B Exemplary polypeptide hormones and receptors Hormone Receptor Entrez Gene ID UniProt ID Natriuretic Peptide, e.g., Atrial NPRA, NPRB, NPRC 4878 P01160 Natriuretic Peptide (ANP) Brain Natriuretic Peptide (BNP) NPRA, NPRB 4879 P16860 C-type natriuretic peptide NPRB 4880 P23582 (CNP) Growth hormone (GH) GHR 2690 P10912 Human growth hormone (hGH) hGH receptor (human 2690 P10912 GHR) Prolactin (PRL) PRLR 5617 P01236 Thyroid-stimulating hormone TSH receptor 7253 P16473 (TSH) Adrenocorticotropic hormone ACTH receptor 5443 P01189 (ACTH) Follicle-stimulating hormone FSHR 2492 P23945 (FSH) Luteinizing hormone (LH) LHR 3973 P22888 Antidiuretic hormone (ADH) Vasopressin receptors, e.g., 554 P30518 V2; AVPR1A; AVPR1B; AVPR3; AVPR2 Oxytocin OXTR 5020 P01178 Calcitonin Calcitonin receptor (CT) 796 P01258 Parathyroid hormone (PTH) PTH1R and PTH2R 5741 P01270 Insulin Insulin receptor (IR) 3630 P01308 Glucagon Glucagon receptor 2641 P01275

[0747] In some embodiments, an effector described herein comprises a hormone of Table 18B, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, an effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 51 by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type hormone for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 18B or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence. In some embodiments, an CAVector encoding a hormone of Table 18B, or a functional variant thereof, is used for the treatment of a disease or disorder described herein.

[0748] In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a hormone of Table 18B. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a hormone receptor of Table 18B. In some embodiments, the antibody molecule comprises a signal sequence.

TABLE-US-00021 TABLE 18C Exemplary growth factors Growth Factor Entrez Gene ID UniProt ID PDGF family PDGF (e.g., PDGF-1, PDGF receptor, e.g., 5156 P16234 PDGF-2, or a PDGFR, PDGFR heterodimer thereof) CSF-1 CSF1R 1435 P09603 SCF CD117 3815 P10721 VEGF family VEGF (e.g., isoforms VEGFR-1, VEGFR-2 2321 P17948 VEGF 121, VEGF 165, VEGF 189, and VEGF 206) VEGF-B VEGFR-1 2321 P17949 VEGF-C VEGFR-2 and 2324 P35916 VEGFR -3 PIGF VEGFR-1 5281 Q07326 EGF family EGF EGFR 1950 P01133 TGF- EGFR 7039 P01135 amphiregulin EGFR 374 P15514 HB-EGF EGFR 1839 Q99075 betacellulin EGFR, ErbB-4 685 P35070 epiregulin EGFR, ErbB-4 2069 O14944 Heregulin EGFR, ErbB-4 3084 Q02297 FGF family FGF-1, FGF-2, FGF-3, FGFR1, FGFR2, 2246, 2247, 2248, 2249, P05230, P09038, FGF-4, FGF-5, FGF-6, FGFR3, and FGFR4 2250, 2251, 2252, 2253, 2254 P11487, P08620, FGF-7, FGF-8, FGF-9 P12034, P10767, P21781, P55075, P31371 Insulin family Insulin IR 3630 P01308 IGF-I IGF-I receptor, IGF- 3479 P05019 II receptor IGF-II IGF-II receptor 3481 P01344 HGF family HGF MET receptor 3082 P14210 MSP RON 4485 P26927 Neurotrophin family NGF LNGFR, trkA 4803 P01138 BDNF trkB 627 P23560 NT-3 trkA, trkB, trkC 4908 P20783 NT-4 trkA, trkB 4909 P34130 NT-5 trkA, trkB 4909 P34130 Angiopoietin family ANGPT1 HPK-6/TEK 284 Q15389 ANGPT2 HPK-6/TEK 285 O15123 ANGPT3 HPK-6/TEK 9068 O95841 ANGPT4 HPK-6/TEK 51378 Q9Y264

[0749] In some embodiments, an effector described herein comprises a growth factor of Table 18C, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, an effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 52 by reference to its UniProt ID. In some embodiments, the functional variant binds to the corresponding receptor with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type growth factor for the same receptor under the same conditions. In some embodiments, the polypeptide of Table 18C or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence. In some embodiments, a CAVector encoding a growth factor of Table 18C, or a functional variant thereof, is used for the treatment of a disease or disorder described herein.

[0750] In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a growth factor of Table 18C. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds a growth factor receptor of Table 18C. In some embodiments, the antibody molecule comprises a signal sequence.

[0751] Exemplary growth factors and growth factor receptors are described, e.g., in Bafico et al., Classification of Growth Factors and Their Receptors Holland-Frei Cancer Medicine. 6th edition, which is herein incorporated by reference in its entirety.

TABLE-US-00022 TABLE 18D Clotting-associated factors Effector Indication Entrez Gene ID UniProt ID Factor I Afibrinogenomia 2243, 2266, 2244 P02671, P02679, P02675 (fibrinogen) Factor II Factor II Deficiency 2147 P00734 Factor IX Hemophilia B 2158 P00740 Factor V Owren's disease 2153 P12259 Factor VIII Hemophilia A 2157 P00451 Factor X Stuart-Prower Factor 2159 P00742 Deficiency Factor XI Hemophilia C 2160 P03951 Factor XIII Fibrin Stabilizing factor 2162, 2165 P00488, P05160 deficiency vWF von Willebrand disease 7450 P04275

[0752] In some embodiments, an effector described herein comprises a polypeptide of Table 18D, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, an effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 53 by reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate no less than 10%, 20%, 30%, 40%, or 50% lower than the wild-type protein. In some embodiments, the polypeptide of Table 18D or functional variant thereof comprises a signal sequence, e.g., a signal sequence that is endogenous to the effector, or a heterologous signal sequence. In some embodiments, a CAVector encoding a polypeptide of Table 18D, or a functional variant thereof is used for the treatment of a disease or disorder of Table 18D.

[0753] Exemplary Protein Replacement Therapeutics

[0754] Exemplary protein replacement therapeutics are described herein, e.g., in the tables below.

TABLE-US-00023 TABLE 19A Exemplary enzymatic effectors and corresponding indications Effector deficiency Entrez Gene ID UniProt ID 3-methylcrotonyl-CoA 3-methylcrotonyl-CoA 56922, 64087 Q96RQ3, Q9HCC0 carboxylase carboxylase deficiency Acetyl-CoA- Mucopolysaccharidosis MPS 138050 Q68CP4 glucosaminide N- III (Sanfilippo's syndrome) acetyltransferase Type III-C ADAMTS13 Thrombotic 11093 Q76LX8 Thrombocytopenia Purpura adenine Adenine 353 P07741 phosphoribosyltransferase phosphoribosyltransferase deficiency Adenosine deaminase Adenosine deaminase 100 P00813 deficiency ADP-ribose protein Glutamyl ribose-5-phosphate 26119, 54936 Q5SW96, Q9NX46 hydrolase storage disease alpha glucosidase Glycogen storage disease 2548 P10253 type 2 (Pompe's disease) Arginase Familial hyperarginemia 383, 384 P05089, P78540 Arylsulfatase A Metachromatic 410 P15289 leukodystrophy Cathepsin K Pycnodysostosis 1513 P43235 Ceramidase Farber's disease 125981, 340485, 55331 Q8TDN7, (lipogranulomatosis) Q5QJU3, Q9NUN7 Cystathionine B Homocystinuria 875 P35520 synthase Dolichol-P-mannose Congenital disorders of N- 8813, 54344 O60762, Q9P2X0 synthase glycosylation CDG Ie Dolicho-P- Congenital disorders of N- 84920 Q5BKT4 Glc: Man9GlcNAc2-PP- glycosylation CDG Ic dolichol glucosyltransferase Dolicho-P- Congenital disorders of N- 10195 Q92685 Man: Man5GlcNAc2- glycosylation CDG Id PP-dolichol mannosyltransferase Dolichyl-P-glucose: Glc- Congenital disorders of N- 79053 Q9BVK2 1-Man-9-GlcNAc-2-PP- glycosylation CDG Ih dolichyl--3- glucosyltransferase Dolichyl-P- Congenital disorders of N- 79087 Q9BV10 mannose: Man-7- glycosylation CDG Ig GlcNAc-2-PP-dolichyl- -6-mannosyltransferase Factor II Factor II Deficiency 2147 P00734 Factor IX Hemophilia B 2158 P00740 Factor V Owren's disease 2153 P12259 Factor VIII Hemophilia A 2157 P00451 Factor X Stuart-Prower Factor 2159 P00742 Deficiency Factor XI Hemophilia C 2160 P03951 Factor XIII Fibrin Stabilizing factor 2162, 2165 P00488, P05160 deficiency Galactosamine-6-sulfate Mucopolysaccharidosis MPS 2588 P34059 sulfatase IV (Morquio's syndrome) Type IV-A Galactosylceramide - Krabbe's disease 2581 P54803 galactosidase Ganglioside - GM1 gangliosidosis, 2720 P16278 galactosidase generalized Ganglioside - GM2 gangliosidosis 2720 P16278 galactosidase Ganglioside - Sphingolipidosis Type I 2720 P16278 galactosidase Ganglioside - Sphingolipidosis Type II 2720 P16278 galactosidase (juvenile type) Ganglioside - Sphingolipidosis Type III 2720 P16278 galactosidase (adult type) Glucosidase I Congenital disorders of N- 2548 P10253 glycosylation CDG IIb Glucosylceramide - Gaucher's disease 2629 P04062 glucosidase Heparan-S-sulfate Mucopolysaccharidosis MPS 6448 P51688 sulfamidase III (Sanfilippo's syndrome) Type III-A homogentisate oxidase Alkaptonuria 3081 Q93099 Hyaluronidase Mucopolysaccharidosis MPS 3373, 8692, 8372, 23553 Q12794, Q12891, IX (hyaluronidase deficiency) O43820, Q2M3T9 Iduronate sulfate Mucopolysaccharidosis MPS 3423 P22304 sulfatase II (Hunter's syndrome) Lecithin-cholesterol Complete LCAT deficiency, 3931 606967 acyltransferase (LCAT) Fish-eye disease, atherosclerosis, hypercholesterolemia Lysine oxidase Glutaric acidemia type I 4015 P28300 Lysosomal acid lipase Cholesteryl ester storage 3988 P38571 disease (CESD) Lysosomal acid lipase Lysosomal acid lipase 3988 P38571 deficiency lysosomal acid lipase Wolman's disease 3988 P38571 Lysosomal pepstatin- Ceroid lipofuscinosis Late 1200 O14773 insensitive peptidase infantile form (CLN2, Jansky-Bielschowsky disease) Mannose (Man) Congenital disorders of N- 4351 P34949 phosphate (P) isomerase glycosylation CDG Ib Mannosyl--1,6- Congenital disorders of N- 4247 Q10469 glycoprotein--1,2-N- glycosylation CDG IIa acetylglucosminyltransferase Metalloproteinase-2 Winchester syndrome 4313 P08253 methylmalonyl-CoA Methylmalonic acidemia 4594 P22033 mutase (vitamin b12 non-responsive) N-Acetyl Mucopolysaccharidosis MPS 411 P15848 galactosamine -4- VI (Maroteaux-Lamy sulfate sulfatase syndrome) (arylsulfatase B) N-acetyl-D- Mucopolysaccharidosis MPS 4669 P54802 glucosaminidase III (Sanfilippo's syndrome) Type III-B N-Acetyl- Schindler's disease Type I 4668 P17050 galactosaminidase (infantile severe form) N-Acetyl- Schindler's disease Type II 4668 P17050 galactosaminidase (Kanzaki disease, adult-onset form) N-Acetyl- Schindler's disease Type III 4668 P17050 galactosaminidase (intermediate form) N-acetyl-glucosaminine- Mucopolysaccharidosis MPS 2799 P15586 6-sulfate sulfatase III (Sanfilippo's syndrome) Type III-D N-acetylglucosaminyl-1- Mucolipidosis ML III 79158 Q3T906 phosphotransferase (pseudo-Hurler's polydystrophy) N-Acetylglucosaminyl- Mucolipidosis ML II (I-cell 79158 Q3T906 1-phosphotransferase disease) catalytic subunit N-acetylglucosaminyl-1- Mucolipidosis ML III 84572 Q9UJJ9 phosphotransferase, (pseudo-Hurler's substrate-recognition polydystrophy) Type III-C subunit N- Aspartylglucosaminuria 175 P20933 Aspartylglucosaminidase Neuraminidase 1 Sialidosis 4758 Q99519 (sialidase) Palmitoyl-protein Ceroid lipofuscinosis Adult 5538 P50897 thioesterase-1 form (CLN4, Kufs' disease) Palmitoyl-protein Ceroid lipofuscinosis 5538 P50897 thioesterase-1 Infantile form (CLN1, Santavuori-Haltia disease) Phenylalanine Phenylketonuria 5053 P00439 hydroxylase Phosphomannomutase-2 Congenital disorders of N- 5373 O15305 glycosylation CDG Ia (solely neurologic and neurologic- multivisceral forms) Porphobilinogen Acute Intermittent Porphyria 3145 P08397 deaminase Purine nucleoside Purine nucleoside 4860 P00491 phosphorylase phosphorylase deficiency pyrimidine 5 Hemolytic anemia and/or 51251 Q9H0P0 nucleotidase pyrimidine 5 nucleotidase deficiency Sphingomyelinase Niemann-Pick disease type A 6609 P17405 Sphingomyelinase Niemann-Pick disease type B 6609 P17405 Sterol 27-hydroxylase Cerebrotendinous 1593 Q02318 xanthomatosis (cholestanol lipidosis) Thymidine Mitochondrial 1890 P19971 phosphorylase neurogastrointestinal encephalomyopathy (MNGIE) Trihexosylceramide - Fabry's disease 2717 P06280 galactosidase tyrosinase, e.g., OCA1 albinism, e.g., ocular albinism 7299 P14679 UDP-GlcNAc: dolichyl- Congenital disorders of N- 1798 Q9H3H5 P NAcGlc glycosylation CDG Ij phosphotransferase UDP-N- Sialuria French type 10020 Q9Y223 acetylglucosamine-2- epimerase/N- acetylmannosamine kinase, sialin Uricase Lesch-Nyhan syndrome, gout 391051 No protein uridine diphosphate Crigler-Najjar syndrome 54658 P22309 glucuronyl-transferase (e.g., UGT1A1) -1,2- Congenital disorders of N- 79796 Q9H6U8 Mannosyltransferase glycosylation CDG Il (608776) -1,2- Congenital disorders of N- 79796 Q9H6U8 Mannosyltransferase glycosylation, type I (pre- Golgi glycosylation defects) -1,3- Congenital disorders of N- 440138 Q2TAA5 Mannosyltransferase glycosylation CDG Ii -D-Mannosidase -Mannosidosis, type I 10195 Q92685 (severe) or II (mild) -L-Fucosidase Fucosidosis 4123 Q9NTJ4 -l-Iduronidase Mucopolysaccharidosis MPS 2517 P04066 I H/S (Hurler-Scheie syndrome) -l-Iduronidase Mucopolysaccharidosis MPS 3425 P35475 I-H (Hurler's syndrome) -l-Iduronidase Mucopolysaccharidosis MPS 3425 P35475 I-S (Scheie's syndrome) -1,4- Congenital disorders of N- 3425 P35475 Galactosyltransferase glycosylation CDG IId -1,4- Congenital disorders of N- 2683 P15291 Mannosyltransferase glycosylation CDG Ik -D-Mannosidase -Mannosidosis 56052 Q9BT22 -Galactosidase Mucopolysaccharidosis MPS 4126 O00462 IV (Morquio's syndrome) Type IV-B -Glucuronidase Mucopolysaccharidosis MPS 2720 P16278 VII (Sly's syndrome) -Hexosaminidase A Tay-Sachs disease 2990 P08236 -Hexosaminidase B Sandhoff's disease 3073 P06865

[0755] In some embodiments, an effector described herein comprises an enzyme of Table 19A, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, an effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 54 by reference to its UniProt ID. In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate no less than 10%, 20%, 30%, 40%, or 50% lower than the wild-type protein. In some embodiments, a CAVector encoding an enzyme of Table 19A, or a functional variant thereof is used for the treatment of a disease or disorder of Table 19A. In some embodiments, a CAVector is used to deliver uridine diphosphate glucuronyl-transferase or a functional variant thereof to a target cell, e.g., a liver cell. In some embodiments, a CAVector is used to deliver OCA1 or a functional variant thereof to a target cell, e.g., a retinal cell.

TABLE-US-00024 TABLE 19B Exemplary non-enzymatic effectors and corresponding indications Effector Indication Entrez Gene ID UniProt ID Survival motor neuron spinal muscular atrophy 6606 Q16637 protein (SMN) Dystrophin or micro- muscular dystrophy 1756 P11532 dystrophin (e.g., Duchenne muscular dystrophy or Becker muscular dystrophy) Complement protein, Complement Factor I 3426 P05156 e.g., Complement deficiency factor C1 Complement factor H Atypical hemolytic 3075 P08603 uremic syndrome Cystinosin (lysosomal Cystinosis 1497 O60931 cystine transporter) Epididymal secretory Niemann-Pick disease 10577 P61916 protein 1 (HE1; NPC2 Type C2 protein) GDP-fucose Congenital disorders of 55343 Q96A29 transporter-1 N-glycosylation CDG IIc (Rambam-Hasharon syndrome) GM2 activator protein GM2 activator protein 2760 Q17900 deficiency (Tay-Sachs disease AB variant, GM2A) Lysosomal Ceroid lipofuscinosis 1207 Q13286 transmembrane CLN3 Juvenile form (CLN3, protein Batten disease, Vogt- Spielmeyer disease) Lysosomal Ceroid lipofuscinosis 1203 O75503 transmembrane CLN5 Variant late infantile protein form, Finnish type (CLN5) Na phosphate Infantile sialic acid 26503 Q9NRA2 cotransporter, sialin storage disorder Na phosphate Sialuria Finnish type 26503 Q9NRA2 cotransporter, sialin (Salla disease) NPC1 protein Niemann-Pick disease 4864 O15118 Type C1/Type D Oligomeric Golgi Congenital disorders of 91949 P83436 complex-7 N-glycosylation CDG IIe Prosaposin Prosaposin deficiency 5660 P07602 Protective Galactosialidosis 5476 P10619 protein/cathepsin A (Goldberg's syndrome, (PPCA) combined neuraminidase and - galactosidase deficiency) Protein involved in Congenital disorders of 9526 O75352 mannose-P-dolichol N-glycosylation CDG If utilization Saposin B Saposin B deficiency 5660 P07602 (sulfatide activator deficiency) Saposin C Saposin C deficiency 5660 P07602 (Gaucher's activator deficiency) Sulfatase-modifying Mucosulfatidosis 285362 Q8NBK3 factor-1 (multiple sulfatase deficiency) Transmembrane Ceroid lipofuscinosis 54982 Q9NWW5 CLN6 protein Variant late infantile form (CLN6) Transmembrane Ceroid lipofuscinosis 2055 Q9UBY8 CLN8 protein Progressive epilepsy with intellectual disability vWF von Willebrand disease 7450 P04275 Factor I (fibrinogen) Afibrinogenomia 2243, 2244, 2266 P02671, P02675, P02679 erythropoietin (hEPO)

[0756] In some embodiments, an effector described herein comprises an erythropoietin (EPO), e.g., a human erythropoietin (hEPO), or a functional variant thereof. In some embodiments, a CAVector encoding an erythropoietin, or a functional variant thereof is used for stimulating erythropoiesis. In some embodiments, a CAVector encoding an erythropoietin, or a functional variant thereof is used for the treatment of a disease or disorder, e.g., anemia. In some embodiments, a CAVector is used to deliver EPO or a functional variant thereof to a target cell, e.g., a red blood cell.

[0757] In some embodiments, an effector described herein comprises a polypeptide of Table 19B, or a functional variant thereof, e.g., a homolog (e.g., ortholog or paralog) or fragment thereof. In some embodiments, an effector described herein comprises a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% sequence identity to an amino acid sequence listed in Table 55 by reference to its UniProt ID. In some embodiments, a CAVector encoding a polypeptide of Table 19B, or a functional variant thereof is used for the treatment of a disease or disorder of Table 19B. In some embodiments, a CAVector is used to deliver SMN or a functional variant thereof to a target cell, e.g., a cell of the spinal cord and/or a motor neuron. In some embodiments, a CAVector is used to deliver a micro-dystrophin to a target cell, e.g., a myocyte.

[0758] Exemplary micro-dystrophins are described in Duan, Systemic AAV Micro-dystrophin Gene Therapy for Duchenne Muscular Dystrophy. Mol Ther. 2018 Oct. 3; 26(10):2337-2356. doi: 10.1016/j.ymthe.2018.07.011. Epub 2018 Jul. 17.

[0759] In some embodiments, an effector described herein comprises a clotting factor, e.g., a clotting factor listed in any table herein (e.g., Table 19A or 19B). In some embodiments, an effector described herein comprises a protein that, when mutated, causes a lysosomal storage disorder, e.g., a protein listed in any table herein (e.g., Table 19A or 19B). In some embodiments, an effector described herein comprises a transporter protein, e.g., a transporter protein listed in any table herein (e.g., Table 19A or 19B).

[0760] In some embodiments, a functional variant of a wild-type protein comprises a protein that has one or more activities of the wild-type protein, e.g., the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate no less than 10%, 20%, 30%, 40%, or 50% lower than the wild-type protein. In some embodiments, the functional variant binds to the same binding partner that is bound by the wild-type protein, e.g., with a Kd of no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type protein for the same binding partner under the same conditions. In some embodiments, the functional variant has at a polypeptide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to that of the wild-type polypeptide. In some embodiments, the functional variant comprises a homolog (e.g., ortholog or paralog) of the corresponding wild-type protein. In some embodiments, the functional variant is a fusion protein. In some embodiments, the fusion comprises a first region with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the corresponding wild-type protein, and a second, heterologous region. In some embodiments, the functional variant comprises or consists of a fragment of the corresponding wild-type protein.

[0761] Regeneration, Repair, and Fibrosis Factors

[0762] Therapeutic polypeptides described herein also include growth factors, e.g., as disclosed in Table 56, or functional variants thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 56 by reference to its UniProt ID. Also included are antibodies or fragments thereof against such growth factors, or miRNAs that promote regeneration and repair.

TABLE-US-00025 TABLE 56 Exemplary regeneration, repair, and fibrosis factors Target Gene accession # Protein accession # VEGF-A NG_008732 NP_001165094 NRG-1 NG_012005 NP_001153471 FGF2 NG_029067 NP_001348594 FGF1 Gene ID: 2246 NP_001341882 miR-199-3p MIMAT0000232 miR-590-3p MIMAT0004801 mi-17-92 MI0000071 https://www.ncbi.nlm.nih.gov/pmc/ articles/PMC2732113/figure/F1/ miR-222 MI0000299 miR-302-367 MIR302A And https://www.ncbi.nlm.nih.gov/pmc/ MIR367 articles/PMC4400607/

[0763] Transformation Factors

[0764] Therapeutic polypeptides described herein also include transformation factors, e.g., protein factors that transform fibroblasts into differentiated cell e.g., factors disclosed in Table 57 or functional variants thereof, .g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 57 by reference to its UniProt ID.

TABLE-US-00026 TABLE 57 Exemplary transformation factors Target Indication Gene accession # Protein accession # MESP1 Organ Repair by Gene ID: 55897 EAX02066 transforming fibroblasts ETS2 Organ Repair by GeneID: 2114 NP_005230 transforming fibroblasts HAND2 Organ Repair by GeneID: 9464 NP_068808 transforming fibroblasts MYOCARDIN Organ Repair by GeneID: 93649 NP_001139784 transforming fibroblasts ESRRA Organ Repair by Gene ID: 2101 AAH92470 transforming fibroblasts miR-1 Organ Repair by MI0000651 n/a transforming fibroblasts miR-133 Organ Repair by MI0000450 n/a transforming fibroblasts TGFb Organ Repair by GeneID: 7040 NP_000651.3 transforming fibroblasts WNT Organ Repair by Gene ID: 7471 NP_005421 transforming fibroblasts JAK Organ Repair by Gene ID: 3716 NP_001308784 transforming fibroblasts NOTCH Organ Repair by GeneID: 4851 XP_011517019 transforming fibroblasts

[0765] Proteins that Stimulate Cellular Regeneration

[0766] Therapeutic polypeptides described herein also include proteins that stimulate cellular regeneration e.g., proteins disclosed in Table 58 or functional variants thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 58 by reference to its UniProt ID.

TABLE-US-00027 TABLE 58 Exemplary proteins that stimulate cellular regeneration Target Gene accession # Protein accession # MST1 NG_016454 NP_066278 STK30 Gene ID: 26448 NP_036103 MST2 Gene ID: 6788 NP_006272 SAV1 Gene ID: 60485 NP_068590 LATS1 Gene ID: 9113 NP_004681 LATS2 Gene ID: 26524 NP_055387 YAP1 NG_029530 NP_001123617 CDKN2b NG_023297 NP_004927 CDKN2a NG_007485 NP_478102

[0767] STING Modulator Effectors

[0768] In some embodiments, a secreted effector described herein modulates STING/cGAS signaling. In some embodiments, the STING modulator is a polypeptide, e.g., a viral polypeptide or a functional variant thereof. For instance, the effector may comprise a STING modulator (e.g., inhibitor) described in Maringer et al. Message in a bottle: lessons learned from antagonism of STING signalling during RNA virus infection Cytokine & Growth Factor Reviews Volume 25, Issue 6, December 2014, Pages 669-679, which is incorporated herein by reference in its entirety. Additional STING modulators (e.g., activators) are described, e.g., in Wang et al. STING activator c-di-GMP enhances the anti-tumor effects of peptide vaccines in melanoma-bearing mice. Cancer Immunol Immunother. 2015 August; 64(8):1057-66. doi: 10.1007/s00262-015-1713-5. Epub 2015 May 19; Bose cGAS/STING Pathway in Cancer: Jekyll and Hyde Story of Cancer Immune Response Int J Mol Sci. 2017 November; 18(11): 2456; and Fu et al. STING agonist formulated cancer vaccines can cure established tumors resistant to PD-1 blockade Sci Transl Med. 2015 Apr. 15; 7(283): 283ra52, each of which is incorporated herein by reference in its entirety.

[0769] Some examples of peptides include, but are not limited to, fluorescent tag or marker, antigen, peptide therapeutic, synthetic or analog peptide from naturally-bioactive peptide, agonist or antagonist peptide, anti-microbial peptide, a targeting or cytotoxic peptide, a degradation or self-destruction peptide, and degradation or self-destruction peptides. Peptides useful in the invention described herein also include antigen-binding peptides, e.g., antigen binding antibody or antibody-like fragments, such as single chain antibodies, nanobodies (see, e.g., Steeland et al. 2016. Nanobodies as therapeutics: big opportunities for small antibodies. Drug Discov Today: 21(7):1076-113). Such antigen binding peptides may bind a cytosolic antigen, a nuclear antigen, or an intra-organellar antigen.

[0770] In some embodiments, the genetic element comprises a sequence that encodes small peptides, peptidomimetics (e.g., peptoids), amino acids, and amino acid analogs. Such therapeutics generally have a molecular weight less than about 5,000 grams per mole, a molecular weight less than about 2,000 grams per mole, a molecular weight less than about 1,000 grams per mole, a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. Such therapeutics may include, but are not limited to, a neurotransmitter, a hormone, a drug, a toxin, a viral or microbial particle, a synthetic molecule, and agonists or antagonists thereof.

[0771] In some embodiments, the composition or CAVector described herein includes a polypeptide linked to a ligand that is capable of targeting a specific location, tissue, or cell.

[0772] Gene Editing Components

[0773] The genetic element of the CAVector may include one or more genes that encode a component of a gene editing system. Exemplary gene editing systems include the clustered regulatory interspaced short palindromic repeat (CRISPR) system, zinc finger nucleases (ZFNs), Gene Writers, reverse transcriptases, epigenetic modifiers, recombinases, and Transcription Activator-Like Effector-based Nucleases (TALEN). ZFNs, TALENs, and CRISPR-based methods are described, e.g., in Gaj et al. Trends Biotechnol. 31.7(2013):397-405; CRISPR methods of gene editing are described, e.g., in Guan et al., Application of CRISPR-Cas system in gene therapy: Pre-clinical progress in animal model. DNA Repair 2016 October; 46:1-8. doi: 10.1016/j.dnarep.2016.07.004; Zheng et al., Precise gene deletion and replacement using the CRISPR/Cas9 system in human cells. BioTechniques, Vol. 57, No. 3, September 2014, pp. 115-124. Non-limiting examples of gene editing and gene writing systems are described, for example, in PCT Publication No. WO 2020/047124 (e.g., any sequence disclosed therein) and Anzalone et al. 2019, Nature 576: 149-157 (each of which is incorporated herein by reference in their entirety).

[0774] In some embodiments, the genetic element comprises a sequence encoding a Gene Writer, e.g., comprising one or more elements from a non-long terminal repeat (LTR) retrotransposon (e.g., an apurinic/apyrimidinic endonuclease (APE)-type or a restriction enzyme-like endonuclease (RLE)-type). In some embodiments, the Gene Writer comprises a retrotransposase. In some embodiments, the the Gene Writer comprises one or more of a DNA binding domain, a reverse transcription domain, and/or an endonuclease domain. Examples of Gene Writers, reverse transcriptases, and recombinases that may be encoded by a genetic element as described herein are described, for example, in PCT Publication No. WO 2020/047124 (incorporated herein by reference in its entirety).

[0775] CRISPR systems are adaptive defense systems originally discovered in bacteria and archaea. CRISPR systems use RNA-guided nucleases termed CRISPR-associated or Cas endonucleases (e.g., Cas9 or Cpf1) to cleave foreign DNA. In a typical CRISPR/Cas system, an endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome that is to be sequence-edited) by sequence-specific, non-coding guide RNAs that target single- or double-stranded DNA sequences. Three classes (1-111) of CRISPR systems have been identified. The class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (crRNA), and a trans-activating crRNA (tracrRNA). The crRNA contains a guide RNA, typically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence. The crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure which is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid. The crRNA/tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be adjacent to a protospacer adjacent motif (PAM) that is specific for a given Cas endonuclease; however, PAM sequences appear throughout a given genome.

[0776] In some embodiments, the CAVector includes a gene for a CRISPR endonuclease. For example, some CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5-NGG (Streptococcus pyogenes), 5-NNAGAA (Streptococcus thermophilus CRISPR1), 5-NGGNG (Streptococcus thermophilus CRISPR3), and 5-NNNGATT (Neisseria meningiditis). Some endonucleases, e.g., Cas9 endonucleases, are associated with G-rich PAM sites, e.g., 5-NGG, and perform blunt-end cleaving of the target DNA at a location 3 nucleotides upstream from (5 from) the PAM site. Another class II CRISPR system includes the type V endonuclease Cpf1, which is smaller than Cas9; examples include AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp.). Cpf1 endonucleases, are associated with T-rich PAM sites, e.g., 5-TTN. Cpf1 can also recognize a 5-CTA PAM motif. Cpf1 cleaves the target DNA by introducing an offset or staggered double-strand break with a 4- or 5-nucleotide 5 overhang, for example, cleaving a target DNA with a 5-nucleotide offset or staggered cut located 18 nucleotides downstream from (3 from) from the PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complimentary strand; the 5-nucleotide overhang that results from such offset cleavage allows more precise genome editing by DNA insertion by homologous recombination than by insertion at blunt-end cleaved DNA. See, e.g., Zetsche et al. (2015) Cell, 163:759-771.

[0777] A variety of CRISPR associated (Cas) genes may be included in the CAVector. Specific examples of genes are those that encode Cas proteins from class II systems including Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cpf1, C2C1, or C2C3. In some embodiments, the CAVector includes a gene encoding a Cas protein, e.g., a Cas9 protein, may be from any of a variety of prokaryotic species. In some embodiments, the CAVector includes a gene encoding a particular Cas protein, e.g., a particular Cas9 protein, is selected to recognize a particular protospacer-adjacent motif (PAM) sequence. In some embodiments, the CAVector includes nucleic acids encoding two or more different Cas proteins, or two or more Cas proteins, may be introduced into a cell, zygote, embryo, or animal, e.g., to allow for recognition and modification of sites comprising the same, similar or different PAM motifs. In some embodiments, the CAVector includes a gene encoding a modified Cas protein with a deactivated nuclease, e.g., nuclease-deficient Cas9.

[0778] Whereas wild-type Cas9 protein generates double-strand breaks (DSBs) at specific DNA sequences targeted by a gRNA, a number of CRISPR endonucleases having modified functionalities are known, for example: a nickase version of Cas endonuclease (e.g., Cas9) generates only a single-strand break; a catalytically inactive Cas endonuclease, e.g., Cas9 (dCas9) does not cut the target DNA. A gene encoding a dCas9 can be fused with a gene encoding an effector domain to repress (CRISPRi) or activate (CRISPRa) expression of a target gene. For example, the gene may encode a Cas9 fusion with a transcriptional silencer (e.g., a KRAB domain) or a transcriptional activator (e.g., a dCas9-VP64 fusion). A gene encoding a catalytically inactive Cas9 (dCas9) fused to FokI nuclease (dCas9-FokI) can be included to generate DSBs at target sequences homologous to two gRNAs. See, e.g., the numerous CRISPR/Cas9 plasmids disclosed in and publicly available from the Addgene repository (Addgene, 75 Sidney St., Suite 550A, Cambridge, MA 02139; addgene.org/crispr/). A double nickase Cas9 that introduces two separate double-strand breaks, each directed by a separate guide RNA, is described as achieving more accurate genome editing by Ran et al. (2013) Cell, 154:1380-1389.

[0779] CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016/0138008A1 and US2015/0344912A1, and in U.S. Pat. Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 A1.

[0780] In some embodiments, the CAVector comprises a gene encoding a polypeptide described herein, e.g., a targeted nuclease, e.g., a Cas9, e.g., a wild type Cas9, a nickase Cas9 (e.g., Cas9 D10A), a dead Cas9 (dCas9), eSpCas9, Cpf1, C2C1, or C2C3, and a gRNA. The choice of genes encoding the nuclease and gRNA(s) is determined by whether the targeted mutation is a deletion, substitution, or addition of nucleotides, e.g., a deletion, substitution, or addition of nucleotides to a targeted sequence. Genes that encode a catalytically inactive endonuclease e.g., a dead Cas9 (dCas9, e.g., D10A; H840A) tethered with all or a portion of (e.g., biologically active portion of) an (one or more) effector domain (e.g., VP64) create chimeric proteins that can modulate activity and/or expression of one or more target nucleic acids sequences.

[0781] In some embodiments, the CAVector includes a gene encoding a fusion of a dCas9 with all or a portion of one or more effector domains (e.g., a full-length wild-type effector domain, or a fragment or variant thereof, e.g., a biologically active portion thereof) to create a chimeric protein useful in the methods described herein. Accordingly, in some embodiments, the CAVector includes a gene encoding a dCas9-methylase fusion. In other some embodiments, the CAVector includes a gene encoding a dCas9-enzyme fusion with a site-specific gRNA to target an endogenous gene.

[0782] In other aspects, the CAVector includes a gene encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more effector domains (all or a biologically active portion) fused with dCas9.

Regulatory Sequences

[0783] In some embodiments, the genetic element comprises a regulatory sequence, e.g., a promoter or an enhancer, operably linked to the sequence encoding the effector.

[0784] In some embodiments, a promoter includes a DNA sequence that is located adjacent to a DNA sequence that encodes an expression product. A promoter may be linked operatively to the adjacent DNA sequence. A promoter typically increases an amount of product expressed from the DNA sequence as compared to an amount of the expressed product when no promoter exists. A promoter from one organism can be utilized to enhance product expression from the DNA sequence that originates from another organism. For example, a vertebrate promoter may be used for the expression of jellyfish GFP in vertebrates. In addition, one promoter element can increase an amount of products expressed for multiple DNA sequences attached in tandem. Hence, one promoter element can enhance the expression of one or more products. Multiple promoter elements are well-known to persons of ordinary skill in the art.

[0785] In one embodiment, high-level constitutive expression is desired. Examples of such promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter/enhancer, the cytomegalovirus (CMV) immediate early promoter/enhancer (see, e.g., Boshart et al, Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the cytoplasmic .beta.-actin promoter and the phosphoglycerol kinase (PGK) promoter.

[0786] In another embodiment, inducible promoters may be desired. Inducible promoters are those which are regulated by exogenously supplied compounds, e.g., provided either in cis or in trans, including without limitation, the zinc-inducible sheep metallothionine (MT) promoter; the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; the T7 polymerase promoter system (WO 98/10088); the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)); the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995); see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)); the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)]; and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997); Rivera et al., Nat. Medicine. 2:1028-1032 (1996)). Other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, or in replicating cells only.

[0787] In some embodiments, a native promoter for a gene or nucleic acid sequence of interest is used. The native promoter may be used when it is desired that expression of the gene or the nucleic acid sequence should mimic the native expression. The native promoter may be used when expression of the gene or other nucleic acid sequence must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.

[0788] In some embodiments, the genetic element comprises a gene operably linked to a tissue-specific promoter. For instance, if expression in skeletal muscle is desired, a promoter active in muscle may be used. These include the promoters from genes encoding skeletal -actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters with activities higher than naturally-occurring promoters. See Li et al., Nat. Biotech., 17:241-245 (1999). Examples of promoters that are tissue-specific are known for liver albumin, Miyatake et al. J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al., Gene Ther. 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)], bone (osteocalcin, Stein et al., Mol. Biol. Rep., 24:185-96 (1997); bone sialoprotein, Chen et al., J. Bone Miner. Res. 11:654-64 (1996)), lymphocytes (CD2, Hansal et al., J. Immunol., 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor a chain), neuronal (neuron-specific enolase (NSE) promoter, Andersen et al. Cell. Mol. Neurobiol., 13:503-15 (1993); neurofilament light-chain gene, Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991); the neuron-specific vgf gene, Piccioli et al., Neuron, 15:373-84 (1995)]; among others.

[0789] The genetic element may include an enhancer, e.g., a DNA sequence that is located adjacent to the DNA sequence that encodes a gene. Enhancer elements are typically located upstream of a promoter element or can be located downstream of or within a coding DNA sequence (e.g., a DNA sequence transcribed or translated into a product or products). Hence, an enhancer element can be located 100 base pairs, 200 base pairs, or 300 or more base pairs upstream or downstream of a DNA sequence that encodes the product. Enhancer elements can increase an amount of recombinant product expressed from a DNA sequence above increased expression afforded by a promoter element. Multiple enhancer elements are readily available to persons of ordinary skill in the art.

[0790] In some embodiments, the genetic element comprises one or more inverted terminal repeats (ITR) flanking the sequences encoding the expression products described herein. In some embodiments, the genetic element comprises one or more long terminal repeats (LTR) flanking the sequence encoding the expression products described herein. Examples of promoter sequences that may be used, include, but are not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, and a Rous sarcoma virus promoter.

Replication Proteins

[0791] In some embodiments, the genetic element of the CAVector, e.g., synthetic CAVector, may include sequences that encode one or more replication proteins. In some embodiments, the CAVector may replicate by a rolling-circle replication method, e.g., synthesis of the leading strand and the lagging strand is uncoupled. In such embodiments, the CAVector comprises three elements additional elements: i) a gene encoding an initiator protein, ii) a double strand origin, and iii) a single strand origin. A rolling circle replication (RCR) protein complex comprising replication proteins binds to the leading strand and destabilizes the replication origin. The RCR complex cleaves the genome to generate a free 3OH extremity. Cellular DNA polymerase initiates viral DNA replication from the free 3OH extremity. After the genome has been replicated, the RCR complex closes the loop covalently. This leads to the release of a positive circular single-stranded parental DNA molecule and a circular double-stranded DNA molecule composed of the negative parental strand and the newly synthesized positive strand. The single-stranded DNA molecule can be either encapsidated or involved in a second round of replication. See for example, Virology Journal 2009, 6:60 doi:10.1186/1743-422X-6-60.

[0792] The genetic element may comprise a sequence encoding a polymerase, e.g., RNA polymerase or a DNA polymerase.

Other Sequences

[0793] In some embodiments, the genetic element further includes a nucleic acid encoding a product (e.g., a ribozyme, a therapeutic mRNA encoding a protein, an exogenous gene).

[0794] In some embodiments, the genetic element includes one or more sequences that affect species and/or tissue and/or cell tropism (e.g. capsid protein sequences), infectivity (e.g. capsid protein sequences), immunosuppression/activation (e.g. regulatory nucleic acids), viral genome binding and/or packaging, immune evasion (non-immunogenicity and/or tolerance), pharmacokinetics, endocytosis and/or cell attachment, nuclear entry, intracellular modulation and localization, exocytosis modulation, propagation, and nucleic acid protection of the CAVector in a host or host cell.

[0795] In some embodiments, the genetic element may comprise other sequences that include DNA, RNA, or artificial nucleic acids. The other sequences may include, but are not limited to, genomic DNA, cDNA, or sequences that encode tRNA, mRNA, rRNA, miRNA, gRNA, siRNA, or other RNAi molecules. In one embodiment, the genetic element includes a sequence encoding an siRNA to target a different loci of the same gene expression product as the regulatory nucleic acid. In one embodiment, the genetic element includes a sequence encoding an siRNA to target a different gene expression product as the regulatory nucleic acid.

[0796] In some embodiments, the genetic element further comprises one or more of the following sequences: a sequence that encodes one or more miRNAs, a sequence that encodes one or more replication proteins, a sequence that encodes an exogenous gene, a sequence that encodes a therapeutic, a regulatory sequence (e.g., a promoter, enhancer), a sequence that encodes one or more regulatory sequences that targets endogenous genes (siRNA, lncRNAs, shRNA), and a sequence that encodes a therapeutic mRNA or protein.

[0797] The other sequences may have a length from about 2 to about 5000 nts, about 10 to about 100 nts, about 50 to about 150 nts, about 100 to about 200 nts, about 150 to about 250 nts, about 200 to about 300 nts, about 250 to about 350 nts, about 300 to about 500 nts, about 10 to about 1000 nts, about 50 to about 1000 nts, about 100 to about 1000 nts, about 1000 to about 2000 nts, about 2000 to about 3000 nts, about 3000 to about 4000 nts, about 4000 to about 5000 nts, or any range therebetween.

[0798] Encoded Genes

[0799] For example, the genetic element may include a gene associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide. Examples include a disease associated gene or polynucleotide. A disease-associated gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of a non disease control. It may be a gene that becomes expressed at an abnormally high level; it may be a gene that becomes expressed at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease. A disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease.

[0800] Moreover, the genetic elements can encode targeting moieties, as described elsewhere herein. This can be achieved, e.g., by inserting a polynucleotide encoding a sugar, a glycolipid, or a protein, such as an antibody. Those skilled in the art know additional methods for generating targeting moieties.

[0801] Viral Sequence

[0802] In some embodiments, the genetic element comprises at least one viral sequence. In some embodiments, the sequence has homology or identity to one or more sequence from a single stranded DNA virus, e.g., CAV, Anellovirus, Bidnavirus, Circovirus, Geminivirus, Genomovirus, Inovirus, Microvirus, Nanovirus, Parvovirus, and Spiravirus. In some embodiments, the sequence has homology or identity to one or more sequence from a double stranded DNA virus, e.g., Adenovirus, Ampullavirus, Ascovirus, Asfarvirus, Baculovirus, Fusellovirus, Globulovirus, Guttavirus, Hytrosavirus, Herpesvirus, Iridovirus, Lipothrixvirus, Nimavirus, and Poxvirus. In some embodiments, the sequence has homology or identity to one or more sequence from an RNA virus, e.g., Alphavirus, Furovirus, Hepatitis virus, Hordeivirus, Tobamovirus, Tobravirus, Tricornavirus, Rubivirus, Birnavirus, Cystovirus, Partitivirus, and Reovirus.

[0803] In some embodiments, the genetic element may comprise one or more sequences from a non-pathogenic virus, e.g., a symbiotic virus, e.g., a commensal virus, e.g., a native virus, e.g., a CAV. In some embodiments, the genetic element may comprise a sequence with homology or identity to a the Cuxhaven 1 isolate of CAV (e.g, as listed in Table 1A or 1B). In some embodiments, the non-pathogenic virus is a non-enveloped, single-stranded DNA virus with a circular, negative-sense genome, e.g., CAV. In some embodiments, the genetic element may comprise one or more sequences or a fragment of a sequence from a non-pathogenic virus having at least about 60%, 70% 80%, 85%, 90% 95%, 96%, 97%, 98% and 99% nucleotide sequence identity to any one of the nucleotide sequences described herein.

[0804] Since, in some embodiments, recombinant retroviruses are defective, assistance may be provided order to produce infectious particles. Such assistance can be provided, e.g., by using cell lines that contain plasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. Suitable cell lines for replicating the CAVectors described herein include cell lines known in the art, e.g., A549 cells, which can be modified as described herein. Said genetic element can additionally contain a gene encoding a selectable marker so that the desired genetic elements can be identified.

[0805] In some embodiments, the genetic element includes non-silent mutations, e.g., base substitutions, deletions, or additions resulting in amino acid differences in the encoded polypeptide, so long as the sequence remains at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptide encoded by the first nucleotide sequence or otherwise is useful for practicing the present invention. In this regard, certain conservative amino acid substitutions may be made which are generally recognized not to inactivate overall protein function: such as in regard of positively charged amino acids (and vice versa), lysine, arginine and histidine; in regard of negatively charged amino acids (and vice versa), aspartic acid and glutamic acid; and in regard of certain groups of neutrally charged amino acids (and in all cases, also vice versa), (1) alanine and serine, (2) asparagine, glutamine, and histidine, (3) cysteine and serine, (4) glycine and proline, (5) isoleucine, leucine and valine, (6) methionine, leucine and isoleucine, (7) phenylalanine, methionine, leucine, and tyrosine, (8) serine and threonine, (9) tryptophan and tyrosine, (10) and for example tyrosine, tryptophan and phenylalanine. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties.

[0806] In some embodiments, identity of two or more nucleic acid or polypeptide sequences having the same or a specified percentage of nucleotides or amino acid residues that are the same (e.g., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) may be measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site www.ncbi.nlm.nih.gov/BLAST/ or the like). Identity may also refer to, or may be applied to, the compliment of a test sequence. Identity also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described herein, the algorithms account for gaps and the like. Identity may exist over a region that is at least about 10 amino acids or nucleotides in length, about 15 amino acids or nucleotides in length, about 20 amino acids or nucleotides in length, about 25 amino acids or nucleotides in length, about 30 amino acids or nucleotides in length, about 35 amino acids or nucleotides in length, about 40 amino acids or nucleotides in length, about 45 amino acids or nucleotides in length, about 50 amino acids or nucleotides in length, or more. Since the genetic code is degenerate, a homologous nucleotide sequence can include any number of silent base changes, i.e., nucleotide substitutions that nonetheless encode the same amino acid.

Proteinaceous Exterior

[0807] In some embodiments, the CAVector, e.g., synthetic CAVector, comprises a proteinaceous exterior that encloses a genetic element. The proteinaceous exterior can comprise capsid protein (e.g., a CAV VP1 molecule as described herein). In some embodiments, the protein is a capsid protein, e.g., has a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90% 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a protein encoded by any one of the nucleotide sequences encoding a capsid protein described herein, e.g., a CAV VP1 molecule, e.g., as described herein. In some embodiments, the protein or a functional fragment of a capsid protein is encoded by a nucleotide sequence having at least about 60%, 70% 80%, 85%, 90% 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an CAV VP1 nucleic acid, e.g., as described herein. In some embodiments, the CAVector comprises a nucleotide sequence encoding a capsid protein or a functional fragment of a capsid protein or a sequence having at least about 60%, 70% 80%, 85%, 90% 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an CAV VP1 molecule as described herein. The proteinaceous exterior of the CAVectors may, in some embodiments, comprise a capsid protein that may self-assemble, e.g., to form the proteinaceous exterior. In some embodiments, the capsid protein may self-assemble into an icosahedral formation, e.g., that makes up the proteinaceous exterior.

[0808] In some embodiments, the proteinaceous exterior protein is encoded by a sequence of the genetic element of the CAVector (e.g., is in cis with the genetic element). In other embodiments, the proteinaceous exterior protein is encoded by a nucleic acid separate from the genetic element of the CAVector (e.g., is in trans with the genetic element).

[0809] In some embodiments, the ranges of amino acids with less sequence identity may provide one or more of the properties described herein and differences in cell/tissue/species specificity (e.g. tropism).

[0810] In some embodiments, the CAVector lacks lipids in the proteinaceous exterior. In some embodiments, the CAVector lacks a lipid bilayer, e.g., a viral envelope. In some embodiments, the interior of the CAVector is entirely covered (e.g., 100% coverage) by a proteinaceous exterior. In some embodiments, the interior of the CAVector is less than 100% covered by the proteinaceous exterior, e.g., 95%, 90%, 85%, 80%, 70%, 60%, 50% or less coverage. In some embodiments, the proteinaceous exterior comprises gaps or discontinuities, e.g., permitting permeability to water, ions, peptides, or small molecules, so long as the genetic element is retained in the CAVector.

[0811] In some embodiments, the proteinaceous exterior comprises one or more proteins or polypeptides that specifically recognize and/or bind a host cell, e.g., a complementary protein or polypeptide, to mediate entry of the genetic element into the host cell.

[0812] In some embodiments, the proteinaceous exterior comprises an arginine-rich region and/or a jelly-roll region, e.g., of an VP1 molecule, e.g., as described herein. In some embodiments, the proteinaceous exterior comprises one or more of the following: one or more glycosylated proteins, a hydrophilic DNA-binding region, an arginine-rich region, a threonine-rich region, a glutamine-rich region, a N-terminal polyarginine sequence, a variable region, a C-terminal polyglutamine/glutamate sequence, and one or more disulfide bridges. For example, the proteinaceous exterior comprises a protein encoded by a CAV VP1 nucleic acid, e.g., as described herein.

[0813] In some embodiments, the proteinaceous exterior comprises one or more of the following characteristics: an icosahedral symmetry, recognizes and/or binds a molecule that interacts with one or more host cell molecules to mediate entry into the host cell, lacks lipid molecules, lacks carbohydrates, is pH and temperature stable, is detergent resistant, and is substantially non-pathogenic in a host.

[0814] In some embodiments, the protein, e.g., substantially non-pathogenic protein and/or proteinaceous exterior protein, comprises one or more glycosylated amino acids, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. In some embodiments, the protein, e.g., substantially non-pathogenic protein and/or proteinaceous exterior protein comprises at least one hydrophilic DNA-binding region, an arginine-rich region, a threonine-rich region, a glutamine-rich region, a N-terminal polyarginine sequence, a variable region, a C-terminal polyglutamine/glutamate sequence, and one or more disulfide bridges.

III. Genetic Element Constructs

[0815] The genetic element described herein may be included in a genetic element construct (e.g., a tandem construct, e.g., as described herein).

[0816] In one aspect, the invention includes a genetic element construct comprising a genetic element comprising (i) a sequence encoding a non-pathogenic exterior protein (e.g., an CAV VP1 molecule or a splice variant or functional fragment thereof), (ii) an exterior protein binding sequence that binds the genetic element to the non-pathogenic exterior protein, and (iii) a sequence encoding an effector. In some embodiments, the genetic element construct is a tandem construct further comprising a second copy of the genetic element, or a fragment thereof (e.g., comprising an uRFS or a dRFS, e.g., as described herein).

[0817] The genetic element or any of the sequences within the genetic element can be obtained using any suitable method. Various recombinant methods are known in the art, such as, for example screening libraries from cells harboring viral sequences, deriving the sequences from a genetic element construct known to include the same, or isolating directly from cells and tissues containing the same, using standard techniques. Alternatively or in combination, part or all of the genetic element can be produced synthetically, rather than cloned.

[0818] In some embodiments, the genetic element construct includes regulatory elements, nucleic acid sequences homologous to target genes, and various reporter constructs for causing the expression of reporter molecules within a viable cell and/or when an intracellular molecule is present within a target cell.

[0819] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82). Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5 flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.

[0820] In some embodiments, the genetic element construct is substantially non-pathogenic and/or substantially non-integrating in a host cell.

[0821] In some embodiments, the genetic element construct is in an amount sufficient to modulate one or more of phenotype, virus levels, gene expression, compete with other viruses, disease state, etc. at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more.

IV. Compositions

[0822] The CAVectors described herein may also be included in pharmaceutical compositions with a pharmaceutically acceptable carrier or excipient, e.g., as described herein. In some embodiments, the pharmaceutical composition comprises at least 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, 10.sup.14, or 10.sup.15 CAVectors. In some embodiments, the pharmaceutical composition comprises about 10.sup.5-10.sup.15, 10.sup.5-10.sup.10, or 10.sup.10-10.sup.15 CAVectors. In some embodiments, the pharmaceutical composition comprises about 10.sup.8 (e.g., about 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, or 10.sup.10) genomic equivalents/mL of the CAVector. In some embodiments, the pharmaceutical composition comprises 10.sup.5-10.sup.10, 10.sup.6-10.sup.10, 10.sup.7-10.sup.10, 10.sup.8-10.sup.10, 10.sup.9-10.sup.10, 10.sup.5-10.sup.6, 10.sup.5-10.sup.7, 10.sup.5-10.sup.8, 10.sup.5-10.sup.9, 10.sup.5-10.sup.11, 10.sup.5-10.sup.12, 10.sup.5-10.sup.13, 10.sup.5-10.sup.14, 10.sup.5-10.sup.15, or 10.sup.10-10.sup.15 genomic equivalents/mL of the CAVector, e.g., as determined according to the method of measuring viral titer described in Example 1. In some embodiments, the pharmaceutical composition comprises sufficient CAVectors to deliver at least 1, 2, 5, or 10, 100, 500, 1000, 2000, 5000, 8,000, 110.sup.4, 110.sup.5, 110.sup.6, 110.sup.7 or greater copies of a genetic element comprised in the CAVectors per cell to a population of the eukaryotic cells. In some embodiments, the pharmaceutical composition comprises sufficient CAVectors to deliver at least about 110.sup.4, 110.sup.5, 110.sup.6, 1 or 10.sup.7, or about 110.sup.4-110.sup.5, 110.sup.4-110.sup.6, 110.sup.4-110.sup.7, 110.sup.5-110.sup.6, 110.sup.5-110.sup.7, or 110.sup.6-110.sup.7 copies of a genetic element comprised in the CAVectors per cell to a population of the eukaryotic cells.

[0823] In some embodiments, the pharmaceutical composition has one or more of the following characteristics: the pharmaceutical composition meets a pharmaceutical or good manufacturing practices (GMP) standard; the pharmaceutical composition was made according to good manufacturing practices (GMP); the pharmaceutical composition has a pathogen level below a predetermined reference value, e.g., is substantially free of pathogens; the pharmaceutical composition has a contaminant level below a predetermined reference value, e.g., is substantially free of contaminants, e.g., as described herein.

[0824] In some embodiments, the pharmaceutical composition comprises below a threshold amount of one or more contaminants. Exemplary contaminants that are desirably excluded or minimized in the pharmaceutical composition include, without limitation, host cell nucleic acids (e.g., host cell DNA and/or host cell RNA), host cell protein, animal-derived components (e.g., serum albumin or trypsin), replication-competent viruses, non-infectious particles, free viral capsid protein, adventitious agents, and aggregates. In embodiments, the contaminant is host cell DNA. In embodiments, the composition comprises less than about 10 ng of host cell DNA per dose. In embodiments, the level of host cell DNA in the composition is reduced by filtration and/or enzymatic degradation of host cell DNA. In embodiments, the pharmaceutical composition consists of less than 10% (e.g., less than about 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1%) contaminant by weight. The disclosure thus includes methods of making CAVectors disclosed herein that include a step of evaluating a CAVector preparation for one or more (1, 2, 3, 4, 5, 6, 7, or all 8) of the following: adventitious agents, pyrogenic substances, endotoxin, mycoplasma, host cell DNA, host cell protein, non-infectious particles, or empty capsids.

[0825] The disclosure includes, in some instances, sterile pharmaceutical compositions that include a CAVector described herein and a pharmaceutical excipient, and wherein the compositions meet the requirements of 21 C.F.R. 610.12 and 610.13. For example, the pharmaceutical compositions may, in some embodiments, have one, two, 3, 4, 5, 6, 7 or all 8 of the following characteristics: [0826] (i) substantially lack adventitious agents, [0827] (ii) substantially lack pyrogenic substances, [0828] (iii) contains equal to or less endotoxin than a control reference or specification, e.g., a U.S. Pharmacopeia (USP) or FDA reference standard for endotoxin contamination, [0829] (iv) contains equal to or less mycoplasma than a control reference or specification, e.g., a U.S. Pharmacopeia (USP) or FDA reference standard for mycoplasma contamination, [0830] (v) contains less host cell DNA than a control reference standard, e.g., less than 10 ng of host cell DNA per dose, less than 5 ng of host cell DNA per dose, [0831] (vi) contains less host cell protein (HCP) than a control reference standard, e.g., less than 100 ng/mL, less than 50 ng/mL, and/or less than 10 ng/dose, less than 5 ng/dose, [0832] (vii) contain less than a threshold amount of non-infectious particles, e.g., meet a predetermined release specification for non-infectious particles relative to infectious particles, e.g., particles to infectious units <2000:1, <1000:1, <500:1, <300:1, <200:1, <100:1, or <50:1, and/or [0833] (viii) contain less than a threshold amount of empty capsids (lacking a genome), e.g., meet a predetermined release specification for empty capsids.

[0834] In one aspect, the invention described herein includes a pharmaceutical composition comprising: [0835] a) a CAVector comprising a genetic element comprising (i) a sequence encoding a non-pathogenic exterior protein, (ii) an exterior protein binding sequence that binds the genetic element to the non-pathogenic exterior protein, and (iii) a sequence encoding a regulatory nucleic acid; and a proteinaceous exterior that is associated with, e.g., envelops or encloses, the genetic element; and [0836] b) a pharmaceutical excipient.

Vesicles

[0837] In some embodiments, the composition further comprises a carrier component, e.g., a microparticle, liposome, vesicle, or exosome. In some embodiments, liposomes comprise spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes may be anionic, neutral or cationic. Liposomes are generally biocompatible, nontoxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679 for review).

[0838] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Vesicles may comprise without limitation DOTMA, DOTAP, DOTIM, DDAB, alone or together with cholesterol to yield DOTMA and cholesterol, DOTAP and cholesterol, DOTIM and cholesterol, and DDAB and cholesterol. Methods for preparation of multilamellar vesicle lipids are known in the art (see for example U.S. Pat. No. 6,693,086, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference). Although vesicle formation can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be expedited by applying force in the form of shaking by using a homogenizer, sonicator, or an extrusion apparatus (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679 for review). Extruded lipids can be prepared by extruding through filters of decreasing size, as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which relating to extruded lipid preparation are incorporated herein by reference.

[0839] As described herein, additives may be added to vesicles to modify their structure and/or properties. For example, either cholesterol or sphingomyelin may be added to the mixture to help stabilize the structure and to prevent the leakage of the inner cargo. Further, vesicles can be prepared from hydrogenated egg phosphatidylcholine or egg phosphatidylcholine, cholesterol, and dicetyl phosphate. (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679 for review). Also, vesicles may be surface modified during or after synthesis to include reactive groups complementary to the reactive groups on the recipient cells. Such reactive groups include without limitation maleimide groups. As an example, vesicles may be synthesized to include maleimide conjugated phospholipids such as without limitation DSPE-MaL-PEG2000.

[0840] A vesicle formulation may be mainly comprised of natural phospholipids and lipids such as 1,2-distearoryl-sn-glycero-3-phosphatidyl choline (DSPC), sphingomyelin, egg phosphatidylcholines and monosialoganglioside. Formulations made up of phospholipids only are less stable in plasma. However, manipulation of the lipid membrane with cholesterol reduces rapid release of the encapsulated cargo or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) increases stability (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679 for review).

[0841] In embodiments, lipids may be used to form lipid microparticles. Lipids include, but are not limited to, DLin-KC2-DMA4, C12-200 and colipids disteroylphosphatidyl choline, cholesterol, and PEG-DMG may be formulated (see, e.g., Novobrantseva, Molecular Therapy-Nucleic Acids (2012) 1, e4; doi:10.1038/mtna.2011.3) using a spontaneous vesicle formation procedure. The component molar ratio may be about 50/10/38.5/1.5 (DLin-KC2-DMA or C12-200/disteroylphosphatidyl choline/cholesterol/PEG-DMG). Tekmira has a portfolio of approximately 95 patent families, in the U.S. and abroad, that are directed to various aspects of lipid microparticles and lipid microparticles formulations (see, e.g., U.S. Pat. Nos. 7,982,027; 7,799,565; 8,058,069; 8,283,333; 7,901,708; 7,745,651; 7,803,397; 8,101,741; 8,188,263; 7,915,399; 8,236,943 and 7,838,658 and European Pat. Nos. 1766035; 1519714; 1781593 and 1664316), all of which may be used and/or adapted to the present invention.

[0842] In some embodiments, microparticles comprise one or more solidified polymer(s) that is arranged in a random manner. The microparticles may be biodegradable. Biodegradable microparticles may be synthesized, e.g., using methods known in the art including without limitation solvent evaporation, hot melt microencapsulation, solvent removal, and spray drying. Exemplary methods for synthesizing microparticles are described by Bershteyn et al., Soft Matter 4:1787-1787, 2008 and in US 2008/0014144 A1, the specific teachings of which relating to microparticle synthesis are incorporated herein by reference.

[0843] Exemplary synthetic polymers which can be used to form biodegradable microparticles include without limitation aliphatic polyesters, poly (lactic acid) (PLA), poly (glycolic acid) (PGA), co-polymers of lactic acid and glycolic acid (PLGA), polycarprolactone (PCL), polyanhydrides, poly(ortho)esters, polyurethanes, poly(butyric acid), poly(valeric acid), and poly(lactide-co-caprolactone), and natural polymers such as albumin, alginate and other polysaccharides including dextran and cellulose, collagen, chemical derivatives thereof, including substitutions, additions of chemical groups such as for example alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof. In general, these materials degrade either by enzymatic hydrolysis or exposure to water, by surface or bulk erosion.

[0844] The microparticles' diameter ranges from 0.1-1000 micrometers (m). In some embodiments, their diameter ranges in size from 1-750 m, or from 50-500 m, or from 100-250 m. In some embodiments, their diameter ranges in size from 50-1000 m, from 50-750 m, from 50-500 m, or from 50-250 m. In some embodiments, their diameter ranges in size from 0.05-1000 m, from 10-1000 m, from 100-1000 m, or from 500-1000 m. In some embodiments, their diameter is about 0.5 m, about 10 m, about 50 m, about 100 m, about 200 m, about 300 m, about 350 m, about 400 m, about 450 m, about 500 m, about 550 m, about 600 m, about 650 m, about 700 m, about 750 m, about 800 m, about 850 m, about 900 m, about 950 m, or about 1000 m. As used in the context of microparticle diameters, the term about means+/5% of the absolute value stated.

[0845] In some embodiments, a ligand is conjugated to the surface of the microparticle via a functional chemical group (carboxylic acids, aldehydes, amines, sulfhydryls and hydroxyls) present on the surface of the particle and present on the ligand to be attached. Functionality may be introduced into the microparticles by, for example, during the emulsion preparation of microparticles, incorporation of stabilizers with functional chemical groups.

[0846] Another example of introducing functional groups to the microparticle is during post-particle preparation, by direct crosslinking particles and ligands with homo- or heterobifunctional crosslinkers. This procedure may use a suitable chemistry and a class of crosslinkers (CDI, EDAC, glutaraldehydes, etc. as discussed in more detail below) or any other crosslinker that couples ligands to the particle surface via chemical modification of the particle surface after preparation. This also includes a process whereby amphiphilic molecules such as fatty acids, lipids or functional stabilizers may be passively adsorbed and adhered to the particle surface, thereby introducing functional end groups for tethering to ligands.

[0847] In some embodiments, the microparticles may be synthesized to comprise one or more targeting groups on their exterior surface to target a specific cell or tissue type (e.g., cardiomyocytes). These targeting groups include without limitation receptors, ligands, antibodies, and the like. These targeting groups bind their partner on the cells' surface. In some embodiments, the microparticles will integrate into a lipid bilayer that comprises the cell surface and the mitochondria are delivered to the cell.

[0848] The microparticles may also comprise a lipid bilayer on their outermost surface. This bilayer may be comprised of one or more lipids of the same or different type. Examples include without limitation phospholipids such as phosphocholines and phosphoinositols. Specific examples include without limitation DMPC, DOPC, DSPC, and various other lipids such as those described herein for liposomes.

[0849] In some embodiments, the carrier comprises nanoparticles, e.g., as described herein.

[0850] In some embodiments, the vesicles or microparticles described herein are functionalized with a diagnostic agent. Examples of diagnostic agents include, but are not limited to, commercially available imaging agents used in positron emissions tomography (PET), computer assisted tomography (CAT), single photon emission computerized tomography, x-ray, fluoroscopy, and magnetic resonance imaging (MRI); and contrast agents. Examples of suitable materials for use as contrast agents in MRI include gadolinium chelates, as well as iron, magnesium, manganese, copper, and chromium.

Carriers

[0851] A composition (e.g., pharmaceutical composition) described herein may comprise, be formulated with, and/or be delivered in, a carrier. In one aspect, the invention includes a composition, e.g., a pharmaceutical composition, comprising a carrier (e.g., a vesicle, a liposome, a lipid nanoparticle, an exosome, a red blood cell, an exosome (e.g., a mammalian or plant exosome), a fusosome) comprising (e.g., encapsulating) a composition described herein (e.g., a CAVector, a CAV, or genetic element described herein).

[0852] In some embodiments, the compositions and systems described herein can be formulated in liposomes or other similar vesicles. Generally, liposomes are spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes may be anionic, neutral or cationic. Liposomes generally have one or more (e.g., all) of the following characteristics: biocompatibility, nontoxicity, can deliver both hydrophilic and lipophilic drug molecules, can protect their cargo from degradation by plasma enzymes, and can transport their load across biological membranes and the blood brain barrier (BBB) (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679; and Zylberberg & Matosevic. 2016. Drug Delivery, 23:9, 3319-3329, doi: 10.1080/10717544.2016.1177136).

[0853] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparation of multilamellar vesicle lipids are known (see, for example, U.S. Pat. No. 6,693,086, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference). Although vesicle formation can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be expedited by applying force in the form of shaking by using a homogenizer, sonicator, or an extrusion apparatus (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679 for review). Extruded lipids can be prepared by, e.g., extruding through filters of decreasing size, as described in Templeton et al., Nature Biotech, 15:647-652, 1997.

[0854] Lipid nanoparticles (LNPs) are another example of a carrier that provides a biocompatible and biodegradable delivery system for the pharmaceutical compositions described herein. See, e.g., Gordillo-Galeano et al. European Journal of Pharmaceutics and Biopharmaceutics. Volume 133, December 2018, Pages 285-308. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the characteristics of the SLN, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a new type of carrier that combines liposomes and polymers, may also be employed. These nanoparticles possess the complementary advantages of PNPs and liposomes. A PLN is composed of a core-shell structure; the polymer core provides a stable structure, and the phospholipid shell offers good biocompatibility. As such, the two components increase the drug encapsulation efficiency rate, facilitate surface modification, and prevent leakage of water-soluble drugs. For a review, see, e.g., Li et al. 2017, Nanomaterials 7, 122; doi:10.3390/nano7060122.

[0855] Exosomes can also be used as drug delivery vehicles for the compositions and systems described herein. For a review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; doi.org/10.1016/j.apsb.2016.02.001.

[0856] Ex vivo differentiated red blood cells can also be used as a carrier for a composition described herein. See, e.g., WO2015073587; WO2017123646; WO2017123644; WO2018102740; WO2016183482; WO2015153102; WO2018151829; WO2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28): 10131-10136; U.S. Pat. No. 9,644,180; Huang et al. 2017. Nature Communications 8: 423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28): 10131-10136.

[0857] Fusosome compositions, e.g., as described in WO2018208728, can also be used as carriers to deliver a composition described herein.

Combinations

[0858] In one aspect, the CAVector or composition comprising a CAVector described herein may also include one or more heterologous moiety. In one aspect, the CAVector or composition comprising a CAVector described herein may also include one or more heterologous moiety in a fusion. In some embodiments, a heterologous moiety may be linked with the genetic element. In some embodiments, a heterologous moiety may be enclosed in the proteinaceous exterior as part of the CAVector. In some embodiments, a heterologous moiety may be administered with the CAVector.

[0859] In one aspect, the invention includes a cell or tissue comprising any one of the CAVectors and heterologous moieties described herein.

[0860] In another aspect, the invention includes a pharmaceutical composition comprising a CAVector and the heterologous moiety described herein.

[0861] In some embodiments, the heterologous moiety may be a virus (e.g., an effector (e.g., a drug, small molecule), a targeting agent (e.g., a DNA targeting agent, antibody, receptor ligand), a tag (e.g., fluorophore, light sensitive agent such as KillerRed), or an editing or targeting moiety described herein. In some embodiments, a membrane translocating polypeptide described herein is linked to one or more heterologous moieties. In one embodiment, the heterologous moiety is a small molecule (e.g., a peptidomimetic or a small organic molecule with a molecular weight of less than 2000 daltons), a peptide or polypeptide (e.g., an antibody or antigen-binding fragment thereof), a nanoparticle, an aptamer, or pharmacoagent.

[0862] Targeting Moiety

[0863] In some embodiments, the composition or CAVector described herein may further comprise a targeting moiety, e.g., a targeting moiety that specifically binds to a molecule of interest present on a target cell. The targeting moiety may modulate a specific function of the molecule of interest or cell, modulate a specific molecule (e.g., enzyme, protein or nucleic acid), e.g., a specific molecule downstream of the molecule of interest in a pathway, or specifically bind to a target to localize the CAVector or genetic element. For example, a targeting moiety may include a therapeutic that interacts with a specific molecule of interest to increase, decrease or otherwise modulate its function.

[0864] Tagging or Monitoring Moiety

[0865] In some embodiments, the composition or CAVector described herein may further comprise a tag to label or monitor the CAVector or genetic element described herein. The tagging or monitoring moiety may be removable by chemical agents or enzymatic cleavage, such as proteolysis or intein splicing. An affinity tag may be useful to purify the tagged polypeptide using an affinity technique. Some examples include, chitin binding protein (CBP), maltose binding protein (MBP), glutathione-S-transferase (GST), and poly(His) tag. A solubilization tag may be useful to aid recombinant proteins expressed in chaperone-deficient species such as E. coli to assist in the proper folding in proteins and keep them from precipitating. Some examples include thioredoxin (TRX) and poly(NANP). The tagging or monitoring moiety may include a light sensitive tag, e.g., fluorescence. Fluorescent tags are useful for visualization. GFP and its variants are some examples commonly used as fluorescent tags. Protein tags may allow specific enzymatic modifications (such as biotinylation by biotin ligase) or chemical modifications (such as reaction with FlAsH-EDT2 for fluorescence imaging) to occur. Often tagging or monitoring moiety are combined, in order to connect proteins to multiple other components. The tagging or monitoring moiety may also be removed by specific proteolysis or enzymatic cleavage (e.g. by TEV protease, Thrombin, Factor Xa or Enteropeptidase).

[0866] Nanoparticles

[0867] In some embodiments, the composition or CAVector described herein may further comprise a nanoparticle. Nanoparticles include inorganic materials with a size between about 1 and about 1000 nanometers, between about 1 and about 500 nanometers in size, between about 1 and about 100 nm, between about 50 nm and about 300 nm, between about 75 nm and about 200 nm, between about 100 nm and about 200 nm, and any range therebetween. Nanoparticles generally have a composite structure of nanoscale dimensions. In some embodiments, nanoparticles are typically spherical although different morphologies are possible depending on the nanoparticle composition. The portion of the nanoparticle contacting an environment external to the nanoparticle is generally identified as the surface of the nanoparticle. In nanoparticles described herein, the size limitation can be restricted to two dimensions and so that nanoparticles include composite structure having a diameter from about 1 to about 1000 nm, where the specific diameter depends on the nanoparticle composition and on the intended use of the nanoparticle according to the experimental design. For example, nanoparticles used in therapeutic applications typically have a size of about 200 nm or below.

[0868] Additional desirable properties of the nanoparticle, such as surface charges and steric stabilization, can also vary in view of the specific application of interest. Exemplary properties that can be desirable in clinical applications such as cancer treatment are described in Davis et al, Nature 2008 vol. 7, pages 771-782; Duncan, Nature 2006 vol. 6, pages 688-701; and Allen, Nature 2002 vol. 2 pages 750-763, each incorporated herein by reference in its entirety. Additional properties are identifiable by a skilled person upon reading of the present disclosure. Nanoparticle dimensions and properties can be detected by techniques known in the art. Exemplary techniques to detect particles dimensions include but are not limited to dynamic light scattering (DLS) and a variety of microscopies such at transmission electron microscopy (TEM) and atomic force microscopy (AFM). Exemplary techniques to detect particle morphology include but are not limited to TEM and AFM. Exemplary techniques to detect surface charges of the nanoparticle include but are not limited to zeta potential method. Additional techniques suitable to detect other chemical properties comprise by .sup.1H, .sup.11B, and .sup.13C and .sup.19F NMR, UV/Vis and infrared/Raman spectroscopies and fluorescence spectroscopy (when nanoparticle is used in combination with fluorescent labels) and additional techniques identifiable by a skilled person.

V. Host Cells

[0869] The invention is further directed to a host or host cell comprising a CAVector, CAV, genetic element, or genetic element construct, e.g., as described herein. In some embodiments, the host or host cell is a plant, insect, bacteria, fungus, vertebrate, avian (e.g., chicken), mammal (e.g., human), or other organism or cell. In certain embodiments, as confirmed herein, provided CAVectors infect a range of different host cells. Target host cells include cells of mesodermal, endodermal, or ectodermal origin. Target host cells include, e.g., epithelial cells, muscle cells, white blood cells (e.g., lymphocytes), kidney tissue cells, lung tissue cells.

[0870] In some embodiments, a host or a host cell is contacted with (e.g., infected with) an CAVector. In some embodiments, the host is a mammal, such as a human. The amount of the CAVector in the host can be measured at any time after administration. In certain embodiments, a time course of CAVector growth in a culture is determined.

[0871] In some embodiments, the CAVector, e.g., an CAVector as described herein, is heritable. In some embodiments, the CAVector is transmitted linearly in fluids and/or cells from mother to child. In some embodiments, daughter cells from an original host cell comprise the CAVector. In some embodiments, a mother transmits the CAVector to child with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%, or a transmission efficiency from host cell to daughter cell at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the CAVector in a host cell has a transmission efficiency during meiosis of at 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the CAVector in a host cell has a transmission efficiency during mitosis of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the CAVector in a cell has a transmission efficiency between about 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, 95%-99%, or any percentage therebetween.

[0872] In some embodiments, the CAVector replicates within the host cell. In one embodiment, the CAVector is capable of replicating in a mammalian cell, e.g., human cell. In other embodiments, the CAVector is replication deficient or replication incompetent.

[0873] While in some embodiments the CAVector replicates in the host cell, the CAVector does not integrate into the genome of the host, e.g., with the host's chromosomes. In some embodiments, the CAVector has a negligible recombination frequency, e.g., with the host's chromosomes. In some embodiments, the CAVector has a recombination frequency, e.g., less than about 1.0 cM/Mb, 0.9 cM/Mb, 0.8 cM/Mb, 0.7 cM/Mb, 0.6 cM/Mb, 0.5 cM/Mb, 0.4 cM/Mb, 0.3 cM/Mb, 0.2 cM/Mb, 0.1 cM/Mb, or less, e.g., with the host's chromosomes.

VI. Methods of Use

[0874] The CAVectors and compositions comprising CAVectors described herein may be used in methods of treating a disease, disorder, or condition, e.g., in a subject (e.g., a mammalian subject, e.g., a human subject) in need thereof. Administration of a pharmaceutical composition described herein may be, for example, by way of parenteral (including intravenous, intratumoral, intraperitoneal, intramuscular, intracavity, and subcutaneous) administration. The CAVectors may be administered alone or formulated as a pharmaceutical composition.

[0875] The CAVectors may be administered in the form of a unit-dose composition, such as a unit dose parenteral composition. Such compositions are generally prepared by admixture and can be suitably adapted for parenteral administration. Such compositions may be, for example, in the form of injectable and infusable solutions or suspensions or suppositories or aerosols.

[0876] In some embodiments, administration of a CAVector or composition comprising same, e.g., as described herein, may result in delivery of a genetic element comprised by the CAVector to a target cell, e.g., in a subject.

[0877] A CAVector or composition thereof described herein, e.g., comprising an effector (e.g., an endogenous or exogenous effector), may be used to deliver the effector to a cell, tissue, or subject. In some embodiments, the CAVector or composition thereof is used to deliver the effector to bone marrow, blood, heart, GI or skin. Delivery of an effector by administration of a CAVector composition described herein may modulate (e.g., increase or decrease) expression levels of a noncoding RNA or polypeptide in the cell, tissue, or subject. Modulation of expression level in this fashion may result in alteration of a functional activity in the cell to which the effector is delivered. In some embodiments, the modulated functional activity may be enzymatic, structural, or regulatory in nature.

[0878] In some embodiments, the CAVector, or copies thereof, are detectable in a cell 24 hours (e.g., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 30 days, or 1 month) after delivery into a cell. In embodiments, a CAVector or composition thereof mediates an effect on a target cell, and the effect lasts for at least 1, 2, 3, 4, 5, 6, or 7 days, 2, 3, or 4 weeks, or 1, 2, 3, 6, or 12 months. In some embodiments (e.g., wherein the CAVector or composition thereof comprises a genetic element encoding an exogenous protein), the effect lasts for less than 1, 2, 3, 4, 5, 6, or 7 days, 2, 3, or 4 weeks, or 1, 2, 3, 6, or 12 months.

[0879] Examples of diseases, disorders, and conditions that can be treated with the CAVector described herein, or a composition comprising the CAVector, include, without limitation: immune disorders, interferonopathies (e.g., Type I interferonopathies), infectious diseases, inflammatory disorders, autoimmune conditions, cancer (e.g., a solid tumor, e.g., lung cancer, non-small cell lung cancer, e.g., a tumor that expresses a gene responsive to mIR-625, e.g., caspase-3), and gastrointestinal disorders. In some embodiments, the CAVector modulates (e.g., increases or decreases) an activity or function in a cell with which the CAVector is contacted. In some embodiments, the CAVector modulates (e.g., increases or decreases) the level or activity of a molecule (e.g., a nucleic acid or a protein) in a cell with which the CAVector is contacted. In some embodiments, the CAVector decreases viability of a cell, e.g., a cancer cell, with which the CAVector is contacted, e.g., by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more. In some embodiments, the CAVector comprises an effector, e.g., an miRNA, e.g., miR-625, that decreases viability of a cell, e.g., a cancer cell, with which the CAVector is contacted, e.g., by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more. In some embodiments, the CAVector increases apoptosis of a cell, e.g., a cancer cell, e.g., by increasing caspase-3 activity, with which the CAVector is contacted, e.g., by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more. In some embodiments, the CAVector comprises an effector, e.g., an miRNA, e.g., miR-625, that increases apoptosis of a cell, e.g., a cancer cell, e.g., by increasing caspase-3 activity, with which the CAVector is contacted, e.g., by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more.

VII. Administration/Delivery

[0880] The composition (e.g., a pharmaceutical composition comprising a CAVector as described herein) may be formulated to include a pharmaceutically acceptable excipient, e.g., as described herein. Pharmaceutical compositions may optionally comprise one or more additional active substances, e.g. therapeutically and/or prophylactically active substances. Pharmaceutical compositions of the present invention may be sterile and/or pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0881] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys.

[0882] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product.

[0883] In one aspect, the invention features a method of delivering a CAVector to a subject. The method includes administering a pharmaceutical composition comprising a CAVector as described herein to the subject. In some embodiments, the administered CAVector replicates in the subject (e.g., becomes a part of the virome of the subject).

[0884] The pharmaceutical composition may include wild-type or native viral elements and/or modified viral elements. The CAVector may include one or more CAV sequences (e.g., nucleic acid sequences or nucleic acid sequences encoding amino acid sequences thereof) or a sequence with at least about 60%, 65%, 70%, 75%, 80%, 85%, 90% 95%, 96%, 97%, 98% and 99% nucleotide sequence identity thereto. The CAVector may comprise a nucleic acid molecule comprising a nucleic acid sequence with at least about 60%, 65%, 70%, 75%, 80%, 85%, 90% 95%, 96%, 97%, 98% and 99% sequence identity to one or more CAV sequences (e.g., a CAV VP1 nucleic acid sequence), e.g., as described herein. The CAVector may comprise a nucleic acid molecule encoding an amino acid sequence with at least about 60%, 65%, 70%, 75%, 80%, 85%, 90% 95%, 96%, 97%, 98% and 99% sequence identity to an CAV amino acid sequence (e.g., the amino acid sequence of an CAV VP1 molecule), e.g., as described herein. The CAVector may comprise a polypeptide comprising an amino acid sequence with at least about 60%, 65%, 70%, 75%, 80%, 85%, 90% 95%, 96%, 97%, 98% and 99% sequence identity to an CAV amino acid sequence (e.g., the amino acid sequence of an CAV VP1 molecule), e.g., as described herein.

[0885] In some embodiments, the CAVector is sufficient to increase (stimulate) endogenous gene and protein expression, e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more as compared to a reference, e.g., a healthy control. In certain embodiments, the CAVector is sufficient to decrease (inhibit) endogenous gene and protein expression, e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more as compared to a reference, e.g., a healthy control.

[0886] In some embodiments, the CAVector inhibits/enhances one or more viral properties, e.g., tropism, infectivity, immunosuppression/activation, in a host or host cell, e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more as compared to a reference, e.g., a healthy control.

[0887] In some embodiments, the subject is administered the pharmaceutical composition further comprising one or more viral strains that are not represented in the viral genetic information.

[0888] In some embodiments, the pharmaceutical composition comprising a CAVector described herein is administered in a dose and time sufficient to modulate a viral infection. Some non-limiting examples of viral infections include adeno-associated virus, Aichi virus, Australian bat lyssavirus, BK polyomavirus, Banna virus, Barmah forest virus, Bunyamwera virus, Bunyavirus La Crosse, Bunyavirus snowshoe hare, Cercopithecine herpesvirus, Chandipura virus, Chikungunya virus, Cosavirus A, Cowpox virus, Coxsackievirus, Crimean-Congo hemorrhagic fever virus, Dengue virus, Dhori virus, Dugbe virus, Duvenhage virus, Eastern equine encephalitis virus, Ebolavirus, Echovirus, Encephalomyocarditis virus, Epstein-Barr virus, European bat lyssavirus, GB virus C/Hepatitis G virus, Hantaan virus, Hendra virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis E virus, Hepatitis delta virus, Horsepox virus, Human adenovirus, Human astrovirus, Human coronavirus, Human cytomegalovirus, Human enterovirus 68, Human enterovirus 70, Human herpesvirus 1, Human herpesvirus 2, Human herpesvirus 6, Human herpesvirus 7, Human herpesvirus 8, Human immunodeficiency virus, Human papillomavirus 1, Human papillomavirus 2, Human papillomavirus 16, Human papillomavirus 18, Human parainfluenza, Human parvovirus B19, Human respiratory syncytial virus, Human rhinovirus, Human SARS coronavirus, Human spumaretrovirus, Human T-lymphotropic virus, Human torovirus, Influenza A virus, Influenza B virus, Influenza C virus, Isfahan virus, JC polyomavirus, Japanese encephalitis virus, Junin arenavirus, KI Polyomavirus, Kunjin virus, Lagos bat virus, Lake Victoria marburgvirus, Langat virus, Lassa virus, Lordsdale virus, Louping ill virus, Lymphocytic choriomeningitis virus, Machupo virus, Mayaro virus, MERS coronavirus, Measles virus, Mengo encephalomyocarditis virus, Merkel cell polyomavirus, Mokola virus, Molluscum contagiosum virus, Monkeypox virus, Mumps virus, Murray valley encephalitis virus, New York virus, Nipah virus, Norwalk virus, O'nyong-nyong virus, Orf virus, Oropouche virus, Pichinde virus, Poliovirus, Punta toro phlebovirus, Puumala virus, Rabies virus, Rift valley fever virus, Rosavirus A, Ross river virus, Rotavirus A, Rotavirus B, Rotavirus C, Rubella virus, Sagiyama virus, Salivirus A, Sandfly fever sicilian virus, Sapporo virus, Semliki forest virus, Seoul virus, Simian foamy virus, Simian virus 5, Sindbis virus, Southampton virus, St. louis encephalitis virus, Tick-borne powassan virus, Torque teno virus, Toscana virus, Uukuniemi virus, Vaccinia virus, Varicella-zoster virus, Variola virus, Venezuelan equine encephalitis virus, Vesicular stomatitis virus, Western equine encephalitis virus, WU polyomavirus, West Nile virus, Yaba monkey tumor virus, Yaba-like disease virus, Yellow fever virus, and Zika Virus. In certain embodiments, the CAVector is sufficient to outcompete and/or displace a virus already present in the subject, e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more as compared to a reference. In certain embodiments, the CAVector is sufficient to compete with chronic or acute viral infection. In certain embodiments, the CAVector may be administered prophylactically to protect from viral infections (e.g. a provirotic). In some embodiments, the CAVector is in an amount sufficient to modulate (e.g., phenotype, virus levels, gene expression, compete with other viruses, disease state, etc. at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more). In some embodiments, treatment, treating, and cognates thereof comprise medical management of a subject (e.g., by administering a CAVector, e.g., a CAVector made as described herein), e.g., with the intent to improve, ameliorate, stabilize, prevent or cure a disease, pathological condition, or disorder. In some embodiments, treatment comprises active treatment (treatment directed to improve the disease, pathological condition, or disorder), causal treatment (treatment directed to the cause of the associated disease, pathological condition, or disorder), palliative treatment (treatment designed for the relief of symptoms), preventative treatment (treatment directed to preventing, minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder), and/or supportive treatment (treatment employed to supplement another therapy).

Redosing

[0889] The CAVectors described herein can, in some instances, be used as a delivery vehicle that can be administered in multiple doses (e.g., doses administered separately). While not wishing to be bound by theory, in some embodiments, a CAVector (e.g., as described herein) induces a relatively low immune response (as measured, for example, as 50% GMT values, e.g., as observed in Example 12), e.g., allowing for repeated dosing of a subject with one or more CAVectors (e.g., multiple doses of the same CAVector or different CAVectors). In an aspect, the invention provides a method of delivering an effector, comprising administering to a subject a first plurality of CAVectors and then a second plurality of CAVectors. In some embodiments, the second plurality of CAVectors comprise the same proteinaceous exterior as the CAVectors of the first plurality. In another aspect, the invention provides a method of selecting a subject (e.g., a human subject) to receive an effector, wherein the subject previously received, or was identified as having received, a first plurality of CAVectors comprising a genetic element encoding an effector, in which the method involves selecting the subject to receive a second plurality of CAVectors comprising a genetic element encoding an effector (e.g., the same effector as that encoded by the genetic element of the first plurality of CAVectors, or a different effector as that encoded by the genetic element of the first plurality of CAVectors). In another aspect, the invention provides a method of identifying a subject (e.g., a human subject) as suitable to receive a second plurality of CAVectors, the method comprising identifying the subject has having previously received a first plurality of CAVectors comprising a genetic element encoding an effector, wherein the subject being identified as having received the first plurality of CAVectors is indicative that the subject is suitable to receive the second plurality of CAVectors.

[0890] In some embodiments, the second plurality of CAVectors comprises a proteinaceous exterior with at least one surface epitope in common with the CAVectors of the first plurality of CAVectors. In some embodiments, the CAVectors of the first plurality and the CAVectors of the second plurality carry genetic elements encoding the same effector. In some embodiments, the CAVectors of the first plurality and the CAVectors of the second plurality carry genetic elements encoding different effectors.

[0891] In some embodiments, the second plurality comprises about the same quantity and/or concentration of CAVectors as the first plurality (e.g., when normalized to the body mass of the subject at the time of administration), e.g., the second plurality comprises 90-110%, e.g., 95-105% of the number of CAVectors in the first plurality when normalized to body mass of the subject at the time of administration. In some embodiments, wherein the first plurality comprises a greater dosage of CAVectors than the second plurality, e.g., wherein the first plurality comprises a greater quantity and/or concentration of CAVectors relative to the second plurality. In some embodiments, wherein the first plurality comprises a lower dosage of CAVectors than the second plurality, e.g., wherein the first plurality comprises a lower quantity and/or concentration of CAVectors relative to the second plurality.

[0892] In some embodiments, the subject is evaluated between the administration of the first and second pluralities of CAVectors, e.g., for the presence (e.g., persistence) of CAVectors from the first plurality, or progeny thereof. In some embodiments, the subject is administered the second plurality of CAVectors if the presence of CAVectors from the first plurality, or the progeny thereof, are not detected.

[0893] In some embodiments, the second plurality is administered to the subject at least 1, 2, 3, or 4 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or 1, 2, 3, 4, 5, 10, or 20 years after the administration of the first plurality to the subject. In some embodiments, the second plurality is administered to the subject between 1-2 weeks, 2-3 weeks, 3-4 weeks, 1-2 months, 3-4 months, 4-5 months, 5-6 months, 6-7 months, 7-8 months, 8-9 months, 9-10 months, 10-11 months, 11-12 months, 1-2 years, 2-3 years, 3-4 years, 4-5 years, 5-10 years, or 10-20 years after the administration of the first plurality to the subject. In some embodiments, the method comprises administering a repeated dose of anellovectors over the course of at least 1, 2, 3, 4, or 5 years.

[0894] In some embodiments, the method further comprises assessing, after administration of the first plurality and before administration of the second plurality, one or more of: [0895] a) the level or activity of the effector in the subject (e.g., by detecting a protein effector, e.g., by ELISA; by detecting a nucleic acid effector, e.g., by RT-PCR, or by detecting a downstream effect of the effector, e.g., level of an endogenous gene affected by the effector); [0896] b) the level or activity of the CAVector of the first plurality in the subject (e.g., by detecting the level of the VP1 of the CAVector); [0897] c) the presence, severity, progression, or a sign or symptom of a disease in the subject that the anellovector was administered to treat; and/or [0898] d) the presence or level of an immune response, e.g., neutralizing antibodies, against a CAV or CAVector.

[0899] In some embodiments, the method further comprises administering to the subject a third, fourth, fifth, and/or further plurality of CAVectors, e.g., as described herein.

[0900] In some embodiments, the first plurality and the second plurality are administered via the same route of administration, e.g., intravenous administration. In some embodiments, the first plurality and the second plurality are administered via different routes of administration. In some embodiments, the first and the second pluralities are administered by the same entity (e.g., the same health care provider). In some embodiments, the first and the second pluralities are administered by different entities (e.g., different health care providers).

[0901] All references and publications cited herein are hereby incorporated by reference.

[0902] The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the invention; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.

EXAMPLES

Table of Contents

[0903] Example 1: Rescue of Recombinant Synthetic CAV and passage in avian cells [0904] Example 2: Tandem CAV constructs [0905] Example 3: CAV Binding to Avian and Human Cells [0906] Example 4: Design and construction of exemplary CAVectors genetic elements [0907] Example 5: Rescue of CAVectors using wild-type CAV [0908] Example 6: Purification of CAVector from supernatant [0909] Example 7: CAVectors transduce human cells [0910] Example 8: Resistance of CAVectors to neutralizing antibodies [0911] Example 9: Production of CAVectors without wild-type CAV [0912] Example 10: Production of nLuc CAVector for injection into mice [0913] Example 11: Administration of CAVector in vivo to mice, resulting in delivery of payload DNA in multiple organs [0914] Example 12: Immunogenicity in mice receiving CAVectors versus AAV2 [0915] Example 13: CAV-like particles (VLPs) assemble in vitro from purified capsid proteins [0916] Example 14: CAVector enter MDCC-MSB1 cells via the late endosome pathway [0917] Example 15: CAVector viability after heat treatment and after storage at 4 C. [0918] Example 16: Recovery of CAVector using tandem plasmid

Example 1: Rescue of Recombinant Synthetic CAV and Passage in Avian Cells

[0919] In this example, recombinant synthetic Chicken Anemia Virus (CAV) was produced from a synthetic genome. To rescue viable CAV from a synthetic genome, CAV plasmid DNA was in vitro circularized (IVC) to remove vector backbone, transfected into chicken cells, and the resulting infected cells passaged into fresh cells repeatedly. Briefly, MDCC-MSB1 cells were electroporated with p637(Neg), pCAV, or pCAV-IVC constructs. The cells were split into fresh medium with uninfected MDCC-MSB1 cells, with subsequent splitting of cells every 48 hours. The repeated splitting steps produced Passage 0 (P0), Passage 1 (P1), Passage 2 (P2), and beyond. Control DNA (described below) was similarly processed to show that virus recovery was only detected when circular double-stranded CAV genomic DNA was provided to the cells (FIGS. 1 and 4). Quantitative PCR (qPCR), microscopy of infected cells, electron microscopy of concentrated viral suspensions, and western blotting were used to show that CAV was replicating in the cells.

[0920] Prepare the Double-Stranded Genome

[0921] The genome of the wild-type CAV strain Cuxhaven 1 was synthesized in vitro as a 2,319 bp EcoRI fragment which was then cloned into the plasmid pUC57. The resulting plasmid (pRTx-708) was propagated in E. coli and purified according to standard methods. The plasmid (75 g) was digested with EcoRI and PvuI and a 2.3 kb band excised from an agarose gel. A Gel Purification kit (Qiagen) was used to extract the CAV genomic dsDNA and a ligation reaction using T4 DNA ligase (NEB) was carried out in a volume of 5 mL to circularize the CAV double-stranded genome. Following a 24-hour incubation at 16 C., the DNA was ethanol precipitated according to standard methods and resuspended in 100 L of water. The DNA solution was dialyzed against UltraPure water for 1 hour (Slide-A-Lyzer MINI Dialysis Units 10,000 MWCO, 10-100 l Cat #69576).

[0922] Two negative control DNA samples were also prepared. One negative control was the CAV genome plasmid pRTx-708 which, after purification from E. coli, was not processed to remove the bacterial backbone as described above. Another negative control was plasmid pRTx-637, in which the gene coding for the capsid protein VP1 was deleted.

[0923] Transfection of CAV Genome

[0924] For each condition, 2.5 ug of DNA was added to 10.sup.6 live MDCC-MSB1 cells (ATCC), or about 2.5 pg/cell, and delivered by electroporation using a 4D-Nucleofector System (Lonza) with large cuvettes (10.sup.6 cells/cuvette) and program DS-137, following the manufacturer's instructions. For each condition, transfected cells were recovered as recommended, and transferred to a final culture volume of 5 mL RPMI containing 10% FBS in T25 flasks. Transfected cells were grown in a humidified 40 C./5% CO.sub.2 incubator for 2 to 3 days. The product of this step is referred to herein as passage 0 (P0).

[0925] Harvest and Passage of Transfected/Infected Cells

[0926] The P0 cell suspension (5 mL) was harvested by taking 2 aliquots of the cell suspension for qPCR and western blot analysis, then transferring 1.5 mL of cell suspension into a new flask and bringing up the cell counts to 210.sup.5 cells/mL using fresh cells in a final volume of 7 mL and then incubated at 40 C., 5% CO2. This process was repeated for 4 passages.

[0927] Measuring Virus Titer

[0928] The cell suspension samples (200 L) were purified using the PureLink viral DNA/RNA kit (Thermo Fisher) by adding 200 L of lysis buffer and 25 L of Proteinase K directly to the sample tube. Copies/ml were evaluated by TaqMan qPCR carried out using Thermo Fisher TaqMan reagents and a QuantStudio real time qPCR instrument according to manufacturer's recommendations.

TABLE-US-00028 Primersandprobeused: CAVFwd: 5-TTGGAAACCCCTCACTGCAGAG-3 CAVRev: 5-CTGAATTGTCCGCAGTTGCAG-3 CAVVP1probe: 5-6FAM-CTGGAATTACAATCACTCTAT-MGBNFQ-3

[0929] Analysis was carried out for samples from passages 0, 1, 2, and 4 (P1-4; FIG. 1). Only samples from cells originally transfected with IVC CAV DNA showed an increase in CAV copies over passage number. This indicated that replication of CAV DNA and transmission to fresh cells occurred.

[0930] Detect Viral Proteins by Western Blot

[0931] To analyze CAV protein expression, 30 ul of each sample was reduced and denatured using SDS sample buffer and boiling for 10 minutes. The samples were then loaded on a BOLT 4-12% Bis-Tris gel (Thermo Fisher) and electrophoresed for 40 minutes as recommended by the supplier. The gel was washed in water for 5 minutes and transferred to a nitrocellulose membrane using the iBlot2 system. The membrane was washed with TBS-T for 5 minutes and blocked with Li-Cor TBS blocking buffer for 1 hour. Detection was carried out by incubating the blocked membrane with a mixture of rabbit anti-Apoptin (VP3; Abcam, Ab193612) and anti-VP2 sera (Cusabio Technology, CSB-PA302471LA01CID) diluted 1:100 in TBS blocking buffer 16 hours at 4 C. After washing, a goat anti-rabbit IRDye 680 secondary antibody (LI-COR Biotechnology) was applied to the membrane, washed, and then imaged using a Li-Cor Odyssey instrument. FIG. 1 shows that P1 and P2 cells derived from IVC CAV-transfected cells (P0) were positive for both CAV proteins, but not samples derived from other transfections.

[0932] Characterization of Infected Cells

[0933] Cell samples from P4 were observed by phase-contrast microscopy to examine cellular morphology. Cells in the IVC CAV sample were frequently found to be enlarged and to have multiple cytoplasmic inclusions, in contrast with the cells from the control samples which had a normal appearance.

[0934] Isolation of Rescued CAV

[0935] In a separate experiment, MDCC-MSB1 cells were transfected and passaged twice to P2 as described above. Following transfection of CAV IVC or p637 into MDCC-MSB1 cells by electroporation, transfected cells were passaged twice (P0 to P2; splitting into fresh medium with uninfected MDCC-MSB1 cells performed every 48 hours) and the resulting passaged cells at P2 were lysed by freeze-thaw to generate a lysate which was used to infect fresh MDCC-MSB1 cells. The virus harvest from these cells corresponded to P3. Cell suspension from CAV IVC or negative control cells was lysed by subjecting it to freeze-thaw and applied to fresh cells which were then incubated for 3 days at 40 C. and 5% CO.sub.2. After incubation, the cells were inspected by phase contrast microscopy and showed clear cytopathic effects only in those which were infected with CAV IVC-derived lysate. In particular, cells exposed to P2 derived from p637 showed normal morphology while cells exposed to P2 derived from IVC CAV DNA showed a morphology typical of infected cells. Based on qPCR analysis of P2 and P3 aliquots, the number of CAV genome copies increased from P2 (labeled as input in FIG. 2) to P3 (output) only in the cells which received CAV IVC-derived lysate. These observations were consistent with CAV IVC DNA giving rise to infectious CAV.

[0936] The CAV-infected P3 cell suspension was lysed with 0.5% Triton X-100, treated with Benzonase, and pelleted by sedimentation ultracentrifugation through a 20% sucrose cushion. The resuspended pellet was then applied to a linear CsCl gradient for isopycnic ultracentrifugation and fractions from the gradient harvested for characterization by qPCR (FIG. 3) and infectivity (FIG. 4). CAV genome copies were detected to peak in the density gradient at 1.32 g/mL (FIG. 3).

[0937] The peak fraction was pooled with the neighboring two fractions, dialyzed to remove CsCl, and the resulting purified viral suspension was added to fresh cells after either 5000-fold or 50,000-fold dilution. A mock purification and infection were carried out in parallel using negative control lysate diluted in the same way. Neither dilution of the negative control showed signs of infection, as measured by qPCR of cell culture samples taken daily over 6 days (FIG. 4). However, culture samples infected with the 5000-fold CAV dilution were clearly positive beginning after 2 days. This confirmed that infectious CAV was derived from synthetic IVC DNA-transfected MDCC-MSB1 cells.

[0938] Electron Microscopy

[0939] MDCC-MSB1 cells were infected with CAV, allowed to incubate and processed essentially as described by Todd et al. 1990. The viral suspension was imaged by negative stain electron microscopy, revealing a large number of viral particles (FIG. 5).

Example 2: Tandem CAV Constructs

[0940] A series of exemplary CAV tandem constructs was generated (FIG. 6A). Briefly, the tandem constructs comprised a plasmid backbone, and either two full copies of the CAV genome, or one full copy and one partial copy. Each of the CAV tandem constructs was introduced into MDCC-MSB1 cells by nucleofection. This was the P0 culture. 200 l of cell suspension were collected on days 2 and 3 post-nucleofection for downstream qPCR. On day 3, cell suspension was passaged in a ratio of 1:10 into fresh MDCC-MSB1 cells to start the P1 culture. On day 2 of the P1 culture, 200 l of suspension were collected for qPCR, and the remaining cells were pelleted for DNA extraction and Southern blotting. qPCR was performed for the P0 and P1 culture samples using CAV probes. An increase in replication was observed upon passaging for pRTX-1114-1116. A smaller increase was observed for pRTX1113, 1118, and 1119 (FIG. 6B). Cell pellets from the P1 samples were analyzed by Southern blotting. Backbone cut or DpnI digested DNA was run on a gel, transferred to a membrane, and probed with biotin-labeled probes made by random hexamers against CAV and ladders. Streptavidin-IRDye-800 was added, and results were imaged on a LiCor Odyssey. The results of this experiment were consistent with the qPCR data. dsDNA circles were observed in all lanes except those that contain pRTX-1117 and pRTX-1121 (FIG. 6C). Bands were DpnI resistant, which indicated replication of the genome. Wild-type CAV virus was also recovered.

[0941] These results indicate that adding a full or partial copy of a CAV genome to a plasmid comprising backbone and a full CAV genome increases viral titer.

Example 3: CAV Binding to Avian and Human Cells

[0942] The ability of CAV to bind a panel of human cell lines was screened. MCF-7 (human breast cancer), MRC5 (lung fibroblast), EKVX (lung adenocarcinoma), Raji (B lymphoblast), Jurkat (T lymphoblast), and MDCC (chicken lymphoblast, positive control) cells were tested in duplicate. For each cell type, 210.sup.5 cells were incubated with CAV (MOI=1.5 CAV particles per cell) for one hour at 4 C. Cells were washed twice, and a trypsin control was performed where each condition was treated with trypsin to remove bound virions and establish a background. DNA was extracted, and qPCR was performed to determine the number of viral genomes bound to each cell type. The trypsin background was subtracted, and the values were plotted as percentage binding normalized to the MDCC control (FIG. 7). The results indicated that CAV bound to Raji cells and to EKVX cells. These data show that CAV can bind specifically to human cells, and are consistent with CAV being able to enter human cells.

Example 4: Design and Construction of Exemplary CAVectors Genetic Elements

[0943] To generate putative vectors, a scanning approach was used to analyze the CAV genome to discover regions necessary for viral replication and packaging. Briefly, a 988 bp reporter cassette was inserted into the CAV genome at staggered 200 bp spacings (FIGS. 8A-8B). The reporter, which contained the SV40 promoter, the nano-luciferase (nLuc) ORF, and the SV40 terminator, replaced the corresponding region of the CAV genome, thus maintaining the wild-type CAV genome length. A total of eight nLuc insertion constructs were designed, as shown in FIG. 8A. The sequences of each nLuc construct are shown in Tables 2-9 above. The constructs were chemically synthesized, cloned into the pUC57-mini plasmid, restriction digested from the plasmid backbone, and in-vitro circularized (IVC). These plasmids could then be used to produce engineered CAV-based genetic elements to be tested for their ability to be packaged into a proteinaceous exterior, thereby forming an engineered CAV vector (referred to herein as a CAVector).

Example 5: Rescue of CAVectors Using Wild-Type CAV

[0944] This example demonstrates the provision in trans of CAV proteins to a CAVector comprising an exogenous gene. The resulting CAVector was able to deliver the exogenous gene to a target cell.

[0945] CAVector genomes designed as described in Example 4 were produced by in vitro circularization (IVC) and then co-transfected into MDCC-MSB1 cells at a 1:1 ratio with plasmid encoding a tandem CAV genome (pRTX-966) or plasmid encoding a partial CAV genome in which the VP1 coding region is deleted but VP2 and VP3 are retained (pRTX-637). As a control, WT CAV IVC was also co-transfected with pRTX-966 or pRTX-637. 510.sup.6 total cells were transfected via nucleofection per condition and incubated in 25 mL RPMI with 10% FBS. After 3 days, the production of nLuc was confirmed, cell suspension was harvested, and supernatants were clarified by centrifugation. Clarified supernatants were then filtered through a 0.2 m filter.

[0946] To test if vector rescue had occurred, filtered supernatants were incubated with 110.sup.5 MDCC-MSB1 cells for 30 minutes in a 48-well plate, followed by three washes. Luminescence was then measured to determine if transduction occurred (day 0), as well as at 24 hour increments thereafter (day 1 and day 2) (FIG. 9A). The day 0 reading provided a measurement of the nLuc background while day 1 and 2 measures the nLuc produced from transduction. Before measuring luminescence, the transduced cells were washed three times with PBS to reduce background nLuc in the samples. The luminescence measurements were performed on lysed cells to enrich for nLuc signal. In the control samples (pRTX-637), there was no increase in luminescence from day 0 to day 2, indicating that no vectors were formed in the absence of VP1 (FIG. 9B). In the samples that were co-transfected with tandem CAV, an increase in luminescence was observed from day 0 to 2 for CAV-nLuc4, 5, and 7, and an increase from day 0 to 1 was observed for CAV-nLuc6 (FIG. 9C). This indicated that these IVC CAVector genomes are capable of undergoing replication and packaging in the presence of WT CAV from a tandem genome. Further, that there was no increase in luminescence for CAV-nLuc1, 2, 3, or 8 suggests that the regions disrupted by the CAVector insert in these constructs play a necessary role in replication and/or packaging.

Example 6: Purification of CAVector from Supernatant

[0947] To concentrate supernatant CAVector particles and further reduce carryover nluc, 10 ml of CAVector supernatant was layered over a 20% sucrose cushion and centrifuged at 31,000 rpm for 3 hours to pellet virus and vector particles. Supernatant and sucrose were removed, and the pellet was resuspended overnight in PBS. A DNase protection assay was performed on the resuspended pellet using probes for CAV and CAVector. This confirmed successful purification of CAVector particles at a concentration of 110.sup.8 vectors/ml (FIG. 10A). Using the CAVector DNase protection assay as a guide, MDCC-MSB1 cells were transduced using a normalized amount of 3 CAVector genomes per cell. 310.sup.5 CAVector genomes were incubated with 110.sup.5 MDCC-MSB1 cells in a 48-well plate for 30 minutes or 48 hours and luminescence was measured after 3 PBS wash steps to determine if transduction occurred. The day 0 results indicated that the background nLuc signal was reduced (FIG. 10B). Further, the day 2 results confirmed that CAV-nLuc4-7 yielded vectors that transduced MDCC-MSB1 cells. Day 2 luminescence values were similar between CAV-nluc4-7, indicating these vectors transduced cells with similar efficiencies. This result also defines a window, spanning the 5-most end of the nanoluciferase cassette of nluc4 and the 3-most end of the cassette in construct nluc7, wherein a transgene can be inserted in the CAV genome to successfully recover a transduction-competent vector.

Example 7: CAVectors Transduce Human Cells

[0948] In this example, whether CAVectors could transduce Raji or Jurkat cells was assessed. CAV-nluc4 and CAV-nluc6 were used as test subjects, and CAV-nluc1, CAV WT, and p637+nluc 6 were used as expected negative controls. Mock-transduced cells were also used as a further negative control. 310.sup.5 CAVector genomes were incubated with 110.sup.5 Raji or Jurkat cells in a 48-well plate for 30 minutes or 48 hours and luminescence was measured after 3 PBS wash steps to determine if transduction occurred. In Raji cells, there was an increase in luminescence from day 0 to day 2 in cells transduced with CAV-nluc4 and CAV-nluc6 but not the negative controls (FIG. 11B). Jurkat cells transduced with CAV n-Luc4 and CAV-nLuc6 also showed an increase in luminescence from day 0 to day 2 (FIG. 11A). These data indicated that CAVectors are capable of transducing human cells.

[0949] In a second example, a transduction screen was performed in a large number of cell lines, using CAVector-nLuc at low (<10) multiplicity of infection (MOI) and using a sub-optimal promoter. The screens showed that, under these conditions, with an MOI of 3, transduction was detected in lymphoid cells, including MOLT-4 cells (luminescence increase of about 2.5 from day 0 to day 2), Jurkat cells (luminescence increase of about 0-2.5 from day 0 to day 2), and Raji cells (luminescence increase of about 4-13 from day 0 to day 2).

Example 8: Resistance of CAVectors to Neutralizing Antibodies

Resistance of CAVectors to Human IVIG and Neutralization of CAVectors by VP1-Specific Antibodies in Chicken Sera

[0950] We assessed whether CAVectors were neutralized by anti-VP1 antibodies. Chicken sera from two independent sources were found to contain neutralizing antibodies to the VP1 capsid protein of CAV. CAV was incubated with either chicken serum or anti-VP1 antibodies raised against a VP1 peptide. Since many chickens are vaccinated against CAV, it was hypothesized that chicken sera would neutralize CAV. In addition, it was expected that the anti-VP1 peptide antibodies would not neutralize CAV since they are based on a peptide that is not conformationally relevant. Following incubation, cells were inoculated and total viral genomes were measured after 7 days. It was found that chicken sera neutralized CAV while anti-VP1 peptide antibodies did not (FIG. 13A). To prove that the neutralization was due to neutralizing VP1 antibodies in the chicken serum, western blots were performed on purified CAV particles using chicken serum as the source of antibody. Bands were observed that coincided with those detected by the anti-VP1 antibody, indicating that the neutralization was due to VP1-specific antibodies (FIG. 13B). To show that CAVectors were encapsidated by VP1, we tested if the neutralizing antibodies in chicken serum could block CAVector transduction. CAVector was incubated with chicken sera, the non-neutralizing VP1 antibody, or human intravenous immunoglobulin (IVIG). The transduction assay was then performed. Chicken serum neutralized CAVector transduction while anti-VP1 antibody and IVIG did not (FIG. 13C). This shows that CAVector transduction was mediated through VP1 and that CAVectors were encapsidated viral vectors.

Resistance of CAVectors to Neutralizing Human Antibodies

[0951] Further characterization was carried out by purifying the particles by isopycnic centrifugation in cesium chloride (CsCl) (FIG. 19A). A peak in DNase-protected vector copies (nanoluciferase amplicon) coincided with a peak in wildtype CAV particles as determined by qPCR, corresponding to a density of 1.29 g/mL. Fractions were dialyzed and found to transduce cells, yielding nanoluciferase luminescence signals proportional to the observed qPCR titers (FIG. 19B).

[0952] To further probe the susceptibility of CAVector to neutralization by human antibodies, 10 human serum samples were assayed along with positive and negative controls. Consistent with the initial IVIG observation, only one of the 10 samples showed any signs of neutralization at a dilution greater than 1:10 (FIG. 19C). By comparison, an adeno-associated virus 2 (AAV2) vector encoding the same nanoluciferase cassette was assayed with the same serum and control samples and shown to be neutralized in accordance with expectations based on previously published data (FIG. 19D). Three of 10 donor sera neutralized the AAV2 vector at dilutions greater than 1:10, and a 1:1250 dilution of IVIG potently neutralized the vector as well.

Example 9: Production of CAVectors without Wild-Type CAV

[0953] This example demonstrates the provision in trans of CAV proteins to a CAVector comprising an exogenous gene, resulting in a CAVector preparation that did not detectably comprise wild-type CAV. The resulting CAVector was able to deliver the exogenous gene to a target cell.

[0954] As described in the Examples above, viral vectors have been produced based on CAV (CAVectors) by co-transfecting in vitro circularized (IVC) CAVector DNA expressing a nanoluciferase reporter with plasmid encoding a tandem CAV genome. From cell supernatants and lysates, bonafide CAVectors, were recovered, but the resultant preparations could include WT CAV particles due to the CAV tandem genome. Following this, efforts were undertaken to produce pure CAVectors in the absence of WT CAV. In place of the tandem CAV plasmid, cells were instead transfected with a plasmid encoding the full CAV genome (pCAV) that expressed the CAV proteins but could not make packaged particles. It was hypothesized that expression of the CAV proteins from their native promoter would be sufficient to replicate and package the co-transfected CAVector DNA. As a negative control, CAVector IVC was co-transfected with plasmid CAV in which the VP1 coding region has been deleted (pVP1). Thus, the negative control would not result in packaged CAVectors.

[0955] At 3 days post-transfection of pCAV and CAVector nLuc6 IVC into MDCC-MSB1 cells, the cell pellets were harvested and lysed and a partial purification was performed by ultracentrifugation over a 20% sucrose cushion. The post-centrifugation pellet was resuspended in PBS, and a transduction assay was performed on MDCC-MSB1 cells. To confirm that any transduction signal that might have been observed was due to VP1-encapsidated vectors, both conditions were treated with VP1-neutralizing antibodies (NAb) from chicken sera. Samples were pre-incubated with or without the VP1-neutralizing antibodies before transductions were performed. Samples were collected at 30 minutes or 2 days post-transduction to measure the change in luminescence as a readout for transduction.

[0956] The negative control, pVP1, did not rescue CAVectors (FIG. 14). A 25-fold increase in luminescence was observed from day 0 to 2 in the pCAV+nLuc6 sample, and this signal was blocked by neutralizing antibodies, indicating that pCAV rescued CAVector successfully. There should not have been any replicating CAV in this sample, based at least on three lines of evidence. First, pCAV transfections had consistently showed a lack of wild-type CAV recovery. Second, excess DNase-protected CAV genomes were not detected in qPCR assays. Third, the observed luminescence signal was increased when wild-type CAV was added to the CAVector samples.

Example 10: Production of nLuc CAVector for Injection into Mice

[0957] In this example, a CAVector carrying an nLuc transgene was produced and injected into mice. Briefly, 3e8 MDCC-MSB1 cells were transfected with nLuc6 CAVector constructs (as described herein, e.g., in Table 7) or CAV (negative control). Expi293 cells were transfected with AAV2 constructs as a positive control. The transfected cells were grown in 3 liters of media for 3 days. Supernatant was removed and the cell pellet was lysed in 0.5% SDS and treated with benzonase to digest unprotected nucleic acids. The lysed pellet was then run through a 0.45 m filter. The filtered lysate is ultracentrifuged through a 20% sucrose cushion at 31,000 rpm for three hours, resuspended overnight, and then run through a CsCl linear gradient. The sample was then fractionated and the fractions were dialyzed, followed by quantification of the resultant concentrate. Quality checks were performed. The titer and endotoxin levels of the resultant preparations are shown in FIG. 12.

Example 11: Administration of CAVector In Vivo to Mice, Resulting in Delivery of Payload DNA in Multiple Organs

[0958] In this example, a CAVector carrying a nano-luciferase (nLuc) payload was delivered into mouse tissues in vivo. Briefly, mice received comparable doses of either (i) a mixture of wild-type CAV (WT) and a CAVector carrying a genetic element encoding a nano-luciferase (Nluc) payload, or (ii) wild-type CAV alone, or (iii) AAV2 also encoding the nLuc payload. Various delivery routes were tested, including sub-retinal (SR), IV, IP, and IM (as shown in Table 23 below).

[0959] To assess tissue distribution of CAV and/or CAVector, animals were sacrificed 3 weeks after injection, and various tissues (blood, liver, spleen, lung, heart, ovary, muscle, brain, kidney, and retina) were collected. Total DNA was extracted from tissues, and assessed for CAVector genomes (using nLuc probes) or CAV WT virus genomes by qPCR. We detected elevated levels of CAVector (nLuc copies/g DNA) in the spleens and livers of mice which received the CAVector via the IV and IP routes, relative to the AAV2 IM groups (FIGS. 16A and 16C). Furthermore, we detected wild-type CAV genomes in livers and spleens in mice administered either CAV WT or CAVector, including via IV and IP (FIGS. 16B and 16D). We also observed similar signals in the muscle, retinas, hearts, and ovaries, but not the brain. Vector was detected in tissues in a pattern consistent with the route of administration (FIG. 20). These data indicate successful in vivo delivery of CAVector DNA in mice.

TABLE-US-00029 TABLE 23 Dose and route of administration of CAVector and controls in mice R46 Dose R46 or AAV Group # Test Article Route (vg) vector dose (vg) 1 PBS Subretinal 0 0 2 CAV IV 6.00E+07 0 3 CAV IP 6.00E+07 0 4 CAV IM 1.50E+07 0 5 CAVector-nLuc IV 9.51E+08 2.47E+07 6 CAVector-nLuc IP 9.51E+08 2.47E+07 7 CAVector-nLuc IM 2.38E+08 6.18E+06 8 CAVector-nLuc SR 9.51E+06 2.47E+05 9 AAV2-nLuc IM 0 1.30E+08 10 AAV2-nLuc IM 0 8.30E+08

Example 12: Immunogenicity in Mice Receiving CAVectors Versus AAV2

[0960] In this example, mice receiving wild-type CAV, CAVector, or AAV2 via intramuscular (IM) administration, as described in Example 11, were assessed for antibody responses against CAV or AAV2. Antibody responses against CAV or AAV2 were measured using an in vitro neutralization assay that relies on the detection of luminescence signal from the encoded nLuc transgene. When neutralizing antibodies against the administered vector (i.e., CAV or AAV2) is present in a sample, luminescence produced by the vector is reduced. Briefly, serum samples taken from the mice upon sacrifice were heat-inactivated and serially diluted. To compare the relative immunogenicity of CAV and AAV2, neutralization measurements were plotted (with luminescence on an inverted y-axis) for mice that received CAV or AAV2 by the IM route (FIG. 17A).

[0961] Chicken serum induced complete neutralization of CAVector at all dilutions tested, while the AAV2-nluc IM negative control, which would not be expected to elicit antibodies to CAV, did not (FIG. 19A). Remarkably, sera from mice which received CAVector and CAV WT IM did not neutralize CAVector. In contrast, animals given AAV2 IM produced high levels of neutralizing antibodies against AAV2, on par with titers present in human IVIG (FIGS. 17B and 17C). The 50% geometric mean neutralizing reciprocal titer (50% GMT) from AAV2-nLuc low dose and high dose animals was 320 and 640 respectively, compared with 1,280 for human IVIG. Given by other routes, CAVector and CAV WT elicited lower levels of neutralizing antibodies. The highest titer observed was 160 for CAV administered IV. These data suggest that CAVectors are less immunogenic than AAV2 vectors when administered intramuscularly.

Example 13: CAV-Like Particles (VLPs) Assemble In Vitro from Purified Capsid Proteins

[0962] In this example, in vitro particle formation by the CAV capsid protein, VP1, was assessed as shown in the workflow at the top of FIG. 18. Briefly, recombinant VP1 (rVp1) was co-expressed in mammalian cells with CAV VP2 and was purified by virtue of an N-terminal affinity tag (FIG. 18, panel 2) followed by size exclusion chromatography (SEC). VP1 was eluted from SEC at a retention volume corresponding to the retention volume of wild type CAV virus (FIG. 18, panel 3). Particles similar to CAV were observed by electron microscopy in VP1 SEC fractions (FIG. 18, panel 4). The putative VP1 VLPs were approximately the same size as wild-type CAV particles and exhibited the same trumpet-shaped spike features present on wild type CAV virus (FIG. 18, panel 5). These results demonstrate that CAV VP1 protein can assemble into virus-like particles in vitro.

Example 14: CAVector Enters MDCC-MSB1 Cells Via the Late Endosome Pathway

[0963] In this example, the mechanism of CAV viral entry into cells was assessed. Detection of CAVector transduction by luminescence assay enabled evaluation of the effect of four compounds known to inhibit different pathways for viral entry. The compounds tested included the macropinocytosis inhibitors amiloride hydrochloride (EIPA) and latrunculin B (LatB), dynasore, which inhibits an early event of endocytosis, and bafilomycin A1 (BafA1), an inhibitor of endosome acidification (FIG. 21A), were evaluated for their ability to inhibit transduction. The compounds, or a dimethylsulfoxide (DMSO) diluent control, were added to MDCC-MSB1 cells 15 minutes prior to and during a 20-hour transduction incubation with CAVector. A control experiment using AAV2-nLuc vector on Expi293 cells was also carried out.

[0964] Luminescence was measured to quantify CAVector transduction, showing that dynasore and BafA1 caused more than a thousandfold drop in signal relative to the DMSO diluent control while the other two compounds had minimal impact (FIG. 21B). In comparison, AAV2-nluc was inhibited to a similar extent by dynasore and BafA1, and about 3-fold by LatB (FIG. 21C). Cells were treated with each entry inhibitor in the absence of any viral vector as well as DMSO and no significant cell death was observed.

Example 15: CAVector Viability after Heat Treatment and after Storage at 4 C.

[0965] To evaluate the stability of CAVectors, thermostability and storage stability were ascertained. The vector was purified by sedimentation of cell lysate through a 20% sucrose cushion, isopycnic CsCl centrifugation, and dialysis into phosphate-buffered saline (PBS) containing divalent cations and 0.001% poloxamer 188.

[0966] In a first example, a fifteen-minute heat treatment of the vector was carried out at temperatures ranging from 40 C. to 95 C. (FIG. 22A). Transduction signal was unchanged after a 55 C. treatment, was reduced 10-fold after 15 minutes at 65 C., and was eliminated after incubation at 75 C. A neutralization control (NAb) was included to rule out any spurious luminescence signal.

[0967] In a second example, the purified CAVector sample was stored at 4 C. over six months before the sample was depleted. During this time, 3 comparable tests of transduction potency were carried out on the material. The results are shown in FIG. 22B. The transduction signal remained unchanged during this time.

Example 16: Recovery of CAVector Using Tandem Plasmid

[0968] This example describes the recovery of an exemplary CAVector encoding the nano-luciferase (nLuc) gene using a tandem plasmid construct (pRTx-1580) comprising two CAVector genome copies. The schematic of the tandem construct is shown in FIG. 23A. The first genome copy encodes a nanoluciferase transgene in place of the partial ORFs but retaining the viral cis elements and rest of the ORFs. The second genome copy is the complete CAVector genome except for deletion of the 3NCR.

[0969] To assess whether this construct can yield vectors, MDCC-MSB1 cells were transfected with the tandem vector construct. Transfected cells were harvested 3 days post transfection and lysed in using a 0.5% SDS lysis buffer containing 20 mM Tris (pH 8.0) for 30 min at 37 C. Lysates were then treated with 100 U/ml of benzonase for 20 minutes at 37 degrees, followed by clarification for 30 minutes at 10,000g to pellet cell debris. The clarified lysate was subjected to sucrose cushion purification. Vector and wildtype genomes were quantified in the sucrose cushion purified material by qPCR following DNase treatment to remove residual non-encapsidated DNA.

[0970] As shown in FIG. 23B, DNAse-protected CAVector genome copies were recovered, indicating that that the pRTx-1580 tandem vector construct retains the ability for vector DNA replication and packaging in MDCC-MSB1 transfection. To test whether these DNAse protected vector genomes can transduce, sucrose cushion purified material was added to MDCC-MSB1 or ConA-B1-VICK cells. A clear increase of luminescence signal over background was observed in both MDCC-MSB1 and ConA-B1-VICK transductions (FIG. 23C), indicating that the pRTx-1580 construct generated vector particles that were capable of transduction.