TRANSFORMED YEAST PRODUCING NOVEL 1-OCTEN-3-OL, AND PREPARATION METHOD THEREFOR

Abstract

The present application relates to a method for preparing transformed yeast producing 1-octen-3-ol, and yeast prepared by the method, and is useful in the cosmetic industry and the food development industry which use a Tricholoma matsutake scent.

Claims

1. A transformed yeast for producing 1-octen-3-ol transformed with a recombinant vector comprising any one base sequence selected from Sequence Listings 9, 10, and 11 encoding lipoxygenase and a base sequence of Sequence Listing 12 encoding hydroperoxide lyase.

2. A method for producing a transformed yeast for producing 1-octen-3-ol comprising the steps of: isolating total RNA of pine mushroom and synthesizing cDNA; PCR-amplifying a lipoxygenase gene and a hydroperoxide lyase gene from the synthesized cDNA; gene-cloning each of the amplified lipoxygenase gene and hydroperoxide lyase gene in a vector; gene-cloning each of the cloned lipoxygenase gene and hydroperoxide lyase gene in each yeast expression vector; and transforming and incubating the yeast expression vector into a yeast to confirm the biosynthesis of 1-octen-3-ol.

3. The method of claim 2, wherein the yeast expression vector is a vector selected from a pYES3/CT vector and a pYES2/CT vector.

4. The method of claim 3, wherein the pYES3/CT vector and the pYES2/CT vector are used in a ratio of 1:1.

5. The method of claim 2, wherein the yeast is incubated in a SC medium using 0.01 to 100 mM of linoleic acid at 15 C. to 45 C. for 12 to 48 hours.

6. The method of claim 2, wherein the yeast is Saccharomyces cerevisiae (S. cerevisiae).

7. A method for producing 1-octen-3-ol comprising the steps of: biosynthesizing 1-octen-3-ol by incubating the transformed yeast for producing the 1-octen-3-ol of claim 1 in a medium; and obtaining the biosynthesized 1-octen-3-ol.

Description

DESCROPTION OF DRAWINGS

[0027] FIG. 1 is an electrophoretic photograph showing total RNA extracted from pine mushroom of the present application.

[0028] FIG. 2 is an electrophoretic photograph showing amplification of a lipoxygenase-1 gene, a lipoxygenase-2 gene, and a lipoxygenase-3 gene (Lanes 1, 2, and 3, respectively), and a hydroperoxide lyase gene (Lane 4) of the present application.

[0029] FIG. 3 is an electrophoretic photograph showing results of inserting a lipoxygenase-1 gene (A), a lipoxygenase-2 gene (B), a lipoxygenase-3 gene (C), and a hydroperoxide lyase gene (D) of the present application into a pGEM easy T vector plasmid.

[0030] FIG. 4 is a schematic diagram showing a map of pYES3/CT and pYES2/CT yeast expression vectors.

[0031] FIG. 5 is an electrophoretic photograph showing results of inserting a lipoxygenase-1 gene, a lipoxygenase-2 gene, and a lipoxygenase-3 gene (A), and a hydroperoxide lyase gene (B) into a plasmid.

[0032] FIG. 6(A) is a photograph of a plate in which transformed yeasts into which a lipoxygenase-1 gene, a lipoxygenase-2 gene, a lipoxygenase-3 gene, and a hydroperoxide lyase gene are introduced are incubated. FIG. 6(B) is an electrophoretic photograph showing colony PCR results of transformed yeasts into which a lipoxygenase-1 gene, a lipoxygenase-2 gene, a lipoxygenase-3 gene, and a hydroperoxide lyase gene are introduced are introduced.

[0033] FIG. 7 is a graph showing a growth curve of each yeast transformed with combinations of a lipoxygenase-1 gene, a lipoxygenase-2 gene, a lipoxygenase-3 gene, and a hydroperoxide lyase gene.

[0034] FIG. 8 is a graph showing biosynthesis of 1-octen-3-ol in (A) lysates of cells incubated without adding a substrate, (B) a medium incubated without adding a substrate, (C) lysates of cells incubated by adding a substrate, and (D) a medium incubated by adding a substrate.

[0035] FIG. 9 is a graph showing (A) a biosynthesis amount of 1-octen-3-ol according to a linoleic acid addition concentration and (B) a biosynthesis amount of 1-octen-3-ol according to reaction temperature and reaction time in a transformant yeast.

MODES OF THE INVENTION

[0036] Hereinafter, the present application will be described in more detail with reference to Examples according to the present application. However, the following Examples of the present application are only an example of the present application. These Examples are intended to describe the present application in more detail, and it will be apparent to those skilled in the art that the scope of the present application as set forth in the appended claims is not limited by these Examples.

Example 1: Isolation of Total RNA from Pine Mushroom

[0037] Total RNA was isolated from pine mushroom fruiting bodies collected in the Gachang area near Daegu. After the fruiting bodies were cut into small pieces of 3 to 5 cm, the cut fruiting bodies were finely ground with a mortar using liquid nitrogen. The ground fruiting bodies were completely dissolved in 1 mL of TRIZol, added with chloroform, and centrifuged for 15 minutes to isolate RNA. A supernatant containing RNA was transferred to a new tube, add with the same amount of iso-propyl alcohol, reacted at room temperature for 15 minutes, and centrifuged at 12,000 rpm for 10 minutes to precipitate RNA. Next, the supernatant was removed, washed by adding 75% ethyl alcohol, and then added with diethypyrocarbonate (DEPC)-treated water to elute and isolate total RNA. As a result, it was confirmed that the total RNA concentration was 992.8 ng/l (A260/A280=1.886) (in FIG. 1, Line 1 indicated a DNA marker, and Lanes 2 to 4 indicated Total RNA).

Example 2: cDNA Synthesis of Pine Mushroom

[0038] First strand cDNA was synthesized by the following method using the total RNA obtained in Example 1 and an Accuscript High Fidelity 1st Strand cDNA Synthesis kit (Stratagene). 1 l of Total RNA, 11.7 l of RNase-free water, 2 l of an AccuScript RT buffer, 1 l of an Oligo dT primer, and 0.8 l of a dNTP mixture were mixed and reacted at 65 C. for 5 minutes and at room temperature for 5 minutes, then further added with DTT 100 mM, 1 l of AccuScript RT, and 0.5 l of RNase Block ribonuclease, reacted at 42 C. for 1 hour, and then reacted at 70 C. for 15 minutes to synthesize cDNA.

Example 3: Preparation of PCR Products of Lipoxygenase-1, 2, 3 Genes and Hydroperoxide Lyase Gene

[0039] Genes were amplified using PrimeSTAR HS Polymerase (TaKaRa) with the cDNA synthesized and obtained in Example 2 as a template, the following primers (Table 1), and PCR conditions (Table 2). PCR was performed using the corresponding genes and restriction enzymes in a SC selectable medium.

TABLE-US-00001 TABLE1 Restriction Name Sequences(5-3) enzyme LOX1-F-HindIII AAGCTTAACACAATGTCCTTAAGCAAGTTTCCG HindIII (SEQIDNO:1) LOX1-R-KpnI GGTACCACCTTCGTTACATCATACTGTAT KpnI (SEQIDNO:2) LOX2-F-KpnI GGTACCAACACAATGTTGACGCGGTTATTTAAG KpnI (SEQIDNO:3) LOX2-R-NotI GCGGCCGCATATCGAACTGCACAACGAGGG NotI (SEQIDNO:4) LOX3-F-HindIII AAGCTTAACACAATGTCGATTGATTCTGTTCCA HindIII (SEQIDNO:5) LOX3-R-KpnI GGTACCATGGCACAGTACTCCCGTTGCCA KpnI (SEQIDNO:6) HPL-F-KpnI GGTACCAACACAATGTCCCTCAAGCATTCTTCC KpnI (SEQIDNO:7) HPL-R-EcoRI GAATTCTGGATGTTGTGTCCGTGGCGATA EcoRI (SEQIDNO:8)

TABLE-US-00002 TABLE 2 Pre- Target gene denaturation Denaturation Anealing Extension Lipoxygenase-1 98 C., 98 C., 60 C., 72 C., (SEQ ID NO: 9) 3 min 10 sec 15 sec 3 min Lipoxygenase-2 98 C., 98 C., 58 C., 72 C., (SEQ ID NO: 10) 3 min 10 sec 15 sec 4 min Lipoxygenase-3 98 C., 98 C., 56 C., 72 C., (SEQ ID NO: 11) 3 min 10 sec 15 sec 4 min Hydroperoxidelyase 98 C., 98 C., 59 C., 72 C., (SEQ ID NO: 12) 3 min 10 sec 5 sec 2 min

[0040] As a result of the experiment, through an electrophoretic photograph, it was confirmed that a lipoxygenase-1 gene (SEQ ID NO: 9, 3159 bp), a lipoxygenase-2 gene (SEQ ID NO: 10, 3333 bp), and a lipoxygenase-3 gene (SEQ ID NO: 11, 3855 bp) (Lanes 1, 2, 3 in FIG. 2, respectively), and a hydroperoxide lyase gene (SEQ ID NO: 12, 1,560 bp, Lane 4 in FIG. 2) were amplified. In Lane 1 of the electrophoretic photograph of FIG. 2, a Plus DNA Ladder marker was used as a DNA marker.

Example 4: Gene Cloning Using pGEM Easy T Vector

[0041] In order to clone PCR products of a lipoxygenase-1 gene, a lipoxygenase-2 gene, a lipoxygenase-3 gene, and a hydroperoxide lyase gene obtained in Example 3 with each pGEM easy T vector (Promega), a A-tailing process was performed using a Mighty TA-cloning Reagent Set (TaKaRa), ligation with the pGEM easy T vector was performed overnight at 4 C., and then the ligated vector was transformed into E. coli DH5a competent cells (TaKaRa). Next, E. coli was smeared on a Luria Broth (LB) medium plate added with ampicillin (100 l/ml), IPTG (0.1 mM), and X-gal (50 g/ml), and incubated at 37 C. for 16 to 18 hours, and thereafter, a plasmid was extracted using a Higene Plasmid Mini Prep kit (Biofact). To confirm whether the gene was correctly inserted into the extracted plasmid, the size of the gene was checked by electrophoresis, and then sequencing of the corresponding base sequence was performed.

[0042] As a result of the experiment, It was confirmed that s lipoxygenase-1 gene (FIG. 3(A)), a lipoxygenase-2 gene (FIG. 3(B)), a lipoxygenase-3 gene (FIG. 3(C)) and a hydroperoxide lyase gene (FIG. 3(D)) were accurately inserted into the pGEM easy T vector plasmid.

Example 5: Gene Cloning Using Yeast Expression Vector

[0043] The pGEM vectors inserted with the lipoxygenase-1 gene, the lipoxygenase-2 gene, and the lipoxygenase-3 gene for gene expression in the yeast reacted at 37 C. and were cleaved with restrictions enzymes HindIII and KpnI, and the pGEM vector inserted with the hydroperoxide lyase gene reacted at 37 C. and was cleaved with restrictions enzymes KpnI and EcoRI. The cleaved genes were quantified after purification with a TaKaRa MiniBEST Agarose Gel DNA Extraction kit (TaKaRa). After selecting Saccharomyces cerevisiae species as a microbial model for expressing the genes, a pYES3 vector (Invitrogen Co., Ltd.), which was a yeast expression vector suitable for a host cell, was selected for efficient protein expression. This vector includes a pUc ori sequence to be easily amplified in bacteria, and includes a 2 origin sequence to be amplified even in yeasts. In addition, this vector had a multiple cloning site as a restriction enzyme site that did not cleave a target gene to accurately insert the gene into the vector. The vector has a GAL1 promoter which a strong promoter, a T7 promoter, and a CYC1 sequence to accurately determine the insertion of the gene and the inserted sequence by gene sequencing analysis. In addition, since a TRP1 gene sequence, which is a selectable marker, is present to easily screen the yeasts inserted with the vector, and a V5 epitope and a 6His tag sequence are present to make it easy to detect the expressed target protein. In order to transform two different types of genes into the yeast together, a pYES2 vector with a different selectable marker URA3 from a pYES3 vector was selected. The pYES2 vector has the same other characteristics as the pYES3 vector and is larger in size by about 100 bp (FIG. 4). Since the yeast into which all of the genes have been inserted may be efficiently screened using the selectable marker, cloning was performed using the following method. The lipoxygenase-1 gene, the lipoxygenase-2 gene, and the lipoxygenase-3 gene were subjected to overnight ligation reaction with a pYES3/CT vector (Invitrogen), and the hydroperoxide lyase gene was subjected to overnight ligation reaction with a pYES2/CT vector (Invitrogen) at 4 C. to be transformed into E. coli DH5a competent cells (TaKaRa). The transformed cells were smeared on a Luria Broth (LB) medium plate added with ampicillin (100 l/ml), IPTG (0.1 mM), and X-gal (50 g/ml) and incubated at 37 C. for 16 to 18 hours. Next, the plasmid was extracted from the screened E. coli using a Higene Plasmid Mini Prep kit (Biofact), and the size of the extracted plasmid was checked by electrophoresis to confirm whether each gene was correctly inserted, and then base sequence sequencing was performed. As a result of the experiment, it was confirmed that the lipoxygenase-1 gene, the lipoxygenase-2 gene, the lipoxygenase-3 gene, and the hydroperoxide lyase gene were correctly inserted into the plasmid (FIG. 5). That is, the lanes of FIG. 5(A) illustrate electrophoretic results of m: DNA ladder marker, 1: pYES3/CT, 2: pYES3/CT+Lipoxygenase-1 gene, 3: pYES3/CT+Lipoxygenase-2 gene, and 4: pYES3/CT+Lipoxygenase-3 gene, and the lanes of FIG. 5(B) illustrate electrophoretic results of m: DNA ladder marker, 1: pYES2/CT, and 2: pYES2/CT+Hydroperoxide lyase.

Example 6: Transformation of Yeast Expression Vectors into INVSc1 Yeast

[0044] Saccharomyces cerevisiae competent cells were prepared using a S.C. EasyComp Transformation kit (Invitrogen). In addition, the pYES3/CT vectors introduced with the lipoxygenase-1 gene, the lipoxygenase-2 gene, and the lipoxygenase-3 gene obtained in Example 5, and the pYES2/CT vector introduced with the hydroperoxide lyase were mixed in a ratio of 1:1, respectively. Thereafter, these vectors were transformed into S. cerevisiae competent cells (INVSc1). In addition, the S. cerevisiae competent cells (INVSc1) were smeared on an SC medium plate (Synthetic complete medium, 0.67% yeast nitrogen base, 2% glucose, 0.192% yeast synthetic drop- out medium supplements, 2% agar) in which tryptophan and uracil were deleted and then incubated at 30 C. for 2 to 3 days (FIG. 6(A)). The SC medium was a minimal medium in which tryptophan and uracil were deleted, and was used because the SC medium efficiently selected a transformant yeast into which both a pYES3 vector with a TRP1 gene and a pYES2 vector with a URA3 gene were inserted and was suitable for expression of a target protein. The composition of the SC medium used was shown in Table 3 below.

TABLE-US-00003 TABLE 3 Composition ratio (%, W/W) Composition contents 0.67% Yeast nitrogen base (without amino acids) 2% Carbon source (adding raffinose for screening and incubation of transformant and galactose for protein expression) 0.01% Adenine, arginine, cysteine, leucine, lysine, threonine 0.005% Aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine, valine 2% Agar (for solid medium) Total 100% Constituted 100% with H.sub.2O.

[0045] Next, as a result of screening transformed yeasts into which two types of genes were introduced by performing colony PCR, it was confirmed that the lipoxygenase-1 gene, the lipoxygenase-2 gene, the lipoxygenase-3 gene, and the hydroperoxide lyase gene were transformed into INVSc1 through yeast expression vectors (FIG. 6(B)). Yeasts KMG 1801, KMG 1802, and KMG 1803 transformed in a 1:1 ratio of the lipoxygenase-1 gene, the lipoxygenase-2 gene, the lipoxygenase-3 gene, and the hydroperoxide lyase gene were deposited with deposit numbers KCTC13476BP, KCTC13477BP, and KCTC13478BP in the Korean Collection for Type Cultures (KCTC) on Feb. 6, 2018. In addition, in order to confirm the growth of the yeast transformed with each combination of the lipoxygenase-1 gene, the lipoxygenase-2 gene, the lipoxygenase-3 gene, and the hydroperoxide lyase gene, 5 mL of each incubation medium was incubated and then used as a sample for measuring a growth curve of the yeast every 0, 4, 8, 12, 16, 20, 24, 28, 32, and 36 hours. As a result of the measurement, it was confirmed that KMG 1801 (Deposit No. KCTC13476BP, FIG. 7(A)) and KMG 1802 (Deposit No. KCTC 13477BP, FIG. 7(B)) grew rapidly in a period of 8 to 12 hours, and KMG 1803 (Deposit No. KCTC13478BP, FIG. 7 (C)) grew rapidly in a period of 28 to 32 hours.

Example 7: Identification of 1-octen-3-ol Biosynthesis in Transformed Yeasts Introduced with Lipoxygenase and Hydroperoxide Lyase Genes

[0046] In order to confirm the biosynthesis of 1-octen-3-ol in yeasts transformed with the combinations of each gene obtained from Example 6, the transformed yeasts were inoculated in a SC selectable medium (Synthetic complete medium, 0.67% yeast nitrogen base, 2% raffinose, 0.192% yeast synthetic drop-out medium supplements) in which tryptophan and uracil were deleted, pre-incubated overnight, and then centrifuged to collect yeasts. The collected yeasts were inoculated in a SC induction medium (Synthetic complete medium, 0.67% yeast nitrogen base, 1% raffinose, 2% galactose, 0.192% yeast synthetic drop-out medium supplements) in which tryptophan and uracil were deleted, added with 2% Tween-20 and 1.5 mM linoleic acid, and then incubated at 30 C. for 20 hours. The incubated yeasts and the media were isolated by centrifugation, and the yeasts were added with a sodium phosphate lysis buffer (50 mM sodium phosphate, 1 mM PMSF, 5% glycerol, 2% triton X-100; pH 6.5) and acid-washed glass beads (0.4 to 0.6 mm size), lyzed with a bead beater, and then the cells were down by centrifugation and a cell lysis supernatant was recovered. Next, in order to confirm the produced 1-octen-3-ol, lysates and the incubated medium were analyzed by gas chromatography-mass spectrometry (Aqilent 7890B GC & 5977B MSD) by extracting volatile components through solid phase microextraction (SPME) for 35 minutes at 70 C. For the gas chromatography-mass spectrometry, DB-WAX (60 m250 m0.25 m) and helium carrier gas were used, and the temperature of the column was increased from 40 C. to 120 C. at a rate of 2 C./min and increased from 120 C. to 240 C. at a rate of 20 C./min. The temperature of the injector was set to 250 C.

[0047] As a result of the experiment, as illustrated in FIG. 8, peaks were not observed in (A) lysates of cells incubated without adding a substrate and (B) a medium incubated without adding a substrate, but peaks of 1-octen-3-ol at 38.27 min were checked in (C) lysates of cells incubated by adding a substrate and (D) a medium incubated by adding a substrate.

[0048] Meanwhile, the results for 1-octen-3-ol biosynthesis according to the combination of each lipoxygenase gene and hydroperoxide lyase were shown in Table 4. According to Table 4, it was confirmed that there was a biosynthetic effect of 1-octen-3-ol in all yeasts into which each combination of the genes Lipoxygenase-1, Lipoxygenase-2, Lipoxygenase-3, and Hydroperoxide lyase found in the fruiting bodies of pine mushroom was introduced, and the degree of biosynthesis was varied according to a type of combination. In addition, it was confirmed that the 1-octen-3-ol biosynthesis concentration was highest when the lipoxygenase-1 was used.

TABLE-US-00004 TABLE 4 Protein Retention time Concentration combination (min) (mg/L) 1 Lipoxygenase-1 + 38.270 0.66 Hydroperoxide lyase 2 Lipoxygenase-2 + 38.269 0.33 Hydroperoxide lyase 3 Lipoxygenase-3 + 38.270 0.58 Hydroperoxide lyase 4 Lipoxygenase-1 + 2 + 38.271 0.42 Hydroperoxide lyase 5 Lipoxygenase-1 + 3 + 38.271 0.38 Hydroperoxide lyase 6 Lipoxygenase-2 + 3 + 38.270 0.27 Hydroperoxide lyase 7 Lipoxygenase-1 + 2 + 3 + 38.267 0.56 Hydroperoxide lyase

Experimental Example 1: Optimization of 1-octen-3-ol Biosynthesis According to Substrate Concentration and Reaction Conditions

[0049] In order to confirm the biosynthesis amount of 1-octen-3-ol in transformed yeasts according to the concentration of a substrate and reaction conditions, the yeasts transformed with lipoxygenase-1 and hydroperoxide lyase were inoculated in a SC selectable medium (Synthetic complete medium, 0.67% yeast nitrogen base, 2% raffinose, 0.192% yeast synthetic drop-out medium supplements) in which tryptophan and uracil were deleted, pre-incubated overnight, and then centrifuged to collect yeasts. The collected yeasts were inoculated in a SC induction medium (Synthetic complete medium, 0.67% yeast nitrogen base, 1% raffinose, 2% galactose, 0.192% yeast synthetic drop-out medium supplements) in which tryptophan and uracil were deleted, added with 2% Tween-20 and an appropriate concentration (0 to 0.1 M) of linoleic acid, and then incubated at 30 C. for 20 hours. In addition, in order to confirm the biosynthesis amount of 1-octen-3-ol in the transformed yeasts according to reaction conditions, the pre-incubated yeasts were inoculated in a SC induction medium (Synthetic complete medium, 0.67% yeast nitrogen base, 1% raffinose, 2% galactose, 0.192% yeast synthetic drop-out medium supplements) in which tryptophan and uracil were deleted, added with 2% Tween-20 and 3 mM linoleic acid, and then incubated at 15 C. and 30 C. for 12, 24, 36, and 48 hours, respectively. The incubated yeasts were collected by centrifugation, added with a sodium phosphate lysis buffer (50 mM sodium phosphate, 1 mM PMSF, 5% glycerol, 2% triton X-100; pH 6.5) and acid-washed glass beads (0.4 to 0.6 mm size), and lyzed with a bead beater. Thereafter, the cells were down by centrifugation, a cell lysis supernatant was recovered, and added with 0.1 g of NaCl (for protein precipitation), and then fragrances were extracted with the same amount of diethyl ether and analyzed by gas chromatography-mass spectrometry (Aqilent 7890B GC & 5977B MSD). For the gas chromatography-mass spectrometry, DB-WAX (60 m250 m0.25 m) and helium carrier gas were used, and the temperature of the column was increased from 40 C. to 120 C. at a rate of 2 C./min and increased from 120 C. to 240 C. at a rate of 20 C./min. The temperature of the injector was set to 250 C. The concentration of the biosynthesized 1-octen-3-ol was compared with a 1-octen-3-ol standard (Sigma) and analyzed. As a result of the experiment, the biosynthesis amount of 1-octen-3-ol was highest at about 0.48 mg/L when the added concentration of linoleic acid was 3 mM (A), and the biosynthesis amount of 1-octen-3-ol was highest at about 0.35 mg/L at 30 C. for 24 hours (B) (FIG. 9).

INDUSTRIAL APPLICABILITY

[0050] The present application relates to a transformed yeast producing 1-octen-3-ol and a method for producing the same, which is a useful invention in the cosmetic industry and food development industry using a pine mushroom flavor.

[0051] Depositary Authority Name: Korean Collection for Type Cultures (KCTC)

[0052] Accession number: KCTC13476BP

[0053] Accession Date: 20180206

[0054] Depositary Authority Name: Korean Collection for Type Cultures (KCTC)

[0055] Accession number: KCTC13477BP

[0056] Accession Date: 20180206

[0057] Depositary Authority Name: Korean Collection for Type Cultures (KCTC)

[0058] Accession number: KCTC13478BP

[0059] Accession Date: 20180206