Crude Drug Composition For Preventing Or Treating Respiratory Diseases
20210000905 ยท 2021-01-07
Inventors
- Mi Won Son (Gyeonggi-do, KR)
- Min Jung Bae (Jeollabuk-do, KR)
- Won Woo Lee (Seoul, KR)
- Doo Suk Lee (Gyeonggi-do, KR)
Cpc classification
A23L33/105
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K36/53
HUMAN NECESSITIES
A61K36/53
HUMAN NECESSITIES
International classification
Abstract
The present disclosure relates to a pharmaceutical composition for preventing or treating respiratory diseases and a food composition for preventing or relieving respiratory diseases comprising a mixed extract of Dioscoreae Rhizoma, Taraxaci Herba and Schizonepetae Spica as an active ingredient. A composition comprising a mixed extract of Dioscoreae Rhizoma, Taraxaci Herba and Schizonepetae Spica of the present disclosure has an advantage of preventing respiratory diseases and relieving the symptoms of respiratory diseases, restores damages in the lung tissue and has efficacy for inhibiting inflammation, oxidative stress and ageing reactions induced by fine dust. More particularly, the composition of the present disclosure increases the expression of a telomerase which extends the length of a telomere, and thus is expected to fundamentally treat degenerative respiratory diseases induced by fine dust unlike existing symptom alleviating agents.
Claims
1. A composition comprising a mixed extract of Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica.
2. The composition of claim 1, wherein the extract is obtained by extraction with an organic solvent, water, or a mixed solvent thereof.
3. The composition of claim 2, wherein the organic solvent is selected from the group consisting of C1 to C6 lower alcohol, petroleum ether, hexane, benzene, chloroform, methylene chloride, ether, ethyl acetate, and acetone.
4. The composition of claim 1, wherein the respiratory disease is selected from the group consisting of cold, rhinitis, pharyngitis, laryngitis, pharyngolaryngitis, pneumonia, acute or chronic bronchitis, asthma, and chronic obstructive pulmonary disease.
5-6. (canceled)
7. Method for prevention, alleviation, or treatment of a respiratory disease comprising: administering a composition to a subject in need thereof, the composition comprising a mixed extract of Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica.
8. The method of claim 7, wherein the extract is obtained by extraction with an organic solvent, water, or a mixed solvent thereof.
9. The method of claim 8, wherein the organic solvent is selected from the group consisting of C1 to C6 lower alcohol, petroleum ether, hexane, benzene, chloroform, methylene chloride, ether, ethyl acetate, and acetone.
10. The method of claim 7, wherein the respiratory disease is selected from the group consisting of cold, rhinitis, pharyngitis, laryngitis, pharyngolaryngitis, pneumonia, acute or chronic bronchitis, asthma, and chronic obstructive pulmonary disease.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
DETAILED DESCRIPTION
[0073] Hereinafter, the present disclosure will be described in more detail with reference to examples. These examples are only for illustrating the present disclosure more specifically, and it would be apparent to those skilled in the art that the scope of the present disclosure is not limited by these examples according to the gist of the present disclosure.
EXAMPLES
[0074] Throughout the present specification, the % used to express the concentration of a specific material, unless otherwise particularly stated, refers to (wt/wt) % for solid/solid, (wt/vol) % for solid/liquid, and (vol/vol) % for liquid/liquid.
Preparative Examples
Preparative Example 1: Preparation of Complex Herbal Medicine Extract (Mixed Extract)
[0075] Washed and dried Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were used in tests. The herbal medicines Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were mixed at a weight ratio of 1:1:1 to a total of 60 g, and 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added thereto, followed by extraction while well stirring at room temperature for 8 hours. The extract was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a powder-type complex herbal medicine extract (mixed extract). The yield was about 12-13%.
Preparative Example 2: Preparation of Complex Herbal Medicine Extract (Mixed Extract) According to Mixing Ratio of Herbal Medicines
[0076] Washed and dried Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were used in tests. The herbal medicines Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were mixed at weight ratios shown in Table 1 to a total of 30 g, and 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added thereto, followed by extraction while well stirring at room temperature for 8 hours. Each of the extracts was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a total of seven types of complex herbal medicine extract powders. The yields thereof are shown in Table 1.
TABLE-US-00001 TABLE 1 Dioscoreae Taraxaci Schizonepetae Yield Classification Rhizoma Herba Spica (%) Preparative 1 1 1 11.95 Example 2-1 Preparative 2 1 1 13.17 Example 2-2 Preparative 4 1 1 14.81 Example 2-3 Preparative 1 2 1 11.84 Example 2-4 Preparative 1 4 1 10.83 Example 2-5 Preparative 1 1 2 10.49 Example 2-6 Preparative 1 1 4 10.27 Example 2-7
Preparative Example 3: Preparation of Complex Herbal Medicine Extracts (Mixed Extracts) According to Various Concentrations of Extraction Solvent (Ethanol)
[0077] Washed and dried Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were used in tests. The herbal medicines Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were mixed at the weight ratio (w/w) in Preparative Example 2-1 to a total of 30 g, and 25, 50, 70, and 90% ethanol aqueous solutions having a volume 10 times the weight were added thereto, followed by extraction while well stirring at room temperature for 8 hours. Each of the extracts was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a total of four types of complex herbal medicine extract powders. The yields thereof are shown in Table 2.
TABLE-US-00002 TABLE 2 Ethanol aqueous solution concentration Yield Classification (%) (%) Note Preparative 25 12.37 Same preparation Example 3-1 method as in Preparative Example 2-1 Preparative 50 13.71 Example 3-2 Preparative 70 9.84 Example 3-3 Preparative 90 5.23 Example 3-4
Preparative Example 4: Preparation of Complex Herbal Medicine Extract (Mixed Extract) Through Hot-Water Extraction
[0078] Washed and dried Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were used in tests. The herbal medicines comprising Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were mixed at the weight ratio (w/w) in Preparative Example 2-1 to a total of 30 g, and distilled water having a volume 10 times the weight was added thereto, followed by reflow extraction at a temperature of 90 C. for 3 hours. The extract was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a complex herbal medicine extract powder, and the yield thereof was about 13.30%.
Comparative Example 1: Preparation of Single-Herbal Medicine Extracts
[0079] Washed and dried Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica were used in tests. To 30 g of each of the herbal medicines Dioscoreae Rhizoma, Taraxaci Herba, and Schizonepetae Spica, 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added, followed by extraction while well stirring at room temperature for 8 hours. Each of the extracts was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a total of three types of single-herbal medicine extract powders. The yields thereof are shown in Table 3.
TABLE-US-00003 TABLE 3 Classification Kind of herbal medicine Yield (%) Comparative Example 1-1 Dioscoreae Rhizoma 19.86 Comparative Example 1-2 Taraxaci Herba 12.52 Comparative Example 1-3 Schizonepetae Spica 7.84
Test Examples
Test Example 1: Lung Tissue Damage Inhibitory Effect of Complex Herbal Medicine Extract in PPE-Induced Emphysema Mouse Models
[0080] In order to investigate a lung tissue damage inhibitory effect of the complex herbal medicine extract of the present disclosure prepared in Preparative Example 1, the following test was carried out.
[0081] After 7-week-old male C57BL/6 mice (Raonbio, Korea) were acclimated for at least one week, the animals were classified into (1) a normal group, (2) a group with emphysema induction and complex herbal medicine extract administration (test group), and (3) a group with emphysema induction and distilled water administration (negative control group). For the induction of emphysema in the test group and the negative control group, 1 U of porcine pancreatic elastase (PPE, Millipore, USA) was administered as a single drop into the mouse trachea. For the normal group, phosphate buffered saline (PBS) was administered as a single drop into the mouse trachea.
[0082] For the test group, the complex herbal medicine extract dissolved in distilled water was orally administered once/day at a dose of 200 mg/kg for two weeks from one week before PPE administration. For the normal group and the negative control group, only distilled water was orally administered. After the last administration of the complex herbal medicine extract or distilled water, the mice were anesthetized with carbon dioxide and the lung tissue was extracted. The extracted lung tissue was fixed in formalin and subjected to hematoxylin and eosin staining (H&E staining). The images taken by observing the lung tissue with an optical microscope (100) are shown in
[0083] As shown in
[0084] It could be therefore verified that the complex herbal medicine extract of the present disclosure showed a lung tissue damage inhibitory effect in the emphysema mouse models.
Test Example 2: Inhibitory Effect of Complex Herbal Medicine Extract on Fine Dust-Induced Reactive Oxygen Species Formation of Pulmonary Epithelial Cell Line
[0085] In order to investigate a reactive oxygen species formation inhibitory effect of the complex herbal medicine extract of the present disclosure prepared in Preparative Example 1, the following test was carried out.
[0086] The human pulmonary endothelial cell line NCI-H292 cells (ATCC, USA) were incubated in an incubator of 5% CO.sub.2 and 37 C. by using RPMI media (Corning, USA) comprising 10% fetal bovine serum (FBS). The cells were prepared on a 96-well plate at 110.sup.4 cells per well, and stabilized for 24 hours. After the cells were stabilized, the cell supernatant was removed, and then the cells were treated with the complex herbal medicine extract in Preparative Example 1 at 100 g/ml, followed by incubation for 1 hour. Then, the cells were further treated with 200 g/ml fine dust (particulate matter 10, PM10, NIST, USA) (test group). The normal group was treated with neither the complex herbal medicine extract nor fine dust, and the negative control group was treated with only fine dust. After 3 hours, the amount of reactive oxygen species formed in the cells was investigated by using DCF-DA analysis (Sigma Aldrich, USA).
[0087] As shown in
Test Example 3: Inhibitory Effect of Complex Herbal Medicine Extract on Fine Dust-Induced Apoptosis
[0088] As in Test Example 2, NCI-H292 cells were prepared on a 96-well plate at 110.sup.4 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with the complex herbal medicine extract in Preparative Example 1 at concentrations of 100, 200, 400, and 800 mg/mL. After 1 hour, the cells were further treated with 50 g/mL fine dust (PM 10). The normal group was treated with neither the complex herbal medicine extract nor fine dust, and the negative control group was treated with only fine dust. After 24 hours, cell viability was investigated through the WST-1 test (Younginfrontier, Korea).
[0089] As shown in
Test Example 4: Anti-Aging Effect of Complex Herbal Medicine Extract on Fine Dust-Induced Cell Aging of Pulmonary Epithelial Cell Line
[0090] As in Test Example 2, NCI-H292 cells were prepared on a 96-well plate at 110.sup.4 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with the complex herbal medicine extract in Preparative Example 1 at a concentration of 200 g/Ml. After 1 hour, the cells were further treated with 50 g/mL fine dust (PM 10). The normal group was treated with neither the complex herbal medicine extract nor fine dust, and the negative control group was treated with only fine dust. After five days, the cells were fixed in formalin, and then the degree of cell aging was investigated through senescence beta-galactosidase staining.
[0091] As shown in
Test Example 5: Telomerase Expression Increasing Effect of Complex Herbal Medicine Extract in Pulmonary Endothelial Cell Line (Anti-Aging Effect)
[0092] NCI-H292 cells were prepared on a 100 pi () plate at 110.sup.6 cells and stabilized. After 24 hours, the cells were treated with the complex herbal medicine extract in Preparative Example 1 at concentrations of 100 and 200 g/ml. After 24 hours, the cells were collected and proteins were extracted, and then western blotting was performed using an antibody (ab32020, Abcam, USA) for human telomerase reverse transcriptase (hTERT), which is a catalytic small unit of telomerase.
[0093] As shown in
Test Example 6: Inhibitory Effect (Anti-Inflammatory Effect) of Complex Herbal Medicine Extract on LPS-Induced Nitric Oxide (NO) Production in Macrophage Cell Line
[0094] The mouse macrophage cell line Raw 264.7 cells (ATCC, USA) were incubated in the incubator of 5% CO.sub.2 and 37 C. by using RPMI media (Invitrogen, USA) comprising 10% fetal bovine serum (FBS). The cells were prepared on a 24-well plate at 2.510.sup.5 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with the complex herbal medicine extract in Preparative Example 1 at concentrations of 0.5, 1, 2, and 4 mg/mL. After 1 hour, the cells were further treated with 100 ng/mL LPS. After 24 hours, the cell supernatant was collected and subjected to Griess test for measuring the change in NO production, and the concentration of NO was calculated using the standard curve according to the concentration of sodium nitrite (NaNO.sub.2) (
[0095] As shown in
Test Example 7: Inhibitory Effect (Anti-Inflammatory Effect) of Complex Herbal Medicine Extract on LPS-Induced Inflammatory Factor Expression in Macrophage Cell Line
[0096] The mouse macrophage cell line Raw 264.7 cells (ATCC, USA) were incubated in an incubator of 5% CO.sub.2 and 37 C. by using RPMI media (Invitrogen, USA) comprising 10% fetal bovine serum (FBS). The cells were prepared on a 24-well plate at 2.510.sup.5 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with 100 ng/mL LPS (Sigma, US) and the complex herbal medicine extract in Preparative Example 1 at concentrations of 0.5, 1, and 2 mg/mL. After 24 hours, the cell supernatant was removed, and then RNA was separated from the cells by using TRIzol (Invitrogen, USA). Thereafter, cDNA obtained through RT-PCR was used to perform qPCR using primers specific to the inflammatory factors IL-6, IL-1, and iNOS and the SYBR green probe (Takara, Japan). The RNA expression change value obtained from qPCR was expressed as a relative change of GAPDH mRNA as a standard gene compared with a non-treatment group (
TABLE-US-00004 TABLE4 SEQ Gene Direction NucleotideSequence(5to3) IDNO GAPDH Forward AGCCTCGTCCCGTAGACAA 1 Reverse AATCTCCACTTTGCCACTGC 2 IL-6 Forward TTGGTCCTTAGCCACTCCTTC 3 Reverse TAGTCCTTCCTACCCCAATTTCC 4 IL-1 Forward TGTGCAAGTGTCTGAAGCAGC 5 Reverse TGGAAGCAGCCCTTCATCTT 6 iNOS Forward CGAAACGCTTCACTTCCAA 7 Reverse TGAGCCTATATTGCTGTGGCT 8
[0097] As shown in
Test Example 8: Antioxidative Factor Expression Increasing Effect (Antioxidative Effect) of Complex Herbal Medicine Extract in Macrophage Cell Line Treated with LPS
[0098] In order to investigate the effect of the complex herbal medicine extract of the present disclosure on the expression of the antioxidative factor heme oxygenase-1 (HO-1) in the macrophage cell line induced by LPS, the test was carried out by the same method as in Test Example 7 except that qPCR was performed by using primers specific to HO-1 gene and SYBR green probe (Takara, Japan). The RNA expression change value obtained from the qPCR results was expressed as a relative change of GAPDH mRNA as a standard gene compared with a non-treatment group (
TABLE-US-00005 TABLE5 SEQ Gene Direction NucleotideSequence(5to3) IDNO GAPDH Forward AGCCTCGTCCCGTAGACAA 1 Reverse AATCTCCACTTTGCCACTGC 2 HO-1 Forward CAGGTGATGCTGACAGAGGA 9 Reverse GAGAGTGAGGACCCACTGGA 10
[0099] As shown in
Test Example 9: Antioxidative Factor Expression Increasing Effect (Antioxidative Effect) of Complex Herbal Medicine Extract According to Mixing Ratio of Herbal Medicines in Macrophage Cell Line Treated with LPS
[0100] In order to investigate an antioxidative effect of the complex herbal medicine extract in Preparative Example 2 according to the mixing ratio in the Raw 264.7 macrophage cell line induced by LPS, qPCR was performed by using the primers specific to HO-1 gene and the SYBR green probe (Takara, Japan). The detailed test procedure was the same as in Test Example 8, and the primer sequences for the mouse genes used in the test are shown in Table 5 above.
[0101] As shown in
Test Example 10: Anti-Inflammatory and Antioxidative Effects of Complex Herbal Medicine Extract According to Concentration of Extraction Solvent (Ethanol) in Macrophage Cell Line Treated with LPS
[0102] In order to investigate the anti-inflammatory and antioxidative effects of the complex herbal medicine extracts according to the concentrations of the extraction solvent (ethanol) in Preparative Example 3 and the hot-water complex herbal medicine extract in Preparative Example 4, qPCR was performed by using the primers specific to iNOS, and HO-1 and the SYBR green probe (Takara, Japan). Each of the extracts was used at a concentration of 2 mg/ml. The detailed test procedures were the same as in Test Examples 7 and 8, and the primer sequences for the mouse genes used in the tests are shown in Tables 4 and 5 above.
[0103] As shown in
Test Example 11: Anti-Inflammatory Effects of Single Herbal Medicine Extract and Complex Herbal Medicine Extract in Pulmonary Inflammation Mouse Model Induced by LPS
[0104] In order to investigate the pulmonary inflammation inhibitory effect of single and complex herbal medicine extracts, the following test was carried out. After 7-week-old male C57BL/6 mice (Raonbio, Korea) were acclimated for at least one week, the animals were classified into (1) a normal group, (2) a group with LPS induction and distilled water administration (negative control group), (3) to (5) groups with LPS induction and single herbal medicine extract administration, and (6) a group with LPS induction and complex herbal medicine extract administration.
[0105] The complex herbal medicine extract in Preparative Example 1 dissolved in distilled water and the single extracts of three kinds of herbal medicines in Comparative Example 1 dissolved in distilled water were orally administered to the test groups of (3) to (6) at 500 mg/kg once/day for five days, and only distilled water was orally administered to the normal group and the negative control group.
[0106] The induction of acute pulmonary inflammation in the test groups and the negative control group was performed by administering 50 g of LPS (Sigma, US) dissolved in 50 l of phosphate buffered saline (PBS) as a single drop into the mouse trachea 24 hours before the end of the test. For the normal group, phosphate buffered saline (PBS) was administered as a single drop into the mouse trachea.
[0107] After the last administration of the herbal medicine extracts or distilled water, the mice were sacrificed with carbon dioxide, and then the lung tissue was separated, and RNA was extracted by using TRIzol (Invitrogen, USA). Thereafter, cDNA obtained through RT-PCR was used to perform qPCR using primers specific to the inflammatory factors IL-1, IL-6, and TNF- and the SYBR green probe (Takara, Japan). The RNA expression change value obtained from qPCR was expressed as a relative change of GAPDH mRNA as a standard gene compared with a non-treatment group. The primer sequences for mouse genes used in the test are shown in Table 6.
TABLE-US-00006 TABLE6 NucleotideSequence SEQ Gene Direction (5to3) IDNO GAPDH Forward AGCCTCGTCCCGTAGACAA 1 Reverse AATCTCCACTTTGCCACTGC 2 IL-6 Forward TTGGTCCTTAGCCACTCCTTC 3 Reverse TAGTCCTTCCTACCCCAATTTCC 4 IL-1 Forward TGTGCAAGTGTCTGAAGCAGC 5 Reverse TGGAAGCAGCCCTTCATCTT 6 TNF- Forward AAGCCTGTAGCCCACGTCGTA 11 Reverse GGCACCACTAGTTGGTTGTCTTTG 12
[0108] As shown in