METHOD FOR CONTROLLING PEST INFESTATIONS

Abstract

The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Claims

1. An siRNA molecule targeting the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8.

2. The siRNA molecule according to claim 1, wherein the region targeted by the siRNA molecule is a contiguous sequence of from 19 to 25 nucleotides.

3. The siRNA molecule according to claim 1, which targets the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 485 and 720 of SEQ ID NO: 23.

4. The siRNA molecule according to claim 1, which targets nucleotides 486-508 of SEQ ID NO: 23.

5. The siRNA molecule according to claim 1, comprising a polynucleotide which has at least 80% sequence identity to the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2).

6. The siRNA molecule according to claim 1, comprising a polynucleotide which has at least 85% sequence identity to the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide which has at least 85% sequence identity to the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2).

7. The siRNA molecule according to claim 1, comprising a polynucleotide which has at least 90% sequence identity to the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide which has at least 90% sequence identity to the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2).

8. The siRNA molecule according to claim 1, comprising a polynucleotide which has at least 95% sequence identity to the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide which has at least 95% sequence identity to the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2).

9. The siRNA molecule according to claim 1, comprising a polynucleotide with the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide with the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2).

10. The siRNA molecule according to claim 1, which consists of the duplex: TABLE-US-00008 (SEQIDNO:1) 5UAAACAAUCGCAAGAAGCUGA3 (SEQIDNO:2) 5AGCUUCUUGCGAUUGUUUAAG3.

11. The siRNA molecule according to claim 1, which comprises a deoxyribonucleotide and/or a modification.

12-19. (canceled)

20. A method for controlling pest infestation, the method comprising: (a) introducing an siRNA molecule targeting the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8, into a plant or transforming the plant with a polynucleotide which causes the plant to express the siRNA molecule; and (b) providing the plant, or portion thereof, to the pest.

21. A method for improving crop yield, the method comprising: a) transforming the plant with a polynucleotide which causes the plant to express an siRNA molecule targeting the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8; and b) cultivating the plant to allow expression of the siRNA molecules, wherein the expression inhibits feeding by a pest and loss of yield due to pest infestation.

22. The method according to claim 20, wherein the plant is selected from the group consisting of wheat, barley, sugarcane, maize, rice, rye, sorghum, soya, palm, potato, cassava, sugar beet, banana, citrus, grapes, apple, watermelon, mango, cucumber, tomato, brassica species, rapeseed, tea, coffee, tobacco, cannabis, cotton and ornamental plants.

23. The method according to claim 22, wherein the plant is wheat.

24. The method of claim 19, wherein the pest is an insect.

25. The method according to claim 24, wherein the insect is selected from the group consisting of Diuraphis noxia, Myzus persicae, Aphis fabae, Aphis glycines, Brevicoryne brassicae, Aphis gossypii, Macrosiphum euphorbiae, Acyrthosiphon pisum, Dysaphis plantaginea, Aphis craccivora, Schizaphis graminum, Rhopalosiphum padi, Rhopalosiphum maidis, Sitobion avenae, whitefly, Thrips, Lepidoptera larva, Diptera larva, Coleoptera larva, Tetranychidae, Gryllidae and Caelifera.

26. The method according to claim 25, wherein the insect is Diuraphis noxia.

27. The method according to claim 20, wherein the siRNA molecule targets the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 485 and 720 of SEQ ID NO: 23.

28. The method according to claim 20, wherein the siRNA molecule targets nucleotides 486-508 of SEQ ID NO: 23.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0029] FIGS. 1a and b SA1 Dncprr1-8 (DNA) alignment. Sanger sequence of SA1 Dncprr1-8 (DNA) (SEQ ID NO: 4) aligned to Dncprr1-8 obtained from the SAM genome sequence (SEQ ID NO: 5). Alignment performed using MUSCLE (3.8) (Edgar 2004).

[0030] FIGS. 2a and b SAM Dncprr1-8 (DNA) alignment. Sanger sequence of SAM Dncprr1-8 (DNA) (SEQ ID NO: 6) aligned to Dncprr1-8 obtained from the SAM genome sequence (SEQ ID NO: 5). Alignment performed using MUSCLE (3.8) (Edgar 2004).

[0031] FIG. 3 Graphic view of the Diuraphis noxia cprr1-8 coding domain sequence, including annotations.

[0032] FIG. 4 Sequence of D. noxia larval cuticle protein gene, cprr1-8 (SEQ ID NO: 7). Regular fontexons, italicsintrons, boldstart and stop codons, underliningcoding domain sequence, double underliningprimer binding sites, last nucleotidetranscription end site. Primer biding sites are:

TABLE-US-00002 (SEQIDNO:8) qPCRF-CCCATCCAACCAAGCCTA (SEQIDNO:9) qPCRR-CCGGGACAACAAGGATACTA (SEQIDNO:10) (Primer5-3:TAGTATCCTTGTTGTCCCGG); (SEQIDNO:11) RNAi-LF-GTAGACAACAAAGTGCCAGC (SEQIDNO:12) RNAi-LR-AATTAATCGCCTCCCAACCA (SEQIDNO:13) (Primer5-3:TGGTTGGGAGGCGATTAATT) (SEQIDNO:14) RNAi-SF-AAAACGCCGTCCAAGTGATC (SEQIDNO:15) RNAi-SR-GGTGCTCCAGTCGAAGTCAA (SEQIDNO:16) (Primer5-3:TTGACTTCGACTGGAGCACC).

[0033] FIG. 5 Protein alignment and secondary structure of the CPRR1-8 G- and T-alleles (Consensus sequence=SEQ ID NO: 17). The T-allele was found in SAM clone #2 (SEQ ID NO: 18), while the other SA1 and SAM clones result in the same amino acid sequence as the G-allele (SEQ ID NO: 19). The length of beta-strands was different and an additional coil was observed on the original G-allele when the secondary structure of the two alleles were compared. The secondary structure was annotated using the EMBOSS 6.5.7 tool gamier. Graphic was generated in Geneious 9.1.8 (Biomatters). , alfa helix; , beta strand; , turn; coil.

[0034] FIG. 6 Predicted tertiary structure of the G-(A) and T-allele (B) of CPRR1-8. Predicted models were obtained with Phyre2 web portal.

[0035] FIG. 7 SA1 Dncprr1-8 transcript (cDNA) alignment. Sanger sequence of the biotype SA1 Dncprr1-8 transcript (cDNA) (SEQ ID NO: 20) aligned to the in silico predicted SAM Dncprr1-8 (SEQ ID NO: 21) transcript from the SAM genome sequence. Alignment performed using MUSCLE (3.8) (Edgar 2004).

[0036] FIG. 8 SAM Dncprr1-8 transcript (cDNA) alignment. Sanger sequence of SAM Dncprr1-8 transcript (cDNA) (SEQ ID NO: 22) aligned to the in silico predicted SAM Dncprr1-8 transcript from the SAM genome sequence (SEQ ID NO: 21). Alignment performed using MUSCLE (3.8) (Edgar 2004).

[0037] FIG. 9 Mature mRNA of D. noxia larval cuticle protein cprr1-8>(SEQ ID NO: 23). Bold, primer binding sites; underlining, start and stop codons; double underlining, sequence to be translated into the Rebers and Riddiford chitin binding domain; dashed underlining, siRNA binding area; italics, conserved cuticle protein sequence.

[0038] FIG. 10 CDS Diuraphis noxia larval cuticle protein cprr1-8>(SEQ ID NO: 24). Primer binding sites are underlined.

[0039] FIG. 11 NGS sequence: D. noxia larval cuticle protein gene, cprr1-8>(SEQ ID NO: 25).

[0040] FIG. 12 Relative qPCR expression of Dnc002 (A) and Dncprr1-8 (B) in D. noxia biotype SA1 and SAM after feeding on susceptible wheat cultivar Gamtoos-S (GamS) or resistant Gamtoos-R (GamR) for at least 10 days.

[0041] FIG. 13 Nymph production of D. noxia biotype SAM after feeding on wheat leaves injected with siRNA (19 nt duplex region and a 2 nt 3-overhang) that targets the genes c002 or cprr1-8. siRNA was dissolved in 10 mM Tris (pH 7.0) before injection. GamS, susceptible wheat cultivar Gamtoos-S; GamR, resistant wheat cultivar Gamtoos-R; No injection, wheat leaves without injection; Buffer, 10 mM Tris (pH 7); c002-siRNA, siRNA targeting c002 dissolved in 10 mM Tris (pH 7); cprr1-8-siRNA, siRNA targeting cprr1-8 dissolved in 10 mM Tris (pH 7).

[0042] FIG. 14 Percentage survival of D. noxia biotype SAM after feeding on wheat leaves injected with siRNA that targets the D. noxia genes c002 or cprr1-8. GamS, D. noxia susceptible wheat cultivar Gamtoos-S; GamR, D. noxia resistant wheat cultivar Gamtoos-R; Buffer, 10 mM Tris (pH 7); c002-siRNA, siRNA targeting c002 dissolved in 10 mM Tris (pH 7); cprr1-8-siRNA, siRNA targeting cprr1-8 dissolved in 10 mM Tris (pH 7); **, significantly different at P 0.01; ***, significantly different at P 0.001. Error bars represent SEM.

[0043] FIG. 15 D. noxia biotype SAM was allowed to feed on wheat cultivar Gamtoos-R injected with Dnc002-siRNA, Dncprr1-8-siRNA or buffer (control, no siRNA). D. noxia biotype SAM was also allowed to feed on wheat cultivar Gamtoos-R and Gamtoos-S that was not injected (control). Relative expression of D. noxia biotype SAM c002 (A) cprrl (B) was determined with qPCR while SAM fed on wheat injected with siRNA. , Gamtoos-S, No injection; , Gamtoos-R, No injection; , Gamtoos-R, Buffer injection; , Gamtoos-R, c002-siRNA injection; , Gamtoos-R, cprr1-8-siRNA injection. qPCR was also used to determine the c002-siRNA (C) or cprr1-8-siRNA (D) concentration in the injected wheat leaf on which D. noxia biotype SAM fed. Error bars represent SEM.

[0044] FIG. 16 Relative cprr1-8 expression after feeding on cprr1-8-siRNA injected wheat. Nymphs of D. noxia feeding on Gamtoos R injected with cprr1-8 were used for gene expression analysis of cprr1-8 via RT-qPCR.

[0045] FIG. 17 (A) Catalase and (B) peroxidase activity of D. noxia biotype SAM after feeding on wheat leaves injected with cprr1-8- or c002-siRNA respectively. siRNA was dissolved in 10 mM Tris (pH 7.0) before injection. GamS, D. noxia susceptible wheat cultivar Gamtoos-S; GamR, D. noxia resistant wheat cultivar Gamtoos-R; No injection, wheat leaves without injection; Buffer, 10 mM Tris (pH 7); c002-siRNA, siRNA targeting c002 dissolved in 10 mM Tris (pH 7); cprr1-8-siRNA, siRNA targeting cprr1-8 dissolved in 10 mM Tris (pH 7).

[0046] FIG. 18 Methylation patterns of Dncprr1-8. Bisulfite sequencing was used to determine the position and amount of 5-methylcytosine compared to unmethylated cytosine of D. noxia biotype SAM and SA1. Coverage of the 3 region of the gene was low and thus presence of methylation could not be determined. A higher frequency of methylation is observed in the exonic/coding domain regions.

[0047] FIG. 19 Dncprr1-8 cDNA sequence (SEQ ID NO: 3) that will be inserted into the monocotyledon RNA interference vector, p9-Ubi-RNAi2.

[0048] FIG. 20 Graphic representation of the binary RNA interference vector, p9-Ubi-RNAi2 containing Dncprr1-8 mRNA sequence. The inserted Dncprr1-8 sequence is flanked by two promoters which will result in the transcription of both strands of the inserted sequence.

DETAILED DESCRIPTION OF THE INVENTION

[0049] siRNA molecules and their uses for controlling pest infestation are described herein. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between about nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. The siRNA molecules are effective in suppressing the D. noxia cprr1-8 gene or an ortholog thereof, and ingestion of the siRNA molecules by a pest with this protein inhibits the biological activity of the pest. The use of the siRNA molecule is a natural and environmentally friendly method for controlling insect pests.

[0050] The region targeted by the siRNA molecule is generally a contiguous sequence of at least 19 nucleotides and up to about 25 nucleotides.

[0051] More particularly, the targeted region is between nucleotides 485 and 720 of SEQ ID NO: 23, and in one embodiment the target region is from nucleotides 486 to 508. In another embodiment the target region is between about nucleotides 509 and 720 and in yet another embodiment the target region is between about nucleotides 464 and 774.

[0052] A siRNA molecule according to the present invention will preferably comprise a double stranded RNA molecule, whose antisense strand will comprise an RNA sequence substantially complementary to the target region, and whose sense strand will comprise an RNA sequence complementary to the antisense strand, wherein both strands are hybridised by standard base pairing between nucleotides.

[0053] Within the meaning of the present invention, substantially complementary to a target mRNA sequence may also be understood as substantially identical to the target sequence. Identity as is known by one of ordinary skill in the art, is the degree of sequence relatedness between nucleotide sequences as determined by matching the order and identity of nucleotides between sequences. In one embodiment the antisense strand of an siRNA having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementarity to the target mRNA sequence is considered substantially complementary and may be used in the present invention. The percentage of complementarity describes the percentage of contiguous nucleotides in a first nucleic acid molecule that can base pair in the Watson-Crick sense with a set of contiguous nucleotides in a second nucleic acid molecule. In one embodiment, the antisense siRNA strand is 100% complementary to the target mRNA sequence, and the sense strand is 100% complementary to the antisense strand over the double stranded portion of the siRNA.

[0054] In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80%, 85%, 90%, 95% or 100% sequence identity to the sequence 5 UAAACAAUCGCAAGAAGCUGA 3 (SEQ ID NO: 1) and a polynucleotide which has at least 80%, 85%, 90%, 95% or 100% sequence identity to the sequence 5 AGCUUCUUGCGAUUGUUUAAG 3 (SEQ ID NO: 2).

[0055] The siRNA molecule can consist of the duplex:

TABLE-US-00003 (SEQIDNO:1) 5UAAACAAUCGCAAGAAGCUGA3 (SEQIDNO:2) 5AGCUUCUUGCGAUUGUUUAAG3.

[0056] Isolated polynucleotides or sets of polynucleotides encoding an siRNA molecule as described above are also provided in this invention. One example is a polynucleotide comprising a sequence which has at least 80% identity to SEQ ID NO: 3. More particularly, the polynucleotide may have at least 85% identity to SEQ ID NO: 3, at least 90% identity to SEQ ID NO: 3 or at least 95% identity to SEQ ID NO: 3. In one embodiment, the polynucleotide is identical to SEQ ID NO: 3.

[0057] In the context of the present invention, the expression at least 80% identity refers to a sequence identity of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to the respective reference polynucleotide. Preferably, the polynucleotide in question and the reference polynucleotide exhibit the indicated sequence identity over a continuous stretch of 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200 or more nucleotides.

[0058] A vector encoding the siRNA molecule as described above is further provided. The vector can include a polynucleotide as described above.

[0059] Methods are known in the art for administering the siRNA molecule to pests. For example, the siRNA molecule can be injected into or caused to be ingested by the pest. Ingestion can occur by feeding the pest with an artificial food containing the siRNA molecule, by causing a plant to transiently or stably express the siRNA molecule, by injecting a plant with the siRNA, or by applying the siRNA molecule to a surface of the plant, such as by spraying the siRNA molecule onto the plant. In one embodiment of the invention, plants or plant cells are transformed with a polynucleotide or set of polynucleotides encoding the siRNA molecule, so as to produce a transgenic plant which expresses the siRNA molecule. In another embodiment, a composition comprising the siRNA molecule is sprayed onto the plant. The composition can be a pesticide.

[0060] Vectors comprising a polynucleotide which can cause a transformed host to express RNA which subsequently becomes the siRNA molecule are also provided, as are plants and plant cells transformed with a polynucleotide encoding the siRNA molecule.

[0061] The siRNA molecule can be used to control pest infestation, improve crop yield or produce a commodity product.

[0062] When the siRNA molecule is ingested by a pest which feeds on the crop, or when the siRNA molecule is otherwise administered to the pest, the biological activity of the pest may be altered, and in particular the fitness or virulence of the pest may be reduced. For example, the survival rate of the pest may be decreased or its reproduction abilities may be reduced. This may be as a result of a target gene in the pest being suppressed. For example, the target gene can be the cprr1-8 gene.

[0063] In one embodiment, the siRNA molecule of the invention is used to control Diuraphis noxia. However, a person skilled in the art will understand that the siRNA molecule could also be used to control other crop pests, such as other aphid species (e.g. Aphis fabae, Aphis glycines, Brevicoryne brassicae, Aphis gossypii, Macrosiphum euphorbiae, Acyrthosiphon pisum, Dysaphis plantaginea, Aphis craccivora, Myzus persicae, Schizaphis graminum, Rhopalosiphum padi, Rhopalosiphum maidis, Sitobion avenae), other Hemipteran (e.g. whitefly) or other insects (e.g. Thrips, Lepidoptera larva, Diptera larva, Coleoptera larva, Tetranychidae, Gryllidae and Caelifera).

[0064] Means to identify orthologous genes and target sequences are available to a person of skill in the art and comprise the use of BLAST searches and database mining of databases such as the EMBL, NCBI and other databases comprising polynucleotides and amino acid sequences.

[0065] The Myzus persicae larval cuticle protein cprr1-8 ortholog is one example. In a study conducted by the inventors, siRNA molecules targeting the nucleotides CAGAAACCAGAAGACUCCAAAAA (SEQ ID NO: 43) of the M. persicae larval cuticle protein cprr1-8 were synthesized. The siRNA molecule comprised polyribonucleotide strands GAAACCAGAAGACUCCAAAAA (SEQ ID NO: 44) and UUUGGAGUCUUCUGGUUUCUG (SEQ ID NO: 45). When ingested by M. persicae, this siRNA caused a significant reduction in nymph production (data not shown).

[0066] In one embodiment of the invention, the plants which are injected or sprayed with the siRNA molecules, or transformed to express the siRNA molecules, are wheat plants. A person skilled in the art, however, will understand that the invention is not intended to be limited to the introduction of the siRNA molecule into wheat plants, and that other plants could also be transformed with the siRNA. For example, other suitable plants include crop plants such as barley, sugarcane, maize, rice, rye, sorghum, soya, palm, potato, cassava, sugar beet, banana, citrus, grapes, apple, watermelon, mango, cucumber, tomato, brassica species like rapeseed, other vegetables, tea, coffee, tobacco, cannabis, cotton and ornamental plants such as roses.

[0067] In the context of the present invention, the term virulence refers to the ability of an insect to feed and proliferate on a particular plant.

[0068] In higher organisms, reactive oxygen species (ROS) are regularly generated by mitochondrial electron transport, when partially reduced and highly reactive metabolites of O.sub.2 such as superoxide anion (O.sub.2) and hydrogen peroxide (H.sub.2O.sub.2) are formed during cellular respiration. Excessive release of ROS damages lipids, proteins, and DNA, which leads to oxidative stress, loss of cell function, and programmed cell death. ROS are also actively released by hosts, in response to cellular invasion by pathogens as first line of defense, and occur in all eukaryotic cells. To regulate oxidative stress, the eukaryotic cell produces different ROS-scavenging enzymes, such as superoxide dismutase (which reduces O.sub.2.sup.. to H.sub.2O.sub.2), glutathione peroxidase and catalase (which reduces H.sub.2O.sub.2 to H.sub.2O).

[0069] This happens in both the host plant and insect species. An increase in peroxidase activity also occurs in wheat after D. noxia infestation, which is indicative of the activation of systemic acquired resistance (SAR), albeit the induction is delayed in susceptible varieties.

[0070] The most virulent South African biotype of D. noxia is SAM (South African Mutant). This biotype was developed from biotype SA1 (the least virulent SA biotype, only virulent to dn3) by feeding it aphid-resistant wheat cultivars, thus placing it under continuous selection pressure. As a result, SAM has been shown to express virulence against all described Dn genes found in wheat (SAM avoids detection by its host plant during feeding and a limited increase in peroxidase activity and SAR is measured). This characteristic makes biotype SAM a useful model in studies to elucidate the mechanism of virulence against resistance genes.

[0071] Arthropod cuticle is a composite, bipartite system, made of chitin filaments embedded in a proteinaceous matrix, which serves as a protective barrier, and provide structural and mechanical support. The physical properties of cuticle are determined by the structure and the interactions of its two major components, which are cuticular proteins (CPs) and chitin. The proteinaceous matrix consists mainly of structural CPs, while the majority of these belonging to the CPR family, containing a conserved R&R region (Rebers and Riddiford Consensus). Two major subfamilies of the CPR family (i.e. RR-1 and RR-2) have been identified from conservation at sequence level and some correlation with the cuticle type.

[0072] The RR1 protein, which can be isolated from the salivary gland, is unique to the biotype SAM. It is encoded by the cprr1-8 gene. The function of RR1 during aphid feeding was investigated to determine whether this protein is associated with the virulence of SAM. This was done using RNA interference (RNAi)-mediated gene silencing or knockdown.

[0073] The RNAi process relies on double-stranded RNA (dsRNA) precursors, specifically lowering transcript abundance of a target gene when introduced into cells. The process involves the cleavage of the dsRNA precursors into siRNA (-21-23 nucleotides in size) by the enzyme Dicer-2 (Dcr-2). The resulting siRNAs are then incorporated into an RNA-induced silencing complex (RISC). Argonaute-2 (Ago-2), the catalytic component of RISC, uses one of the siRNA strands as a template to recognize and degrade the complementary mRNA.

[0074] Although the siRNA molecules in one embodiment contain nucleotide sequences that are fully complementary to nucleotides CUUAAACAAUCGCAAGAAGCUGA of the mature D. noxia larval cuticle protein cprr1-8 (SEQ ID NO: 23, FIG. 9), it will be apparent to a person skilled in the art that 100% sequence complementarity between the siRNA and the target nucleic acid is not required to practice the invention. In order for a siRNA to effectively target a region, up to 2 nucleotides of the siRNA can be changed. The length of the siRNA (in which case it is simply referred to as dsRNA) can be increased according to the D. noxia larval cuticle protein cprr1-8 conserved sequence (italicized in FIG. 9, nucleotides 465-773). The siRNA could also target other areas of the D. noxia larval cuticle protein cprr1-8 conserved cuticle protein sequence, for example the Rebers and Riddiford chitin binding domain (double-underlined in FIG. 9, nucleotides 510-719). In the examples provided herein, the siRNA strands have a 3 overhang of two nucleotides. However, a person skilled in the art will understand that the length of the overhang can be varied (e.g. three nucleotides).

[0075] In some embodiments, siRNAs have 5-phosphate and 3-hydroxyl groups.

[0076] An important issue with siRNA molecules is their instability in biological fluids due to the ubiquitous nature of RNAses. Consequently, the use of many different chemical modifications to nucleotides has been described with the purpose of enhancing compound stability.

[0077] Thus, in an embodiment of the invention, the siRNA further comprises at least one nucleotide with a chemical modification. Preferred chemical modifications which enhance stability and reduce immunogenic effects include 2-O-methyl nucleotides, 2-fluoro nucleotides, 2-amino nucleotides, 2-deoxy nucleotides, or nucleotides containing 2-O or 4-C methylene bridges. Others preferred chemical modifications for exonuclease protection include ExoEndoLight (EEL): modification of all pyrimidines in the sense strand to 2-O-methyl residues, and modifications of all pyrimidines in a 5-UA-3 or 5-CA-3 motif in the antisense strand. In addition, position 1 of the sense strand can also be changed to 2-O-methyl, preventing 5-phosphorylation of the sense strand and thus increasing specificity of the siRNA by further inactivating the sense strand. In addition, the sense strand can also include a 2-O-methyl modification in position 14, because 2-O-Me at this position further inactivates the sense strand and therefore increases specificity of the siRNAs. Other preferred chemical modifications for exonuclease protection include Methyl-Fluoro (MEF): exo protection alternating 2-fluoro and 2-O-methyl modifications starting (5-end) with a 2-F on the sense strand and starting with 2-O-Me on the antisense strand. In addition, position 1 of the sense strand can also be changed to 2-O-Me and position 1 of the antisense strand to 2-F (as this can efficiently be 5-phosphorylated). Also, modification of the ribonucleotide backbone connecting adjacent nucleotides can be made by the introduction of phosphorothioate modified nucleotides. A further preferred chemical modification within the meaning of the present invention relates to the substitution of uracyl ribonucleotides with deoxythymidine (deoxyribonucleotides). In another embodiment of the present invention, at least one chemically modified nucleotide is on the sense strand, on the antisense strand or on both strands of the siRNA.

[0078] siRNA molecules of the invention can be synthesized by standard methods known in the art, e.g. by use of an automated synthesizer. RNAs produced by such methodologies tend to be highly pure and to anneal efficiently to form siRNA duplexes. Following chemical synthesis, single stranded RNA molecules are deprotected, annealed to form siRNAs, and purified (e.g. by gel electrophoresis or HPLC). Alternatively, standard procedures may be used for in vitro transcription of RNA from DNA templates carrying RNA polymerase promoter sequences. The sense and antisense transcripts may be synthesized in two independent reactions and annealed later, or may be synthesized simultaneously in a single reaction.

[0079] Three siRNA delivery techniques were attempted and compared: direct injection of dsRNA or siRNA into aphid haemolymph; feeding of dsRNA from an artificial diet; and plant-mediated RNAi to initiate down-regulation of gene targets. However, because aphids are so small (>3 mm in size), microinjection requires specialized equipment. Wheat also has a large genome (17 000 MB) and unlike Arabidopsis, can be cumbersome to transform. Thus, alternative strategies to achieve RNAi-mediated gene silencing in D. noxia were required for the experimental purposes of this invention, and a novel siRNA delivery method was developedthe siRNA was injected into leaves of wheat plants and aphids were subsequently fed on these wheat plants. This method allows observation of the interaction of plant and aphid during a gene silencing experiment, while this is not the case for siRNA/dsRNA delivery through artificial media. It is also not invasive like direct injection of siRNA or dsRNA into the aphid hemolymph and is less laborious than plant transformation if elucidating gene function is the immediate goal.

[0080] The siRNA of the present invention was shown to decrease foundress survival by approximately 50% and affected nymph production significantly during in planta feeding experiments. The present study also demonstrated transgenerational knockdown, in that expression of the Dncprr1-8 gene in the newly born embryos was decreased, making this method highly useful and feasible.

[0081] siRNA molecules may also be formed within a cell by transcription of RNA from an expression construct introduced into the cell. The expression constructs for in vivo production of siRNA molecules comprise siRNA encoding sequences operably linked to elements necessary for the proper transcription of the siRNA encoding sequence(s), including promoter elements and transcription termination signals. The siRNA expression constructs can further comprise vector sequences that facilitate the cloning of the expression constructs.

[0082] For example, in order to deliver siRNA to insect pests in a field scenario, crop plants will be transformed with a plant RNA interference vector containing cprr1-8 mRNA sequence. In particular, a cprr1-8 fragment of 301 bp in length (SEQ ID NO: 3, FIG. 19) can be amplified using high fidelity DNA polymerase from reverse transcribed mRNA and inserted into a binary vector, such as p9-Ubi-RNAi2 (FIG. 20) in the case of monocotyledons or p9U10-RNAi for dicotyledons. Wheat can thereafter be transformed with the constructed vector using agrobacterium. The transformed plant will produce RNA from both strands of the cprr1-8 fragment. The complementary RNA strands will anneal to form dsRNA which will be cleaved into siRNA in the plant cells. These siRNAs will be ingested when pest insects feed on the transformed crop plant. Based on the results described herein, this is expected to result in a reduction of fecundity and thus reduce the detrimental effect of insect pests.

[0083] Alternatively, the siRNA can be formulated into a suitable composition for use on plants. The composition can be suitably formulated to improve activity, stability and/or bio-availability and/or to limit toxicity. Formulations can contain biological salts, lipids or lipid derivatives, polysaccharides or polysaccharide derivatives, sugars or sugar derivatives, bio-friendly or approved GRAS additives.

[0084] The composition can be formulated in various types of formulations, such as solutions, wettable powders, soluble powders, tablets and water-soluble or dispersible granules. The composition can also be formulated as a concentrated stock (which is diluted in an aqueous solution prior to conventional spray application) or as a ready to use product.

[0085] A surfactant can be used as a wetting, solubilizing and penetrating agent. Suitable surfactants include peptide derived surfactants (i.e. surfactin and iturin), non-ionic surfactants, anionic surfactants and amphoteric surfactants, such as cholic acids, alkyl sulfate salts, alkylsulfonic acid salts, alkylarylsulfonic acid salts, alkyl aryl ethers and their polyoxyethylene derivatives, polyethylene glycol ethers, polyol esters and sugar alcohol derivatives.

[0086] Other components of the formulation can include additional surface active agents, solvents, cosolvents, dyes, U.V. (ultra-violet) protectants, antioxidants, antifoams, stickers, spreaders, anti-foaming agents, preservatives, humectants, buffers, carriers, emulsifiers, wetting agents, dispersants, fixing agents, disintegrators, acid solubilisers or other components which facilitate product handling and application. These carriers, diluents, auxiliary agents and so forth are preferably selected to optimize the antifungal action on plants or plant material.

[0087] Solid carriers can include, for example, the following materials in fine powder or granular form: agarose/agar containing cell culture media or dried cell culture media; organic-type fertilisers; clays (e.g. kaolinite, diatomaceous earth, synthetic hydrated silicon oxide, Fubasami clay, bentonite, acid clay); talc and other inorganic minerals (e.g. sericite, quartz powder, sulfur powder, activated carbon, calcium carbonate); and chemical fertilizers (e.g. ammonium sulfate, ammonium phosphate, ammonium nitrate, ammonium chloride, urea). Liquid carriers can include, for example, cell culture media, water; alcohols (e.g. methanol, ethanol, isopropanol); ketones (e.g. acetone, methyl ethyl ketone, cyclohexanone); esters (e.g. ethyl acetate, butyl acetate); nitriles (e.g. acetonitrile, isobutyronitrile); and acid amides (e.g. dimethylformamide, dimethylacetamide), as well as dilute bases (e.g. sodium hydroxide, potassium hydroxide and amines).

[0088] Other auxiliary agents can include, for example, adhesive agents and dispersing agents, such as casein, gelatin, polysaccharides (e.g. powdered starch, gum arabic, cellulose derivatives, alginic acid, chitin), lignin derivatives and synthetic water-soluble polymers (e.g. polyvinyl alcohol, polyvinyl pyrrolidone, polyacrylic acid); salts (eg. citrate, chloride, sulphate, acetate, ammonium, bicarbonate, phosphate salts and like) and stabilizers such as PAP (isopropyl acid phosphate), BHT (2,6-di-tert-butyl-4-methylphenol), BHA (2-/3-tert-butyl-4-methyoxyphenol), vegetable oils, mineral oils, phospholipids, waxes, fatty acids and fatty acid esters.

[0089] One or more plant growth regulators, herbicides, fungicides, bactericides, insecticides, nematicides, acaricides, biochemical pesticides, plant produced pesticides (botanicals), antimicrobials, antifungals, plant nutrients and so forth can also be incorporated into the composition of the present invention.

[0090] The composition may be diluted in water, water organic mixture or with liquid carrier and sprayed or applied in controlled environments on the plant or plant material to be treated or used to wash plant materials or environment/systems/equipment or mixed with cell culture media or plant propagation media. Alternatively, the composition may be directly applied to the soil (in which the plant will be grown or is growing) with or without granular fertilizers or organic-type fertilisers for propagation of cultured plants or the improved growth of plants.

[0091] In accordance with the present invention, there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989 (herein Sambrook et al., 1989); DNA Cloning: A Practical Approach, Volumes I and II (Glover ed. 1985); Oligonucleotide Synthesis (Gait ed. 1984); Nucleic Acid Hybridization (Hames and Higgins eds. 1985); Transcription And Translation (Hames and Higgins eds. 1984); Animal Cell Culture (Freshney ed. 1986); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); Ausubel et al. eds., Current Protocols in Molecular Biology, John Wiley and Sons, Inc. 1994; among others.

[0092] Throughout the specification and claims, unless the contents requires otherwise, the word comprise or variations such as comprises or comprising will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0093] The invention is described in more detail below in the following non-limiting examples.

EXAMPLES

Materials and Methods

[0094] Aphid populations

[0095] Colonies of parthenogenetic (apterous) female aphids of South African D. noxia biotypes SA1 and SAM, expressing different levels of virulence, were separately established in BugDorm cages (MegaView Science Education Services Co. Ltd., Taiwan) in an insectary with the following conditions: 22.52.5 C., 40% relative humidity, and continuous artificial lighting from high pressure sodium lamps.

[0096] The aphid colonies were maintained on near isogenic wheat lines. SA1 was maintained on Tugela (D. noxia susceptible, biotype SA1), while SAM was maintained on TugelaDn 1, a wheat cultivar containing the Dn1 resistance gene. All cultivars were planted in sand-filled pots and watered daily with a fertilizer that consisted of 2 g Microplex (Ocean Agriculture (Pty) Ltd, South Africa), 164 g Sol-u-fert (Kynoch Fertilizers (Pty) Ltd, South Africa) and 77 ml potassium nitrate per 100 liters of water.

[0097] The c002 gene from D. noxia was used as reference in the present study.

Plant Material and Growth Conditions

[0098] Near isogenic wheat lines (NiLs), GamtoosR (GamR, resistant) and GamtoosS (GamS, susceptible) were grown under greenhouse conditions using natural lighting and kept at a temperature of 25 C.2 C. The resistance in GamR was obtained after a 1RS/1BL translocation from rye (Secale cereale L.), and is denoted Dn7. GamR is known to express antixenosis and antibiosis against aphids during feeding. Antibiosis is observed when the plant reduces the reproductive fitness of aphids feeding on it, while antixenosis is the non-preference of a cultivar as host. Seeds were planted in pots filled with crusher dust and watered twice daily using drip irrigation. These plants were used for siRNA injection experiments. Plants used to maintain aphid colonies were grown under King Plus 800W LED lights for a 12 h photoperiod and at a temperature of 20 C.1 C.

Sample Preparation and RNA Extraction

[0099] For RNA extraction of both aphid and plant material, samples were immediately flash-frozen in liquid nitrogen and ground in 1.5 ml Eppendorf tubes using a micropestle. RNA from aphids was extracted using an RNeasy Mini Kit (Qiagen) and on-column DNase I treatment (Qiagen) following the manufacturer's protocol. RNA from wheat was extracted by adding 600 pl TRI Reagent (Zymo Research) to the ground material, after which the Direct-zol RNA MiniPrep Plus kit (Zymo Research) was used by following the manufacturer's protocol and stored at 80 C. until further use.

[0100] Complementary DNA (cDNA) synthesis was conducted using an iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer's protocol. The quantity of the cDNA was assessed through Qubit analysis (Thermo Fisher Scientific; Central Analytical Services, CAF, Stellenbosch University), whereafter the cDNA was stored at -80 C. until further use.

Sequence Characterization of Gene Dncprr1-8 that Encodes the Protein RR1 from Diuraphis noxia

[0101] PCR primers were designed to amplify the transcript and genic area of Dncprr1-8 (Table 1). Synthesized cDNA was used as template for the amplification of transcript sequence and extracted DNA as template for the amplification of genes. The PCR products were purified using the MinElute Reaction Cleanup Kit (Qiagen) and Sanger sequenced at Central Analytical Services (CAF), Stellenbosch University. The PCR products of primers cprr1-8_gene_2 F and cprr1-8_gene_2 R (Table 1) were cloned before plasmids were Sanger sequenced.

[0102] Both ends of the raw reads were then trimmed in Geneious 9.1.8 (Biomatters, New Zealand) using the Trim Ends function which trims vector sequence (not required in the case of direct sequencing of PCR products), primer sequence and low quality sequence (error probability set 0.01). The Geneious assembler was used to assemble the trimed reads de novo at the highest sensitivity, after which it was aligned to the next-generation sequencing (NGS) reference genome sequence of biotype SAM using MUSCLE 3.8 (Edgar 2004).

[0103] The obtained sequences were submitted to the basic local alignment search tool (BLASTn and BLASTx) at the National Centre for Biotechnology Information (NCBI) (//blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the identity of genes Dncprr1-8 (FIGS. 4 and 9) and Dnc002. The protein coding region was analyzed for amino acid content through the use of the Geneious (v7.1.5) platform. Secondary protein structure was determined using the EMBOSS 6.5.7 tool gamier. To predict tertiary protein structure the Phyre2 web portal was used.

TABLE-US-00004 TABLE1 Sequenceofprimersusedforsequenceverificationand geneexpressionanalysisofcprr1-8andc002 Amplicon Annealing Nameofprimer Sequencesofprimers(5-3) Template length(bp) temp.(C.) c002qPCRF CCCGTATGAGAAGCCGACTG cDNA 123 60 (SEQIDNO:26) c002qPCRR CCATCTTGGTGGGAGCTCTG cDNA (SEQIDNO:27) cprr1-8CDSF TTACTACCCAGGTGCCCCA cDNA 434 59 (SEQIDNO:28) cprr1-8CDSR CTGTGGTTGGGAGGCGATTA cDNA (SEQIDNO:29) cprr1-8qPCRF CCCATCCAACCAAGCCTA cDNA 123 56 (SEQIDNO:8) cprr1-8qPCRR TAGTATCCTTGTTGTCCCGG cDNA (SEQIDNO:10) cprr1-8_gene_1F GCATCAGTTGTGTCATTTGTCCA DNA 1765 57 (SEQIDNO:30) cprr1-8_gene_1R GTTTGGGCCGTTTCAGCG (SEQIDNO:31) cprr1-8_gene_2F TCGTACTTTATCATACACTTATGAATT DNA 1141 58 (SEQIDNO:32) cprr1-8_gene_2R GCGGGTCTCTATTTCTCAAT (SEQIDNO:33)
Design of siRNA

[0104] Once the sequence identities of the respective genes were confirmed, siRNAs targeting the Dncprr1-8 and Dnc002 were designed. (Table 2) These siRNAs have a 19 nt duplex region and a 2 nt 3-overhang. The synthesized siRNA was obtained from IDT (https://www.idtdna.com/).

TABLE-US-00005 TABLE2 SequencesofsiRNAs Nameof Sequenceofsense Sequenceofantisense siRNA (5-3) (5-3) c002- AUUUCAGAGAGACAUCGGAGG UCCGAUGUCUCUCUGAAAUUG siRNA (SEQIDNO:34) (SEQIDNO:35) cprr1-8- UAAACAAUCGCAAGAAGCUGA AGCUUCUUGCGAUUGUUUAAG siRNA (SEQIDNO:1) (SEQIDNO:2)
Aphid Feeding on siRNA-Containing Artificial Media

[0105] An artificial feeding media developed specifically for D. noxia was used for aphid feeding. It was modified to contain the following: 0.10 g L-methionine (Merck), 0.20 g L-leucine (Sigma-Aldrich), 0.10 g L-tryptophan (Merck), 20.00 g sucrose (Merck), 0.20 g MgCl.sub.2.6H.sub.2O (Merck), and 0.25 g K.sub.2HPO.sub.4 (Sigma-Aldrich). The pH was adjusted to 7.0 using KOH (Merck) and ddH.sub.2O was added to a final volume of 100 ml. The media was then filter sterilized (0.2 m pore size) and stored at 4 C.

[0106] Adult D. noxia of between 350 m and 500 m in size were placed individually inside a glass test tube with a 14 mm outside diameter. Parafilm M (Bemis, Oshkosh, Wis., USA) was stretched close to its maximum capacity and placed over the opening. One microliter of siRNA (25 g/l) dissolved in RNase-free water (Ambion), or water for the control, was added to 24 l artificial feeding media and placed on the stretched Parafilm M. Another layer of Parafilm M was then placed over the artificial media, spreading the media between the two layers. The test tubes were placed vertically in a stand with the open end at the bottom. Yellow tape was placed below the test tubes to encourage the aphids to feed. The experiment was repeated ten times (n=10) for each siRNA (i.e., Dnc002 and Dncprr1-8) and control (only media). The survival rate and the number of nymphs produced by each foundress were determined daily for four days.

Aphid Feeding on siRNA-Injected Wheat

[0107] The leaves of 30-day-old wheat plants were injected with 1 l of 1 pg/pl siRNA dissolved in 10 mM Tris (Sigma-Aldrich) pH 7.0, at two locations in the midvein5 mm apart, resulting in a total of 2 g siRNA injected into each leaf. 10 mM Tris (Sigma-Aldrich) at pH 7.0 was injected as a control. A 10 l, model 1701 Hamilton syringe with a 25.4 mm needle of 34 gauge, and 45 tip (Hamilton) was used for the injections. To contain aphids at the injection site, 15 ml polypropylene tubes (Greiner) were cut 45 mm from the opening, after which the closed end of the bottom tube was also removed to produce two tubes of 45 mm in length. After 15 adult aphids were placed on the leaf between the injection sites, the leaf was threaded though the modified polypropylene tube, which was then held in place by cotton wool inserted at the top and bottom of the leaf at each end of the tube. The cotton wool was adjusted to allow aphids to move around freely within a 25 mm.sup.2 area centered around the injection sites. The cages were supported by wire wrapped around the tubes, and anchored to a wooden rod. The foundress aphids were then allowed to feed for a period of 6 h or 48 h before the survivors were counted and sampled for further analysis. Leaf samples were taken at the same time points (6 h and 48 h), as well as directly after injection (Oh). The experiment was performed in triplicate for every time point, and repeated twice over time (n=18).

Foundress Survival and Nymph Reproduction

[0108] Aphid reproductive measurements were taken. Directly after injection of siRNA, the aphids (n=15) (biotype: SAM) were caged on the emerged third leaf of each plant, with each plant considered a biological repeat, with thee biological repeats per treatment (n=3). As the siRNA titer only lasts for a limited time period, the mothers were considered the foundress, and her nymph production recorded from the second day of settlement (24 h). Aphid nymph numbers were measured daily and the mean total number of nymphs was calculated as a measure of fertility (n=15).

Gene Expression Analysis in Aphids Using qPCR

[0109] Silencing/knockdown of candidate genes was confirmed via qPCR. Primers were all designed to be 20 bp in length, to amplify a product of 123 bp in size and bind to the coding domain sequences of the Dnc002 and Dncprr1-8 genes. cDNA was synthesized as described, of which 0.5 ng was subsequently used for qPCR analysis. The qPCR setup comprised 5 l SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and one of the following primer sets: 0.5 M of both the forward and reverse sets specific to Dnc002 or Dncprr1-8, 0.4 M forward and 0.6 M reverse specific to L32 or 0.6 M of both the forward and reverse specific to L27 in 10 l total volume reactions. The PCR cycling profile consisted of two initial steps of 50 C. for 1 min and 95 C. for 5 min, followed by 40 cycles at 95 C. for 10 s, 20 s at annealing temp specified in Table 1 and 72 C. for 20 s. A melt curve was also performed at 0.5 C. increments every 5 s from 65 C. to 95 C. Relative expression was calculated using untreated aphids sampled at day 0 as the calibrator and normalized to ribosomal proteins L27 and L32.

siRNA Concentration in Wheat

[0110] A section of leaf material 10 mm in length, which included the two injection sites in the middle, was used for RNA extraction as described above. Stemloop primers specific to the synthetic siRNAs were designed. Each 20 l cDNA synthesis reaction contained 3 mM MgCl.sub.2, 0.5 mM of each dNTP, 30 M random hexamer primers, 0.5 M specific stemloop primer, 150 ng RNA template, 1 l ImProm-II Reverse Transcriptase (Promega) and 4 l ImProm-II 5X Reaction Buffer (Promega). 5 ng of the cDNA was used in each 10 pl qPCR reaction as well as 5 l SsoAdvanced universal SYBR Green supermix (Bio-Rad), 1 M universal stemloop reverse primer and 1 M specific forward primer (DnC002-siRNA F or RR1-siRNA F, Table 3). Thermal cycling was used to perform the reactions. 18S expression levels for each sample were determined in a 10 l qPCR reaction consisting of 0.2 ng cDNA, 5 l SsoAdvanced Universal SYBR Green Supermix and 0.4 M of both the forward and reverse primers. After an initial 3 min step at 95 C., 40 cycles of 95 C. for 10 s, 54 C. for 30 s and 72 C. for 30 s were followed to amplify the product. The concentration of the siRNAs was calculated relative to 18S expression.

TABLE-US-00006 TABLE3 Sequencesofprimersusedforreverse transcriptionandqPCRofsiRNAs Nameofprimer Sequencesofprimers(5-3) c002siRNASLRT GTCGTATCCAGTGCAGGGTCCGAGGTAT TCGCACTGGATACGACCCTCCG (SEQIDNO:36) c002siRNAF GCCACCATTTCAGAGAGACAT (SEQIDNO:37) cprr1-8siRNASLRT GTCGTATCCAGTGCAGGGTCCGAGGTAT TCGCACTGGATACGACCTTAAA (SEQIDNO:38) cprr1-8siRNAF GCACAGCTTCTTGCGATTG (SEQIDNO:39) UniversalstemloopR GTGCAGGGTCCGAGGT (SEQIDNO:40) 18SRNAforward TGCCTATCAACTTTCGATGG (SEQIDNO:41) 18SRNAreverse TGGATGTGGTAGCCGTTTCTC (SEQIDNO:42)

Aphid Protein Assays

[0111] Aphids were ground in ice-cold 50 mM phosphate buffer (pH of 7.5), 1 mM phenylmethylsulfonyl fluoride and 1 mM dithiothreitol. The extract was centrifuged at 4 C. for 15 min at 17 200 rpm. The supernatant was removed and kept on ice until protein assays were performed.

[0112] Catalase activity was determined colometrically by adding an aliquot of protein extract to 0.2 M phosphate buffer (pH 6.5) and 100 M H.sub.2O.sub.2 and the degradation of H.sub.2O.sub.2 was observed at 260 nm. Enzyme activity was expressed as pmol H.sub.2O.sub.2.mg protein.sup.1.min.sup.1.

[0113] Peroxidase activity was measured by adding an aliquot of protein extract to 0.2 M phosphate buffer (pH 5.0), 100 mM H.sub.2O.sub.2 and 30 mM guaiacol. The formation of tetraguaiacol was a linear function of enzyme concentration and peroxidase activity was expressed as mmol tetraguaiacol min.sup.1. mg.sup.1 protein.

Wheat Protein Assays

[0114] Liquid N.sub.2 was used to freeze wheat leaf material while it was ground. To this, 100 mM potassium phosphate (pH 7.5), 1 mM ethylenediaminetetraacetic acid and 1% polyvinylpyrrolidone was added to further homogenize the leaf material using a micropestle. The supernatant was collected after centrifugation at 4 C. for 15 min at 17 200 rpm.

[0115] Peroxidase activity was determined using horse radish peroxidase (BioLabs, Inqaba, Pretoria, ZA) as a standard. Hydrogen peroxide (0.06%) was added into a mixture containing 2 g of leaf extract, 6 mM guaiacol, 25 mM potassium phosphate buffer (pH 6.0) and 24% distilled water. The formation of tetraguaiacol was a linear function of enzyme concentration and peroxidase activity was expressed as mmol tetraguaiacol min.sup.-1. mg.sup.-1 protein.

Aphid and Plant Protein Concentrations

[0116] All protein concentrations were determined using bovine serum albumin (Bio-Rad, USA) as standard and a Glomax spectrophotometer (Promega, USA) was used for this purpose.

DNA Methylation of Dncprr1-8

[0117] The DNA methylation state of D. noxia biotype SA1 and SAM was determined through whole genome bisulfite sequencing. DNA was extracted from at least 150 D. noxia biotype SA1 and SAM, respectively. The quality of DNA was assessed through Qubit 2.0 (Thermo Fisher Scientific) and a 2% (m/v) TAE agarose gel. The DNA samples were sent to Macrogen (South Korea) where the library preparation and sequencing was performed. After trimming and filtering the HiSeq X (Illumina, USA) reads obtained, Bismark was used to determine the methylation status of SA1 and SAM using the SAM genome as reference (GenBank assembly accession: GCA_001465515.1). For every cytosine in the reference genome Bismark outputs the amount of times it was methylated or unmethylated based on the bisulfite reads mapped to that position. It also distinguishes between the different contexts of cytosine (CpG, CHG and CHH) and the DNA strand that was methylated. In the present study this data set was manipulated to determine the proportion of methylation at every cytosine present in Dncprr1-8 which was then used to determine the total methylation in this gene and to graph the proportion of methylation at every site using Microsoft Excel (Microsoft).

Data Analysis

[0118] All sequence analysis was conducted utilizing the BLASTn and BLASTx tools and SWISSPROT with E-values lower than 1e-10 considered as significant. CutProtFam-Pred: Detection and classification of putative structural cuticular proteins from sequence alone, based on profile Hidden Markov Models was applied to confirm the RR1 protein identity (http://bioinformatics.biol.uoa.gr/CutProtFam-Pred) (loannidou et al., 2014) All statistical analyses were conducted by using GraphPad PRISM 7 Software Tools (www.graphpad.com/guides/prism/7/statistics/index.htm?usingstatistical analysis step by s.htm) with significance set at =0.05. Aphid fertility measurements were calculated using the mean total number of nymphs born per day.

Results and Discussion

[0119] Sequence characterization of D. noxia Dncprr1-8

DNA Sequencing

[0120] After obtaining the in silico predicted sequence for cuticle protein (RR-1) from the available SAM genome sequence (g3915.t2), 1663 bp of biotype SA1 and 1689 bp of biotype SAM were Sanger sequenced (SEQ ID Nos: 4 and 6, respectively). The initial Sanger reads of Dncprr1-8, generated using primers cprr1-8 gene_1 F and cprr1-8 gene_1 R, did not align properly to the reference SAM genome sequence (SEQ ID NO: 5) as there was a sequence gap in this reference sequence (FIGS. 1 and 2). Primers cprr1-8 gene_2 F and cprr1-8 gene_2 R were then designed on the initial Sanger reads obtained to close the sequence gap. As direct PCR sequencing was not possible, the fragments from primers cprr1-8 gene_2 F and cprr1-8 gene_2 R were cloned before it was sequenced. Analysis of the available sequences revealed that the Dncprr1-8 gene was 4197 bp long (SEQ ID NO: 7), containing 5 exons, a non-cytoplasmic domain and includes a 35-36 amino acid motif known as the chitin-binding Rebers and Riddiford (R&R) consensus (FIGS. 3 and 4). SAM clone #2 was found to be different to the SA1 clones. At base position 160 of the CDS, SAM clone #2 had a thymine instead of the guanine found in the other SA1 and SAM clones (SEQ ID NOS: 18 and 19). This should result in glycine to cysteine amino acid change. When predicted secondary structures of both G and T alleles were compared, the length of beta-strands was different and an additional coil was observed on the original G allele around the single nucleotide polymorphism (SNP) (FIG. 5). The predicted tertiary structures also differed between alleles (FIG. 6).

Complementary DNA Sequencing

[0121] The Sanger sequencing reads of biotype SA1 and SAM Dncprr1-8 transcripts (cDNA) almost covered the entire CDS. From the 826 bp in silico predicted Dncprr1-8 transcript, 718 bp from biotype SA1 and 730 bp from biotype SAM were Sanger sequenced directly form PCR products (FIGS. 7 and 8, SEQ ID Nos: 20 and 22). A C/T polymorphism was found at position 218 from the in silico predicted transcription start site. This polymorphism was present in both SA1 and in SAM and had no effect on amino acid sequence. No other polymorphisms were found between the two biotypes, based on cDNA sequencing.

Assessing the Relative Expression of Dnc002 and Dncprr1-8 in D. noxia Biotypes SA1 and SAM

[0122] In order to assess whether there is any difference in the inherent expression of Dncprr1-8 and Dnc002 in biotypes SA1 and SAM when feeding on resistant (GamR) and susceptible (GamS) NiLs, the biotypes were fed on these lines for 10 days. After feeding for 10 days, qPCR expression analyses were conducted for Dncprr1-8 and Dnc002 and relative expression was calculated (FIG. 12). The obtained results revealed that even though the level of Dncprr1-8 expression was higher in SAM relative to its parent SA1, it was not statistically significant (FIG. 12B). While the expression of Dnc002 didn't differ between the aphid biotypes when feeding on GamS, although higher in SAM when feeding on GamR, this also wasn't statistically significant (FIG. 12A).

Optimizing siRNA of Dnc002 and Dncprr1-8

[0123] After determining that the relative expression of these genes didn't differ significantly in biotype SAM irrespective of its host, different siRNA delivery systems were compared. Firstly, siRNA was delivered through direct injection in the insect haemolymph. This technique proved impossible due to the size of the aphids. All the aphids died shortly after injection, irrespective of being injected with no fluid, buffer or siRNA (data not shown).

[0124] Delivery of the siRNA was then conducted using feeding on artificial media (Shakesby et al., 2009; Whyard et al., 2009) or in planta (feeding on siRNA injected plants (Lapitan et al. 2007)), whereafter reproduction and foundress survival (FIGS. 13 and 14) were assessed. The aphids were allowed to feed for 48 h before counting the number of nymphs produced to ensure settling of the foundresses. In the artificial feeding experiment, all foundresses survived irrespective of the feeding medium (FIG. 14). In contrast, 48 hours post injection (hpi) with Dncprr1-8-siRNA and Dnc002-siRNA, significantly more foundresses died after feeding on these plants than on any other treatment.

[0125] In the artificial feeding experiment, although not statistically significant, more nymphs were produced by foundresses feeding on artificial media containing Dncprr1-8-siRNA, than on just artificial medium or medium containing Dnc002-siRNA (FIG. 13). In planta knockdown with both Dncprr1-8-siRNA and Dnc002-siRNA resulted in significantly lower nymph production by foundresses feeding on these plants, when compared to foundresses feeding on GamS and buffer injected plants.

[0126] siRNA of Dnc002 and Dncprr1-8

[0127] To investigate the functions of Dnc002-siRNA and Dncprr1-8 in the salivary glands of virulent biotype SAM while feeding on one of the most RWA resistant wheat varieties, GamR (containing Dn7), biotype SAM was allowed to feed on uninjected, buffer injected and plants injected with either 2 g Dnc002-siRNA (FIG. 15A) or 2 g Dncprr1-8-siRNA (FIG. 15C) and relative gene expression measured. When biotype SAM fed on Dnc002-siRNA for 48 h, overexpression was observed relative to untreated and buffer injected leaves at 6 h and 48 h after introduction of aphids. Upregulation of Dnc002 was also observed when SAM fed on GamS.

[0128] At 6 h after aphid introduction, Dncprr1-8 expression measured in SAM differed according to the plants they fed on and was in the following order (from highest): uninjected GamR >buffer injected GamR>Dncprr1-8-siRNA>GamS. However, the Dncprr1-8 expression differed only statistically between aphids that fed on GamS, GamR and buffer injected plants (P0.05). At 48 hpi the expression of Dncprr1-8 in aphids feeding on GamS was significantly lower than that measured after 6 hpi, and also lower than in aphids feeding on Dncprr1-8-siRNA injected GamR plants. In fact, the levels of Dncprr1-8 of the latter aphids were comparable to those feeding on GamS and much lower than those feeding on uninjected GamR plants.

[0129] At 48 hpi the expression of Dncprr1-8 was the lowest in aphids feeding on Dncprr1-8-siRNA followed by GamS, buffer injected GamR and the highest expression was observed in aphids feeding on GamR. Although not significant, Dncprr1-8 expression was lower in both aphids that fed on Dncprr1-8-siRNA injected GamR and GamS at 48 hpi compared to 6 hpi. Between the same time points Dncprr1-8 expression of aphids that fed on buffer injected GamR also decreased, but not to the same extend as Dncprr1-8-siRNA injected plants and GamS. When feeding on GamR, Dncprr1-8 expression stayed roughly the same.

[0130] To validate that the response measured in the feeding aphids can be directly correlated to siRNA present in the plants, the levels of Dncprr1-8-siRNA and Dnc002-siRNA were quantified using stemloop primers and qPCR analyses to reveal the siRNA concentration relative to wheat 18S expression (FIGS. 15B and D). These results confirmed that Dnc002-siRNA and Dncprr1-8-siRNA were present in the siRNA injected leaves and absent from the untreated leaves. Six hours after injection the siRNA was still present at levels equivalent to levels measured directly after injection. After 48 h a decrease in siRNA was observed, although it was still present in significant quantities, indicating relative stability within the plant. The measured levels of siRNA were significantly higher (P0.05) in the Dncprr1-8-siRNA and Dnc002-siRNA injected plants, when compared to all other plants.

Transgenerational Effect of siRNA

[0131] To validate whether the interference also affects the unborn embryos of the feeding foundresses, newly born nymphs were sampled on 0, 96 and 144 hpi and assayed for the expression of Dncprr1-8 (FIG. 16). Interestingly, the effect of knockdown was most severe in newly born nymphs produced 96 hpi, and differed significantly from that in nymphs produced from foundresses feeding on uninjected GamR plants.

D. noxia-Host Interaction

[0132] To elucidate the functions of Dnc002 and Dncprr1-8 in the salivary glands of virulent biotype SAM during feeding on GamR (a wheat expressing antibiosis and antixenosis, biotype SAM was allowed to feed on uninjected, buffer injected and plants injected with either 2 pg Dnc002-siRNA or 2 g Dncprr1-8-siRNA, whereafter the activities of reactive oxygen species (ROS) were assayed in the feeding aphids and host (FIG. 17).

[0133] As peroxidase (PDX) is a ROS enzyme and a marker of the oxidative burst during the host defense throughout the interaction of wheat and Diuraphis noxia, it was assayed at 0, 6 and 48 hpi (FIG. 17A). When comparing the PDX activity between uninjected, infested GamS and GamR plants, higher PDX activity was measured in the plants after infestation, with the highest PDX activity assayed in the GamR 48 hpi (P0.05), which is indicative of the induction of the host defense response. However, even though PDX activity increased slightly in the Dnc002-siRNA and Dncprr1-8-siRNA injected plants after 6 hpi, it decreased after 48 hpi to that at 0 h. This observation suggests that unlike aphids feeding on uninjected GamR plants, the aphids feeding on the Dnc002-siRNA and Dncprr1-8-siRNA injected plants were not perceived as invasive. Hence the decrease in the transcription of host defense proteins like PDX, as these are expected to increase as part of the systemic acquired resistance pathway in the resistant GamR plants and remained elevated to provide prolonged basal resistance.

[0134] Although aphid survival rate was still unaffected 6 h after feeding on siRNA (FIG. 14), PDX and catalase (CAT) activity increased in aphids feeding on uninjected GamS and GamR, buffer injected and Dnc002-siRNA or Dncprr1-8-siRNA injected plants over the 48 h period (FIG. 17B). However, PDX activity was only significantly higher in aphids feeding on Dnc002-siRNA or Dncprr1-8-siRNA injected plants (P0.05) 6 hpi (FIG. 17B). CAT activity was also elevated at 6 hpi in aphids that fed on Dncprr1-8- and Dnc002-siRNA injected plants, with CAT activity in Dnc002-siRNA fed aphids being significantly higher than in aphids that fed on buffer injected plants (P0.05) (FIG. 17C). ROS metabolism influences critical parameters of insect physiology, including fecundity and immune response. As PDX and CAT activity is indicative of cellular stress experienced in response to the aphids' feeding environment, the results suggest that both genes afford the aphids some level of protection while feeding on the antixenotic and antibiotic GamR, as partial knockdown of these genes decreased foundress survival by approximately 50% and affected nymph production significantly during in planta feeding experiments. In a field setting, a reduction of the aphid reproduction by 40-60% would dramatically decrease aphid population growth, contributing to a substantial reduction in agricultural losses.

DNA Methylation of Dncprr1-8

[0135] In order to determine if DNA methylation is involved in the differential expression of Dncprr1-8 between biotype SAM and SA1, whole genome sequence data of bisulfite treated DNA from at least one hundred aphids from each biotype was analyzed. In doing so the proportion of DNA methylation at every cytosine of Dncprr1-8 was determined for the two biotypes. Methylation was observed at more sites and at a higher frequency in SAM compared to SA1 in the CpG, CHG and CHH contexts (Table 4).

TABLE-US-00007 TABLE 4 DNA methylation of Dncprr1-8. The amount of cytosine sites and total proportion of methylation (5-methylcytosine) in the contexts of CpG, CHG and CHH is compared between SA1 and SAM Dncrpp1-8 Amount of sites methylated Percentage methylation CpG CHG CHH Total CpG CHG CHH Total SA1 38 34 58 130 1.83% 1.13% 0.76% 1.08% SAM 54 42 67 163 2.58% 1.31% 1.04% 1.45%

[0136] Methylation was mainly observed in the exonic areas of Dncprr1-8 (FIG. 18). At 416 bp, 422 bp, 433 bp and 436 bp after the TSS, SAM is methylated 90.00%, 95.24%, 95.65% and 95.65%, while SA1 was methylated at 78.57%, 73.68%, 82.35% and 82.35%, respectively. That amounts to a difference in the average methylation for those sites of 14.90%. At 518 bp after the TSS of Dncprr1-8 (second exon), SA1 is methylated at 27.3% while no methylation was observed in SAM even though 26 reads were mapped at that position. In the area of Dncprr1-8 that translates to the chitin-binding domain (1197-1274 bp from the TSS), the following observations were made: from 1,200 bp to 1,225 bp from the TSS (just left from the highest peak on the graph on the 4th exon as seen in FIG. 18), SAM is 2.13% more methylated than SAl. Furthermore, the highest frequency of DNA methylation in both biotypes was observed at 1268-1294 bp from the TSS.

REFERENCES

[0137] Edgar, R. C. (2004). MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792-1797. [0138] Lapitan, N. L. V., Li, Y.-C., Peng, J. and Botha, A-M. (2007) Fractionated extracts of Russian wheat aphid eliciting defense responses in wheat. J. Econ. Entomol. 100, 990-999. [0139] Shakesby, A. J., Wallace, I. S., Isaacs, H. V., Pritchard, J., Roberts, D. M. and Douglas, A. E. (2009). A water-specific aquaporin involved in aphid osmoregulation. Insect Biochem. Mol. Biol. 39, 1-10. [0140] Whyard, S., Singh, A. D. and Wong, S. (2009). Ingested double-stranded RNAs can act as species-specific insecticides. Insect. Biochem. Mol. Biol. 39, 824-832.