MODRNA ENCODING SPHINGOLIPID-METABOLIZING PROTEINS
20210000975 ยท 2021-01-07
Inventors
- Efrat ELIYAHU (New York, NY, US)
- Lior Zangi (New York, NY, US)
- Adam VINCEK (New York, NY, US)
- Yoav Hadas (New York, NY, US)
Cpc classification
A61K31/7088
HUMAN NECESSITIES
A61K48/0016
HUMAN NECESSITIES
A61K48/0066
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
Abstract
The present disclosure pertains to the use of a modified RNA (modRNA) that encodes a sphingolipid-metabolizing protein such as acid ceramidase to achieve expression of the sphingolipid-metabolizing protein in a mammalian cell or group of cells. Expression of the protein from the (modRNA) reduces high levels of ceramide in the cell that lead to cell death or senescence.
Claims
1. A method to inhibit cell death and/or cell senescence and/or promote survival of a mammalian cell or group of mammalian cells, comprising contacting said cell or cells with a modified RNA (modRNA) that encodes a sphingolipid-metabolizing protein.
2. The method of claim 1, wherein said sphingolipid-metabolizing protein is selected from the group consisting of (1) a ceramidase; (2) a sphingosine kinase (SPHK); (3) sphingosine-1-phosphate receptor (SIPR) or a combination of (1), (2), and (3), a combination of (1) and (2), a combination of (1) and (3), or a combination of (2) and (3).
3. The method of claim 1, wherein said mammalian cell or group of mammalian cells are selected from the group consisting of primary cells, stems cells and gametes.
4. The method of claim 3, wherein said mammalian cell or group of mammalian cells is selected from the group consisting of cardiac cells, muscle cells, epithelial cells, endothelial cells, oocytes, sperm, and embryos.
5. A composition comprising (1) a modRNA that encodes a ceramidase; (2) a modRNA that encodes sphingosine kinase (SPHK); (3) a modRNA that encodes sphingosine-1-phosphate receptor (SIPR) or a combination of (1), (2), and (3), a combination of (1) and (2), a combination of (1) and (3), or a combination of (2) and (3) and a pharmaceutically acceptable carrier.
6. The method of claim 1, wherein the sphingolipid-metabolizing protein is a ceramidase.
7. The method of claim 6, wherein the ceramidase is an acid ceramidase.
8. The method of claim 7, wherein the acid ceramidase has the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7.
9. The method of claim 1, wherein the ceramidase is an alkaline ceramidase.
10. The method of claim 9, wherein the alkaline ceramidase has the nucleotide sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17.
11. The method of claim 1, wherein the ceramidase is a neutral ceramidase.
12. The method of claim 11, of claim 5, wherein the neutral ceramidase has the nucleotide sequence of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.
13. The method of claim 1, wherein the sphingolipid-metabolizing protein is sphingosine kinase (SPHK).
14. The method of claim 1, wherein the SPHK has the nucleotide sequence of SEQ ID NO: 2.
15. The method of claim 1, wherein said sphingolipid-metabolizing protein is S1PR2.
16. The method of claim 15, wherein the S1PR2 has the nucleotide sequence of SEQ ID NO: 3.
17. The method of claim 1, wherein said cells or group of cells are contacted with modRNA that encodes a ceramidase and modRNA that encodes sphingosine kinase (SPHK).
18. The method of claim 1, wherein said cells or group of cells are contacted with modRNA that encodes a ceramidase, modRNA that encodes sphingosine kinase (SPHK) and modRNA that encodes sphingosine-1-phosphate receptor (SIPR).
19. The method of claim 1, wherein said cells or group of cells are contacted with modRNA that encodes a ceramidase and modRNA that encodes sphingosine-1-phosphate receptor (SIPR).
20. The method of claim 17, wherein said ceramidase is acid ceramidase (AC).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION OF THE DISCLOSURE
[0042] All patents, published applications and other references cited herein are hereby incorporated by reference into the present application.
[0043] In the description that follows, certain conventions will be followed as regards the usage of terminology. In general, terms used herein are intended to be interpreted consistently with the meaning of those terms as they are known to those of skill in the art. Some definitions are provided purely for the convenience of the reader.
[0044] The term cell or group of cells is intended to encompass single cells as well as multiple cells either in suspension or in monolayers. Whole tissues also constitute a group of cells.
[0045] The term cell quality or quality of a cell refers to the level of cell viability, and cellular function of a cell as measured against a normal healthy cell of the same type with normal cell function and expected life span, the quality of cells that are programmed for survival but not for cell death. Embryo quality is the ability of an embryo to perform successfully in terms of conferring a high pregnancy rate and/or resulting in a healthy offspring and is assessed mainly by microscopic evaluation at certain time points following in vitro fertilization. Embryo profiling is the estimation of embryo quality by qualification and/or quantification of various parameters known to those of skill in the art including but not limited to number of pronuclei, cell number, cell regularity, degree of fragmentation. Estimations of embryo quality guides the choice in embryo selection in in vitro fertilization.
[0046] The term inhibit or inhibition when used in conjunction with senescence includes the ability of the sphingolipid-metabolizing proteins of the disclosure to reverse senescence, thereby returning to normal or near normal function.
[0047] The terms stress, stress-related events or cellular-stress refer to a wide range of molecular changes that cells undergo in response to environmental stressors, such as extreme temperatures, exposure to toxins, mechanical damage, anoxia, and noise.
[0048] The term robustness as it is used herein, refers to the quality or condition of being strong and in good condition.
[0049] Duration of expression can be tailored to the specific situation by choice of gene delivery method. The term short term expression, for example, refers to expression of the desired protein for a duration of several days rather than weeks. So, for example, the use of modRNA as a gene delivery method achieves transient expression of the selected sphingolipid-metabolizing protein for up to about 11 or 12 days. Quick, transient expression of short duration may be sufficient, for example, to extend survival and the quality of oocytes and embryos prior to IVF.
[0050] The term modRNA refers to a synthetic modified RNA that can be used for expression of a gene of interest. Chemical modifications made in the modRNA, for example substitution of pseudouridine for uridine, stabilize the molecule and enhance transcription. Additionally, unlike delivery of protein agents directly to a cell, which can activate the immune system, the delivery of modRNA can be achieved without immune impact. The use of modRNA for in vivo and in vitro expression is described in more detail in for example, WO 2012/138453.
Shingolipid-Metabolizing Proteins
[0051] In one embodiment, a modRNA composition useful for the method of the present disclosure may include either individually or in different combinations modRNAs encoding the following sphingolipid-metabolizing proteins: ceramidase (acid, neutral or alkaline), sphingosine kinase (SPHK), and sphingosine-1-phosphate receptor (S1PR). In one embodiment, the sphingolipid-metabolizing protein is a ceramidase.
[0052] Ceramidase is an enzyme that cleaves fatty acids from ceramide, producing sphingosine (SPH), which in turn is phosphorylated by a sphingosine kinase to form sphingosine-1-phosphate (S1P). Ceramidase is the only enzyme that can regulate ceramide hydrolysis to prevent cell death and SHPK is the only enzyme that can synthesize sphingosine 1 phosphate (S1P) from sphingosine (the ceramide hydrolysis product) to initiate cell survival. S1PR, a G protein-coupled receptor binds the lipid-signaling molecule S1P to induce cell proliferation, survival, and transcriptional activation.
[0053] Presently, 7 human ceramidases encoded by 7 distinct genes have been cloned: [0054] acid ceramidase (ASAH1)associated with cell survival; [0055] neutral ceramidase (ASAH2, ASAH2B, ASAH2C)protective against inflammatory cytokines; [0056] alkaline ceramidase 1 (ACER1)mediating cell differentiation by controlling the generation of SPH and S1P; [0057] alkaline ceramidase 2 (ACER2)important for cell proliferation and survival; and [0058] alkaline ceramidase 3 (ACER3).
The nucleotide sequences for the coding sequences are shown below in Table 1.
[0059] The discovery by Kariko et al. (Incorporation of Pseudouridine Into mRNA Yields Superior Nonimunogenic Vector With Increased Translational Capacity and Biological Stability. Mol Ther. 2008; 16 (11): 1833-1840, incorporated herein by reference) that the substitution of uridine and cytidine with pseudouridine and 5-methylcytidine, respectively, drastically reduced the immune response elicited from exogenous RNA set the stage for a new kind of gene delivery, in which transient expression of therapeutic proteins is achieved.
[0060] Modified mRNA (modRNA) is a relatively new gene delivery system, which can be used in vitro or in vivo to achieve transient expression of therapeutic proteins in a heterogeneous population of cells. Incorporation of specific modified nucleosides enables modRNA to be translated efficiently without triggering antiviral and innate immune responses. In the present disclosure, modRNA is shown to be effective at delivering short-term robust gene expression of a survival gene and its use in the field of gene therapy is expanding. A stepwise protocol for the synthesis of modRNA for delivery of therapeutic proteins is disclosed in, for example, Kondrat et al. Synthesis of Modified mRNA for Myocardial Delivery. Cardiac Gene Therapy, pp. 127-138 2016, the contents of which are hereby incorporated by reference into the present disclosure.
[0061] The use of modRNA, a relatively nascent technology, has considerable potential as a therapy for disease. Delivery of a synthetic modified RNA encoding human vascular endothelial growth factor-A, for example, results in expansion and directed differentiation of endogenous heart progenitors in a mouse myocardial infarction model (Zangi et al. Modified mRNA directs the fate of heart progenitor cells and induces vascular regeneration after myocardial infarction. Nature Biotechnology 31, 898-907 (2013)). In another example, diabetic neuropathy may be lessened by the ability to deliver genes encoding nerve growth factor. Additionally, with the advent of genome editing technology, CRISPR/Cas9 or transcription activator-like effector nuclease (TALEN), transfection will be safer if delivered in a transient and cell-specific manner.
[0062] In one embodiment of the present method, the gene delivery molecule that encodes a sphingolipid-metabolizing protein is modRNA. While various gene delivery methods exist for achieving expression of an exogenous protein, for example, using plasm ids, viruses or mRNA, in certain situations modRNA offers several advantages as a gene delivery tool.
[0063] An advantage of gene delivery over protein is the ability to achieve endogenous expression of protein for a specific period of time and therefore extended exposure to the sphingo-lipid metabolizing enzyme.
[0064] One advantage of modRNA delivery is the lack of a requirement for nuclear localization or transcription prior to translation of the gene of interest. Eliminating the need for transcription of an mRNA prior to translation of the protein of interest results in higher efficiency in expression of the protein of interest.
[0065] Kariko et al. showed in 2008 that uridine replacement in mRNA with pseudouridine (hence the name modified mRNA (modRNA)) resulted in changes to the mRNA secondary structure that avoid the innate immune system and reduce the recognition of modRNA by RNase. In addition, these changes of nucleotides are naturally occurring in our body and lead to enhance translation of the modRNA compared to unmodified mRNA.
[0066] The present invention is based on the observation that administration of a modRNA survival cocktail comprising modRNAs that encode one or more sphingolipid-metabolizing proteins decreased the rate of apoptosis in vitro and in vivo in different cell types, tissue and embryos (
[0067] modRNA is a synthetic mRNA with an optimized 5UTR and 3UTR sequences, anti-reverse cup analog (ARCA) and one or more naturally modified nucleotides. The optimized UTRs sequences enhance the translation efficiency. ARCA increases the stability of the RNA and enhances the translation efficiency and the naturally modified nucleotides increase the stability of the RNA reduce the innate immune response of cells (in vitro and in vivo) and enhance the translation efficiency of the mRNA. This combination generates a superior mRNA that mediate a higher and longer expression of proteins with a minimal immune respond. Modified mRNA is a safe, local, transient, and with high expression gene delivery method to the heart. Kariko et al. have shown in 2008 that uridine replacement in mRNA with pseudouridine (hence the name modified mRNA (modRNA)) resulted in changes to the mRNA secondary structure that avoid the innate immune system and reduce the recognition of modRNA by RNase. In addition, these changes of nucleotides are naturally occurring in our body and lead to enhance translation of the modRNA compared to unmodified mRNA.
[0068] Since the modRNAs encode physiological enzymes, the expression of ceramidase should have little or no toxic effects. In addition, transfecting cells with ceramidase modRNA will increase the precursor (inactive form) of the enzyme that will allow autonomous control of the active ceramidase protein, which is required for survival. Furthermore, control of ceramide metabolism is the only known biological function of ceramidase; manipulation of ceramidase should not influence other cellular signaling. In addition, creation of a mouse model that continually overexpresses the AC enzyme (COEAC) in all tissues demonstrates a lack of toxicity or tumorigenesis effect by overexpression of AC.
[0069] Thirdly, messenger RNA modifications allow modRNA to avoid detection by the innate immune system and RNase. Based on that observation, modRNA can be used as a safe and effective tool for short-term gene delivery. Pharmacokinetics analyses of modRNA indicate a pulse-like expression of protein up to 7 days.
Effect of Sphingolipid-Metabolizing Proteins on Cardiomyocytes
[0070] The effect of these genes on the viability of neonatal rat cardiomyocytes (nrCM) under anoxic conditions was examined. Synthetic modRNAs that encode human AC, Sphk1 and S1PR2 were used. The expression kinetics of proteins encoded by modRNA and its reduced immunogenicity (Sultana 2017) make modRNA an ideal vector to study the role of gene expression in acute conditions such as myocardial infarction. First, the effect of modRNA transfection on the expression levels of the target proteins in Hek293 cells (
[0071] When the cells were transfected with a combination of genes an additive effect was observed. Overexpression of AC and Sphk1 reduced the number of apoptotic cells by 48% and overexpression of AC and S1PR2 together reduced apoptosis by 33%. Surprisingly, combining Sphk1 with S1PR2 or combining AC, Sphk1 and S1PR2 did not reduce the levels of apoptosis (
[0072] To study the effect of AC, Sphk1, and S1PR2 on cell death in LV after myocardial infarction, hearts were infarcted by ligation of the left anterior descending artery. Immediately after the LAD was ligated, 100 g modRNA encoding to a control gene or gene of interest were injected to the myocardium of the left ventricle. After 48 h the hearts were harvests and the levels of DNA fragmentation was measured. Strikingly, overexpression of AC in the left ventricle immediately after LAD ligation reduced the number of cells with fragmented DNA in the left ventricle by 54% compare to hearts that were treated with Luc modRNA. Overexpression of Sphk1 reduced DNA fragmentation by 29% and S1PR2 did not prevent the fragmentation of DNA in the LV 48 h post-MI (
[0073] The beneficial effects of AC and Sphk1 and the additive effect of the combined expression of these two genes prompted us to study their effect on heart remodeling and function post MI. To this aim, we injected AC, Sphk1, AC+Sphk1 or Luc directly to the LV and compare the Left ventricular internal dimension-diastole (LVIDd), Left ventricular internal dimension-systole (LVIDs) and fractioning shortening % (% FS) at different time point post MI. At the end of the experiment (29 days post MI) the hearts were harvested and immunostained with WGA and CD31 to assess the average area of cardiomyocytes and the number of vessels in the LV. To measure the scar size, Masson's trichrome stain was performed on heart sections. Two days post-MI, there was no significant difference between the groups in all measured parameters (
[0074] In accordance with the beneficial effect that AC and Sphk1 have on heart function a significant reduction in the scar size 29 days post MI was found. In mice treated with AC, Sphk1 or AC +Sphk1 the scar areas were 14.2%, 16.7% and 16.1% of LV area compared to 23.3% in control mice (
[0075] Overall, these data identify AC as an important component of the in vivo/in vitro oocyte and embryo environment, and provide a novel technology for enhancing the outcome of assisted fertilization.
[0076] Table 1 contains the nucleotide sequences to be encoded by the modRNAs of the present method.
TABLE-US-00001 TABLE1 Gene OpenReadingFrame ASAH1 ATGCCGGGCCGGAGTTGCGTCGCCTTAGTCCTCCTGGCTGCCGCCGTCAGCTGTGCCGTCGCGCA transcript GCACGCGCCGCCGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACA variant1 GAGGTGCAGTTCCATGGTACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGAATTG (ACv1) ATGCTTGACAAGGCACCAGTGCTAAAGGTTATAGTGAATTCTCTGAAGAATATGATAAATACATT CGTGCCAAGTGGAAAAATTATGCAGGTGGTGGATGAAAAATTGCCTGGCCTACTTGGCAACTTTC CTGGCCCTTTTGAAGAGGAAATGAAGGGTATTGCCGCTGTTACTGATATACCTTTAGGAGAGATT ATTTCATTCAATATTTTTTATGAATTATTTACCATTTGTACTTCAATAGTAGCAGAAGACAAAAA AGGTCATCTAATACATGGGAGAAACATGGATTTTGGAGTATTTCTTGGGTGGAACATAAATAATG ATACCTGGGTCATAACTGAGCAACTAAAACCTTTAACAGTGAATTTGGATTTCCAAAGAAACAAC AAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTATGTGGGCATGTTAACAGGATTCAAACCAGG ACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAAT GGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGC ACAAGTTATGAAGAAGCCAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTAT CCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATG TATATGAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAA CATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGA GAATATCTCATTTGAAACCATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCG TATACACAACCTTGATAGATGTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGAC CCTTGTATAGGTTGGTGA(SEQIDNO:1) Sphk1 ATGGATCCAGTGGTCGGTTGCGGACGTGGCCTCTTTGGTTTTGTTTTCTCAGCGGGCGGCCCCCG GGGCGTGCTCCCGCGGCCCTGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGG CCTTGCAGCTCTTCCGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTG ATGCTCACTGAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGA CGCTCTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGGC CTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAACGCGCTG GCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTCCTGACCAACTG CACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCTCTGCACACGGCTTCGG GGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATTGCTGATGTGGACCTAGAGAGT GAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTGGGCACCTTCCTGCGTCTGGCAGCCCT GCGCACCTACCGCGGCCGACTGGCCTACCTCCCTGTAGGAAGAGTGGGTTCCAAGACACCTGCCT CCCCCGTTGTGGTCCAGCAGGGCCCGGTAGATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCC TCTCACTGGACAGTGGTGCCCGACGAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCT GGGCAGTGAGATGTTTGCTGCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACG TGCGGGCGGGAGTGTCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCAT ATGGAGTATGAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGA TGGGAAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTGC ACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCCCAGCAG ATGCCACCGCCAGAAGAGCCCTTATGA(SEQIDNO:2) S1PR2 ATGGGCAGCTTGTACTCGGAGTACCTGAACCCCAACAAGGTCCAGGAACACTATAATTATACCAA GGAGACGCTGGAAACGCAGGAGACGACCTCCCGCCAGGTGGCCTCGGCCTTCATCGTCATCCTCT GTTGCGCCATTGTGGTGGAAAACCTTCTGGTGCTCATTGCGGTGGCCCGAAACAGCAAGTTCCAC TCGGCAATGTACCTGTTTCTGGGCAACCTGGCCGCCTCCGATCTACTGGCAGGCGTGGCCTTCGT AGCCAATACCTTGCTCTCTGGCTCTGTCACGCTGAGGCTGACGCCTGTGCAGTGGTTTGCCCGGG AGGGCTCTGCCTTCATCACGCTCTCGGCCTCTGTCTTCAGCCTCCTGGCCATCGCCATTGAGCGC CACGTGGCCATTGCCAAGGTCAAGCTGTATGGCAGCGACAAGAGCTGCCGCATGCTTCTGCTCAT CGGGGCCTCGTGGCTCATCTCGCTGGTCCTCGGTGGCCTGCCCATCCTTGGCTGGAACTGCCTGG GCCACCTCGAGGCCTGCTCCACTGTCCTGCCTCTCTACGCCAAGCATTATGTGCTGTGCGTGGTG ACCATCTTCTCCATCATCCTGTTGGCCATCGTGGCCCTGTACGTGCGCATCTACTGCGTGGTCCG CTCAAGCCACGCTGACATGGCCGCCCCGCAGACGCTAGCCCTGCTCAAGACGGTCACCATCGTGC TAGGCGTCTTTATCGTCTGCTGGCTGCCCGCCTTCAGCATCCTCCTTCTGGACTATGCCTGTCCC GTCCACTCCTGCCCGATCCTCTACAAAGCCCACTACTTTTTCGCCGTCTCCACCCTGAATTCCCT GCTCAACCCCGTCATCTACACGTGGCGCAGCCGGGACCTGCGGCGGGAGGTGCTTCGGCCGCTGC AGTGCTGGAGGCCGGGGGTGGGGGTGCAAGGACGGAGGCGGGGCGGGACCCCGGGCCACCACCTC CTGCCACTCCGCAGCTCCAGCTCCCTGGAGAGGGGCATGCACATGCCCACGTCACCCACGTTTCT GGAGGGCAACACGGTGGTCATG(SEQIDNO:3) Firefly ATGGCCGATGCTAAGAACATTAAGAAGGGCCCTGCTCCCTTCTACCCTCTGGAGGATGGCACCGC luciferase TGGCGAGCAGCTGCACAAGGCCATGAAGAGGTATGCCCTGGTGCCTGGCACCATTGCCTTCACCG ATGCCCACATTGAGGTGGACATCACCTATGCCGAGTACTTCGAGATGTCTGTGCGCCTGGCCGAG GCCATGAAGAGGTACGGCCTGAACACCAACCACCGCATCGTGGTGTGCTCTGAGAACTCTCTGCA GTTCTTCATGCCAGTGCTGGGCGCCCTGTTCATCGGAGTGGCCGTGGCCCCTGCTAACGACATTT ACAACGAGCGCGAGCTGCTGAACAGCATGGGCATTTCTCAGCCTACCGTGGTGTTCGTGTCTAAG AAGGGCCTGCAGAAGATCCTGAACGTGCAGAAGAAGCTGCCTATCATCCAGAAGATCATCATCAT GGACTCTAAGACCGACTACCAGGGCTTCCAGAGCATGTACACATTCGTGACATCTCATCTGCCTC CTGGCTTCAACGAGTACGACTTCGTGCCAGAGTCTTTCGACAGGGACAAAACCATTGCCCTGATC ATGAACAGCTCTGGGTCTACCGGCCTGCCTAAGGGCGTGGCCCTGCCTCATCGCACCGCCTGTGT GCGCTTCTCTCACGCCCGCGACCCTATTTTCGGCAACCAGATCATCCCCGACACCGCTATTCTGA GCGTGGTGCCATTCCACCACGGCTTCGGCATGTTCACCACCCTGGGCTACCTGATTTGCGGCTTT CGGGTGGTGCTGATGTACCGCTTCGAGGAGGAGCTGTTCCTGCGCAGCCTGCAAGACTACAAAAT TCAGTCTGCCCTGCTGGTGCCAACCCTGTTCAGCTTCTTCGCTAAGAGCACCCTGATCGACAAGT ACGACCTGTCTAACCTGCACGAGATTGCCTCTGGCGGCGCCCCACTGTCTAAGGAGGTGGGCGAA GCCGTGGCCAAGCGCTTTCATCTGCCAGGCATCCGCCAGGGCTACGGCCTGACCGAGACAACCAG CGCCATTCTGATTACCCCAGAGGGCGACGACAAGCCTGGCGCCGTGGGCAAGGTGGTGCCATTCT TCGAGGCCAAGGTGGTGGACCTGGACACCGGCAAGACCCTGGGAGTGAACCAGCGCGGCGAGCTG TGTGTGCGCGGCCCTATGATTATGTCCGGCTACGTGAATAACCCTGAGGCCACAAACGCCCTGAT CGACAAGGACGGCTGGCTGCACTCTGGCGACATTGCCTACTGGGACGAGGACGAGCACTTCTTCA TCGTGGACCGCCTGAAGTCTCTGATCAAGTACAAGGGCTACCAGGTGGCCCCAGCCGAGCTGGAG TCTATCCTGCTGCAGCACCCTAACATTTTCGACGCCGGAGTGGCCGGCCTGCCCGACGACGATGC CGGCGAGCTGCCTGCCGCCGTCGTCGTGCTGGAACACGGCAAGACCATGACCGAGAAGGAGATCG TGGACTATGTGGCCAGCCAGGTGACAACCGCCAAGAAGCTGCGCGGCGGAGTGGTGTTCGTGGAC GAGGTGCCCAAGGGCCTGACCGGCAAGCTGGACGCCCGCAAGATCCGCGAGATCCTGATCAAGGC TAAGAAAGGCGGCAAGATCGCCGTGTAA(SEQIDNO:4) nGFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGA CGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGA CCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTG ACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTC CGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGA CCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGAC TTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA TATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGG ACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTG CTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGA TCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACA AGGGAGATCCAAAAAAGAAGAGAAAGGTAGGCGATCCAAAAAAGAAGAGAAAGGTAGGTGATCCA AAAAAGAAGAGAAAGGTATAA(SEQIDNO:5) ASAH2 ATGAACTGCTGCATCGGGCTGGGAGAGAAAGCTCGCGGGTCCCACCGGGCCTCCTACCCAAGTCT transcript CAGCGCGCTTTTCACCGAGGCCTCAATTCTGGGATTTGGCAGCTTTGCTGTGAAAGCCCAATGGA variant2 CAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGG (ACv2) TACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGAATTGATGCTTGACAAGGCACC AGTGCTAAAGGTTATAGTGAATTCTCTGAAGAATATGATAAATACATTCGTGCCAAGTGGAAAAA TTATGCAGGTGGTGGATGAAAAATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTTTGAAGAG GAAATGAAGGGTATTGCCGCTGTTACTGATATACCTTTAGGAGAGATTATTTCATTCAATATTTT TTATGAATTATTTACCATTTGTACTTCAATAGTAGCAGAAGACAAAAAAGGTCATCTAATACATG GGAGAAACATGGATTTTGGAGTATTTCTTGGGTGGAACATAAATAATGATACCTGGGTCATAACT GAGCAACTAAAACCTTTAACAGTGAATTTGGATTTCCAAAGAAACAACAAAACTGTCTTCAAGGC TTCAAGCTTTGCTGGCTATGTGGGCATGTTAACAGGATTCAAACCAGGACTGTTCAGTCTTACAC TGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAATGGATTCTGGGAAAGAAA GATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGCACAAGTTATGAAGAAGC CAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATCCTGGGAGGCAACCAGT CTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGAACTCGATGCT AAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGA TGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAA CCATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATA GATGTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTG A(SEQIDNO:6) ASAH1 ATGAACTGCTGCATCGGGCTGGGAGAGAAAGCTCGCGGGTCCCACCGGGCCTCCTACCCAAGTCT transcript CAGCGCGCTTTTCACCGAGGCCTCAATTCTGGGATTTGGCAGCTTTGCTGTGAAAGCCCAATGGA variant3 CAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACTGTCTTCCCTGCTGTTATAAGG TACAGAGGTGCAGTTCCATGGTACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGA ATTGATGCTTGACAAGGCACCAGTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTTTGAAGAGG AAATGAAGGGTATTGCCGCTGTTACTGATATACCTTTAGGAGAGATTATTTCATTCAATATTTTT TATGAATTATTTACCATTTGTACTTCAATAGTAGCAGAAGACAAAAAAGGTCATCTAATACATGG GAGAAACATGGATTTTGGAGTATTTCTTGGGTGGAACATAAATAATGATACCTGGGTCATAACTG AGCAACTAAAACCTTTAACAGTGAATTTGGATTTCCAAAGAAACAACAAAACTGTCTTCAAGGCT TCAAGCTTTGCTGGCTATGTGGGCATGTTAACAGGATTCAAACCAGGACTGTTCAGTCTTACACT GAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAATGGATTCTGGGAAAGAAAG ATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGCACAAGTTATGAAGAAGCC AAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATCCTGGGAGGCAACCAGTC TGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGAACTCGATGCTA AGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGAT GATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAAC CATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATAG ATGTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGA (SEQIDNO:7) ASAH2 GCCAAACGCACCTTCTCTAACTTGGAGACATTCCTGATTTTCCTCCTTGTAATGATGAGTGC transcript CATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATT variant1 TAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCTGCCCAA CGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGAGCTCCACAGCCACTCAAACTTCTCCAGT GCCTTTAACCCCAGAGTCTCCTCTATTTCAGAACTTCAGTGGCTACCATATTGGTGTTGGACGAG CTGACTGCACAGGACAAGTAGCAGATATCAATTTGATGGGCTATGGCAAATCCGGCCAGAATGCA CAGGGCATCCTCACCAGGCTATACAGTCGTGCCTTCATCATGGCAGAACCTGATGGGTCCAATCG AACAGTGTTTGTCAGCATCGACATAGGCATGGTATCACAAAGGCTCAGGCTGGAGGTCCTGAACA GACTGCAGAGTAAATATGGCTCCCTGTACAGAAGAGATAATGTCATCCTGAGTGGCACTCACACT CATTCAGGTCCTGCAGGATATTTCCAGTATACCGTGTTTGTAATTGCCAGTGAAGGATTTAGCAA TCAAACTTTTCAGCACATGGTCACTGGTATCTTGAAGAGCATTGACATAGCACACACAAATATGA AACCAGGCAAAATCTTCATCAATAAAGGAAATGTGGATGGTGTGCAGATCAACAGAAGTCCGTAT TCTTACCTTCAAAATCCGCAGTCAGAGAGAGCAAGGTATTCTTCAAATACAGACAAGGAAATGAT AGTTTTGAAAATGGTAGATTTGAATGGAGATGACTTGGGCCTTATCAGCTGGTTTGCCATCCACC CGGTCAGCATGAACAACAGTAACCATCTTGTAAACAGTGACAATGTGGGCTATGCATCTTACCTG CTTGAGCAAGAGAAGAACAAAGGATATCTACCTGGACAGGGGCCATTTGTAGCAGCCTTTGCTTC ATCAAACCTAGGAGATGTGTCCCCCAACATTCTTGGACCACGTTGCATCAACACAGGAGAGTCCT GTGATAACGCCAATAGCACTTGTCCCATTGGTGGGCCTAGCATGTGCATTGCTAAGGGACCTGGA CAGGATATGTTTGACAGCACACAAATTATAGGACGGGCCATGTATCAGAGAGCAAAGGAACTCTA TGCCTCTGCCTCCCAGGAGGTAACAGGACCACTGGCTTCAGCACACCAGTGGGTGGATATGACAG ATGTGACTGTCTGGCTCAATTCCACACATGCATCAAAAACATGTAAACCAGCATTGGGCTACAGT TTTGCAGCTGGCACTATTGATGGAGTTGGAGGCCTCAATTTTACACAGGGGAAAACAGAAGGGGA TCCATTTTGGGACACCATTCGGGACCAGATCCTGGGAAAGCCATCTGAAGAAATTAAAGAATGTC ATAAACCAAAGCCCATCCTTCTTCACACCGGAGAACTATCAAAACCTCACCCCTGGCATCCAGAC ATTGTTGATGTTCAGATTATTACCCTTGGGTCCTTGGCCATAACTGCCATCCCCGGGGAGTTTAC GACCATGTCTGGACGAAGACTTCGAGAGGCAGTTCAAGCAGAATTTGCATCTCATGGGATGCAGA ACATGACTGTTGTTATTTCAGGTCTATGCAACGTCTATACACATTACATTACCACTTATGAAGAA TACCAGGCTCAGCGATATGAGGCAGCATCGACAATTTATGGACCGCACACATTATCTGCTTACAT TCAGCTCTTCAGAAACCTTGCTAAGGCTATTGCTACGGACACGGTAGCCAACCTGAGCAGAGGTC CAGAACCTCCCTTTTTCAAACAATTAATAGTTCCATTAATTCCTAGTATTGTGGATAGAGCACCA AAAGGCAGAACTTTCGGGGATGTCCTGCAGCCAGCAAAACCTGAATACAGAGTGGGGGAAGTTGC TGAAGTTATATTTGTAGGTGCTAACCCGAAGAATTCAGTACAAAACCAGACCCATCAGACCTTCC TCACTGTGGAGAAATATGAGGCTACTTCAACATCGTGGCAGATAGTGTGTAATGATGCCTCCTGG GAGACTCGTTTTTATTGGCACAAGGGACTCCTGGGTCTGAGTAATGCAACAGTGGAATGGCATAT TCCAGACACTGCCCAGCCTGGAATCTACAGAATAAGATATTTTGGACACAATCGGAAGCAGGACA TTCTGAAGCCTGCTGTCATACTTTCATTTGAAGGCACTTCCCCGGCTTTTGAAGTTGTAACTATT TAG
(SEQIDNO:8) ASAH2
GCCAAACGCACCTTCTCTAACTTGGAGACATTCCTGATTTTCCTCCTTGTAATGATGAGTGC transcript CATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATT variant2 TAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCTGCCCAA CGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGAGCTCCACAGCCACTCAAACTTCTCCAGT GCCTTTAACCCCAGAGTCTCCTCTATTTCAGAACTTCAGTGGCTACCATATTGGTGTTGGACGAG CTGACTGCACAGGACAAGTAGCAGATATCAATTTGATGGGCTATGGCAAATCCGGCCAGAATGCA CAGGGCATCCTCACCAGGCTATACAGTCGTGCCTTCATCATGGCAGAACCTGATGGGTCCAATCG AACAGTGTTTGTCAGCATCGACATAGGCATGGTATCACAAAGGCTCAGGCTGGAGGTCCTGAACA GACTGCAGAGTAAATATGGCTCCCTGTACAGAAGAGATAATGTCATCCTGAGTGGCACTCACACT CATTCAGGTCCTGCAGGATATTTCCAGTATACCGTGTTTGTAATTGCCAGTGAAGGATTTAGCAA TCAAACTTTTCAGCACATGGTCACTGGTATCTTGAAGAGCATTGACATAGCACACACAAATATGA AACCAGGCAAAATCTTCATCAATAAAGGAAATGTGGATGGTGTGCAGATCAACAGAAGTCCGTAT TCTTACCTTCAAAATCCGCAGTCAGAGAGAGCAAGGTATTCTTCAAATACAGACAAGGAAATGAT AGTTTTGAAAATGGTAGATTTGAATGGAGATGACTTGGGCCTTATCAGCTGGTTTGCCATCCACC CGGTCAGCATGAACAACAGTAACCATCTTGTAAACAGTGACAATGTGGGCTATGCATCTTACCTG CTTGAGCAAGAGAAGAACAAAGGATATCTACCTGGACAGGGGCCATTTGTAGCAGCCTTTGCTTC ATCAAACCTAGGAGATGTGTCCCCCAACATTCTTGGACCACGTTGCATCAACACAGGAGAGTCCT GTGATAACGCCAATAGCACTTGTCCCATTGGTGGGCCTAGCATGTGCATTGCTAAGGGACCTGGA CAGGATATGTTTGACAGCACACAAATTATAGGACGGGCCATGTATCAGAGAGCAAAGTCAAAAAC ATGTAAACCAGCATTGGGCTACAGTTTTGCAGCTGGCACTATTGATGGAGTTGGAGGCCTCAATT TTACACAGGGGAAAACAGAAGGGGATCCATTTTGGGACACCATTCGGGACCAGATCCTGGGAAAG CCATCTGAAGAAATTAAAGAATGTCATAAACCAAAGCCCATCCTTCTTCACACCGGAGAACTATC AAAACCTCACCCCTGGCATCCAGACATTGTTGATGTTCAGATTATTACCCTTGGGTCCTTGGCCA TAACTGCCATCCCCGGGGAGTTTACGACCATGTCTGGACGAAGACTTCGAGAGGCAGTTCAAGCA GAATTTGCATCTCATGGGATGCAGAACATGACTGTTGTTATTTCAGGTCTATGCAACGTCTATAC ACATTACATTACCACTTATGAAGAATACCAGGCTCAGCGATATGAGGCAGCATCGACAATTTATG GACCGCACACATTATCTGCTTACATTCAGCTCTTCAGAAACCTTGCTAAGGCTATTGCTACGGAC ACGGTAGCCAACCTGAGCAGAGGTCCAGAACCTCCCTTTTTCAAACAATTAATAGTTCCATTAAT TCCTAGTATTGTGGATAGAGCACCAAAAGGCAGAACTTTCGGGGATGTCCTGCAGCCAGCAAAAC CTGAATACAGAGTGGGGGAAGTTGCTGAAGTTATATTTGTAGGTGCTAACCCGAAGAATTCAGTA CAAAACCAGACCCATCAGACCTTCCTCACTGTGGAGAAATATGAGGCTACTTCAACATCGTGGCA GATAGTGTGTAATGATGCCTCCTGGGAGACTCGTTTTTATTGGCACAAGGGACTCCTGGGTCTGA GTAATGCAACAGTGGAATGGCATATTCCAGACACTGCCCAGCCTGGAATCTACAGAATAAGATAT TTTGGACACAATCGGAAGCAGGACATTCTGAAGCCTGCTGTCATACTTTCATTTGAAGGCACTTC CCCGGCTTTTGAAGTTGTAACTATTTAGT
(SEQIDNO:9) ASAH2B
AGGCAGCATCGACAATTTATGGACCGCACGCATTATCTGCTTACATTCAGCTCTTCAGAAAC transcript CTTGCTAAGGCTATTGCTACGTATTGTGGATAGAGCACCAAAAGGCAGAACTTTCGGGGATGTCC variant1 TGCAGCCAGCAAAACCTGAATACAGAGTGGGGGAAGTTGCTGAAGTTATATTTGTAGGTGCTAAC CCGAAGAATTCAGTACAAAACCAGACCCATCAGACCTTCCTCACTGTGGAGAAATATGAGGCTAC TTCAACATCGTGGCAGATAGTGTGTAATGATGCCTCCTGGGAGACTCGTTTTTATTGGCACAAGG GACTCCTGGGTCTGAGTAATGCAACAGTGGAATGGCATATTCCAGACACTGCCCAGCCTGGAATC TACAGAATAAGATATTTTGGACACAATCGGAAGCAGGACATTCTGAAGCCTGCTGTCATACTTTC ATTTGAAGGCACTTCCCCGGCTTTTGAAGTTGTAACTATTTAG
(SEQIDNO:10) ASAH2B
GTAGCCAACCTGAGCAGAGGTCCAGAACCTCCCTTTTTCAAACAATTAATAGTTCCATTAAT transcript TCCTAGTATTGTGGATAGAGCACCAAAAGGCAGAACTTTCGGGGATGTCCTGCAGCCAGCAAAAC variant3 CTGAATACAGAGTGGGGGAAGTTGCTGAAGTTATATTTGTAGGTGCTAACCCGAAGAATTCAGTA CAAAACCAGACCCATCAGACCTTCCTCACTGTGGAGAAATATGAGGCTACTTCAACATCGTGGCA GATAGTGTGTAATGATGCCTCCTGGGAGACTCGTTTTTATTGGCACAAGGGACTCCTGGGTCTGA GTAATGCAACAGTGGAATGGCATATTCCAGACACTGCCCAGCCTGGAATCTACAGAATAAGATAT TTTGGACACAATCGGAAGCAGGACATTCTGAAGCCTGCTGTCATACTTTCATTTGAAGGCACTTC CCCGGCTTTTGAAGTTGTAACTATTTAGTGAATGGTAGCCAACCTGAGCAGAGGTCCAGAACCTC CCTTTTTCAAACAATTAATAGTTCCATTAATTCCTAGTATTGTGGATAGAGCACCAAAAGGCAGA ACTTTCGGGGATGTCCTGCAGCCAGCAAAACCTGAATACAGAGTGGGGGAAGTTGCTGAAGTTAT ATTTGTAGGTGCTAACCCGAAGAATTCAGTACAAAACCAGACCCATCAGACCTTCCTCACTGTGG AGAAATATGAGGCTACTTCAACATCGTGGCAGATAGTGTGTAATGATGCCTCCTGGGAGACTCGT TTTTATTGGCACAAGGGACTCCTGGGTCTGAGTAATGCAACAGTGGAATGGCATATTCCAGACAC TGCCCAGCCTGGAATCTACAGAATAAGATATTTTGGACACAATCGGAAGCAGGACATTCTGAAGC CTGCTGTCATACTTTCATTTGAAGGCACTTCCCCGGCTTTTGAAGTTGTAACTATTTAG
(SEQIDNO:11) ASAH2B
GTAGCCAACCTGAGCAGAGGTCCAGAACCTCCCTTTTTCAAACAATTAATAGTTCCATTAAT transcript TCCTAGTATTGTGGATAGAGCACCAAAAGGCAGAACTTTCGGGGATGTCCTGCAGCCAGCAAAAC variant4 CTGAATACAGAGTGGGGGAAGTTGCTGAAGTTATATTTGTAGGTGCTAACCCGAAGAATTCAGTA CAAAACCAGACCCATCAGACCTTCCTCACTGTGGAGAAATATGAGGCTACTTCAACATCGTGGCA GATAGTGTGTAATGATGCCTCCTGGGAGACTCGTTTTTATTGGCACAAGGGACTCCTGGGTCTGA GTAATGCAACAGTGGAATGGCATATTCCAGACACTGCCCAGCCTGGAATCTACAGAATAAGATAT TTTGGACACAATCGGAAGCAGGACATTCTGAAGCCTGCTGTCATACTTTCATTTGAAGGCACTTC CCCGGCTTTTGAAGTTGTAACTATT
(SEQIDNO:12) ACER1
CCTAGCATCTTCGCCTATCAGAGCTCCGAGGTGGACTGGTGTGAGAGCAACTTCCAGTACTC GGAGCTGGTGGCCGAGTTCTACAACACGTTCTCCAATATCCCCTTCTTCATCTTCGGGCCACTGA TGATGCTCCTGATGCACCCGTATGCCCAGAAGCGCTCCCGCTACATTTACGTTGTCTGGGTCCTC TTCATGATCATAGGCCTGTTCTCCATGTATTTCCACATGACGCTCAGCTTCCTGGGCCAGCTGCT GGACGAGATCGCCATCCTGTGGCTCCTGGGCAGTGGCTATAGCATATGGATGCCCCGCTGCTATT TCCCCTCCTTCCTTGGGGGGAACAGGTCCCAGTTCATCCGCCTGGTCTTCATCACCACTGTGGTC AGCACCCTTCTGTCCTTCCTGCGGCCCACGGTCAACGCCTACGCCCTCAACAGCATTGCCCTGCA CATTCTCTACATCGTGTGCCAGGAGTACAGGAAGACCAGCAATAAGGAGCTTCGGCACCTGATTG AGGTCTCCGTGGTTTTATGGGCTGTTGCTCTGACCAGCTGGATCAGTGACCGTCTGCTTTGCAGC TTCTGGCAGAGGATTCATTTCTTCTATCTGCACAGCATCTGGCATGTGCTCATCAGCATCACCTT CCCTTATGGCATGGTCACCATGGCCTTGGTGGATGCCAACTATGAGATGCCAGGTGAAACCCTCA AAGTCCGCTACTGGCCTCGGGACAGTTGGCCCGTGGGGCTGCCCTACGTGGAAATCCGGGGTGAT GACAAGGACTGC
(SEQIDNO:13) ACER2
GGCGCCCCGCACTGGTGGGACCAGCTGCAGGCTGGTAGCTCGGAGGTGGACTGGTGCGAGGA CAACTACACCATCGTGCCTGCTATCGCCGAGTTCTACAACACGATCAGCAATGTCTTATTTTTCA TTTTACCGCCCATCTGCATGTGCTTGTTTCGTCAGTATGCAACATGCTTCAACAGTGGCATCTAC TTAATCTGGACTCTTTTGGTTGTAGTGGGAATTGGATCCGTCTACTTCCATGCAACCCTTAGTTT CTTGGGTCAGATGCTTGATGAACTTGCAGTCCTTTGGGTTCTGATGTGTGCTTTGGCCATGTGGT TCCCCAGAAGGTATCTACCAAAGATCTTTCGGAATGACCGGGGTAGGTTCAAGGTGGTGGTCAGT GTCCTGTCTGCGGTTACGACGTGCCTGGCATTTGTCAAGCCTGCCATCAACAACATCTCTCTGAT GACCCTGGGAGTTCCTTGCACTGCACTGCTCATCGCAGAGCTAAAGAGGTGTGACAACATGCGTG TGTTTAAGCTGGGCCTCTTCTCGGGCCTCTGGTGGACCCTGGCCCTGTTCTGCTGGATCAGTGAC CGAGCTTTCTGCGAGCTGCTGTCATCCTTCAACTTCCCCTACCTGCACTGCATGTGGCACATCCT CATCTGCCTTGCTGCCTACCTGGGCTGTGTATGCTTTGCCTACTTTGATGCTGCCTCAGAGATTC CTGAGCAAGGCCCTGTCATCAAGTTCTGGCCCAATGAGAAATGGGCCTTCATTGGTGTCCCCTAT GTGTCCCTCCTGTGTGCCAACAAGAAATCATCAGTCAAGATCACG
(SEQIDNO:14) ACER3
GCTCCGGCCGCGGACCGAGAGGGCTACTGGGGCCCCACGACCTCCACGCTGGACTGGTGCGA transcript GGAGAACTACTCCGTGACCTGGTACATCGCCGAGTTCTGGAATACAGTGAGTAACCTGATCATGA variant1 TTATACCTCCAATGTTCGGTGCAGTTCAGAGTGTTAGAGACGGTCTGGAAAAGCGGTACATTGCT TCTTATTTAGCACTCACAGTGGTAGGAATGGGATCCTGGTGCTTCCACATGACTCTGAAATATGA AATGCAGCTATTGGATGAACTCCCAATGATATACAGCTGTTGCATATTTGTGTACTGCATGTTTG AATGTTTCAAGATCAAGAACTCAGTAAACTACCATCTGCTTTTTACCTTAGTTCTATTCAGTTTA ATAGTAACCACAGTTTACCTTAAGGTAAAAGAGCCGATATTCCATCAGGTCATGTATGGAATGTT GGTCTTTACATTAGTACTTCGATCTATTTATATTGTTACATGGGTTTATCCATGGCTTAGAGGAC TGGGTTATACATCATTGGGTATATTTTTATTGGGATTTTTATTTTGGAATATAGATAACATATTT TGTGAGTCACTGAGGAACTTTCGAAAGAAGGTACCACCTATCATAGGTATTACCACACAATTTCA TGCATGGTGGCATATTTTAACTGGCCTTGGTTCCTATCTTCACATCCTTTTCAGTTTGTATACAA GAACACTTTACCTGAGATATAGGCCAAAAGTGAAGTTTCTCTTTGGAATCTGGCCAGTGATCCTG TTTGAGCCTCTCAGGAAGCAT
(SEQIDNO:15) ACER3
GCTCCGGCCGCGGACCGAGAGGGCTACTGGGGCCCCACGACCTCCACGCTGGACTGGTGCGA transcript GGAGAACTACTCCGTGACCTGGTACATCGCCGAGTTCTTGGTAGGAATGGGATCCTGGTGCTTCC variant2 ACATGACTCTGAAATATGAAATGCAGCTATTGGATGAACTCCCAATGATATACAGCTGTTGCATA TTTGTGTACTGCATGTTTGAATGTTTCAAGATCAAGAACTCAGTAAACTACCATCTGCTTTTTAC CTTAGTTCTATTCAGTTTAATAGTAACCACAGTTTACCTTAAGGTAAAAGAGCCGATATTCCATC AGGTCATGTATGGAATGTTGGTCTTTACATTAGTACTTCGATCTATTTATATTGTTACATGGGTT TATCCATGGCTTAGAGGACTGGGTTATACATCATTGGGTATATTTTTATTGGGATTTTTATTTTG GAATATAGATAACATATTTTGTGAGTCACTGAGGAACTTTCGAAAGAAGGTACCACCTATCATAG GTATTACCACACAATTTCATGCATGGTGGCATATTTTAACTGGCCTTGGTTCCTATCTTCACATC CTTTTCAGTTTGTATACAAGAACACTTTACCTGAGATATAGGCCAAAAGTGAAGTTTCTCTTTGG AATCTGGCCAGTGATCCTGTTTGAGCCTCTCAGGAAGCAT
(SEQIDNO:16) ACER3
ATATACAGCTGTTGCATATTTGTGTACTGCATGTTTGAATGTTTCAAGATCAAGAACTCAGT transcript AAACTACCATCTGCTTTTTACCTTAGTTCTATTCAGTTTAATAGTAACCACAGTTTACCTTAAGG variant3 TAAAAGAGCCGATATTCCATCAGGTCATGTATGGAATGTTGGTCTTTACATTAGTACTTCGATCT ATTTATATTGTTACATGGGTTTATCCATGGCTTAGAGGACTGGGTTATACATCATTGGGTATATT TTTATTGGGATTTTTATTTTGGAATATAGATAACATATTTTGTGAGTCACTGAGGAACTTTCGAA AGAAGGTACCACCTATCATAGGTATTACCACACAATTTCATGCATGGTGGCATATTTTAACTGGC CTTGGTTCCTATCTTCACATCCTTTTCAGTTTGTATACAAGAACACTTTACCTGAGATATAGGCC AAAAGTGAAGTTTCTCTTTGGAATCTGGCCAGTGATCCTGTTTGAGCCTCTCAGGAAGCAT
(SEQIDNO:17) Sphk2 ATGAATGGACACCTTGAAGCAGAGGAGCAGCAGGACCAGAGGCCAGACCAGGAGCTGACCGGGAG CTGGGGCCACGGGCCTAGGAGCACCCTGGTCAGGGCTAAGGCCATGGCCCCGCCCCCACCGCCAC TGGCTGCCAGCACCCCGCTCCTCCATGGCGAGTTTGGCTCCTACCCAGCCCGAGGCCCACGCTTT GCCCTCACCCTTACATCGCAGGCCCTGCACATACAGCGGCTGCGCCCCAAACCTGAAGCCAGGCC CCGGGGTGGCCTGGTCCCGTTGGCCGAGGTCTCAGGCTGCTGCACCCTGCGAAGCCGCAGCCCCT CAGACTCAGCGGCCTACTTCTGCATCTACACCTACCCTCGGGGCCGGCGCGGGGCCCGGCGCAGA GCCACTCGCACCTTCCGGGCAGATGGGGCCGCCACCTACGAAGAGAACCGTGCCGAGGCCCAGCG CTGGGCCACTGCCCTCACCTGTCTGCTCCGAGGACTGCCACTGCCCGGGGATGGGGAGATCACCC CTGACCTGCTACCTCGGCCGCCCCGGTTGCTTCTATTGGTCAATCCCTTTGGGGGTCGGGGCCTG GCCTGGCAGTGGTGTAAGAACCACGTGCTTCCCATGATCTCTGAAGCTGGGCTGTCCTTCAACCT CATCCAGACAGAACGACAGAACCACGCCCGGGAGCTGGTCCAGGGGCTGAGCCTGAGTGAGTGGG ATGGCATCGTCACGGTCTCGGGAGACGGGCTGCTCCATGAGGTGCTGAACGGGCTCCTAGATCGC CCTGACTGGGAGGAAGCTGTGAAGATGCCTGTGGGCATCCTCCCCTGCGGCTCGGGCAACGCGCT GGCCGGAGCAGTGAACCAGCACGGGGGATTTGAGCCAGCCCTGGGCCTCGACCTGTTGCTCAACT GCTCACTGTTGCTGTGCCGGGGTGGTGGCCACCCACTGGACCTGCTCTCCGTGACGCTGGCCTCG GGCTCCCGCTGTTTCTCCTTCCTGTCTGTGGCCTGGGGCTTCGTGTCAGATGTGGATATCCAGAG CGAGCGCTTCAGGGCCTTGGGCAGTGCCCGCTTCACACTGGGCACGGTGCTGGGCCTCGCCACAC TGCACACCTACCGCGGACGCCTCTCCTACCTCCCCGCCACTGTGGAACCTGCCTCGCCCACCCCT GCCCATAGCCTGCCTCGTGCCAAGTCGGAGCTGACCCTAACCCCAGACCCAGCCCCGCCCATGGC CCACTCACCCCTGCATCGTTCTGTGTCTGACCTGCCTCTTCCCCTGCCCCAGCCTGCCCTGGCCT CTCCTGGCTCGCCAGAACCCCTGCCCATCCTGTCCCTCAACGGTGGGGGCCCAGAGCTGGCTGGG GACTGGGGTGGGGCTGGGGATGCTCCGCTGTCCCCGGACCCACTGCTGTCTTCACCTCCTGGCTC TCCCAAGGCAGCTCTACACTCACCCGTCTCCGAAGGGGCCCCCGTAATTCCCCCATCCTCTGGGC TCCCACTTCCCACCCCTGATGCCCGGGTAGGGGCCTCCACCTGCGGCCCGCCCGACCACCTGCTG CCTCCGCTGGGCACCCCGCTGCCCCCAGACTGGGTGACGCTGGAGGGGGACTTTGTGCTCATGTT GGCCATCTCGCCCAGCCACCTAGGCGCTGACCTGGTGGCAGCTCCGCATGCGCGCTTCGACGACG GCCTGGTGCACCTGTGCTGGGTGCGTAGCGGCATCTCGCGGGCTGCGCTGCTGCGCCTTTTCTTG GCCATGGAGCGTGGTAGCCACTTCAGCCTGGGCTGTCCGCAGCTGGGCTACGCCGCGGCCCGTGC CTTCCGCCTAGAGCCGCTCACACCACGCGGCGTGCTCACAGTGGACGGGGAGCAGGTGGAGTATG GGCCGCTACAGGCACAGATGCACCCTGGCATCGGTACACTGCTCACTGGGCCTCCTGGCTGCCCG GGGCGGGAGCCCTGA(SEQIDNO:18)
Reducing Cell Death in Rat Myocardium
[0077] In order to characterize the dynamics of cell death as well as expression of genes that are involved in the metabolism and signaling of sphingolipids in the heart as a result of myocardial infarction (MI) in mice, hearts were infarcted by ligation of the left anterior descending artery (LAD) and harvested at different time point post ligation.
[0078] For cell death assessment the hearts were harvested at 1, 2, 4, and 28 days post MI and from sham operated mice. TUNEL stain was used to assess DNA fragmentation in cardiac cells Troponin-I immunostaining was used to distinguish between cardiomyocytes and non-cardiomyocytes (
[0079] Sphingolipids metabolism and signaling pathway partial transcriptomes were studied in hearts of sham operated mice or mice 4 h and 24 h post MI. We focused on two partially overlapping sets of genes: Sphingolipid metabolism genes based on KEGG PATHWAY map00600 and Sphingolipid signaling pathway genes based on KEGG PATHWAY map04071[11]. In the Sphingolipids metabolism transcriptome 4 h post ligation 2 genes were significantly upregulated by more than 2 fold and one was downregulated by less than 2 fold. 24 h post MI 10 genes were significantly upregulated by more than 2 fold and 2 were downregulated by less than 2 fold. Total of 12 out of 49 genes (not shown). In the Sphingolipids signaling pathway transcriptome 4 h post ligation 5 genes were significantly upregulated by more than 2 fold and 2 were downregulated by less than 2 fold. 24 h post MI, 28 genes were significantly upregulated by more than 2 fold and 10 were downregulated by less than 2 fold totals of 38 out of 82 genes (
[0080] The dendrograms of both transcriptomes (
[0081] In order to study the role of ceram ides metabolites on cell death and heart function post MI we chose to alter ceramide metabolism and signaling pathway by enhancing ceramide degradation and S1P synthesis. First we confirm the RNA-seq DATA for the main genes that are involved in this process namely: Acid ceramidase (AC), Sphingosine Kinase 1 (Sphk1) and Sphingosine-1-Phosphate Receptor 2 (S1PR2) by qPCR and western blot analysis of hearts from an independent experiment. In agreement with the results of the RNAseq analysis, the relative levels of AC mRNA didn't change significantly (
[0082] Next, we checked the effect of these genes on the viability of neonatal rat cardiomyocytes (nrCM) under anoxic conditions. To this aim, we used a synthetic modRNA that encode to the human AC, Sphk1 and S1PR2. The expression kinetics of proteins encoded by modRNA and its reduced immunogenicity (Sultana 2017) make modRNA an ideal vector to study the role of genes expression in acute conditions such as myocardial infarction. First, we checked the effect of modRNA transfection on the expression levels of the target proteins in Hek293 cells (sup.
[0083] When the cells were transfected with a combination of genes an additive effect was observed. Overexpression of AC and Sphk1 reduce the number of apoptotic cells by 48% and overexpression of AC and S1PR2 together reduce apoptosis by 33%. Surprisingly, combining Sphk1 with S1PR2 or combining AC, Sphk1 and S1PR2 did not reduce the levels of apoptosis (
[0084] To study the effect of AC, Sphk1, and S1PR2 on cell death in LV after myocardial infarction, hearts were infarcted by ligation of the left anterior descending artery. Immediately after the LAD was ligated, 100 g modRNA encoding to a control gene or gene of interest were injected to the myocardium of the left ventricle. After 48 h the hearts were harvests and the levels of DNA fragmentation was measured. Strikingly, overexpression of AC in the left ventricle immediately after LAD ligation reduced the number of cells with fragmented DNA in the left ventricle by 54% compare to hearts that were treated with Luc modRNA. Overexpression of Sphk1 reduced DNA fragmentation by 29% and S1PR2 did not prevent the fragmentation of DNA in the LV 48 h post-MI (
[0085] The beneficial effects of AC and Sphk1 and the additive effect of the combined expression of these two genes prompted us to study their effect on heart remodeling and function post MI. To this aim, we injected AC, Sphk1, AC+Sphk1 or Luc directly to the LV and compare the Left ventricular internal dimension-diastole (LVIDd), Left ventricular internal dimension-systole (LVIDs) and fractioning shortening % (% FS) at different time point post MI. At the end of the experiment (29 days post MI) the hearts were harvested and immunostained with WGA and CD31 to assess the average area of cardiomyocytes and the number of vessels in the LV. To measure the scar size, Masson's trichrome stain was performed on heart sections. Two days post-MI, there was no significant difference between the groups in all measured parameters (
[0086] In accordance with the beneficial effect that AC and Sphk1 have on heart function we found a significant reduction in the scar size 29 days post MI. In mice treated with AC, Sphk1 or AC+Sphk1 the scar areas were 14.2%, 16.7% and 16.1% of LV area compared to 23.3% in control mice (
[0087] No signs of CM hypertrophy were found by WGA stain and no difference in the number of luminal structures in the LV could be observed by CD31 immunostaining (
[0088] To determine if the expression of AC and Sphk1 improves heart function by preventing apoptosis at early stages or by promoting heart regeneration after the infarct development we compare the % FS at 28 days post MI to the % FS 2 days post MI. Surprisingly we found that the heart function in mice that were treated with AC improved 28 days post MI compare to the heart function at 2 days post MI by 1.5% in average. In contrast, % FS in control mice reduced by 9%. In mice treated with Sphk1 and AC+Sphk1 there was very mild reduction in % FS of 0.8% and 0.3% respectively (
[0089] Given the fact that occasionally, some or all of the injected RNA is spilt to the LV rather than to the myocardium leading to reduction of the efficiency of cell transfection, we decided to examine the outcome of injection after excluding hearts that we suspect were not properly injected and can be classified as outliers. We identified 2 outliers in the AC group and 1 in the AC+Sphk1 group. After excluding those hearts from the statistics the improvement in % FS of AC hearts was in average 5.3% and in AC+Sphk1 hearts there was an average improvement of 2.7% (
[0090] The survival rates of mice that were treated with AC modRNA were significantly higher than survival rates of control mice. 100% of the AC treated mice survived 90 days post MI while the survival rate of mice treated with control modRNA were 60%. The survival rates of mice treated with Sphk1 or AC+Sphk1 were 80% (
Improving Cell Quality and Survival in Assisted Reproductive Technologies
[0091] Nowhere is the role of cell death more significant than in the field of reproduction. Ovulated oocytes undergo molecular changes characteristic of cell death unless successful fertilization occurs. Under normal physiological conditions 85-90% of oocytes succumb to cell death at some point during fetal or postnatal life. Clinically, when the remaining oocyte reserve has been exhausted (on average, this occurs in women around age 50), menopause ensues as a direct consequence of ovarian senescence. A major challenge of assisted reproduction technologies (ARTs) is to mimic the natural environment required to sustain oocyte and embryo survival.
[0092] Accordingly, the ability to increase cell quality and survival is of particular interest in reproductive cells, which have unique features, such as the ability of the oocyte to undergo a cortical reaction and triggering of protein expression in the fertilized zygote.
[0093] The formation of a human embryo starts with the fertilization of the oocyte by the sperm cell. This yields the zygote, which carries one copy each of the maternal and paternal genomes. To prevent fertilization by multiple sperm, the egg undergoes a cortical reaction; once a single sperm manages to penetrate the outer membrane of the oocyte, the oocyte develops a permanent, impermeable barrier.
[0094] Expression of the genetic information contained in the zygote starts only after the zygote divides a couple of times.
[0095] There are several studies that support association of the signaling lipid, ceramide, and its metabolizing enzymes with cellular and organismal aging. It has been reported that the intracellular level of ceramide increased during stress related signaling such as cell culture and aging. Ceramidase, for example, acid ceramidase (AC) is required to hydrolyze ceramide into sphingosine and free fatty acids. Sphingosine is rapidly converted to sphingosine-1-phosphate (S1P), another important signaling lipid that counteracts the effects of ceramide and promotes cell survival. Thus, AC is a rheostat that regulates the levels of ceramide and S1P in cells, and as such participates in the complex and delicate balance between death and survival.
[0096] We have previously shown that AC expression is carefully regulated during oocyte maturation and early embryo development (Eliyahu, et al, 2010). We have also found that the complete knock-out of AC function in mice leads to embryo death between the 2 and 8-cell stage (Eliyahu, FASEB J, 2007). In addition, our previous publication (Eliyahu, FASEB J, 2010) showed that the ceramide-metabolizing enzyme, AC is expressed and active in human cumulus cells and follicular fluid, essential components of this environment, and that the levels of this enzyme are positively correlated with the quality of human embryos formed in vitro. These observations led to a new approach for oocyte and embryo culture that markedly improves the outcome of in vitro fertilization (IVF).
[0097] The disclosed method provides an opportunity to improve egg quality. Firstly, when women have a failed IVF cycle or are considering undergoing IVF at an advanced maternal age, they are often told that they likely have poor-quality eggs. Why is egg quality so important for success in infertility treatment? The answer comes down to the simple fact that high-quality eggs produce high-quality embryos: 95% of embryo quality comes from the egg. Embryos must be strong enough to survive the early stages of development in order to result in a successful pregnancy.
[0098] As a woman ages, her ovaries' ability to produce high-quality eggs starts to decline. This is a condition known as diminished ovarian reserve (DOR) and is the most common cause of infertility for women over 40. Because of their poor egg quality (and resulting poor embryo quality), these women have difficulty conceiving on their own. Success rates of fertility treatments are also lower for these women, who are often refused treatment at fertility centers unless they are willing to use donor eggs. The method disclosed herein provides a treatment plan for these women geared toward improving the number and quality of eggs.
[0099] Ceramide has been shown to induce apoptotic cell death in different cells type [7] including murine and human cardiomyocytes [14, 15]. On the other hand, sphingosine, one of the products of ceramide degradation can be phosphorylated to give rise to a major agent of cell survival and cardioprotection sphingosine 1 phosphate [16, 17].
[0100] In this disclosure, we describe a strategy different from previously described approaches to reduce ceramide levels in the ischemic heart. Instead of targeting ceramide synthesis we study the effect of increasing ceramide degradation by overexpression of acid ceramidase. With this strategy, not only can we reduce ceramide levels but we also increase the reservoir of sphingosine which is the main building block for the pro survival molecule Sphingosine 1 phosphate. We found that modRNA encoding AC mediated high expression levels of AC in vitro and in vivo. This overexpression was accompanied with increased enzymatic activity in hearts post-MI and a reduce levels of apoptotic cells under an anoxic condition in vitro as well as reduce the number of cells with fragmented DNA in the left ventricle of mice 1 and 2 days post MI. We also observed reduce levels of Caspase3 in the hearts of AC treated hearts compared to mice treated with a control gene. 28 days post MI the function of hearts treated with AC was significantly better in terms of % FS LVIDd and LVIDs. When we compare % FS 28 d post-MI to % FS 2 d post-MI we observed a significant improvement which implies a better regenerative capacity in AC treated hearts. In consistent with reducing cell death and better heart function, the average scar size in AC treated mice was significantly smaller than the scar size of Luc control mice. Not only did we observe less apoptosis 1 and 2 days post MI and better heart functions 28 post MI, the survival rates of mice that were treated with AC modRNA were significantly higher than survival rates of control mice in a long-term survival assay suggesting a long-term effects of our intervention in the early events that are taking place as a results of acute MI.
[0101] Acid ceramidase catalyzes the hydrolysis of ceramide into sphingosine and free fatty acid [18]. While it has been reported that sphingosine is capable of disassembling mitochondrial ceramide channels suggesting the existence of an anti-apoptotic property of sphingosine [19, 20] other evidence support a positive role of sphingosine in the execution of apoptotic or necrotic cell death [21]. Moreover, it was suggested by Benaim et al [22] that Sphingosine can disturb the homeostasis of cellular calcium by inhibiting the activity of sarco(endo)plasmic reticulum Ca(2+)-ATPase (SERCA) which has a pivotal role in proper cardiac function [23, 24]. Two genes encode sphingosine kinaseSphk1 and Sphk2. It catalyzes the phosphorylation of sphingosine to S1P and has been shown to possess cardioprotective properties [25]. Duan et al reported that adenoviral mediated overexpression of Sphk1 in rat hearts can protect the treated hearts from ischemia and reperfusion injury [26]. Our transcriptome analysis shows that the expression levels of Sphk1 are elevated by 12 and 67 fold 4 and 24 hours post-MI respectively. A similar trend was found with qPCR analyzed of Sphk1 levels in an independent experiment. This was accompanied by a significant elevation in Sphk1 protein levels as measured by western blot analysis. The pathway analysis of sphingosine signal transduction reviled an up regulation of all the components in the TNF signaling pathway including TNF alpha, TNFR, TRADD, and TRAF2. Interestingly, Xia et al showed that TRAF2 can interact with Sphk1 and that this interaction is necessary for the anti-apoptotic activity of TRAF2 [27]. Recently Guo et al reported a cardioprotective role of TRAF2 [28] It will be interesting to examine the role of Sphk1 and TRAF2 interaction in this context. In this study, modRNA mediated delivery of Sphk1 to isolated neonate rat cardiomyocytes, reduced the level of apoptosis in the transfected cells 48 h after the cell were transferred to an anoxic environment. Combined expression of Sphk1 and acid ceramidase in neonate rat cardiomyocytes had an additive effect demonstrating the importance of ceramide and sphingosine degradation as well as S1P synthesis in cardiomyocytes' survival. When Sphk1 was over express in infarcted hearts, we observed a nonsignificant reduction in the portion of nuclei with fragmented DNA in the left ventricle 48 h post-MI, 28 days post MI the % FS was moderately better in Sphk1 treated mice compare to Luc controls. The average scar size in Sphk1 mice was smaller than the average scar size in control mice; however the difference is not significant. The survival rates of Sphk1 treated mice were higher than the survival of control mice, however, the difference is not significant.
[0102] Contrary to the additive effect that was achieved by combined expression of AC and Sphk1 in isolated cardiomyocytes, in vivo we did not observe any advantage of combined expression over the effect we observed when the mice were treated AC in term of cell death 2 days' post-MI or heart function and scar size 28 days post MI. Not only has this but the survival rates of mice treated with AC and Sphk1 were not significantly lower than the survival rates of mice treated with AC alone. The above observation suggests that the high endogenous levels of Sphk1 during acute MI are sufficient in order to degrade sphingosine in the heart and keep it levels below toxic levels even in the presence of high AC levels. While the levels of Sphk1 after MI increased dramatically, the levels of Sphk2 are moderately reduced 4 h post-MI and then increased by less than 1.5 fold 24 h post-MI. Our unpublished data showed that overexpression of Sphk2 can reduce cell death in-vitro and in-vivo under stress condition however this effect was less significant than the positive effect of Sphk1 cell survival.
[0103] Sphingosine 1 phosphate exert its activity on cells by activating a family of five G protein-coupled receptors: S1pr1-5. The levels of the two most abundant receptors in the heart namely S1pr1 and 3 are moderately but significantly elevated after MI. In contrast, the levels of S1pr2 4 h after MI are reduced and 24 h post MI the levels are back to normal. The role of S1pr1 and S1pr3 in cardio protection is well established [25] however the role of S1p2 in heart function is less clear. Or results suggest that overexpression of S1p2 in cells and in heart have a neglected effect on cells survival.
Cell Senescence
[0104] Senescence is the major cause of suffering, disease, and death in modern times. Senescence, or biological aging, is the slow drop of functional characteristics. Senescence can refer either to cellular senescence or to the senescence of a whole organism. In addition to induced senescence such as aging, there is stress-induced senescence, which is a very broad concept including a variety of stress conditions such as oxidative stress, injury, noise exposure, and other sources of damage to cells. These stresses act via intracellular pathways to induce a state of non-proliferation. Cellular senescence described by Hayflick and Moorhead in the 1960s, is the irreversible arrest of cells following long culture. Telomere shortening is the key mechanism driving replicative senescence in human fibroblasts. Apart from cell cycle arrest, senescent cells have been shown to experience dramatic changes in terms of gene expression, combination of CDK1 activity, heterochromatin formation, metabolism including (Sphingolipids metabolism), epigenetics, and a distinct secretion profile known as the Senescence-Associated Secretory Phenotype (SASP) (Copp'e et al., 2014). SASP is a way for senescent cells to communicate with the immune system, potentially to facilitate their own clearance (for example pro-inflammatory cytokines) and contribute to disruption of cell and tissue homeostasis and function (Shay and Wright, 2010). It has been shown that chronic SASP is able to induce senescence in adjacent young cells, contributing to tissue dysfunction (Acosta et al., 2013, Jurk et al., 2014). Senescent cells also show mitochondrial dysfunction (Passos et al., 2010).
[0105] Oxidative stress-induced senescence in the heart caused by myocardial infarction (MI) can trigger cardiomyocyte death or senescence (Huitong et al., 2018). Moreover, senescence can have deleterious effects with chronic, worsening pathologies such as type 2 diabetes (Palmer et al., 2015), atherosclerosis (Gorenne et al., 2006; Wang et al., 2015), Multiple Sclerosis (MS) (Oost et al., 2019), and other chronic diseases.
[0106] The involvement of sphingolipids has been studied in multiple organisms and cell types for the regulation of aging and senescence, especially ceramide and sphingosine-1-phosphate (S1P) for induced cellular senescence, distinct from their effect on survival. Significant and wide-ranging evidence defines critical roles of sphingolipid enzymes and pathways in aging and organ injury leading to tissue senescence (Trayssac et al., 2018), including regulation by stress stimuli, p53, participation in growth arrest, SASP, and other aspects of the senescence response. Acid ceramidase is the only protein that can balance the level of ceramide vs S1P by hydrolyzing ceramide to a product that can be phosphorylated to form S1P. The present invention is based on the further discovery that in addition to its role in protecting cells from apoptosis, administration of AC decreased the rate of senescence in vitro, and in vivo, in different cell types and tissues.
[0107] Blockage in the coronary arteries reduces the supply of blood to heart muscle and causes dynamic effects within the infarction risk area and around the ischemic border zone. Tissues in the infarction risk area exhibit distinct metabolic changes within a few minutes. Nearly the entire risk area tissues become irreversibly injured during a severe hypoperfusion of 6 hours. On the other hand, the border zone tissues exhibit only moderate metabolic changes due to greater collateral perfusion, including from 45-80% of blood flow regionally in the non-ischemic vascular bed. The ischemic border zone tissues are from the lateral edges of infarct, are approximately 2 mm wide, and increase in width along the subepicardium. Over time, the subepicardial margins of border zone widen due to improved collateral blood flow. The tissues in the border zone region are in, or entering into, senescence.
EXAMPLES
Mice
[0108] All animal procedures were performed under protocols approved by the Icahn School of Medicine at Mount Sinai Institutional Care and Use Committee. CFW mice strains, male and female, were used for studies on heart function following myocardial infarction. Before surgery mice were anaesthetized with ketamine 100 mg/kg and xylazine 10 mg/kg cocktail.
[0109] For protein expression assay, 100 g of Luc, Sphk1 or S1pr2 modRNA in 60 l citrate sucrose buffer (sultana 2017) were injected directly into the myocardium in an open-chest surgery. MI was induced by permanent ligation of the LAD. The left thoracic region was shaved and sterilized. After intubation, the heart was exposed through a left thoracotomy. A suture was placed to ligate the LAD. When needed, 100 g modRNA was injected into the infarct border zone immediately after LAD ligation. The thoracotomy and skin were sutured closed in layers. Excess air was removed from the thoracic cavity, and the mouse was removed from ventilation when normal breathing was established. Hearts from sham operated mice were collected immediately after open chest operation without LAD ligation.
Synthesis of modRNA
[0110] Clean PCR products generated with plasmid templates served as template for mRNA. ModRNAs were transcribed in vitro using a custom ribonucleoside blend of Anti Reverse Cap Analog, 3-OMe-m7G(5) ppp(5)G (6 mM, TriLink Biotechnologies), guanosine triphosphate (1.5 mM, Life Technologies), adenosine triphosphate (7.5 mM, Life Technologies), cytidine triphosphate (7.5 mM, Life Technologies), N1-Methylpseu-douridine-5-Triphosphate (7.5 mM, TriLink Biotechnologies). The mRNA was purified using a Megaclear kit (Life Technologies) and was treated with Antarctic Phosphatase (New England Biolabs); then it was purified again using the Megaclear kit. The mRNA was quantitated by Nanodrop (Thermo Scientific), precipitated with ethanol and ammonium acetate, and resuspended in 10 mM TrisHCl and 1 mM EDTA.
In Vitro Transfection of modRNA in Cardiomyocytes
[0111] 2.5 ug per well (of 24 well plate) of mRNA encoding nGFP, AC, Sphk1 or S1pr2 were complexed with RNAiMAX (Life Technologies) and transfected into neonatal rat or hPSC-derived CMs according to the manufacturer's instructions. For Immunofluorescent staining, 18 hr post-transfection cells were washed 1 time with PBS fixed with 4% PFA for 10 min and washed 3 times with PBS. For western blot analysis cells were washed 1 time with PBS and then lysed with lysis buffer (Sigma). For anoxic induced apoptosis, cells were transfer to anoxia chamber for 48 h and harvested with Trypsin 0.25% (Sigma) for FACS analysis.
In Sperm and Oocytes
[0112] Mouse sperm and oocytes were treated with 50 to 200 ng/microliter of naked AC modRNA into the culture media. In some embodiments, 100 ng/plwas used. Pronuclei (PN) embryos can be injected with modRNA by intracytoplasmic injection. In some embodiments, embryos were injected with 50-100 ng of modRNA.
hPSC Differentiation
[0113] For heart function following myocardial infarction studies, hPSCs (H9) were differentiated along a cardiac lineage as previously described. Briefly, hPSCs were maintained in E8 media and passaged every 4-5 days onto matrigel-coated plates. To generate embryonic bodies (EBs), hPSCs were treated with 1 mg/ml collagenase B (Roche) for 30 min or until cells dissociated from plates. Cells were collected and centrifuged at 1,300 rpm for 3 min, and they were resuspended into small clusters of 50-100 cells by gentle pipetting in differentiation media containing RPMI (Gibco), 2 mmol/L L-glutamine (Invitrogen), 4 x 10 monothioglycerol (MTG, Sigma), 50 mg/mL ascorbic acid (Sigma), and 150 mg/mL transferrin (Roche). Differentiation media were supplemented with 2 ng/mL BMP4 and 3 mmol Thiazovivin (Millipore) (day 0). EBs were maintained in six-well ultra-low attachment plates (Corning) at 37 C. in 5% CO2, 5% O2, and 90% N2. On day 1, media were changed to differentiation media supplemented with 20 ng/mL BMP4 (R&D Systems) and 20 ng/mL Activin A (R&D Systems). On day 4, media were changed to differentiation media supplemented with 5 ng/mL VEGF (R&D Systems) and 5 mmol/L XAV (Stemgent). After day 8, media were changed every 5 days to differentiation media without supplements.
Neonatal Rat CM Isolation
[0114] Neonatal rat ventricular CMs were isolated from 3- to 4-day-old Sprague-Dawley rats (Jackson ImmunoResearch Labora-tories). We used multiple rounds of digestion with 0.1% collagenase II (Invitrogen) in BPS. After each digestion, the supernatant was collected in horse serum (Invitrogen). Total cell suspension was centrifuged at 1,500 rpm for 5 min. Supernatants were discarded and cells were resuspended in DMEM (Gibco) with 0.1 mM ascorbic acid (Sigma), 0.5% Insulin-Transferrin-Selenium (100), penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells were plated in plastic culture dishes for 90 min until most of the non-myocytes attached to the dish and myocytes remained in the suspension. Myocytes were then seeded at 110 cells/well in a 24-well plate. Neonatal rat CMs were incubated for 48 hr in DMEM containing 5% horse serum. After incubation, cells were transfected with modRNAs as described above.
Real-Time qPCR Analyses
[0115] Total RNA was isolated using the RNeasy mini kit (QIAGEN) and reverse transcribed using Superscript III reverse transcriptase (Invitrogen), according to the manufacturer's instructions. Real-time qPCR analyses were performed on a Mastercycler realplex 4 Sequence Detector (Eppendoff) using SYBR Green (Quantitect SYBR Green PCR Kit, QIAGEN). Data were normalized to 18srRNA expression where appropriate (endogenous controls). Fold changes of gene expression were determined by the ddCT method. PCR primer sequences are summarized in Table 2.
TABLE-US-00002 TABLE2 SEQID SEQID Gene Forward NO. Reverse NO. AC ACAGGATTCAAACCAGGACTGT 19 TGGGCATCTTTCCTTCCGAA 20 AC TGACAGGATTCAAACCAGGACT 21 CTGGGCATCTTTCCTTCCGA 22 Sphk1 ATACTCACCGAACGGAAGAACC 23 CCATTAGCCCATTCACCACC 24 TC Sphk1 ACTGATACTCACCGAACGGAA 25 CATTAGCCCATTCACCACCT 26 C S1PR2 CACAGCCAACAGTCTCCAAA 27 TCTGAGTATAAGCCGCCCA 28 S1PR2 ATAGACCGAGCACAGCCAA 29 GAACCTTCTCAGGATTGAGG 30 T 18srRNA* TAACGAACGAGACTCTGGCAT 31 CGGACATCTAAGGGCATCAC 32 AG *Genetic Vaccines and Therapy 2004, 2:5
Western Blot
[0116] Upon thawing, hearts lysates' were subjected to separation by SDS-PAGE using 12% precast Nupage Bis/Tris gels (Invitrogen, Carlsbad, Calif., USA) under reducing conditions and MES running buffer (Invitrogen), and transferred onto a nitrocellulose membrane (Bio-Rad) using a semidry transfer apparatus and Nupage-MOPS transfer buffer (Invitrogen). The membrane was block with TBS/Tween containing 5% dry milk and incubated with specific primary antibodies over night at 4 OC washed with TBS/Tween and incubated with rabbit or gout antibodies conjugated to hors reddish peroxidase for 1 hour at room temperature. Detection was performed by an enhanced chemiluminecence (ECL) detection system (Pierce, Rockford, Ill.). For molecular weight was determination, using prestained protein standards (Amersham, Buckinghamshire, UK).
Immunohistochemistry
[0117] The mouse hearts were harvested and perfused using perfusion buffer (2 g/l butanedione, monoxime and 7.4 g/l KCl in PBS1) and 4% paraformaldehyde (PFA). Hearts were fixed in 4% PFA/PBS overnight on shaker and then washed with PBS for 1 hr and incubated in 30% sucrose/PBS at 4 O C overnight. Before freezing, hearts were mounted in OCT for 30 min and frozen at 80 C. Transverse heart sections of 10 M were made by cryostat. Cryosections were washed in PBST and blocked for 1 h with 5% donkey serum in PBST. Sections were incubated over night at 4 C. using primary antibodies for Troponin I, Sphk1, S1p2. Secondary antibodies were used for fluorescent labeling (Jackson ImmunoResearch Laboratories). TUNEL staining was performed according to manufacturer's recommendations (In-Situ Cell Death Detection Kit, Fluorescein, Cat #11684795910, Roche). Stained sections were imaged using a Zeiss Slide Scanner Axio Scan or Zeiss mic. Quantification of TUNEL in cardiac sections was performed using ImageJ software. For cell immunocytochemistry, Hek293 and isolated CMs were fixed on coverslips with 4% PFA for 10 min at room temperature. Following permeabilization with 0.1% TRITON X100 in PBS for 10 min at room temperature, cells were blocked with 5% Donkey serum+0.1% TRITON X100 in PBS for 30 minutes. Coverslips were incubated with primary antibodies in humidity chamber for 1 hour at room temperature followed by incubation with corresponding secondary antibodies conjugated to Alexa Fluor 488, Alexa Fluor 647 and Alexa Fluor 555, and Hoechst 33342 staining for nuclei visualization (all from Invitrogene). The fluorescent images were taken on a Zeiss fluorescent microscope at 20 magnification.
Methods for Assisted Reproduction Studies
Mouse Oocyte and Sperm Collection
[0118] All experiments involving animals were approved by and performed in strict accordance with the guidelines of the appropriate institutional animal care and use committees. Seven- to 8-wk-old 129-SVIMJ and C57-Black/6 female mice (Jackson Laboratory, Bar Harbor, Me.) were superovulated with 10 IU of pregnant mare serum gonadotropin (PMSG; Syncro-part, Sanofi, France), followed by 10 IU of human chorionic gonadotropin (hCG; Sigma, St. Louis, Mo.) 48 hours later. Mature and aged MII oocytes were collected from the oviduct ampullae at 16 or 46 hour after injection of hCG, respectively. Cumulus cells were removed by a brief exposure to 400 IU/ml of highly purified hyaluronidase (H-3631; Sigma) in M2 medium (Sigma). Epididymal sperm from 10-wk-old mice were used for IVF of oocytes from the same strain.
Mouse Fertilization and Embryo Culture
[0119] Microdrops of fertile sperm in Vitrofert solution (Vitrolife, Goteborg, Sweden) were prepared, and 10 oocytes were placed into each sperm microdrop. The fertilization process was performed for 6 hours at 37 C. in a humidified atmosphere of 5% CO.sub.2 and 95% air. After IVF, zygotes were washed 3 times with potassium simplex optimized medium (KSOM, Chemicon, Billerica MA) and cultured for an additional 20-48 hours at 37 C. in a humidified atmosphere of 5% CO.sub.2 and 95% air. Cleavage of the zygotes was observed and recorded throughout the in vitro culture.
Harvest, Evaluation and Culture of Human Gametes
(A) Oocytes
[0120] Female patients undergo approved and controlled ovarian stimulation by administration of recombinant follicle-stimulating hormone (rFSH) followed by concomitant administration of gonadotropin-releasing hormone (GnRH) antagonist. Specifically, rFSH was administrated beginning from a day equal to of the cycle. GnRH antagonist was added at day 6, or when follicles were 12 mm in diameter and until the leading follicle exceeds mm or the estradiol level is above 450 pg/ml. This protocol was continued until at least 2 follicles of 17-18 mm were observed. At this point, ovulation was induced by double trigger administration of Ovitrelle (LH) and Decapeptide (GnRH analogue). Ovum pickup was performed 36-38 h afterwards.
[0121] The cumulus-oocyte complexes was isolated into fertilization medium (LifeGlobal), in the presence of 100 g/l of AC modRNA.
(B) Sperm
[0122] Sperm samples were evaluated for their count, motility and morphology, and all parameters were documented. Post validation sperm were incubated with Multipurpose Handling Medium (MHM, Irvine Scientific), and divided into two halves; one half was incubated in the presence of 100 ug/ul of AC modRNA in the media for 1 hour as the study group, and the second half was incubated in the absence of AC modRNA in the media for control. After a 1 hour incubation, a second evaluation of sperm samples for their count, motility and morphology was conducted. Values were compared to those obtained before treatment with AC modRNA.
[0123] Following incubation and evaluation, gametes were handled by an approved and common protocol. Oocytes were inseminated, or injected, by ICSI (intracytoplamic sperm injection) according to the spouse sperm parameters and routine protocol. After insemination, ICSI oocytes were transferred to Global medium (medium for culture of Life Global) as is routine in IVF/ICSI. All embryos were incubated and embryonic development was monitored from the time of fertilization up to day 5 in the integrated EmbryoScope time-lapse monitoring system (EMBRYOSCOPE, UnisenseFertiliTech, Vitrolyfe Denmark). The EMBRYOSCOPE offers the possibility of continuous monitoring of embryo development without disturbing culture conditions. Embryo scoring and selection with time-lapse monitoring was performed by analysis of time-lapse images of each embryo with software developed specifically for image analysis (EmbryoViewer workstation; UnisenseFertilitech A/S). Embryo morphology and developmental events were recorded to demonstrate the precise timing of the observed cell divisions in correlation to the timing of fertilization as follows: time of 1) pronuclei fading (tPnf), 2) cleavage to a 2-blastomere (t2), 3) 3-blastomere (t3), 4) 4-blastomere (t4) and so forth until reaching an 8-blastomere (t8) embryo, 5) compaction (tm), and 6) start of blastulation. In addition, the synchrony and the duration of cleavages were also measured. Blastocyst morphology including the composition of the inner cell mass and the trophectoderm, were evaluated according to the Gardner blastocyst grading scale.
[0124] Preimplantation genetic screening (PGS) is performed by chromosomal microarray analysis (CMA) in order to select euploid embryos for transfer. For this, trophectoderm biopsy is performed on day 5. Subsequently, blastocysts and the biopsied embryos are frozen by vitrification. DNA from trophectodermal samples is subjected to whole genome amplification (WGA) and CMA as previously described (Frumkin et al., 2017). Embryos found to be euploid are thawed in a subsequent cycle and transferred to the uterus of the mother for implantation and pregnancy.
[0125] Following fertilization, the number of mouse and bovine embryos formed in the presence of AC also was improved (from approximately 40 to 88%), leading to approximately 5-fold more healthy births. Significantly more high-grade blastocysts were formed, and the number of morphologically intact, hatched embryos was increased from approximately 24 to 70% (Eliyahu et al., 2010).
[0126] During an IVF protocol, embryo culture can last up to 7 days and the chance of embryo survival is low especially for early embryos produced by aged oocytes. As shown in Table 3 mouse oocytes aged in vitro (that serve as a model for oocyte of elderly woman's) have higher chances to develop in to healthy embryos post AC treatment (Fertilization rate increased from 0.02% to 25.2%) (Eliyahu et al., 2010). Since the embryo's gene activation machinery is not fully functional yet, it's very challenging for the embryos to survive for so long in culture.
[0127] As part of our effort to prolong embryo survival in culture we developed a method for preventing the apoptotic death of embryos cultured in vitro by administering an effective amount of the sphingolipid-metabolizing protein, acid ceramidase-encoding modRNA. The present disclosure describes using modRNA rather than recombinant protein based on the observation that modRNA can supply enzyme expression for at least 10 days even post embryo transfer and implantation. Usually, during human IVF protocol embryos will be transferred between days 3-5 and it is not possible to expose the embryo post transfer to the recombinant protein. In addition, all embryos will be incubated from the time of fertilization up to day 5 in the integrated EmbryoScopeTM time-lapse monitoring system (EmbryoScope, UnisenseFertiliTech, Vitrolyfe Denmark). The EmbryoScope offers the possibility of continuous monitoring of embryo development without disturbing culture conditions. The use of recombinant protein requires disruption of culture condition in order to refresh the media every 24-48 h.
[0128] Preliminary results demonstrated that modRNA survival cocktail injection into early mouse embryos dramatically improves the number of formed blastocytes (Table 3) and the number of live-born pups during IVF and embryo injection (Table 4).
TABLE-US-00003 TABLE 3 Zygotes Conditions Number 2 cells Blastocytes Control 81 70/81 27/81 (86%) (33%) AC ModRNA 101 91/101 78/101 (90%) (77%)
[0129] AC ModRNA improves the quality of embryos cultured in vitro. Mice sperm were incubated with 100ng/u Naked AC ModRNA for 1 h in 37 C. CO.sub.2 incubator. Post incubation, sperm were used for standard insemination (IVF) of C57BL/6 MII eggs. *(P<0.003).
TABLE-US-00004 TABLE 4 2-4 Conditions oocytes Zygotes cells Pups Pups/Oocytes Control 107 86 72 8 8/107 = 7.5% AC ModRNA 116 98 91 19 19/116 = 16.4%
[0130] AC ModRNA improves birth rate. Mice sperm were incubated with 100 ng/ul Naked AC ModRNA for 1 h in 37 C. CO.sub.2 incubator. Post incubation, sperms were used for standard insemination (IVF) of C57BL/6 MII eggs. All of the embryos from both groups were then transferred into pseudo pregnant female recipients, and the birth rates were recorded. As shown in Table 4, the birth rate of implanted 2- to 4-cell embryos from the AC ModRNA treated group (8/86, 19%) was higher than that without treatment (8/86, 9%), indicating no deleterious effect of the AC ModRNA treatment on implantation or development. The pups derived from the rAC-treated embryos were followed for up to 1 month, and all had a normal appearance and motor function (data not shown). *(P<0.05).
[0131] Survival effect of AC modRNA is evaluated on the basis of 1) sperm parameters, 2) embryo morphology and morphokinetics from day 1-5, 3) blastocyst ploidy, and 4) pregnancy rate.
[0132] Overall, these data identify AC as an important component of the in vivo/in vitro oocyte and embryo environment, and provide a novel technology for enhancing the outcome of assisted fertilization.
REFERENCES
[0133] Perez G I, Tao X J, Tilly J L. Fragmentation and death (a.k.a. apoptosis) of ovulated oocytes. Mol Hum Reprod. 1999; 5 (5):414-20. [0134] Eliyahu E, Park J H, Shtraizent N, He X, Schuchman EH. Acid ceramidase is a novel factor required for early embryo survival. FASEB J. 2007; 21 (7):1403-9. [0135] Eliyahu E, Shtraizent N, Martinuzzi K, Barritt J, He X, Wei H, Chaubal S, Copperman A B, Schuchman E H. Acid ceramidase improves the quality of oocytes and embryos and the outcome of in vitro fertilization. FASEB J. 2010; 24 (4):1229-38. [0136] Katalin Karik, Hiromi Muramatsu, Frank A Welsh, Jnos Ludwig, Hiroki Kato, Shizuo Akira, Drew Weissman. Incorporation of Pseudouridine Into mRNA Yields Superior Nonimmunogenic Vector With Increased Translational Capacity and Biological Stability. Mol Ther. 2008; 16 (11): 1833-1840. [0137] Yang H, Wang H, Shivalila C S, Cheng A W, Shi L, Jaenisch R. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 2013; 154 (6):1370-9. [0138] Wu Y, Liang D, Wang Y, Bai M, Tang W, Bao S, Yan Z, Li D, Li J. Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell. 2013; 13 (6):659-62. [0139] Ruzo A, Brivanlou A H. At Last: Gene Editing in Human Embryos to Understand Human Development. Cell Stem Cell. 2017; 21 (5):564-565. [0140] Frumkin T, Peleg S, Gold V, Reches A, Asaf S, Azem F, Ben-Yosef D, Malcov M. Complex chromosomal rearrangement-a lesson learned from PGS. J Assist Reprod Genet. 2017; 34 (8):1095-1100.