BISPECIFIC CHIMERIC ANTIGEN RECEPTORS AND THEIR APPLICATION IN THE TREATMENT OF TUMOR
20210000870 ยท 2021-01-07
Inventors
Cpc classification
A61K35/17
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K38/177
HUMAN NECESSITIES
A61K39/001117
HUMAN NECESSITIES
A61K38/1774
HUMAN NECESSITIES
C07K2317/73
CHEMISTRY; METALLURGY
A61K47/65
HUMAN NECESSITIES
C07K19/00
CHEMISTRY; METALLURGY
A61K35/545
HUMAN NECESSITIES
C07K14/70578
CHEMISTRY; METALLURGY
C07K16/2896
CHEMISTRY; METALLURGY
C07K16/2878
CHEMISTRY; METALLURGY
International classification
A61K35/17
HUMAN NECESSITIES
A61K47/65
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
Abstract
The embodiments of the present invention provide a bispecific chimeric antigen receptor, consisting of a signal peptide, two specific antigen-binding fragments, an extracellular spacer region, a transmembrane region, an intracellular co-stimulatory signaling domain, the first antigen that is recognized and bound by the specific antigen-binding fragments is a member selected from the group consisting of CD19, CD20, CD22, CD33, CD269, CD138, CD79a, CD79b, CD23, ROR1, CD30, B cell surface antibody light chain, CD44, CD123, Lewis Y, CD7 and CD46; the second antigen that is recognized and bound by the specific antigen-binding fragments is CD38, the two specific antigen-binding fragments is linked by a linker peptide, the bispecific chimeric antigen receptor can recognize respectively two kinds of tumor-associated antigens by constructing low affinity chimeric antigen receptors and high affinity chimeric antigen receptors and have very strong specificity. In addition, the embodiments of the present invention also provide a use of the bispecific chimeric antigen receptor in the treatment of tumors.
Claims
1. A chimeric antigen receptor, wherein: consisting of a signal peptide, two specific antigen-binding fragments, an extracellular spacer region, a transmembrane region, an intracellular co-stimulatory signaling domain, the first antigen that is recognized and bound by the specific antigen-binding fragments is a member selected from the group consisting of CD19, CD20, CD22, CD33, CD269, CD138, CD79a, CD79b, CD23, ROR1, CD30, B cell surface antibody light chain, CD44, CD123, Lewis Y, CD7 and CD46; the second antigen that is recognized and bound by the specific antigen-binding fragments is CD38, the two specific antigen-binding fragments is linked by a linker peptide.
2. The chimeric antigen receptor of claim 1, wherein: the chimeric antigen receptor is formed by a cell membrane localization signal peptide, a CD269 specific antigen-binding fragment, a linker peptide, a CD38 specific antigen-binding fragment, an extracellular spacer region, a transmembrane region, an intracellular signaling region and a co-stimulatory domain in a serially connected manner.
3. The chimeric antigen receptor of claim 2, wherein: the CD269 specific antigen-binding fragment comprises a framework region and a complementarity determining region CDR1-3, the amino acid sequence of the CD269 specific antigen-binding fragment includes any one of SEQ ID NO:1-SEQ ID NO:90 in the sequence list.
4. The chimeric antigen receptor of claim 3, wherein: the binding affinity constant Kd of the CD269 specific antigen-binding fragment to CD269 is <5.410.sup.8M.
5. The chimeric antigen receptor of claim 2, wherein: the CD38 specific antigen-binding fragment comprises a framework region and a complementarity determining region CDR1-3, the, amino acid sequence of the CD38 specific antigen-binding fragment includes any one of SEQ ID NO:91-SEQ ID NO:180 in the sequence list.
6. The chimeric antigen receptor of claim 5, wherein: the binding affinity constant Kd of the CD38 specific antigen-binding fragment to CD38 is between 5.210.sup.7M and 4.210.sup.5M.
7. The chimeric antigen receptor of claim 2, wherein: the cell membrane localization signal peptide is a membrane localization signal peptide of CD4, CD8, G-CSFR or GM-CSFR.
8. The chimeric antigen receptor of claim 2, wherein: the linker peptide is (GGGGS).sub.n or (EAAAK).sub.n, wherein 1n<4.
9. The chimeric antigen receptor of claim 2, wherein: the extracellular spacer region is an extracellular domain of protein CD4, CD8, CD28, CD137, CD27, PD-1, OX40, TLR4, ICAM-1, ICOS(CD278), NKp80(KLRF1), NKp44, NKp30 or NKp46.
10. The chimeric antigen receptor of claim 2, wherein: the transmembrane region is a transmembrane domain of protein CD4, CD8, CD28, CD137, CD27, PD-1, IL2R, IL2R, IL7R, NKG2D, NKG2C, IgG4 or IgG1.
11. The chimeric antigen receptor of claim 2, wherein: the intracellular signaling region is an intracellular domain of CD2, CD3, CD7, CD27, CD28, CD137, CD134, LCK, TNFR-1, TNFR-2, Fas, NKG-2D, DAP10, DAP12, B7-H3, TLR2 of TLR4IL7R or any combination thereof.
12. The chimeric antigen receptor of claim 1, wherein: the chimeric antigen receptor contains: (1) an amino acid sequence of any light chain variable region listed in SEQ ID NO:1-SEQ ID NO:180 in the sequence list; or (2) an amino acid sequence of any light chain variable region listed in SEQ ID NO:1-SEQ ID NO:180 in the sequence list, in which at least 1 but not more than 30 amino acid sequences are modified; or (3) an amino acid sequence having 90-99% identity to the amino acid sequence of any light chain variable region listed in SEQ ID NO:1-SEQ ID NO:180 in the sequence list.
13. The chimeric antigen receptor of claim 1, wherein: the chimeric antigen receptor contains: (1) an amino acid sequence of any heavy chain variable region listed in SEQ ID NO:1-SEQ ID NO:180 in the sequence list; or (2) an amino acid sequence of any heavy chain variable region listed in SEQ ID NO:1-SEQ ID NO:180 in the sequence list, in which at least 1 but not more than 30 amino acid sequences are modified; or (3) an amino acid sequence having 90-99% identity to the amino acid sequence of any heavy chain variable region listed in SEQ ID NO:1-SEQ ID NO:180 in the sequence list.
14. The chimeric antigen receptor of claim 2, wherein: the chimeric antigen receptor has an amino acid sequence corresponding to a construct in the Table 4.
15. A polypeptide, wherein: the polypeptide codes the chimeric antigen receptor of claim 1.
16. A gene, therein: the gene codes the chimeric antigen receptor of claim 1.
17. A genetically-engineered virus, wherein: the virus expresses the chimeric antigen receptor of claim 1 in a host cell.
18. A genetically-engineered effector cell, wherein: the effector cell expresses the polypeptide sequence of the chimeric antigen receptor of claim 1, the effector cell is a member selected from the group consisting of T lymphocytes, NK cells, hematopoietic stem cells, pluripotent stem cells, embryonic stem cells and induced pluripotent stem cells, or T lymphocytes and NK cells which is formed by inducing, culturing and differentiating the stem cells.
19. The genetically-engineered effector cell of claim 18, wherein the chimeric antigen receptor expresses on the cell membrane of the effector cell, and may specifically bind to the corresponding antigen.
20. Use of the chimeric antigen receptor of claim 1 in the preparation of antitumor drugs, anti-autoimmune disease drugs or anti-viral infectious disease drugs.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
BRIEF DESCRIPTION OF THE TABLES
[0046] Table 1 shows the amino acid codons.
[0047] Table 2 shows the binding affinity of recombinant BCMA monoclonal antibody to rBCMA.
[0048] Table 3 shows the binding affinity of recombinant CD38 monoclonal antibody to rCD38.
[0049] Table 4 shows different CAR constructs.
[0050] Table 5 shows the components within the qPCRmix Master I.
[0051] Table 6 shows the components within the qPCRmix Master II.
[0052] Table 7 shows the titer detection of recombinant lentivirus.
[0053] Table 8 shows the titer of Jurkar cells infected with BCMA-Fc recombinant lentivirus.
[0054] Table 9 shows in vitro killing efficiency of BM38CAR-T.
DETAILED DESCRIPTION OF THE INVENTION
[0055] Hereafter the present invention will be described in more detail with reference to the accompanying drawings and embodiments. The following examples are merely exemplary, and are only used to further describe the technical solution of the present invention. Those skilled in the art should understand that various modifications or replacements without departing from the spirit and scope of the present invention should be covered within the protection scope of the present invention. The experimental methods without the specific experimental conditions are usually in accordance with the conventional conditions or in accordance with the recommended conditions by manufacturers.
[0056] The present invention provides a human single chain antibody specifically targeting BCMA and CD38. In the following embodiments, the antibody of the present invention is derived from specific heavy and light chain sequences, and/or contains specific structural characteristics, for example contains a CDR region and a framework region of specific amino acid sequences. The present invention provides a method for screening and preparing antibodies, identifies the binding characteristics of the above antibodies by flow cytometry, constructs a CAR structure, and provides a preparation and application method of CAR-T cells carrying the corresponding CAR molecules.
[0057] In various embodiments of the present invention, at least one chimeric antigen receptor was provided, its structure and distribution were shown in
EXAMPLE 1
Construction of Human Stable BCMA-Expressing Cell Lines
[0058] 1.1 Construction of a Plasmid Vector
[0059] The vector system used in this example belongs to the third-generation, self-inactivating lentiviral vector system, this system has three plasmids, i.e., a packaging plasmid psPAX2 for coding the protein Gag/Pol and coding the protein Rev, an envelope plasmid pMD2.G for coding the protein VSV-G and a recombinant plasmid pCDH-CMV-huCD19-EF1-GFP-T2A-Puro for coding human BCMA extracellular region and transmembrane region based on an empty vector plasmid pCDH-CMV-MCS-EF1-GFP-T2A-Puro (purchased from Addgene company).
[0060] In accordance with the human BCMA sequence provided by Genbank Accession No. NM_001192.2, a PCR-based gene synthesis was used for synthesizing a signal peptide, a human BCMA extracellular region, a transmembrane region and an intracellular region, PCR amplification of
TABLE-US-00001 SEQIDNO:187 (huBCMA-F):5>ATGTTGCAGATGGCTGGGCAG<3 SEQIDNO:188 (huBCMA-F):5>TACCTAGCAGAAATTGATTTC<3
[0061] was performed with primers, the amplification conditions were as follows: pre-denaturation: 94 C., 4 min, denaturation: 94 C., 30 s; annealing: 58 C., 30 s; extension: 68 C., 80 s; 30 cycles. The theoretical size of the obtained fragment was 1716 bp, the amplified product had the same size as the theoretical size by analyzing using agarose gel electrophoresis. Wherein, the XhoI and BamHI restriction sites were introduced into the upstream and downstream of the open reading frame. The obtained targeted gene was double digested by XhoI and BamHI, and linked into a pCDH-CMV-MCS-EF1-GFP-T2A-Puro vector digested by the same double enzymes. The successfully constructed lentiviral vector pCDH-CMV-huBCMA-EF1-GFP-T2A-Puro was packaged after identification by XhoI and BamHI enzymes digestion and sequencing without errors.
[0062] 1.2 293 Plasmid Transfected T Cells Packaging Lentiviral
[0063] 293 T cells (ATCC: CRL-11268) was inoculated at a density of 610.sup.6 to the 6th10th generations in a 10 cm petri dish, incubated overnight at 37 C. with 5% CO.sub.2, which is ready for transfection. The medium is a DMEM (ThermoFisher company) containing 10% phage-free fetal bovine serum (Hangzhou Sijiqing company), the next day, the medium was changed into serum-free DMEM about 2 hours prior to transfection.
[0064] The transfection steps were as follows: [0065] 1) 5 g of target gene plasmid pCDH-CMV-huBCMA-EF1-GFP-T2A-Puro, 7.5 g of packaging plasmid pCDH-CMV-huBCMA-EF1-GFP-T2A-Puro, pSPAX 2 and 2.5 g of envelope plasmid pMD2.G were dissolved in a 500 L Mill Q water and mixed well; [0066] 2) 62 L of 2.5 M CaCl.sub.2 (Sigma Corporation) was added dropwise and vortex mixed at 1200 rpm/min; [0067] 3) finally, 500 L of 2 HBS (280 mM NaCl, 10 mM KCl, 1.5 mM Na.sub.2HPO.sub.4, 12 mM glucose, 50 mm Hepes (Sigma Corporation), pH 7.05, filter sterilization by 0.22 M) was added drop wise and mixed by shaking at 1200 rpm/min for 10 s; [0068] 4) the formation was added immediately drop wise into a petri dish, and shaked gently at 37 C. with 5% CO.sub.2, the medium was changed into DMEM containing 10% fetal bovine serum after 4-6 h incubation.
[0069] After 48 h or 72 h transfection, the cell debris was removed by centrifugation, followed by the virus was collected by filtration through a 0.45 m filter (Millipore Corporation).
[0070] 1.3 Recombinant Lentiviral Infected Leukemia Hela or K562 Cells
[0071] After the collected virus solution was concentrated and titrated, and was used to infect the Hela or K562 cells in a 6-well plate. Three days after infection, the cells were collected, part of the cells was taken and the cell-surface BCMA expression was detected by flow cytometry. The remaining cells were incubated for expansion, and some of the cells was frozen and saved, others were passaged in 6-well plate, 2 g/ml of Puromycin antibiotic (purchased from Sigma) was added to screen for 1-2 weeks till all cells in view expressed GFP under microscope observation or the BCMA expression was detected by flow cytometry, when compared with the negative cells, the stably transfected cells should exhibit positive GFP and BCMA expression. The frozen cells was used for the killing assay by subsequent flow cytometry, the amount of the antibiotic was halved during subsequent cultivation to maintain over-expression of the corresponding genes.
EXAMPLE 2
Screening and Identification of Specific Single-Chain Antibody (scFv) Binding to Human BCMA
[0072] 2.1 Screening of Anti-Human BCMA Specific Single Chain Antibody by Phage Display
[0073] The sequence of the single-chain antibody specifically binding to human BCMA was screened from directionally modified human single-chain antibody phage libraries by phage display technology of single chain antibody.
[0074] To achieve such objective, a glycerol bacteria from a phage display natural library (a self-constructing library) of fully human single chain antibodies was inoculated in a 400 ml 2YT/ampicillin medium to reach a cell density of OD600=0.1, and cultured at 37 C. under shaking condition (200 rpm) till the cell density reached OD600=0.5. 10.sup.12 Pfu of M13KO7 helper phage (purchased from ThermoFisher Corporation) was used to infect and the cultivation was performed for 30 minutes at 30 C. and 50 rpm. After adding 50 mg/L kanamycin, the cultivation was performed for 30 minutes at 37 C. under shaking condition (200 rpm), the precipitate was separated through centrifugation (15 minutes, 1600g, 4 C.) and resuspended in the 400 ml 2YT/ampicillin/kanamycin medium, the cultivation was performed for 16 hours at 37 C. under shaking condition (200 rpm). Finally, the precipitate was separated through centrifugation (20 minutes, 5000g, 4 C.) and discarded, the supernatant was filtered through a 0.45 m filter, added with volume of 20% (w/v) PEG8000, 2.5M NaCl solution and incubated for 1 hour in an ice bath to precipitate phage particles. Followed by centrifugation (20 min, 8000g, 4 C.), the supernatant was discarded, the phage precipitate was resuspended in a 25 ml pre-cooled PBS solution (NaCl, 2.7 mM KCl, 8 mM Na.sub.2HPO.sub.4, 2 mM KH.sub.2PO.sub.4) and centrifuged (5 minutes, 20000g, 4 C.). 1/4 volume of 20% (w/v) PEG8000, 2.5M NaCl solution was added to the supernatant, and put in an ice bath for 30 minutes to re-precipitate phage particles. Followed by centrifugation and precipitation (30 min, 20000g, 4 C.), the phage precipitate was resuspended in a 2 ml pre-cooled PBS solution, kept in an ice bath for 30 minutes and centrifuged (30 minutes, 17000g, 4 C.). The supernatant was mixed with a PBS solution containing 4% (w/v) BSA in a ratio of 1:1, placed on a rotary mixer, maintained at room temperature for 30 minutes, and then used directly for screening.
[0075] The directional screening for a biotin-labeled recombinant human Fc-BCMA protein (available from Acrobiosystems Corporation) was implemented for 3 rounds using the phage antibody libraries, the screening protocol was as follows:
[0076] The phage antibody libraries and the biotin-labeled recombinant human Fc-BCMA antigen were incubated for 2 hours at room temperature, and then were incubated for 30 minutes at room temperature with streptavidin-labeled Dynabeads magnetic beads (available from ThermoFisher Corporation) blocked with 2% BSA solution. And then the magnetic beads were washed with PBST (containing 0.1% Tween-20) buffer, the phage having non-specific binding or weak binding ability was removed. The phage having strong binding ability was eluted with glycine-hydrochloric acid buffer (pH 2.2) from the magnetic beads and neutralized with Tris neutralizer (pH 9.1) for infecting E. coli ER2738 in logarithmic growth phase and the next round of screening. During the 3 rounds of screening, the amount of the magnetic beads were 50 l, 20 l and 10 l respectively, the concentration of the biotin-labeled human Fc-BCMA antigen were 100 nM, 10 nM and 1 nM respectively, the numbers of washing with PBST were 10 times, 15 times and 20 times respectively.
[0077] 1.2 Identification of Human BCMA Specific Single Chain Antibody
[0078] Single clone were randomly selected from the third round of screening clones, its binding capacity to human Fc-BCMA was analyzed by single phage ELISA (enzyme-linked immunosorbent assay). For this purpose, each single colony was inoculated with 300 l 2YT/ampicillin medium (containing 2% of glucose) in a 96-well deep-well plate, and cultured for 16 hours at 37 C. under shaking condition (250 rpm). 20 l cultures were inoculated to a 500 l 2YT/ampicillin medium (containing 0.1% of glucose), and cultured for 1.5 hours at 37 C. under shaking condition (250 rpm). A helper phage solution was prepared, 75 l of M13KO7 (the titer was 310.sup.12 pfu/ml) was mixed into a 15 ml 2YT medium, added to the culture plate in 50 l/well. The cultivation was performed for 30 minutes at 37 C. and 150 rpm, followed by the prepared kanamycin solution (180 l 50 mg/ml of kanamycin was taken and added to a 15 ml 2YT medium) was added in 50 l/well, and the cultivation was performed for 16 hours at 37 C. under shaking condition (250 rpm). Finally, the cells were centrifuged and precipitated (30 minutes, 5000g, 4 C.), the supernatant was transferred to a new 96-well deep-well plate.
[0079] To perform a single phage ELISA, a human Fc-BCMA recombinant antigen (100 ng/well) and a negative control protein Fc (100 l/well) in a 96 well MediSorp ELISA plate (available from Thermo Fisher) were coated overnight at 4 C. Each well was closed by a PBST solution containing 2% BSA. After that the wells were washed three times with PBST and patted to clean. And then each prepared phage solution was added to each well in the plate in 100 l/well. Washing was performed with PBST three times after incubation at 37 C. for 2 hours. In order to detect bound phages, anti-M13 antibody superoxide dismutase conjugate (purchased from Proteintech Group, Inc) was diluted in PBST at 1:5000, 100 l was added to each well. Washing was performed with PBST three times after incubation at 37 C. for 1 hours, and then washing was performed with PBST three times. Finally, 50 l TMB substrate was drawn and added to wells, and developed for 10 minutes at room temperature, and then 50 l of 2 M H.sub.2SO.sub.4 per well was added to stop the color reaction. The extinction value was determined by enzyme-linked immunosorbent assay (Bio-Rad) at 450 nm. For the wells which was judged as positive in accordance with the extinction value, the phage plasmid was extracted to perform a sequencing verification for scfv sequences, the amino acid sequence of the obtained single-chain antibodies was analyzed as shown in the sequence list, the single-chain antibodies of the present invention had very strong binding signal to human Fc-BCMA in ELISA experiments, had no binding or very weak binding to Fc recombinant protein, the binding curve of the single chain antibodies to different concentrations of BCMA antigen was shown in
[0080] In order to initially determine whether the phage obtained by screening which express scFv may bind to the BCMA native antigen, the concentrated phage by centrifugation was used to stain and perform a flow analysis for BCMA-K562 cells. The binding ability of the concentrated phage with human BCMA antigen on cell surface was analyzed by a flow cytometry (CytoFLEX, Beckman). The specific method was as follows:
[0081] 1) Raji, K562-BCMA and K562 cells in logarithmic growth phase were taken, inoculated in a T25 cell culture flask with an inoculation density of about 510.sup.5 cell/ml and cultured overnight at 37 C. in a culture incubator.
[0082] 2) The culture medium in the petri dish was slightly shaked, the cells were collected by centrifugation at 200 g5 min, resuspended in a phosphate buffer (NBS PBS) containing 1% of bovine calf serum at a concentration of 2310.sup.6/mL and added into a flow special tube in an amount of 100 ul/tube.
[0083] 3) The centrifugation at 200 g5 min was performed, the supernatant was discarded.
[0084] 4) The phage to be tested and positive antibodies were respectively added into two experimental groups, a PBS blank control without antibodies was set as the control group. The final concentration of each phage was 20 g/ml, each tube was added with 100 ul and placed in an ice bath for 45 minutes.
[0085] 5) Each tube was added with 2 ml 1% NBS PBS and centrifuged at 200 g5 min two times.
[0086] 6) The supernatant was discarded, goat anti-human antibody FITC (ProteintechGroup, Inc.) at a dilution of 1:100 was added at 100 ul/tube and placed in an ice bath for 45 minutes.
[0087] 7) Each tube was added with 2 ml 1% NBS PBS and centrifuged at 200 g5 min two times.
[0088] 8) The supernatant was discarded, resuspended, in a 300 l 1% NBS PBS, and detected by flow cytometry.
[0089] 9) Data was analyzed by flow cytometry data analysis software CytoExpert 2.0.
[0090] The flow cytometry results show that, compared with the isotype control IgG, BCMA-K562 cells stained with BCMA-targeted single-chain antibody exhibit significantly different fluorescence peak, but there is no obvious difference for human BCMA negative K562 cells, this indicates that the phage obtained by screening which binds BCMA may recognize specifically human BCMA extracellular region, the result of the typical flow analysis was shown in
EXAMPLE 3
Preparation and Activity Analysis of Anti-BCMA Antibodies
[0091] 3.1 Light and heavy chain eukaryotic expression vectors of the selected single-chain antibodies were constructed, transfected with HEK293F to induce a recombinant expression and the purification was performed. The light and heavy chains in the sequence of single chain antibody obtained in example 1 were constructed respectively into a monoclonal antibody expression plasmid pCMV-V5-Fc, after the sequence was confirmed by sequencing without errors, the plasmid was prepared in large quantity. The light and heavy chain expression plasmids were mixed in an appropriate ratio, and then transfected into HEK-293 F cells with well growth, and cultured continuously for 7 days at 37 C. with 5% CO.sub.2 in a shaker (125 rpm). Centrifugation at 4000 rpm was performed for 10 min, the precipitate was removed, the supernatant was collected, and washed with 0.45 m membrane filter, the treated samples were subjected to a Protein A (available from GE Corporation) affinity column to purify, finally, a purified recombinant antibody BCMA with murine IgG Fc regions was obtained, the identification results by polyacrylamide gel electrophoresis was shown as
[0092]
[0093] 3.2 Binding Activity of Recombinant Antibodies to Human BCMA Antigen by ELISA Analysis
[0094] The binding activity of the screened antibodies to human BCMA antigen was measured by ELISA experiment in concentration gradient. For this purpose, the human BCMA-His antigen was diluted with a 0.1M NaHCO.sub.3 (pH 9.6) coating solution, each well was coated with 100 ng (50 l/well) overnight at 4 C. and closed by a PBST blocking solution containing 2% BSA and 0.01% (v/v) Tween-20 for 2 hours at room temperature. PBST was used to wash the plate for three times and removed. After that, each well was added with 100 l PBST solution containing a series of concentrations (the starting concentration was 10 nM with a 3-fold gradient dilution still 1:729) of each antibody protein. Each sample was measured by parallel three-well analysis. Washing was performed with PBST three times after incubation at 37 C. for 2 hours, and then a horseradish peroxidase-labeled goat anti-human antibody (purchased from Proteintech Group, Inc) with a dilution of 1:20000 was at 100 l/well, and reacted at 37 C. for 1 hour. In order to detect, the wells were washed three times with PBST, and then washed three times with PBS. Finally, TMB was added to develop for 15 minutes and then 50 l of 2 M H.sub.2SO.sub.4 per well was added to stop the color reaction. The extinction value was determined by enzyme-linked immunosorbent assay (Bio-Rad) at 450 nm. GraphPad software was used to evaluate the absorbance value, and the binding strength of antibodies was calculated. For this purpose, a plot for the extinction values measured in each case vs the corresponding antibody concentration was drawn, and the resulting curve is fitted by the following nonlinear regression, the apparent affinity was calculated according to the formula A0/(A0A)=1+KD/a (where A0 is OD value of an antibody in the absence of antigen, A is OD value after adding antigen with a molar concentration of a, and KD is the inverse of the affinity constant), as shown in Table 2. The binding activity of the obtained anti-human BCMA single chain antibody in example 1 to the BCMA-His antigen was between 54 nM and 0.91 nM after being recombinant expressed into a complete antibody.
EXAMPLE 4
Construction of Human Stable BCMA-Expressing Cell Lines
[0095] 4.1 Construction of a Plasmid Vector
[0096] The vector system used in this example belongs to the third-generation, self-inactivating lentiviral vector system, this system has three plasmids, i.e., a packaging plasmid psPAX2 for coding the protein Gag/Pol and coding the protein Rev, an envelope plasmid pMD2.G for coding the protein VSV-G and a recombinant plasmid pCDH-CMV-huBCMA-EF1-GFP-Puro for coding human BCMA extracellular region and transmembrane region based on an empty vector plasmid pCDH-CMV-MCS-EF1-GFP-Puro (purchased from Addgene company).
[0097] In accordance with the human BCMA sequence provided by Genbank Accession No. NM_001192.2, PCR-based gene synthesis were used for synthesizing signal peptides, a human BCMA extracellular region, a transmembrane region and an intracellular region, PCR amplification of
TABLE-US-00002 huBCMA-F(SEQIDNO189):5-TGTGATCATGTTGCAGAT-3 huBCMA-R(SEQIDNO190):5-TACCTAGCAGAAATTGAT-3
[0098] was performed with primers, the amplification conditions were as follows: pre-denaturation: 94 C., 4 min, denaturation: 94 C., 30 s; annealing: 58 C., 30 s; extension: 68 C., 80 s; 30 cycles. The theoretical size of the obtained fragment was 1716 bp, the amplified product had the same size as the theoretical size by analyzing using agarose gel electrophoresis. Wherein, the XhoI and BamHI restriction sites were introduced into the upstream and downstream of the open reading frame. The obtained targeted gene was double digested by XhoI and BamHI, and linked into a pCDH-CMV-MCS-EF1-GFP-Puro vector digested by the same double enzymes. The successfully constructed lentiviral vector pCDH-CMV-huBCMA-EF1-GFP-Puro was packaged after identification by XhoI and BamHI enzymes digestion and sequencing without errors.
[0099] 4.2 293 Plasmid Transfected T Cells Packaging Lentiviral
[0100] 293 T cells (ATCC: CRL-11268) was inoculated at a density of 610.sup.6 to the 6th10th generations in a 10 cm petri dish, incubated overnight at 37 C. with 5% CO.sub.2, which is ready for transfection. The medium is a DMEM (Thermo Fisher company) containing 10% phage-free fetal bovine serum (Hangzhou Sijiqing company), the next day, the medium was changed into a serum-free DMEM about 2 hours prior to transfection.
[0101] The transfection steps were as follows:
[0102] 1) 5 g of target gene plasmid pCDH-CMV-huBCMA-EF1-GFP-T2A-Puro, 7.5 g of packaging plasmid pCDH-CMV-huBCMA-EF1-GFP-T2A-Puro, pSPAX 2 and 2.5 g of envelope plasmid pMD2.G were dissolved in a 500 L Mill Q water and mixed well;
[0103] 2) 62 l of 2.5 M CaCl.sub.2 (Sigma Corporation) was added dropwise and vortex mixed at 1200 rpm/min;
[0104] 3) finally, 500 L of 2 HBS (280 mM NaCl, 10 mM KCl, 1.5 mM Na.sub.2HPO.sub.4, 12 mM glucose, 50 mm Hepes (Sigma Corporation), pH 7.05, filter sterilization by 0.22 M) was added drop wise and mixed by shaking at 1200 rpm/min for 10 s;
[0105] 4) the formation was added immediately drop wise into a petri dish, and shaked gently at 37 C. with 5% CO.sub.2, the medium was changed into DMEM containing 10% fetal bovine serum after 4-6 h incubation.
[0106] 5) After 48 h or 72 h transfection, the cell debris was removed by centrifugation, followed by the virus was collected by filtration through a 0.45 m filter (Millipore Corporation).
[0107] 4.3 Recombinant Lentiviral Infected Leukemia Hela or K562 Cells
[0108] After the collected virus solution was concentrated and titrated, and was used to infect the Hela or K562 cells in a 6-well plate respectively. Three days after infection, the cells were collected, part of the cells was taken to mix and clone and the cell-surface BCMA expression was detected by flow cytometry and BCMA-targeted fluorescently labeled antibodies. The method and steps by flow cytometry are the same as in Example 5. The remaining cells were incubated for expansion, and some of the cells was frozen and saved, others were passaged in 6-well plate, 2 ug/ml of Puromycin antibiotic (purchased from Sigma) was added to screen for 1-2 weeks till all cells in view expressed GFP under microscope observation. The frozen cells were used for the killing assay by subsequent flow cytometry. For example, the constructed stable BCMA-expressing cell lines K562 and Hela were detected by using the recombinant anti-BCMA monoclonal antibody expressed and purified in Example 2 and the corresponding fluorescently labeled secondary antibody by flow cytometry. The results were shown in
EXAMPLE 5
Screening and Analysis of Single Chain Antibodies Binding to Targeting CD38
[0109] In order to obtain the sequences of monoclonal antibodies binding to targeting CD38, the present example constructed a human CD38 phage library by using the same method as described in Example 2, 10 strains of single-chain antibodies capable of binding specifically to human CD38 were obtained by screening, the CD38 molecules binding to human CD38 cell membrane surface were identified by flow detection.
[0110] The binding curve of the recombinant antibodies binding targetedly to CD38 obtained by the present example to CD38 by using recombinant expressed CD38 extracellular region antigen and ELISA method (which is the same as the ELISA method in Example 3) was shown in
EXAMPLE 6
Construction of Chimeric Antigen Receptors Targeting BCMA and CD38
[0111] The sequences of bispecific chimeric antigen receptors targeting BCMA and CD38 was shown in Table 4, one single chain antibody targeting BCMA and one single chain antibody targeting CD38 were combined, the two single-chain antibodies were linked by a linker peptide, the second single-chain antibody is followed by a transmembrane region and a co-stimulatory signal molecule. As an example, the present example illustrated the construction of dual-targeted chimeric antigen receptors, packaging of recombinant lentivirus, transduction and preparation of CAR-T cells, and detection method of tumor cell killing ability by forming a dual-antigen recognition region by combining one strain of BCMA monoclonal antibody with high affinity and three strains of CD38 monoclonal antibodies with different affinities respectively. In each combination, two scFv fragments were connected respectively in different orders and rigid series, 6 dual-antigen recognition regions (BM38-07, BM38-06, BM38-05, 38BM-05, 38BM-06, 38BM-07) were formed in total, which described the killing ability of the tumors obtained by different combinations and prevention of killing behaviors targeting non-tumor cells.
[0112] The experimental materials and equipment used in this example were as follows:
[0113] Lentiviral backbone plasmid pLVX-EF1 was constructed by our company and was saved after verification by full-length sequencing without errors, lentiviral packaging plasmid pRSV.REV (Rev expression plasmid), pMDLg/p.RRE (Gag/Pol expression plasmid), pVSV-G (VSV glycoprotein expression plasmid) were purchased from Addgene, HEK293T cells, Jurkat cells were purchased from China Center for Type Culture Collection, LentiX-293 T cells were purchased from Clontech, BCMA-K562 cells was constructed by our company.
[0114] Human fresh peripheral blood was provided by healthy volunteers;
[0115] 0.22 m-0.8 m PES filter was purchased from PALL company; 200 mesh cell screen, 10 cm, 15 cm cell culture dishes, 1 L culture bag, 24-well, 6-well culture plates, 10-layer cell culture factory were purchased from Corning company; D-PBS 0.4% of trypan blue was purchased from Thermo company, and polyethylenimine (PEI) was purchased from POLYSCIENCES company.
[0116] Opti-MEM, Pen-Srep, Hepes, FBS, AIM-V, RPMI 1640, DMEM, Trypsin, Lipofectamine 3000 were purchased from Thermo company; Biotinylated protein L was purchased from GeneScrip company; LDH detection kit was purchased from Promega company; Ficoll lymphocyte isolation liquid was purchased from GE company; 20% human albumin injection was purchased from CSL Behring company; rIL-2, rIL-7, rIL-15, and rIL-21 were purchased from Cytocares company; CD3 monoclonal antibodies, CD28 monoclonal antibodies. CD3/CD28 magnetic beads and CD4/CD8 magnetic beads were purchased from Miltenyi company;
[0117] CD4-FITC and CD8-APC were purchased from BioLegend company, Phycoerythrin (PE)-conjugated streptavidin was purchased from BD Bioscience company; Protein L Magnetic Beads were purchased from BioVision company;
[0118] The coding DNA sequences and amino acid combination of CAR constructs BM38-07, BM38-06, BM38-05, 38BM-05, 38BM-06 and 38BM-07 were shown in Table 4. The sequences were synthesized by Wuhan Gene Create Biological Engineering Co., Ltd. The oligonucleotide sequence was loaded into the vector pLVX-EF-1 by restriction endonuclease digestion or homologous recombination, and the resulting recombinant plasmid was saved after verification by sequencing without errors.
EXAMPLE 7
Preparation of Dual-Targeted Chimeric Antigen Receptor Recombinant Lentivirus
[0119] Preparation of Solution:
[0120] DMEM complete medium: DMEM pre-prepared medium stored at 2-8 C. was taken out, added with 10% (v/v) phage-free fetal bovine serum, and stored at 2-8 C. for later use after mixing in upside down;
[0121] 1 PBS Solution:
[0122] 0.5M CaCl.sub.2 Solution:
[0123] 1 g/L of PEI solution: 1 g of PEI powder was weighed, dissolved with 900 ml Milli-Q grade ultrapure water, heated in a water bath to 60-80 C. under continuous stirring, the pH was adjust with HCl to about 2.0 after calibrating the pH meter. The beaker was covered, a continue stirring was performed for 3 h until the powder was completely dissolved. After cooling to room temperature, NaOH was added to adjust the pH to 6.9-7.1. The solution was transferred to a volumetric flask and added with water to dilute to 1 L, filtered through a 0.22 m PES needle filter and then packed, the resultant solution were stored at 20 C. for long-term storage, and can be stored in a 2-8 C. freezer for short-term use;
[0124] 2 HBS Solution:
[0125] 0.25% (m/V) Trypsin solution: 2.50 g of Trypsin and 0.20 g of EDTA were weighed and placed into a 1000 ml beaker, was added with 900 ml 1 PBS to dissolve, a 1000 ml graduated cylinder was used to dilute to 1000 ml after completing the dissolution, disposable syringe filter (0.22 m, PES) was used to filter to sterilize, the resultant solution was packed and stored in a 50 ml centrifuge tube, can be stored in a 20 C. refrigerator for long-term storage, and in a 2-8 C. refrigerator for short-term use;
[0126] 1 M NaOH Solution
[0127] 1.5 M NaCl Solution, 1 M NaCl Solution, 0.15 M NaCl Solution:
[0128] 1 M Tris-HCl (pH 6-8) Solution
[0129] 250 mM Tris-HCl (pH 6-8) Solution:
[0130] 25 mM Tris-HCl (pH 6-8) Solution:
[0131] The flow for constructing the recombinant lentivirus according to the present invention was shown in
[0132] 1. Construction of Recombinant Lentiviral Backbone Plasmids
[0133] As shown in the above figure, the sequences of the fully synthetic chimeric antigen receptors (BM38-05, BM38-06, BM38-07, 38BM-05, 38BM-06, 38BM-07) based on BCMA, CD38 dual targets were constructed to the multiple cloning site MCS at downstream of the promoter EF1 of lentiviral backbone plasmid pLVX-EF1 by double digestion and re-ligation to obtain recombinant lentiviral backbone plasmids pLVX-EF1-BM38-05, pLVX-EF1-BM38-06, pLVX-EF1-BM38-07, pLVX-EF1-38BM-05, pLVX-EF1-38BM-06, pLVX-EF1-38BM-07, the enzyme cleavage sites were 5-BamHI, 3-XhoI. The constructed recombinant backbone plasmids were prepared in a large-scale for recombinant lentiviral packaging after verification by sequencing without errors.
[0134] 2. Preparation in a Large-Scale of Recombinant Lentiviral Backbone Plasmids and Packaging Plasmids
[0135] For the constructed lentiviral backbone plasmids and other packaging plasmids above, a standard strain library was established, and then the strains were activated and cultured in large numbers. The thalli were collected, and the above plasmids were extracted and prepared by the method in guideline for EndoFree Maxi Plasmid Kit and plasmid extraction kits for subsequent cell transfection and recombinant virus packaging.
[0136] 3. Cultivation of LentiX-293T Cells
[0137] 1) The frozen LentiX-293 T cells were taken out from a liquid nitrogen tank, rapidly transferred to a 37 C. water bath for 1-2 min and then transferred to a biological safety cabinet; 9 ml of pre-cooled complete medium containing 10% FBS was in advance added into a 15 ml centrifuge tube, the cell sap in a cryogenic vial slowly transferred to a 15 ml centrifuge tube with 1 ml pipette, and centrifuged for 10 minutes at 1000 g and the supernatant was discarded, the precipitate was re-suspended with 3 ml of complete medium, and then transferred to a 10 cm petri dish, supplemented with complete medium containing 10% FBS to 8 ml/10 cm dish, after 24 hours, the cells were observed by a microscope, and the cells were passaged again when the cell confluence reached about 70%.
[0138] 2) LentiX-293 T cells, which are free from contamination and in a good condition, were selected, 5 petri dishes was set as one group, after the cells were trypsinized, 8 ml complete medium was drawn with an electric pipette, 2 ml, was added into each digested petri dish to prevent the petri dish from drying, all cells are blown into a single cell suspension using a 10 ml pipette and transferred into a T75 culture medium flask;
[0139] 3) The remaining cells in the 5 petri dishes were transferred to a culture flask and transferred to a culture flask after rinsing again with the culture medium;
[0140] 4) The cap of the culture flask was covered tightly, the cell suspension was mixed well in upside-down or by the electric pipette, a proper amount of cell suspension was taken for counting after dilution, the cell suspension was evenly distributed into 20 of 10 cm petri dishes according to the counting result to ensure that each plate has a cell density of about 410.sup.6 cell/10 ml, a cross-shaped shaking was performed for several times along the front-and-back and the left-and-right direction to make the cells spread out, and the cell suspension was cultured in a 5% (v/v) CO.sub.2 incubator with a saturated humidity.
[0141] 5) The passaged cells were checked, the culture medium for cells was changed when the cell confluence reached 70-80%, the cells adhere well, the cell contour was full and the cells were evenly distributed at the bottom of the petri dishes. The culture medium was replaced with 8 ml of pre-warmed fresh complete medium.
[0142] 4. Cell Transfection of LentiX-293T
[0143] 6) ADNA/PEI solution was prepared in a proportion of 1:1 (v/v), the following operations were implemented in a biosafety cabinet in accordance with a sterile operation standard. The amount of LentiX-293 T cells transfected plasmid in each dish was used according to the following proportions: recombinant lentiviral backbone plasmid (20 g), pRSV-REV (15 g), pMDL-RRE (10 g), pVSV-G (7.5 g). A new 5 ml centrifuge tube was taken, added with the packaging plasmids in the above amount and supplied with DMEM to 1.0 ml, covered, and mixed fully;
[0144] 7) The transfection was carried out in accordance with the operation on PEI transfection kits
[0145] 8) After 72 hours, the supernatant from the same dish was collected again together, the supernatant collected at this time contained recombinant lentivirus LV-BM38-07, LV-BM38-06, LV-BM38-05, LV-38BM-05, LV-38BM-06, LV-38BM-07.
[0146] 5. Purification of Recombinant Lentiviral by Ion Exchange Chromatography
[0147] 1) The collected supernatant was filtered by a vacuum pump through a 0.22 m-0.8 m PES filter to remove impurities and cellular fractions;
[0148] 2) The supernatants were added with 1.5 M NaCl 250 mM Tris-HCl (pH 6-8) in a ratio of 1:1-1:10;
[0149] 3) Two ion exchange columns were placed in series, sequentially passed through a column with 4 ml 1 M NaOH, 4 ml 1 M NaCl, 5 ml 0.15 M NaCl 25 mM Tris-HCl (pH 6-8) solution;
[0150] 4) The solution obtained in the step 2 was loaded onto an ion exchange column through a peristaltic pump at speed of 1-10 ml/min;
[0151] 5) After all of supernatant was passed through the column, washed once with 10 ml 0.15 M NaCl 25 mM Tris-HCl (pH 6-8) solution;
[0152] 6) 1-5 ml 1.5 M NaCl 25 mM Tris-HCl (pH 6-8) was used to elute according to the loading amount, the eluate was collected;
[0153] 7) The eluate was distributed into 50 L per tube and frozen in a 80 C. refrigerator for long-term storage.
[0154] 6. Determination of Recombinant Lentivirus Titer
[0155] 1) 293 T cells were inoculated in a 24-well plate with 510.sup.4 cell/well, the volume of the added medium was 500 ul, different types of cells had different growth rates, and the cell fusion rate during virus infection was 40% -60%;
[0156] 2) 3 sterile EP tubes were prepared, each tube was charged with 90 ul of fresh complete medium (high glucose DMEM+10% FBS), 24 hours after inoculation, two wells of cells were taken and counted with a hemocytometer to determine the actual number of cells at the time of infection, the number was referred to as N;
[0157] 3) 10 ul of the virus stock to be measured was taken and added to the first tube, gently mixed, 10 ul of the solution was taken and added to the second tube, and then the operation was continued until the last tube; 410 ul of complete medium (high Sugar DMEM+10% FBS) was added in each tube, the final volume was 500 ul;
[0158] 4) 20 hours after the beginning of infection, the supernatant was removed, replaced with 500 l of complete medium (high sugar DMEM+10% FBS), and cultured continuously for 48 hours with 5% CO.sub.2;
[0159] 5) After 72 hours, the fluorescence expression was observed, under normal conditions, the number of fluorescent cells decreased with increase of dilution fold, and then photographed;
[0160] 6) The cells were digested with 0.2 ml 0.25% trypsin-EDTA solution, placed at 37 C. for 1 min. The entire cell surface was purged with the medium, the cells were harvested by centrifugation. Genomic DNA was extracted according to the instruction on DNeasy kit. Each sample tube was charged with 200 l eluent to wash DNA and quantitated;
[0161] 7) Preparation of target DNA detection qPCRmix master I (the sequences of qPCR primer were SEQ ID NO:191-SEQ ID NO.196):
TABLE-US-00003 EF1-F: (SEQIDNO:191) 5-TATCGATGCTCCGGTGCCCGTCAGT-3 EF1-R: (SEQIDNO:192) 5-TCACGACACCTGAAATGGAAGA-3 WPRE-qPCR-F: (SEQIDNO:193) 5-TCCGGGACTTTCGCTTT-3 WPRE-qPCR-R: (SEQIDNO:194) 5-CAGAATCCAGGTGGCAACA-3 Actin-qPCR-F: (SEQIDNO:195) 5-CATGTACGTTGCTATCCAGGC-3 Actin-qPCR-R: (SEQIDNO:196) 5-TCCTTAATGTCACGCACGAT-3
[0162] The components of the qPCRmix Master I was shown in Table 5. In Table 5, N=number of reactions. For example: the total reaction number was 40, 1 ml 2 TaqMan Universal PCR Master Mix, 4 l forward primer, 4 l reverse primer, 4 l probe and 788 l H.sub.2O were mixed, shaken and then placed on ice.
[0163] Preparation of internal control DNA detection qPCRmix tube II (the sequences of qPCR primer were SEQ ID NO:194, SEQ ID NO.195):
TABLE-US-00004 (SEQIDNO:194) Actin-qPCR-F:5-CATGTACGTTGCTATCCAGGC-3 (SEQIDNO:195) Actin-qPCR-R:5-TCCTTAATGTCACGCACGAT-3
[0164] The components of the qPCRmix Master II was shown in Table 6. In Table 6, N=number of reactions. For example: the total reaction number was 40, 1 ml 2 TaqMan Universal PCR Master Mix, 100 l 10RNaseP primer/probe mix and 700 l H.sub.2O were mixed, shaken and then placed on ice.
[0165] The PCR system was established on a pre-cooled 96-well PCR plate. 45 l was taken from Master I to add into the wells of each row of A-D, 45 l was taken from Master I to add into the wells of each row of E-G.
[0166] 5 l of plasmid standard and genomic DNA of the samples to be tested were added to the rows of A-D, and each sample was repeated once. 1 more well was left to add with 5 l of water as a no-template control.
[0167] 5 l of genomic standard and genomic DNA of the samples to be tested were added to the rows of E-G, and each sample was repeated once. 1 more well was left to add with 5 l of water as a no-template control.
[0168] The used quantitative PCR instrument was Roche LC96 quantitative system. The cycling conditions were set into: 94 C., 3 minutes, followed by 94 C., 15 seconds, 60 C., 1 minute, 40 cycles, finally 72 C., 3 minutes till the procedure terminated.
[0169] Data analysis: the measured copy number of the integrated lentiviral vector in the DNA samples was calibrated with the number of genomes to obtain the number of integrated virus copies per genome.
[0170] Titers (integration units per ml, IU ml-l) were calculated by the following formula:
IU/ml=(CND1000)/V
[0171] Wherein: C=Average number of integrated virus copies per genome
[0172] N=Number of cells at the time of infection (about 110.sup.5)
[0173] D=Dilution fold of virus vectors
[0174] V=Volume of the added diluted virus
[0175] The titer determination result of the recombinant lentiviral LV-BM38-07, LV-BM38-06, LV-BM38-05, LV-38BM-05, LV-38BM-06, LV-38BM-07 containing CAR genes was shown in Table 7.
[0176] 7. Titer Determination of Recombinant Lentiviral Inflected Jurkat Cells
[0177] The virus titers of the recombinant lentivirus solution purified by an ion exchange chromatography were evaluated by transducing Jurkat cells and CAR expression or expression of marker genes.
[0178] Jurkat cells were transduced with 3-fold serial dilutions of virus supernatant on the first day with a starting concentration of 1:300. CAR expression was evaluated on the 5.sup.th day with BCMA-Fc antigen (AcroBiosystem). The virus titer was calculated according to the following formula:
(% CAR+)(# Jurkat cells)/(viral load (ml))(dilution)
[0179] The average virus titer was calculated by the dilution points in the positive linear range of 1 to 20% CAR.
[0180] The titers of BCMA-Fc recombinant lentivirus-infected Jurkar cells were shown in Table 8.
EXAMPLE 8
Isolation and Cultivation of T Cells and Transduction of T Cells by Lentivirus
[0181] 50 ml of fresh peripheral blood was drawn from healthy volunteers, human peripheral blood mononuclear cells (PBMC) were obtained through a conventional method. The cells were washed once with an appropriate amount of MACS buffer (in 1.5 ml/10.sup.7 PBMC), centrifuged for 10 min at 800 r/min to precipitate the cells, the supernatant was discarded. The cells were re-suspended (in 80 l/10.sup.7 PBMC) with an, appropriate amount of MACS buffer, and then added with an appropriate amount of anti-human-CD3 immuno-magnetic beads (in 20 l/10.sup.7 PBMC) and mixed evenly, incubated for 15 min at 4 C. Then the cells were washed with an appropriate amount of MACS buffer (in 1.5 ml/10.sup.7 PBMC), centrifuged for 10 min at 800 r/min to precipitate the cells, the supernatant was discarded. The cells were re-suspended with 500 L MACS buffer. A MS separation column was placed on a MiniMACS separator, and the separation column was washed once with a 500 L MACS buffer. The cell suspension was added onto the MS separation column. The cells that flowed out firstly were CD3-cells not labeled with the magnetic beads. The separation column was washed with 500 L MACS buffer three times, the MS separation column is removed from the MiniMACS separator, and placed into a 15 ml centrifuge tube. 1 ml MACS buffer was added into the separation column, the retained cells were quickly eluted, and the eluate was the isolated CD3+T lymphocytes. An appropriate amount of MACS buffer was added, mixed well and counted. The supernatant was discarded after centrifugation at 1000 r/min for 10 min. The cells was re-suspended with a RPMI1640 medium containing 10% FBS, the cell concentration was adjusted to 110.sup.6/ml in a 6-well plate. The plate was then placed a 37 C., 5% CO.sub.2 incubator.
[0182] T lymphocytes were activated according to the instruction of human T lymphocytes CD3/CD28 immunoactivated magnetic beads. The isolated CD3+T lymphocytes were plated on a 24-well plate at 110.sup.6 cells/well. 25 L of pre-washed magnetic beads were added to each well, and add with recombinant human IL-2 (purchased from Shanghai Huaxin Biological High Technology Co., Ltd.) till the final concentration was 30 U/ml. The 24-well plate was cultured in a 37 C., 5% CO.sub.2 incubator. The medium containing recombinant human IL-2 was changed every 2-3 days. The passage was performed depending on the cell growth density.
[0183] Recombinant lentivirus infection can be performed when CD3+T lymphocytes grew in a good condition at a density of about 210.sup.6 cells/ml. The infected MOI was calculated based on the titer of recombinant lentivirus infected Jurkat cells, which generally did not exceed 5. Polybrene was added to a 24-well plate till the final concentration was 4 g/ml, at the same time the lentiviral suspensions LV-BM38-07, LV-BM38-06, LV-BM38-05, LV-38BM-05, LV-38BM-06, LV-38BM-07 were added, after 6 hours, the fresh culture medium was supplemented or the medium was changed completely to continue culturing.
EXAMPLE 9
Detection of BM38-05, BM38-06, BM38-07 CAR-T Cells
[0184] The expression of chimeric antigen receptors was detected by flow cytometry on the 6.sup.th day of the cultivation of infected T cells. Firstly, the infected CAR-T cells were incubated with biotin-labeled human Fc-BCMA protein for 30 min at 37 C., washed twice with D-PBS, and then added with PE-labeled Streptavidin and incubated at 37 C. for 30 min. After washing with D-PBS 3 times, the ratio of positive cells was detected by flow cytometry. Non-infected T lymphocytes and T-cells only stained with PE-labeled Streptavidin were used as negative controls to identify T-cells infected with the chimeric antigen receptors and their positive rate. The results were shown in
[0185] In addition, the marker proteins or tags such as GFP can be expressed simultaneously during constructing a CAR expression vector, the positive rate of T cells expressing the marker proteins such as GFP was confirmed by fluorescence imaging or FACS analysis. By referring to the positive level of Fc-BCMA recombinant antigen for T cells expressing CAR genes, it was confirmed that the lentiviral-infected T cells carrying CAR genes can successfully display the CAR structure on the cell membrane of the T cells. Furthermore, there was no significant difference in the positive rate between the two detection methods, which indicated that T cells stably expressing chimeric antigen receptors can be obtained by lentiviral transduction.
EXAMPLE 10
In Vitro Toxicity Study of T Lymphocytes Expressing Chimeric Antigen Receptors
[0186] Target cells with tumor-specific antigens and T lymphocytes or CAR-T cells were mixed with into a suitable in vitro cell culture system. After a period of time, T cells or CAR-T cells can be observed to recognize (aggregate) and kill (reduce the number of tumor cells) the target cells. For example, in this experiment, BCMA-overexpressing K562 cells were mixed with T cells or BM38-05, BM38-06, BM38-07 CAR-T. The cells used in this experiment were K562 (K562 cells themselves did not express BCMA proteins) and K562 cells (K562-BCMA) transfected with BCMA as target cells. The effector cells were CAR-T cells prepared as described above. The effector-to-target ratio was 2.5, 12.5:1 and 25:1, and the number of the target cells was 10,000 cells/well. Appropriate number of effector cells can be added depending on different effector-to-target ratio. All cells were cultured in a cell culture incubator at 5% CO.sub.2 and 37 C. At the beginning of the experiment, K562-BCMA cells at 10,000 cell/well firstly were inoculated into a 6-well plate, and then an appropriate number of T cells or CAR-T cells was added depending on the effector-to-target ratio after 12 h of incubation. The incubation was continued in a 5% CO.sub.2, 37 C. incubator for 4 h, the culture plate was taken out and observed under an inverted microscope to calculate the killing efficiency. The results were shown in Table 9. BM38-05, BM38-06, and BM38-07 had a significant killing effect on BCMA-positive K562 cells. In contrast, 38BM-05, 38BM-06, 38BM-07 had a significantly consistent and weak killing effect.
EXAMPLE 11
In Vitro Toxicity Study of T Lymphocytes Expressing Chimeric Antigen Receptors
[0187] When CAR-T cells kill tumor cells, T cells firstly recognize and identify the tumor cells carrying tumor antigens, form immune synapses, and then release killing factors to finish the immune monitoring and killing of the T cells, therefore, the process was a continuous process. Traditional method for detecting the killing of T cells on tumor cells is to perform endpoint detection by taking one time point, however, the results obtained by such method often have larger errors and also cannot truly reflect the complete process for killing tumor cells as for T cells. In order to overcome the technical bottleneck and restriction of such detection method, a real time cellular analysis (RTCA) technology can carry out a real-time, label-free, dynamic monitoring on cytotoxic effects caused by small molecule compounds, antibody drugs, T cells, etc based on the detection of electrical impedance generated by cells attached to the culture plate with microelectrodes. Based on such real-time cell killing analysis technology of electrical impedance, researchers can obtain high-sensitivity quantitative data, which will be helpful to study and reveal the specific mechanism of antitumor compounds or cells, and also can significantly reduce the cost of the experiments and increase the accuracy of the results.
[0188] The cells in this experiment were human cervical cancer cell lines Hela and BCMA-transfected Hela cells (BCMA-Hela) as target cells, and the effector cells were the BM38-06CAR-T cells by prepared previously. The effector-to-target ratio was 2.5, 12.5:1, and 25:1 respectively, the number of target cells was 10,000 cells/well, and an appropriate number of effector cells were added according to different effector-to-target ratios. All cells were cultured in a 5% CO.sub.2, 37 C. cell incubator. RTCA technology was used to monitor continuously and dynamically the adherence, spreading, and reproduction of target cells. Cell Index was used to represent the growth status of target cells, or can be equivalent to the number of target cells. Throughout the whole experimental process with the exception of the addition process of effector cells, it shall be ensured that the culture plates and detection equipment were in a stable culture environment to avoid large fluctuations in the Cell Index data. In order to obtain a time-dependent cell effect characteristic curve, 90 ul of medium was added to wells in a 16-well E-plate culture. After the background baseline was detected, 100 ul of cell suspension was added, mixed well and placed onto the test bench in a CO.sub.2 incubator to obtain continuously the Cell Index of the cell growth status. After 18 hours, target cells were allowed to grow adherently for a period of time, and then added with an equal volume of effector cell suspension, and placed onto the test bench in an incubator to continue to collect the Cell Index data that reflects the cell growth status. After 48 hours, the whole experiment was finished, and the collected data was exported and plotted. The results were shown in
EXAMPLE 12
In Vivo Antitumor Effect of CAR-T Cells (Survival Curve of an Experimental Animal Model)
[0189] In order to confirm if CAR-T cells, which have a good, killing effect to tumor cells in vitro, still have killing effect to tumor cells in a tumor-bearing mouse model. The example established a mouse model by injecting with K562-BCMA cells and control K562 cells through the tail vein, the model mouse were injected with different numbers of BCMA CAR-T cells, BM38 CAR-T cells and control T cells again through the tail vein one week later. The survival time of the model mouse was observed, and the mouse was killed at a certain time point, the peripheral blood and bone marrow tissue samples of the mouse were collected, the number of CAR-T cells and tumor cells were measured by flow cytometry to evaluate the tumor killing ability of different CAR-T Cells in the tumor-bearing mouse model.
[0190] The experimental process was as follows: K562-BCMA cells were grown in a RPMI1640 medium containing 10% heat-inactivated fetal bovine serum as described above. B-NDG mouse (NOD-PrkdcscidIL2rgtm1/Bcgen) was purchased from Beijing Biocytogen Co., Ltd., bred for 1 week under sterile conditions and were injected with 510.sup.5 cells/100 l of K562-BCMA cells through the tail vein to establish a tumor-bearing mouse model.
[0191] The mouse was reinfused with 510.sup.6 control T cells or CAR-T cells at 7-8 days after implantation of the tumor cells. The T cells or CAR-T cells were partially thawed in a 37 C. water bath and then completely thawed by adding 1 ml of cold sterile PBS to the tube containing the cells. The thawed cells were transferred to a 15 ml falcon tube and adjusted to a final volume of 10 ml with PBS. The cells were washed twice at 1000 rpm for 10 minutes each and then counted by a hemocytometer. CAR T cells were normalized relative to CAR transduction such that each group had the same percentage of CAR+T cells. 510.sup.6 cells was re-suspended with cold PBS at a concentration of 5010.sup.6 cells/ml and kept on ice until the mouse were administered. The mouse was injected intravenously with 100 l of CAR T cells through the tail vein at a dose of 510.sup.6 T cells per mouse.
[0192] 5 to 7 mice in each group were treated with 100 l PBS alone (PBS), untransduced T cells (Mock), BCMA CAR-T cells or BM38 CAR-T cells, T cells were provided by the same healthy volunteers. After the injection of CAR-T, the survival status of the experimental animals was measured daily, and the weight changes were recorded. The mouse was judged as appearance of a death event if extremely poor survival status such as inability to eat, paralysis and other symptoms was monitored, at this time, the peripheral blood and bone marrow samples were collected after the mouse was sacrificed, and the number of tumor cells (K562-BCMA, GFP positive) and CAR-T cells (human CD45+CAR+) in the peripheral blood and bone marrow was analyzed by flow cytometry. The time of the appearance of the death event was recorded, and the survival time curve of mice in each group was statistically analyzed. The results were shown in
[0193] Flow cytometry analysis of the peripheral blood and bone marrow in the tumor-bearing mice showed that the peripheral blood and bone marrow in the tumor-bearing mice reinfused with BM38 CAR-T cells had fewer K562-BCMA cells but at the same time had more CAR-T cells, as shown in
[0194] While the preferred embodiments of the present invention have been described, those skilled in the art can make various changes and modifications to these embodiments upon knowing the basic inventive concepts. Therefore, the appended claims are intended to be construed as embodying preferred embodiments and all modifications and alternative constructions which fall within the scope of the invention.
[0195] Obviously, those skilled in the art can make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, it is intended that the present invention covers such modifications and variations as come within the scope of the appended claims and their equivalents.
[0196] The appended tables in the present invention are as follows:
TABLE-US-00005 TABLE1 AminoAcidCodons Chinese Three-letter Single-letter Name EnglishName Abbreviation Abbreviation NucleotideCodon Glycine Gly G GGU,GGC,GGA,GGG
Alanine Ala A GCU,GCC,GCA,GCG
Valine Val V GUU,GUC,GUA,GUG
Leucine Leu L CUU,CUC,CUA,CUG,UUA,UUG
Isoleucine Ile I AUU,AUC,AUA
Proline Pro P CCU,CCA,CCG,CCC
Phenylalanine Phe F UUU,UUC
Tyrosine Tyr Y UAJ,UAC
Tryptophan Trp W UGG
Serine Ser s UCU,UCA,UCC,UCG,AGU,AGC
Threonine Thr T ACU,ACC,ACG,ACA
Cystine Cys C UGU,UGC
Methionine Met M AUG
Asparagine Asn N AAU,AAC
Glutamine Gln Q CAA,CAG
Asparticacid Asp D GAU,GAC
Glutamicacid Glu E GAA,GAG
Lysine Lys K AAA,AAG
Arginine Arg R CGU,CGC,CGG,CGA,AGA,AGG
Histidine His H CAU,CAC
UAA,UAG,UGA
TABLE-US-00006 TABLE 2 Affinity of recombinant BCMA monoclonal antibody to Fc-BCMA Antibody K.sub.a (1/Ms) K.sub.d (1/s) K.sub.D (M) BM-3E2 3.5 E+05 3.6 E05 6.9 E09 BM-6G3 4.8 E+06 3.6 E04 5.6 E09 BM-7A9 5.2 E+05 1.6 E02 7.3 E09 BM-4G12 6.2 E+04 1.5 E05 4.2 E09 BM-6E7 7.3 E+04 4.4 E04 9.1 E10 BM-9B5 6.2 E+06 5.8 E04 6.5 E09 BM-4C11 3.8 E+05 3.2 E05 6.9 E08 BM-3G7 2.9 E+05 6.1 E06 7.2 E09 BM-6F5 5.4 E+04 7.6 E05 5.4 E08 BM-5C8 2.9 E+05 2.9 E06 8.2 E09
TABLE-US-00007 TABLE 3 Affinity of recombinant CD38 monoclonal antibody to rCD38 Antibody Ka (1/Ms) Kd (1/s) KD (M) 38-4A6 7.2 E+06 4.4 E04 2.5 E06 38-4B7 6.3 E+06 5.6 E05 4.2 E05 38-5A4 8.5 E+05 8.2 E03 3.6 E06 38-6C9 1.9 E+06 9.1 E06 5.2 E07 38-6D12 2.4 E+06 6.3 E05 5.1 E06 38-3F10 5.3 E+04 5.7 E05 7.1 E06 38-4F9 6.7 E+06 5.9 E05 5.6 E05 38-6B10 6.5 E+05 6.2 E06 8.6 E06 38-7A12 5.9 E+04 6.8 E04 9.8 E06 38-4B5 4.8 E+06 4.7 E05 7.2 E05
TABLE-US-00008 TABLE 4 Design of different CAR constructs Intracellular CAR SP Target 1 Linker Target 2 Hinge TM Cos1 Cos2 Prism BM-01 GM-CSF BM-3E2 CD8 CD8 CD28 4-1BB CD3 BM-02 GM-CSF BM-6G3 CD8 CD8 CD28 4-1BB CD3 BM-03 GM-CSF BM-7A9 CD8 CD8 CD28 4-1BB CD3 BM-04 GM-CSF BM-4G12 CD8 CD8 CD28 4-1BB CD3 BM-05 GM-CSF BM-6E7 CD8 CD8 CD28 4-1BB CD3 BM-06 GM-CSF BM-9B5 CD8 CD8 CD28 4-1BB CD3 BM-07 GM-CSF BM-4C11 CD8 CD8 CD28 4-1BB CD3 BM-08 GM-CSF BM-3G7 CD8 CD8 CD28 4-1BB CD3 BM-09 GM-CSF BM-6F5 CD8 CD8 CD28 4-1BB CD3 BM-10 GM-CSF BM-5C8 CD8 CD8 CD28 4-1BB CD3 38-01 GM-CSF 38-4A6 CD8 CD8 CD28 4-1BB CD3 38-02 GM-CSF 38-4B7 CD8 CD8 CD28 4-1BB CD3 38-03 GM-CSF 38-5A4 CD8 CD8 CD28 4-1BB CD3 38-04 GM-CSF 38-6C9 CD8 CD8 CD28 4-1BB CD3 38-05 GM-CSF 38-6D12 CD8 CD8 CD28 4-1BB CD3 38-06 GM-CSF 38-3F10 CD8 CD8 CD28 4-1BB CD3 38-07 GM-CSF 38-4F9 CD8 CD8 CD28 4-1BB CD3 38-08 GM-CSF 38-6B10 CD8 CD8 CD28 4-1BB CD3 38-09 GM-CSF 38-7A12 CD8 CD8 CD28 4-1BB CD3 38-10 GM-CSF 38-4B5 CD8 CD8 CD28 4-1BB CD3 BM38-01 GM-CSF BM-3E2 EAAAK 38-4A6 CD8 CD8 4-1BB CD3 BM38-02 GM-CSF BM-6G3 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-03 GM-CSF BM-7A9 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-04 GM-CSF BM-4G12 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-05 GM-CSF BM-6E7 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-06 GM-CSF BM-9B5 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-07 GM-CSF BM-4C11 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-08 GM-CSF BM-3G7 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-09 GM-CSF BM-6F5 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-10 GM-CSF BM-5C8 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-11 GM-CSF BM-3E2 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-12 GM-CSF BM-6G3 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-13 GM-CSF BM-7A9 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-14 GM-CSF BM-4G12 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-15 GM-CSF BM-6E7 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-16 GM-CSF BM-9B5 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-17 GM-CSF BM-4C11 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-18 GM-CSF BM-3G7 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-19 GM-CSF BM-6F5 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-20 GM-CSF BM-5C8 EAAAK 38-4B7 CD8 CD8 4-1BB CD3 BM38-21 GM-CSF BM-3E2 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-22 GM-CSF BM-6G3 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-23 GM-CSF BM-7A9 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38 24 GM-CSF BM-4G12 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-25 GM-CSF BM-6E7 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-26 GM-CSF BM-9B5 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-27 GM-CSF BM-4C11 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-28 GM-CSF BM-3G7 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-29 GM-CSF BM-6F5 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM3S-30 GM-CSF BM-5C8 EAAAK 38-5A4 CD8 CD8 4-1BB CD3 BM38-31 GM-CSF BM-3E2 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-32 GM-CSF BM-6G3 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-33 GM-CSF BM-7A9 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-34 GM-CSF BM-4G12 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-35 GM-CSF BM-6E7 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-36 GM-CSF BM-9B5 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-37 GM-CSF BM-4C11 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-38 GM-CSF BM-3G7 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-39 GM-CSF BM-6F5 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-40 GM-CSF BM-5C8 EAAAK 38-6C9 CD8 CD8 4-1BB CD3 BM38-41 GM-CSF BM-3E2 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-42 GM-CSF BM-6G3 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-43 GM-CSF BM-7A9 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-44 GM-CSF BM-4G12 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-45 GM-CSF BM-6E7 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-46 GM-CSF BM-9B5 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-47 GM-CSF BM-4C11 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-48 GM-CSF BM-3G7 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-49 GM-CSF BM-6F5 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-50 GM-CSF BM-5C8 EAAAK 38-6D12 CD8 CD8 4-1BB CD3 BM38-51 GM-CSF BM-3E2 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-52 GM-CSF BM-6G3 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-53 GM-CSF BM-7A9 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-54 GM-CSF BM-4G12 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-55 GM-CSF BM-6E7 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-56 GM-CSF BM-9B5 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-57 GM-CSF BM-4C11 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-58 GM-CSF BM-3G7 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-59 GM-CSF BM-6F5 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-60 GM-CSF BM-5C8 EAAAK 38-3F10 CD8 CD8 4-1BB CD3 BM38-61 GM-CSF BM-3E2 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-62 GM-CSF BM-6G3 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-63 GM-CSF BM-7A9 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-64 GM-CSF BM-4G12 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-65 GM-CSF BM-6E7 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-66 GM-CSF BM-9B5 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-67 GM-CSF BM-4C11 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-68 GM-CSF BM-3G7 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-69 GM-CSF BM-6F5 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-70 GM-CSF BM-5C8 EAAAK 38-4F9 CD8 CD8 4-1BB CD3 BM38-71 GM-CSF BM-3E2 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-72 GM-CSF BM-6G3 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-73 GM-CSF BM-7A9 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-74 GM-CSF BM-4G12 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-75 GM-CSF BM-6E7 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-76 GM-CSF BM-9B5 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-77 GM-CSF BM-4C11 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-78 GM-CSF BM-3G7 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-79 GM-CSF BM-6F5 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-80 GM-CSF BM-5C8 EAAAK 38-6B10 CD8 CD8 4-1BB CD3 BM38-81 GM-CSF BM-3E2 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-82 GM-CSF BM-6G3 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-83 GM-CSF BM-7A9 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-84 GM-CSF BM-4G12 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-85 GM-CSF BM-6E7 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-86 GM-CSF BM-9B5 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-87 GM-CSF BM-4C11 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-88 GM-CSF BM-3G7 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-89 GM-CSF BM-6F5 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-90 GM-CSF BM-5C8 EAAAK 38-7A12 CD8 CD8 4-1BB CD3 BM38-91 GM-CSF BM-3E2 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-92 GM-CSF BM-6G3 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-93 GM-CSF BM-7A9 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-94 GM-CSF BM-4G12 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-95 GM-CSF BM-6E7 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-96 GM-CSF BM-9B5 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-97 GM-CSF BM-4C11 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-98 GM-CSF BM-3G7 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-99 GM-CSF BM-6F5 EAAAK 38-4B5 CD8 CD8 4-1BB CD3 BM38-100 GM-CSF BM-5C8 EAAAK 38-4B5 CD8 CD8 4-1BB CD3
TABLE-US-00009 TABLE 5 Components in qPCRmix Master I 2 TaqMan Master Mix 25 l n Forward primer (100 pmol/ml) 0.1 l n Reverse primer (100 pmol/ml) 0.1 l n Probe (100 pmol/ml) 0.1 l n H.sub.2O 19.7 l n
TABLE-US-00010 TABLE 6 Components in the qPCRmix Master II 2 TaqMan Master Mix 25 l n 10 RNase P primer/probe mix 2.5 l n H.sub.2O 17.5 l n
TABLE-US-00011 TABLE 7 Titration results of recombinant lentivirus Lentivirus Tite LV-BM38-07 9.3 E+10 LV-BM38-06 1.2 E+11 LV-BM38-05 4.5 E+11 LV-38BM-07 8.9 E+10 LV-38BM-06 6.7 E+10 LV-38BM-05 2.4 E+10
TABLE-US-00012 TABLE 8 Titer of BCMA-Fc recombinant lentivirus-infected Jurkar cells Lentivirus Infection Rate Tite (TU/mL) LV-BM38-07 62.5% 1.25 E+08 LV-BM38-06 74.8% 1.50 E+08 LV-BM38-05 68.4% 1.37 E+08 LV-38BM-07 56.3% 1.13 E+08 LV-38BM-06 45.8% 0.92 E+08 LV-38BM-05 67.6% 1.35 E+08
TABLE-US-00013 TABLE 9 Analysis of killing efficiency of BM38 CAR-T cells in vitro CAR-T effector- Cytotoxicity to-target BM38-07 BM38-06 BM38-05 (%) ratio 0.5 2.5 12.5 0.5 2.5 12.5 0.5 2.5 12.5 K562 12.5 15.1 22.4 14.8 15.8 24.2 15.6 18.4 22.8 BCMA-K562 85.6 102.5 106.8 84.2 106.5 105.4 64.2 82.1 86.5