MODIFIED HOMOSERINE DEHYDROGENASE AND METHOD FOR PRODUCING HOMOSERINE OR L-AMINO ACID DERIVED FROM HOMOSERINE USING THE SAME

Abstract

The present disclosure relates to modified homoserine dehydrogenase and a method for producing a homoserine-derived L-amino acid using the same.

Claims

1. A modified homoserine dehydrogenase, wherein in the amino acid sequence of SEQ ID NO: 1, the amino acid at position 285 is substituted with isoleucine; the amino acid at position 398 is substituted with glutamine; or the amino acids at both positions are substituted with isoleucine and glutamine, respectively.

2. The modified homoserine dehydrogenase according to claim 1, wherein in the amino acid sequence of SEQ ID NO: 1, the amino acid at position 378 is further substituted with tryptophan.

3. A polynucleotide encoding the modified homoserine dehydrogenase of claim 1.

4. A microorganism of the genus Corynebacterium, comprising the modified homoserine dehydrogenase of claim 1.

5. The microorganism according to claim 4, wherein the microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium producing homoserine or a homoserine-derived L-amino acid.

6. The microorganism according to claim 5, wherein the homoserine-derived L-amino acid is at least one kind selected from the group consisting of L-threonine, L-isoleucine, O-acetyl homoserine, and L-methionine.

7. The microorganism according to claim 4, wherein the microorganism of the genus Corynebacterium produces L-alanine.

8. The microorganism according to claim 4, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

9. A method for producing homoserine or a homoserine-derived L-amino acid, comprising: culturing a microorganism of claim 4 in a medium; and recovering homoserine or a homoserine-derived L-amino acid from the microorganism or medium.

10. The method according to claim 9, wherein the homoserine-derived L-amino acid is at least one kind selected from the group consisting of L-threonine, L-isoleucine, O-acetyl homoserine, and L-methionine.

11.-17. (canceled)

18. A polynucleotide encoding the modified homoserine dehydrogenase of claim 2.

19. A microorganism of the genus Corynebacterium, comprising the modified homoserine dehydrogenase of claim 2.

20. The microorganism according to claim 19, wherein the microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium producing homoserine or a homoserine-derived L-amino acid.

21. The microorganism according to claim 20, wherein the homoserine-derived L-amino acid is at least one kind selected from the group consisting of L-threonine, L-isoleucine, O-acetyl homoserine, and L-methionine.

22. The microorganism according to claim 19, wherein the microorganism of the genus Corynebacterium produces L-alanine.

23. The microorganism according to claim 19, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

24. A method for producing homoserine or a homoserine-derived L-amino acid, comprising: culturing a microorganism of claim 19 in a medium; and recovering homoserine or a homoserine-derived L-amino acid from the microorganism or medium.

25. The method according to claim 24, wherein the homoserine-derived L-amino acid is at least one kind selected from the group consisting of L-threonine, L-isoleucine, O-acetyl homoserine, and L-methionine.

Description

MODE FOR CARRYING OUT THE INVENTION

[0067] Hereinbelow, the present disclosure will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

EXAMPLE 1

Screening for AHV-Resistant Microorganisms through Artificial Modification

[0068] In this Example, an experiment of imparting resistance against 2-amino-3-hydroxy-valerate (hereinafter referred to as AHV), which is an L-threonine analogue, was conducted using Corynebacterium glutamicum KFCC10881 (Korean Patent No. 0159812) as a parent strain, in order to release the feedback inhibition by L-threonine of homoserine dehydrogenase (hereinafter referred to as Hom, EC:1.1.1.3).

[0069] Modification was induced by an artificial modification method using N-methyl-N-nitro-N-nitrosoguanidine (hereinafter referred to as NTG). The KFCC10881 strain, which had been cultured in a seed medium for 18 hours, was inoculated into 4 mL of the seed medium, and then cultured until OD.sub.660 reached about 1.0. The culture medium was centrifuged to recover the cells, and then the cells were washed twice with a 50 mM Tris-malate buffer (pH 6.5) and suspended in the final 4 mL of the same buffer. An NTG solution (2 mg/mL in a 0.05 M Tris-malate buffer (pH 6.5)) was added to the cell suspension to have a final concentration of 150 mg/L, and then allowed to stand at room temperature for 20 minutes. Thereafter, the cells were recovered by centrifugation, and washed twice with the same buffer to remove the NTG. The finally washed cells were suspended in 4 mL of a 20% glycerol solution and then stored at 70 C. until use. The NTG-treated strains were plated on a minimal medium containing 3 g/L of AHV, and then 155 AHV-resistant KFCC10881 strains were obtained through the above procedure.

[0070] Seed Medium (pH 7.0)

[0071] glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH.sub.2PO.sub.4 4 g, K.sub.2HPO.sub.4 8 g, MgSO.sub.4 7H.sub.2O 0.5 g, biotin 100 g, thiamine HCl 1,000 g, calcium pantothenate 2,000 g, nicotinamide 2,000 g (based on 1 L of distilled water)

[0072] Minimal Medium (pH 7.2)

[0073] glucose 5 g, KH.sub.2PO.sub.4 1 g, (NH.sub.4).sub.2SO.sub.4 5 g, MgSO.sub.4 7H.sub.2O 0.4 g, NaCl 0.5 g, biotin 200 g, thiamine HCl 100 g, calcium pantothenate 100 g, nicotinamide 0.03 g, urea 2 g, Na.sub.2B.sub.4O.sub.7 10H.sub.2O 0.09 mg, (NH.sub.4).sub.6Mo.sub.7O.sub.27 4H.sub.2O 0.04 mg, ZnSO.sub.4 7H.sub.2O 0.01 mg, CuSO.sub.4 5H.sub.2O, MnCl.sub.2 4H.sub.2O 0.01 mg, FeCl.sub.3 6H.sub.2O 1 mg, CaCl.sub.2 0.01 mg (based on 1 L of distilled water)

EXAMPLE 2

L-Threonine Production Test for AHV-Resistant KFCC10881 Strains

[0074] A test for the L-threonine producing-ability was conducted on the 155 AHV-resistant strains obtained in Example 1. The 155 strains obtained in Example 1 were inoculated into a corner-baffled flask (250 mL) containing the seed medium (25 mL), and then cultured with shaking at 30 C. at 200 rpm for 20 hours. The seed culture medium (1 mL) was inoculated into a corner-baffled flask (250 mL) containing the below L-threonine production medium (24 mL), and then cultured with shaking at 30 C. at 200 rpm for 48 hours.

[0075] L-Threonine Production Medium (pH 7.2)

[0076] glucose 30 g, KH.sub.2PO.sub.4 2 g, urea 3 g, (NH.sub.4).sub.2SO.sub.4 40 g, peptone 2.5 g, CSL (Sigma) 5 g (10 mL), MgSO.sub.4 7H.sub.2O 0.5 g, leucine 400 mg, CaCO.sub.3 20 g (based on 1 L of distilled water)

[0077] After the culture, the amounts of the various amino acids produced using HPLC were measured. The concentrations of the culture media of the amino acids for the 22 strains, which are shown to have an excellent L-threonine-producing ability among the 155 strains experimented on, were shown in Table 1. The candidates for the 22 strains confirmed through the above procedure were named as KFCC10881-1 to KFCC10881-22.

TABLE-US-00001 TABLE 1 Experiments on L-Threonine Production of Excellent AHV-resistant Strains Thr + Hse + OD Thr Hse Gly Ala Ile Lys Gly + Ile KFCC10881 58.5 0.0 0.1 0.3 0.1 0.0 13.3 0.4 KFCC10881-1 60.1 2.0 1.5 2.8 1.6 2.7 5.7 7.7 KFCC10881-2 57.1 3.0 2.2 0.8 3.1 1.3 12.5 7.3 KFCC10881-3 47.3 2.8 2.3 0.8 3.4 1.4 10.5 7.3 KFCC10881-4 51.7 3.2 2.1 0.8 3.2 1.3 13.4 7.4 KFCC10881-5 58.4 3.1 2.2 0.8 3.3 1.3 12.4 7.4 KFCC10881-6 52.6 3.4 2.5 0.7 3.4 1.0 12.8 7.6 KFCC10881-7 14.2 0.4 0.2 0.3 0.2 0.6 11.1 1.5 KFCC10881-8 55.8 3.0 2.0 0.8 3.3 1.3 13.0 7.1 KFCC10881-9 44.3 3.2 2.8 0.6 3.1 0.9 12.6 7.5 KFCC10881-10 47.5 3.7 3.0 0.7 3.4 0.8 12.6 8.2 KFCC10881-11 57.0 2.7 1.8 0.7 3.4 1.2 11.6 6.4 KFCC10881-12 51.8 3.3 3.5 0.6 3.2 0.9 12.4 8.3 KFCC10881-13 49.8 3.0 2.3 0.7 3.4 1.3 12.8 7.3 KFCC10881-14 62.7 2.4 2.1 2.5 3.2 3.0 3.3 10.0 KFCC10881-15 62.4 2.9 2.7 0.7 3.2 1.1 12.3 7.4 KFCC10881-16 59.6 2.8 2.5 0.8 3.3 1.3 11.4 7.4 KFCC10881-17 24.1 0.1 0.2 0.2 1.6 0.2 10.4 0.7 KFCC10881-18 60.5 2.6 2.5 0.7 3.2 1.0 12.3 6.8 KFCC10881-19 60.0 3.0 1.9 2.8 2.7 3.0 5.4 9.3 KFCC10881-20 65.8 2.7 2.0 0.8 3.4 1.4 13.0 6.9 KFCC10881-21 17.3 0.3 0.3 0.3 0.2 0.6 11.1 1.5 KFCC10881-22 60.1 3.5 1.9 2.0 2.5 2.8 2.7 10.2

[0078] As shown in Table 1, the amounts of L-threonine, L-homoserine, L-glycine, L-alanine, and L-isoleucine, which are produced by the 22 types of strains having resistance to AHV, were increased compared to a control group, whereas the amount of L-lysine was decreased.

[0079] The biosynthetic pathways of L-threonine and L-lysine are separated from aspartate-semialdehyde (hereinafter referred to as ASA) as a starting point. That is, the amount of L-lysine produced is decreased as the amount of L-threonine produced is increased. Accordingly, the amounts of homoserine (Hse), L-glycine (Gly), and L-isoleucine (Ile), which can be by-products in the L-threonine biosynthetic pathway, may be increased as the amount of L-threonine produced is increased, and thus the total amount thereof produced (Thr+Hse+Gly+Ile) was also confirmed.

[0080] Therefore, among the AHV-resistant strains above, the 4 types of strains (KFCC10881-1, KFCC10881-14, KFCC10881-19, and KFCC10881-22), which have the reduced amount of L-lysine produced, the increased amount of L-threonine produced, and the increased total amount of Thr+Hse+Gly+Ile produced, were selected as the most excellent AHV-resistant strains.

EXAMPLE 3

Analysis of Nucleotide Sequences of Strains having Excellent Ability to Produce Threonine Derived from KFCC10881

[0081] In order to analyze the nucleotide sequences of the L-threonine biosynthesis enzymes of the strains selected in Example 1 above, the following experiment was conducted. Based on the gene information provided by the Kyoto Encyclopedia of Genes and Genomes (KEGG), each of the nucleotide sequence of hom (SEQ ID NO: 1, NCgl1136), which encodes homoserine dehydrogenase of Corynebacterium glutamicum ATCC13032, and the nucleotide sequence of thrB (SEQ ID NO: 2, Gene No. NCgl1137), which encodes homoserine kinase, was obtained. hom and thrB are known to consist of an operon structure (Peoples et al., Mol. Biol. 2(1):63-72, 1988).

[0082] In order to obtain the DNA fragment containing the hom-thrB operon of the selected strains, PCR was carried out using the genomic DNA of the strains as a template and a combination of primers of SEQ ID NO: 3 and SEQ ID NO: 4. PfuUltra high-fidelity DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction. PCR conditions were as follows: denaturation at 96 C. for 30 seconds; annealing at 52 C. for 30 seconds; and polymerization at 72 C. for 3 minutes, and a total of 30 cycles were repeated. As a result, it was possible to amplify a gene fragment (2778 bp; SEQ ID NO: 5), which includes the nucleotide sequence (300 bp) containing a promoter site upstream of the initiation codon of SEQ ID NO: 1 to include the 200 bp downstream of termination codon of SEQ ID NO: 2.

[0083] The nucleotide sequence was determined using the above prepared primer by an ABI PRISM 3730XL Analyzer (96 capillary type; Applied Biosystems). In the nucleotide sequence corresponding to hom among the hom-thrB operon in KFCC10881-1, cytosine, which is the nucleotide at position 854 of SEQ ID NO: 1, was mutated to thiamine, and thus the ACT codon encoding the threonine residue was mutated to the ATT codon encoding the isoleucine residue (hereinafter referred to as T285I modification; SEQ ID NO: 6). In addition, in the nucleotide sequence corresponding to the hom-thrB operon in KFCC10881-14, guanine, which is the nucleotide at position 1193 of SEQ ID NO: 1, was mutated to adenine, and thus the CGA codon encoding the arginine residue was mutated to the CAA codon encoding the glutamine residue (hereinafter referred to as R398Q modification; SEQ ID NO: 7). In addition, in the nucleotide sequence corresponding to the hom-thrB operon in KFCC10881-19, guanine, which is the nucleotide at position 1132 of SEQ ID NO: 1, was mutated to cytosine, and thus the GGG codon encoding the glycine residue was mutated to the TGG codon encoding the tryptophan residue (hereinafter referred to as G378W modification; SEQ ID NO: 8). In addition, in the nucleotide sequence corresponding to hom-thrB operon in KFCC10881-22, guanine, which is the nucleotide at position 1132 of SEQ ID NO: 1, was mutated to adenine, and guanine, which is the nucleotide at position 1134, was mutated to cytosine, and thus the GGG codon encoding the glycine residue was mutated to AGC codon encoding the serine residue (hereinafter referred to as G3785 modification; SEQ ID NO: 9). Meanwhile, no modification was discovered in thrB, corresponding to SEQ ID NO: 2.

[0084] In view of the nucleotide sequence analyses above, it was possible to consequently confirm that the feedback inhibition by L-threonine was desensitized as in the Hom (SEQ ID NO: 10) expressed in KFCC10881-1, threonine, which is the amino acid residue at position 285, was mutated to isoleucine (T2851 modification); in the Hom (SEQ ID NO: 11) expressed in KFCC10881-14, arginine, which is the amino acid residue at position 398, was mutated to glutamine (R398Q modification); in the Hom (SEQ ID NO: 12) expressed in KFCC10881-19, glycine, which is the amino acid residue at position 378, was mutated to tryptophan (G378W modification); and in the Hom (SEQ ID NO: 13) expressed in KFCC10881-22, glycine, which is the amino acid residue at position 378, was mutated to serine (G378S modification).

EXAMPLE 4

Preparation of Novel Strains to which Homoserine Dehydrogenase is Introduced

[0085] The primers of SEQ ID NO: 14 and SEQ ID NO: 15 were prepared in order to prepare strains in which the variants (T2851, R398Q, G378W, and G378S) identified in Example 2 were introduced to the wild-type strains.

[0086] In order to prepare strains to which each of the T2851, R398Q, G378W, and G378S hom modifications are introduced, PCR was carried out using the genomic DNA extracted from each of the KFCC10811-1, KFCC10811-14, KFCC10811-19, and KFCC10811-22 strains as a template and using primers of SEQ ID NO: 14 and SEQ ID NO: 15. PfuUltra high-fidelity DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction. PCR conditions were as follows: denaturation at 95 C. for 30 seconds; annealing at 55 C. for 30 seconds; and polymerization at 72 C. for 2 minutes, and a total of 28 cycles was repeated. As a result, a gene fragment (1668 bp) including a promoter site (about 300 bp) of the hom gene (1338 bp) was obtained. The amplified product was purified using a PCR Purification kit (QUIAGEN), and then used as an insert DNA fragment for the preparation of a vector. Meanwhile, after treating with a restriction enzyme smaI, the ratio of the molar concentration (M) of the pDZ vector heat-treated at 65 C. for 20 minutes to the insert DNA fragment amplified by the PCR above was set to be 1:2, and then these were cloned using an Infusion Cloning Kit (TaKaRa) according to its manual. Thereafter, the vectors, i.e., pDZ-T285I, pDZ-R398Q, pDZ-G378W, and pDZ-G378S, for introducing the T285I, R398Q, G378W, and G378S modifications on the chromosome were prepared.

[0087] Corynebacterium glutamicum ATCC13032 was transformed with each of the prepared vectors by electroporation. After the secondary crossover, strains substituted with each of the modified nucleotides on the chromosome were obtained. By using a combination of the primers listed below and using a MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)), the appropriateness of the substitution was primarily determined by selecting amplified strains in the combination of the primers corresponding to each of the modified sequences (CTR-T285I: SEQ ID NO: 16 and SEQ ID NO: 17; CTR-R398Q: SEQ ID NO: 16 and SEQ ID NO: 18; CTR-G378W: SEQ ID NO: 16 and SEQ ID NO: 19; and CTR-G378S: SEQ ID NO: 16 and SEQ ID NO: 20). In addition, analyses of the hom sequences of the selected strains were conducted to secondarily confirm the appropriateness of the substitution by using SEQ ID NO: 16 and SEQ ID NO: 21 and by analyzing the modified sequences in the same manner as in Example 2. The strains substituted with each of the modified nucleotides were named as CTR-T285I, CTR-R398Q, CTR-G378W, and CTR-G378S, respectively.

EXAMPLE 5

Measurement of Activity of Homoserine Dehydrogenase

[0088] The activity of the enzyme Hom was measured in the prepared strains. The wild-type strain ATCC13032 in a control group and CTR-T285I, CTR-R398Q, CTR-G378W, and CTR-G378S prepared in Example 4 were inoculated into 25 mL of the seed medium, and then cultured until reaching the late log phase. The cells were recovered by centrifugation, washed twice with a 0.1 M potassium phosphate buffer (pH 7.6), and finally suspended in 2 mL of the same buffer containing glycerol at a concentration of 30%. The cell suspension was physically disrupted by a conventional glass bead vortexing method for 10 minutes, and then the supernatant was recovered through two centrifugations (13,000 rpm, 4 C., 30 minutes) and used as a crude extract for measuring the activity of the enzyme Hom. For the measurement of the activity of Hom, a coenzyme solution (0.1 mL) was added to a reaction solution for measuring the enzyme activity (a potassium phosphate (pH 7.0) buffer, 25 mM NADPH, 5 mM aspartate semi-aldehyde), and then reacted at 30 C. The Hom activity U was defined as the number of NADPH mol consumed per minute according to the presence of L-threonine (0 mM, 10 mM), and the results of the enzyme activity are shown in Table 2 below.

TABLE-US-00002 TABLE 2 Measurement of Hom Activity (U) and Desensitization by L-threonine Enzyme activity (U) according to the amount of L-threonine added (mM) Strain 0 mM 10 mM ATCC13032 0.92 0.02 CTR-T285I 1.11 0.82 CTR-R398Q 1.31 1.12 CTR-G378W 1.39 1.21 CTR-G378S 1.38 1.22

[0089] As a result of the experiment, it was confirmed that in the Hom containing each of the T2851, R398Q, G378W, and G378S modifications, inhibition of the activity was reduced under the condition of containing 10 mM L-threonine, unlike the wild-type Hom, and thus desensitization to L-threonine occurred.

EXAMPLE 6

Preparation and Evaluation of Microorganism Strain of the Genus Corynebacterium having Productivity of L-Threonine

[0090] Strains producing L-threonine were developed from the wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to resolve the feedback inhibition of aspartate kinase (LysC), which is an important enzyme first acted upon in the threonine biosynthesis pathway, leucine, which is an amino acid at position 377 of LysC, was substituted with lysine (SEQ ID NO: 22).

[0091] More specifically, in order to prepare the strains in which the LysC (L377K) modification is introduced, PCR was carried out using the chromosome of ATCC13032 as a template and using primers of SEQ ID NOs: 23 and 24 or SEQ ID NOs: 25 and 26. PfuUltra high-fidelity DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction. PCR conditions were as follows: denaturation at 95 C. for 30 seconds; annealing at 55 C. for 30 seconds; and polymerization at 72 C. for 1 minute, and a total of 28 cycles were repeated. As a result, a DNA fragment (515 bp) in the 5 upstream region and a DNA fragment (538 bp) in the 3 downstream region were each obtained with the modification site of the lysC gene as the center. PCR was carried out with the two amplified DNA fragments as a template using primers of SEQ ID NO: 23 and SEQ ID NO: 26. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 28 cycles under the following conditions: denaturation at 95 C. for 30 seconds; annealing at 55 C. for 30 seconds; and polymerization at 72 C. for 2 minutes. Thereafter, the polymerization reaction was carried out at 72 C. for 5 minutes. As a result, the DNA fragment (1023 bp) including the modification of the lysC gene, which encodes an aspartokinase variant in which leucine at position 377 is substituted with lysine, was amplified. The amplified product was purified using a PCR Purification kit (QUIAGEN) and used as an insert DNA fragment for the preparation of a vector. Meanwhile, after treating with a restriction enzyme SmaI, the ratio of the molar concentration (M) of the pDZ vector heat-treated at 65 C. for 20 minutes to the insert DNA fragment amplified by the PCR above was set to be 1:2, and then these were cloned using an Infusion Cloning Kit (TaKaRa) according to its manual. Thereafter, the vector pDZ-L377K for introducing the L377K modification on the chromosome was prepared.

[0092] ATCC13032 was transformed with the prepared vector by electroporation. After the secondary crossover, a strain in which each of the nucleotide modifications is substituted with modified nucleotides was obtained, and the strain was named as CJP1.

[0093] In order to clearly confirm the L-threonine production change of the strain, each of the modifications identified in Example 4 was introduced into a gene encoding homoserine dehydrogenase. Specifically, in order to introduce each of the T285I, R398Q, G378W, and G378S modifications to the CTR-L377K strain, CJP1 was transformed with each of the pDZ-T285I, pDZ-R398Q, pDZ-G378W, and pDZ-G378S vectors prepared in Example 4 by electroporation, and then strains in which each of the nucleotide modifications is substituted with modified nucleotides on the chromosome were obtained by the secondary crossover as in the same manner as in Example 4. The strains substituted with each of the modified nucleotides were named as CJP1-T285I, CJP1-R398Q, CJP1-G378W, and CJP1-G378S.

[0094] The strains CJP1-T285I and CJP1-R398Q were deposited at the Korean Culture Center of Microorganisms (KCCM), which is an International Depository Authority under the Budapest Treaty, on Sep. 26, 2017, with Accession Nos. KCCM12119P and KCCM12120P, respectively.

TABLE-US-00003 TABLE 3 Confirmation of L-threonine-producing Ability of 4 Prepared Strains Amino acid (g/L) Strain Thr Lys CJP1 0.40 3.60 CJP1-T285I 1.10 3.00 CJP1-R398Q 1.21 2.75 CJP1-G378W 1.30 2.68 CJP1-G378S 1.25 2.78

[0095] As a result, in the stains in which each of the modifications is introduced, the amount of L-lysine produced was decreased and the amount of L-threonine produced was increased by 0.7 g/L to 0.9 g/L, as compared with the CJP1 strain.

[0096] Meanwhile, in order to obtain a strain simultaneously including the T285I and R398Q modifications, the CJP1-T285I strain was transformed with the pDZ-R398Q vector, and then the strain (CJP1-T285I, R398Q) was obtained in by the same method as described above. In addition, in order to obtain a strain simultaneously including the G378W and R398Q modifications, the CJP1-G378W strain was transformed with the pDZ-R398Q vector, and then the strain (CJP1-G378W, R398Q) was obtained by the same method as described above. In addition, in order to obtain strains simultaneously including the T285I and G378W modifications, the CJP1-T285I strain was transformed with the pDZ-G378W vector, and then the strain (CJP1-T285I, G378W) was obtained by the same method as described above. The test on the ability to produce L-threonine was conducted by the method described in Example 2, and the results thereof are shown in Table 4 below.

TABLE-US-00004 TABLE 4 Confirmation of L-threonine-producing Ability of 3 Prepared Strains Amino acid (g/L) Strain Thr Lys CJP1 0.41 3.55 CJP1-G378W 1.30 2.68 CJP1-T285I, R398Q 1.41 2.65 CJP1-G378W, R398Q 2.12 1.92 CJP1-T285I, G378W 1.92 2.15

[0097] As a result, the threonine-producing ability was confirmed to be higher when the two types of modifications of the present disclosure were introduced, compared with the CJP1-G378W strain showing the highest threonine-producing ability in the Examples. In the strains in which the two modifications are introduced, the amount of threonine produced was increased by 1.1 g/L to 1.7 g/L compared to the CJP1 strain, which is a control group, and therefore, it was confirmed that the desensitization effect of Hom was greatly improved.

EXAMPLE 7

Preparation and Evaluation of Microorganism Strain of the Genus Corynebacterium Producing L-Isoleucine

[0098] In order to produce strains producing isoleucine, a vector was prepared for enhancing the expression of the modified ilvA (V323A) gene (Appl. Enviro. Microbiol., Dec. 1996, p. 4345-4351), which encodes known L-threonine dehydratase (the first enzyme in the isoleucine biosynthesis pathway) in the strains prepared in Example 6.

[0099] Specifically, in order to prepare a vector for introducing a modification, which targets the ilvA gene, a pair of primers (SEQ ID NOs: 27 and 28) for amplifying the 5 upstream region and a pair of primers (SEQ ID NOs: 29 and 30) for amplifying the 3 downstream region were devised with the modification site as the center. BamHI restriction enzyme sites (underlined) were inserted at each terminus of the primers of SEQ ID NOs: 27 and 30, and the primers of SEQ ID NOs: 28 and 29 were designed such that a nucleotide-substituted modification (underlined) is positioned at a region where a cross-over is to be induced.

TABLE-US-00005 TABLE5 SEQIDNO: Nucleotidesequence 27 ACGGATCCCAGACTCCAAAGCAAAAGCG 28 ACACCACGgCAGAACCAGGTGCAAAGGACA 29 CTGGTTCTGcCGTGGTGTGCATCATCTCTG 30 ACGGATCCAACCAAACTTGCTCACACTC

[0100] PCR was carried out with the chromosome of the wild-type as a template using primers of SEQ ID NOs: 27, 28, 29, and 30. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 95 C. for 30 seconds; annealing at 55 C. for 30 seconds; and polymerization at 72 C. for 30 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (627 bp) in the 5 upstream region and a DNA fragment (608 bp) in the 3 downstream region were obtained with the modification site of the ilvA gene as the center.

[0101] PCR was carried out with the two amplified DNA fragments as a template using primers of SEQ ID NOs: 27 and 30. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 95 C. for 30 seconds; annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 60 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, the DNA fragment (1217 bp) was amplified, including the modification of the ilvA gene encoding the IlvA variant in which valine at position 323 is substituted with alanine. The vector pECCG117 (Korean Patent No. 10-0057684) and the DNA fragment (1011 bp) were treated with a restriction enzyme BamHI, ligated using DNA ligase, and then cloned to obtain a plasmid. The thus-obtained plasmid was named as pECCG117-ilvA(V323A).

[0102] The pECCG117-ilvA(V323A) vector was introduced to each of the CJP1-T285I,R398Q, CJP1-G378W,R398Q, and CJP1-T285I,G378W strains prepared in Example 6 by electroporation and smeared on a selective medium containing kanamycin (25 mg/L) to obtain transformed strains. The thus-obtained transformed strains were cultured by the same flask cultivation method of Example 2, and the concentrations of L-isoleucine in the culture media were analyzed. The results thereof are shown in Table 6.

TABLE-US-00006 TABLE6 EvaluationofPreparedStrains L-Isoleucine Strain (g/L) CJP1/pECCG117-ilvA(V323A) 0.7 CJP1-G378W/pECCG117-ilvA(V323A) 0.9 CJP1-T285I,R398Q/pECCG117- 1.1 ilvA(V323A) CJP1-G378W,R398Q/pECCG117- 1.2 ilvA(V323A) CJP1-T285I,G378W/pECCG117- 1.0 ilvA(V323A)

[0103] As a result, it was confirmed that in the strain including the hom(G378W) modification, concentration of L-isoleucine was improved by 0.2 g/L compared to the control strain. In addition, in the strain including the hom modification, in which two modifications had been simultaneously introduced, the ability to produce L-isoleucine was further improved by 0.3 g/L to 0.5 g/L compared to the control strain. Further, among the prepared strains, 1.1 g/L of L-isoleucine was produced in the CJP1-T285I,R398Q/pECCG117-ilvA(V323A) strain including both T285I and R398Q modifications.

EXAMPLE 8

Preparation and Evaluation of O-Acetyl-Homoserine (OAH)-Producing Strain Substituted with Modified Hom

[0104] 8-1. Preparation of ATCC13032 Strain Substituted with Modified Hom

[0105] The two types of modifications (T285I and R398Q) were introduced into the ATCC13032 strain in the same manner as in Example 7, and the thus-prepared strain was named as ATCC13032::Hom.sup.FBR.

[0106] 8-2. Deletion of metB Gene

[0107] In this example, the metB gene encoding cystathionine gamma-synthase in the O-acetyl-homoserine degradation pathway was obtained through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template. Based on GenBank of the National Institutes of Health (NIH GenBank), the information of the nucleotide sequence of the metB was obtained (NCBI Registration No. Ncgl2360; SEQ ID NO: 31). In addition, based on this, the primers (SEQ ID NOS: 32 and 33) containing the N-terminus and linker sequence of the metB gene and the primers (SEQ ID NOS: 34 and 35) containing the C-terminus and linker sequence of the metB gene were synthesized. PCR was carried out with the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template using the oligonucleotides of the nucleotide sequences of SEQ ID NOS: 32 and 33 and SEQ ID NOS: 34 and 35 as the primers. PfuUltra high-fidelity DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows: denaturation at 96 C. for 30 seconds; annealing at 53 C. for 30 seconds; and polymerization at 72 C. for 1 minute, and a total of 30 cycles were repeated. As a result, an amplified gene (500 bp) containing the N-terminus and linker of the metB gene and an amplified gene (500 bp) containing the C-terminus and linker of the metB gene were obtained.

[0108] PCR was carried out using the two thus-obtained amplified genes as a template for a total of 10 cycles under the following conditions: denaturation at 96 C. for 60 seconds; annealing at 50 C. for 60 seconds; and polymerization at 72 C. for 1 minute. Thereafter, the nucleotide sequences of SEQ ID NOS: 32 and 35 were added thereto, and then a total of 20 cycles were repeated. As a result, an amplified metB gene (1000 bp), which is a metB inactivation cassette containing the N-terminal-linker-C-terminal of the metB gene, was obtained. The metB gene obtained though the PCR was treated with restriction enzymes XbaI and SalI included at the termini, and then cloned into a pDZ(KR 0924065) vector, in which the restriction enzymes XbaI and SalI are treated, via ligation. Thereafter, a recombinant pDZ-metB vector in which the metB inactivation cassette is finally cloned was prepared.

[0109] The Corynebacterium glutamicum ATCC13032 and ATCC13032::Hom.sup.FBR were transformed with the thus-prepared pDZ-metB vector. After secondary crossover, Corynebacterium glutamicum ATCC13032 metB and ATCC13032::Hom.sup.FBR ImetB, in which the metB gene is inactivated on the chromosome, were obtained. The inactivated metB gene was finally confirmed by carrying out PCR using primers of SEQ ID NOS: 32 and 25, and then it was compared with ATCC13032 in which the metB gene is not inactivated.

[0110] 8-3. Deletion of metY Gene

[0111] In this Example, the metY gene encoding O-acetylhomoserine (thiol)-lyase in the O-acetyl-homoserine degradation pathway was obtained through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template. Based on GenBank of the National Institutes of Health (NIH GenBank), the information of the nucleotide sequence of the metY gene was obtained (NCBI Registration No. Ncgl0625; SEQ ID NO: 36). In addition, based on this, the primers (SEQ ID NOS: 37 and 38) containing the N-terminus and linker sequence of the metY gene and the primers (SEQ ID NOS: 39 and 40) containing the C-terminus and linker sequence of the metY gene were synthesized.

[0112] PCR was carried out with the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template using the oligonucleotides of the nucleotide sequences of SEQ ID NOS: 39 and 40 as the primers. PfuUltra high-fidelity DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows: denaturation at 96 C. for 30 seconds; annealing at 53 C. for 30 seconds; and polymerization at 72 C. for 1 minute, and a total of 30 cycles were repeated. As a result, an amplified gene (500 bp) containing the N-terminus and linker of the metY gene and an amplified gene (500 bp) containing the C-terminus and linker of the metY gene were obtained. PCR was carried out using the two thus-obtained amplified genes as a template for a total of 10 cycles under the following conditions: denaturation at 96 C. for 60 seconds; annealing at 50 C. for 60 seconds; and polymerization at 72 C. for 1 minute. Thereafter, the nucleotide sequences of SEQ ID NOS: 37 and 40 were added thereto, and then a total of 20 cycles were repeated. As a result, an amplified metY gene (1000 bp), which is a metB inactivation cassette containing the N-terminal-linker-C-terminal of the metY gene, was obtained.

[0113] The metY gene obtained through the PCR was treated with restriction enzymes XbaI and SalI included at the termini, and then cloned into a pDZ(KR2008-0025355) vector, in which the restriction enzymes XbaI and SalI are treated, via ligation. Thereafter, a recombinant pDZ-metY vector in which the metY inactivation cassette is finally cloned was prepared.

[0114] The Corynebacterium glutamicum ATCC13032, ATCC13032::Hom.sup.FBR, ATCC 13032 metB, and ATCC13032::Hom.sup.FBR metB strains were transformed with the thus-prepared pDZ-metY vector. After secondary crossover, Corynebacterium glutamicum ATCC13032 metY, ATCC13032::Hom.sup.FBR metY, ATCC13032 metB metY, and ATCC13032::Hom.sup.FBR metB metY, in which the metY gene is inactivated on the chromosome, were obtained. The inactivated metY gene was finally confirmed by carrying out PCR using primers of SEQ ID NOS: 37 and 40, and then it was compared with ATCC13032 in which the metY gene is not inactivated.

[0115] 8-4. Preparation and Evaluation of Strain Producing O-Acetyl-Homoserine

[0116] Comparison was made between the O-acetyl-homoserine-producing abilities of the ATCC13032, ATCC13032 metB, ATCC13032 metY, ATCC13032 metB metY, ATCC13032::Hom.sup.FBR, ATCC13032::Hom.sup.FBR metB, ATCC13032::Hom.sup.FBR metY, and ATCC13032::Hom.sup.FBR metB metY strains prepared in Examples 8-1 to 8-3, in which the metB, metY, metBY gene are deleted and the modified hom gene is substituted.

[0117] Specifically, single colonies were cultured in an LB solid medium overnight in a 32 C. incubator, and one loopful of each of the single colonies was inoculated on O-acetyl-homoserine titer media (25 mL), and then the resultants were cultured at 32 C. at 250 rpm for 42 to 64 hours. The O-acetyl-homoserine from each of the cultured products was analyzed by HPLC, and the results thereof are shown in Table 7 below.

[0118] L-O-Acetylhomoserine Production Medium (pH 7.2)

[0119] glucose 30 g, KH.sub.2PO.sub.4 2 g, urea 3 g, (NH.sub.4).sub.2SO.sub.4 40 g, peptone 2.5 g, CSL (Sigma) 5 g (10 mL), MgSO.sub.4.7H.sub.2O 0.5 g, methionine 400 mg, leucine 400 mg, CaCO.sub.3 20 g (based on 1 L of distilled water)

TABLE-US-00007 TABLE 7 Evaluation of O-Acetyl-Homoserine Production Strains O-AH production (g/L) ATCC13032 0.0 metB 0.3 metY 0.3 metBY 0.5 ATCC13032::Hom.sup.FBR 0.0 (T285I + R398Q) metB 1.2 metY 1.4 metBY 3.5

[0120] As a result, as shown in Table 7 above, O-acetyl homoserine was not accumulated when Corynebacterium glutamicum ATCC13032, a control strain, was cultured; whereas each of 0.3 g/L, 0.3 g/L, and 0.5 g/L of O-acetyl homoserine was accumulated in the ATCC13032 metB, ATCC13032 metY, and ATCC13032 metB metY strains, respectively, in which the metB, metY, and metBY genes are inactivated.

[0121] Additionally, in the case of the ATCC13032::Hom.sup.FBR strain in which the hom gene is substituted in a mutant form, and the ATCC13032::Hom.sup.FBR metB, ATCC13032::Hom.sup.FBR metY, and ATCC13032::Hom.sup.FBR metB metY strains in which the metB, metY, and metBY genes are inactivated, respectively, it was confirmed that O-acetyl homoserine was accumulated in an amount of 1.2 g/L, 1.4 g/L, and 3.5 g/L for each of these strains.

[0122] Therefore, from the results above, it was confirmed that the production amount of the target amino acid, which utilizes homoserine as a precursor by using the modified hom of the present disclosure, could be greatly increased.

EXAMPLE 9

Preparation and Evaluation of Strain Producing Methionine (Met)

EXAMPLE 9-1

Preparation of Recombinant Vector for Deletion of mcbR Gene

[0123] In this Example, in order to prepare strains producing methionine, a vector for inactivation of the mcbR gene (J. Biotechnol. 103:51-65, 2003), which encodes known methionine and cysteine transcription regulatory proteins in the strains prepared in Example 6, was prepared.

[0124] Specifically, a recombinant plasmid vector was prepared using the method below in order to knock out the mcbR gene on the chromosome of Corynebacterium ATCC13032. Based on nucleotide sequences reported in Genbank of the National Institutes of Health (NIH GenBank), the mcbR gene and its surrounding sequence (SEQ ID NO: 41) of Corynebacterium glutamicum were obtained.

[0125] For the purpose of obtaining the mcbR-deleted gene, PCR was carried out with the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template using primers of SEQ ID NOS: 42 and 43 and SEQ ID NOS: 44 and 45. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 95 C. for 30 seconds; annealing at 53 C. for 30 seconds; and polymerization at 72 C. for 30 seconds. As a result, DNA fragments (700 bp) were obtained.

[0126] A pDZ vector (Korean Patent No. 10-0924065), which cannot be cloned in Corynebacterium glutamicum, and the amplified mcbR gene fragments were treated with a restriction enzyme smaI for chromosomal introduction. Thereafter, they were ligated using DNA ligase, and then transformed with E. coli DH5, followed by smearing the same on an LB solid medium containing kanamycin (25 mg/L). Colonies transformed with the vector, in which deleted fragments of the target genes are inserted through PCR, were selected, and a plasmid was obtained using a plasmid extraction method. The thus-obtained plasmid was named as pDZ-mcbR.

EXAMPLE 9-2

Preparation and Evaluation of Microorganism Strain of Genus Corynebacterium Producing L-Methionine

[0127] Each of the CJP1-G378W, CJP1-T285I,R398Q, CJP1-G378W,R398Q, CJP1-T285I,G378W, and CJP1 strains, which had been prepared in Example 6 by homologous recombination on the chromosome, was transformed with the pDZ-mcbR vector prepared in Example 9 using electroporation (van der Rest et al., Appl. Microbiol. Biotechnol. 52:541-545, 1999). Thereafter, secondary recombination was carried out on a solid medium containing X-gal. Strains in which the mcbR gene is deleted were confirmed by a PCR method with the transformed Corynebacterium glutamicum strains, in which the secondary recombination had been completed, using primers of SEQ ID NOS: 46 and 47. These recombinant strains were named as Corynebacterium glutamicum CJP1-G378W/mcbR, CJP1-T285I,R398Q/mcbR, CJP1-G378W,R398Q/mcbR, CJP1-T285I,G378W/mcbR, and CJP1/mcbR, respectively.

[0128] In order to analyze the L-methionine-producing ability of the prepared CJP1-G378W/mcbR, CJP1-T285I,R398Q/mcbR, CJP1-G378W,R398Q/mcbR, and CJP1-T285I,G378W/mcbR strains, the strains were cultured together with their parent strain, Corynebacterium glutamicum CJP1/mcbR, in the following manner.

[0129] Corynebacterium glutamicum CJP1/mcbR and the inventive strains (Corynebacterium glutamicum CJP1-G378W/mcbR, CJP1-T2851,R398Q/mcbR, CJP1-G378W,R398Q/mcbR, and CJP1-T285I,G378W/mcbR) were inoculated into a corner-baffled flask (250 mL) containing the seed medium below (25 mL), and then cultured with shaking at 30 C. at 200 rpm for 20 hours. Thereafter, the seed culture medium (1 mL) was inoculated into a corner-baffled flask (250 mL) containing the production medium below (24 mL), and then cultured with shaking at 30 C. at 200 rpm for 48 hours. The compositions of the seed medium and production medium are as follows.

[0130] <Seed Medium (pH 7.0)>

[0131] glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH.sub.2PO.sub.4 4 g, K.sub.2HPO.sub.4 8 g, MgSO.sub.4.7H.sub.2O 0.5 g, biotin 100 g, thiamine HCl 1,000 g, calcium pantothenate 2,000 g, nicotinamide 2,000 g (based on 1 L of distilled water)

[0132] <Production Medium (pH 8.0)>

[0133] glucose 50 g, (NH.sub.4).sub.2S.sub.2O.sub.3 12 g, yeast extract 5 g, KH.sub.2PO.sub.4 1 g, MgSO.sub.4.7H.sub.2O 1.2 g, biotin 100 g, thiamine HCl 1,000 g, calcium pantothenate 2,000 g, nicotinamide 3000 g, CaCO.sub.3 30 g (based on 1 L of distilled water)

[0134] After cultivation using the cultivation method above, the concentration of L-methionine in each culture medium was analyzed, and the results are shown in Table 8.

TABLE-US-00008 TABLE 8 Evaluation of Prepared Strains Strain L-Methionine (g/L) CJP1/mcbR 0.01 CJP1-G378W/mcbR 0.13 CJP1-T285I, R398Q/mcbR 0.18 CJP1-G378W, R398Q/mcbR 0.20 CJP1-T285I, G378W/mcbR 0.17

[0135] As a result, it was confirmed that in the strain including the G378W hom modification, the L-methionine-producing ability was improved by 0.12 g/L compared to the control strain. Additionally, it was confirmed that in the strains including the hom modification, in which two modifications had been simultaneously introduced, the L-methionine-producing ability was improved by 0.16 g/L to 0.19 g/L compared to the control strain.

[0136] Based on the results above, it was confirmed that the amount of L-methionine produced could be greatly increased by using the modified hom of the present disclosure.

[0137] While the present disclosure has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present disclosure pertains that the present disclosure may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present disclosure. Therefore, the embodiments described above are considered to be illustrative in all respects and not restrictive. Furthermore, the scope of the present disclosure is defined by the appended claims rather than the detailed description, and it should be understood that all modifications or variations derived from the meanings and scope of the present disclosure and equivalents thereof are included in the scope of the appended claims.

[Accession Number]

[0138] Name of Depositary Agency: Korean Culture Center of Microorganisms (International Depositary Authority)

[0139] Deposition Number: KCCM12119P

[0140] Date of Deposition: Sep. 26, 2017

[0141] Name of Depositary Agency: Korean Culture Center of Microorganisms (International Depositary Authority)

[0142] Deposition Number: KCCM12120P

[0143] Date of Deposition: Sep. 26, 2017