TRANSGENIC MAMMALS AND METHODS OF USE THEREOF
20210000087 · 2021-01-07
Inventors
- Bao DUONG (Pacifica, CA, US)
- Peter Daniel BURROWS (Birmingham, AL, US)
- Werner MUELLER (Köln, DE)
- Gloria ESPOSITO (Vienna, AT)
- Matthias WABL (San Francisco, CA, US)
Cpc classification
C07K16/462
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
A01K2267/01
HUMAN NECESSITIES
C12N5/163
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
A01K67/0278
HUMAN NECESSITIES
A01K2217/05
HUMAN NECESSITIES
International classification
Abstract
Transgenic mammals that express canine-based immunoglobulins are described herein, including transgenic rodents that express canine-based immunoglobulins for the development of canine therapeutic antibodies.
Claims
1. A transgenic rodent or rodent cell comprising a genome comprising an engineered partly canine immunoglobulin light chain locus comprising canine immunoglobulin light chain variable region gene segments, wherein the engineered immunoglobulin locus is capable of expressing immunoglobulin comprising canine variable domains and wherein the transgenic rodent produces more, or is more likely to produce, immunoglobulin comprising light chain than immunoglobulin comprising light chain.
2. The transgenic rodent according to claim 1, wherein more light chain producing cells than light chain producing cells are likely to be isolated from said rodent.
3. The transgenic rodent according to claim 1, wherein the transgenic rodent produces at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% and up to about 100% immunoglobulin comprising light chain.
4. The transgenic rodent cell according to claim 1, wherein the transgenic rodent cell, or its progeny, has at least about a 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% and up to about 100%, probability of producing immunoglobulin comprising light chain.
5. The transgenic rodent or rodent cell according to claim 1, wherein the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain variable region gene locus.
6. The transgenic rodent or rodent cell according to claim 1, wherein the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain variable region gene locus.
7. The transgenic rodent or rodent cell according to claim 6, wherein the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences and one or more J-C units wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and a rodent constant region coding sequence.
8. The transgenic rodent or rodent cell according to claim 7, wherein the rodent constant region coding sequence comprises a rodent C.sub.1, C.sub.2, C.sub.3 coding sequence, or a combination thereof.
9. The transgenic rodent or rodent cell according to claim 7, wherein the J-C units comprise canine J.sub. gene segment coding sequences and rodent constant region coding sequences embedded in non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain locus.
10. The transgenic rodent or rodent cell according to claim 6, wherein the engineered immunoglobulin locus comprises a rodent immunoglobulin locus in which one or more rodent V.sub. gene segment coding sequences and one or more rodent J.sub. gene segment coding sequences have been deleted and replaced by one or more canine V.sub. gene segment coding sequences and one or more J.sub. gene segment coding sequences, respectively, and in which rodent C.sub. coding sequences in the locus have been replaced by rodent C.sub.1, C.sub.2, C.sub.3 coding sequence, or a combination thereof.
11. The transgenic rodent or rodent cell according to claim 1 wherein: (A) an endogenous rodent immunoglobulin light chain locus is deleted, inactivated, or made nonfunctional one or more of: i. deleting or mutating all endogenous rodent V.sub. gene segment coding sequences; ii. deleting or mutating all endogenous rodent J.sub. gene segment coding sequences; iii. deleting or mutating all endogenous rodent C.sub. coding sequence; iv. deleting or mutating a 5 splice site and adjacent polypyrimidine tract of a rodent C.sub. coding sequence; v. deleting, mutating, or disrupting an endogenous intronic enhancer (iE.sub.) and 3 enhancer sequence; or (B) an endogenous rodent immunoglobulin light chain variable domain is suppressed or inactivated by one or more of: i. deleting or mutating all endogenous rodent V.sub. gene segments ii. deleting or mutating all endogenous rodent J.sub. gene segments; and iii. deleting or mutating all endogenous rodent C.sub. coding sequences.
12. The transgenic rodent or rodent cell according to claim 1, wherein the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine variable domain and rodent constant domain.
13. The transgenic rodent or rodent cell according claim 1, wherein the genome of the transgenic rodent or rodent cell comprises an engineered immunoglobulin locus comprising canine V.sub. and J.sub. gene segment coding sequences embedded in rodent non-coding regulatory or scaffold sequences of the rodent immunoglobulin light chain variable region gene locus.
14. The transgenic rodent or rodent cell according to claim 13, wherein the canine V.sub. and J.sub. coding sequences are inserted upstream of a rodent immunoglobulin light chain constant region coding sequence.
15. The transgenic rodent or rodent cell according to claim 1, wherein the genome of the transgenic rodent or rodent cell comprises an engineered immunoglobulin locus comprising canine V.sub. and J.sub. gene segment coding sequences embedded in rodent non-coding regulatory or scaffold sequences of the rodent immunoglobulin light chain variable region gene locus.
16. The transgenic rodent or rodent cell according to claim 15, comprising a rodent immunoglobulin light chain constant region coding sequence inserted downstream of the canine V.sub. and J.sub. gene segment coding sequences.
17. The transgenic rodent or rodent cell according to claim 16, wherein the rodent immunoglobulin light chain constant region is inserted upstream of an endogenous rodent C.sub.2 coding sequence.
18. The transgenic rodent or rodent cell according to claim 15, wherein expression of an endogenous rodent immunoglobulin light chain variable domain is suppressed or inactivated by one or more of: a. deleting or mutating all endogenous rodent V.sub. gene segment coding sequences. b. deleting or mutating all endogenous rodent J.sub. gene segment coding sequences; and c. deleting or mutating all endogenous C.sub. coding sequences or splice sites.
19. The transgenic rodent or rodent cell according to claim 1 wherein the engineered canine immunoglobulin light chain locus comprises a rodent intronic enhancer (iE.sub.) and 3E.sub. regulatory sequences.
20. The transgenic rodent or rodent cell according to claim 1, wherein the transgenic rodent or rodent cell comprises an engineered partly canine immunoglobulin heavy chain locus comprising canine immunoglobulin heavy chain variable region gene coding sequences and non-coding regulatory or scaffold sequences of the rodent immunoglobulin heavy chain locus.
21. The transgenic rodent or rodent cell according to claim 20, wherein the engineered canine immunoglobulin heavy chain locus comprises canine V.sub.H, D and J.sub.H gene segments comprising V.sub.H, D or J.sub.H coding sequences embedded in non-coding regulatory or scaffold sequences of the rodent immunoglobulin heavy chain locus.
22. The transgenic rodent or rodent cell according to claim 21, wherein the heavy chain scaffold sequences are interspersed by functional ADAM6A genes, ADAM6B genes, or a combination thereof.
23. The transgenic rodent or rodent cell according to claim 1, wherein the rodent regulatory or scaffold sequences comprise enhancer, promoters, splice sites, introns, recombination signal sequences, or combinations thereof.
24. The transgenic rodent or rodent cell according to claim 1, wherein an endogenous rodent immunoglobulin locus has been deleted and replaced with the engineered partly canine immunoglobulin locus.
25. The transgenic rodent or rodent cell according to claim 1, wherein the rodent is a mouse or a rat.
26. The transgenic rodent or rodent cell according to claim 1, wherein the rodent cell is a mouse or rat embryonic stem (ES) cell, or mouse or rat cell of an early stage embryo.
27. A cell of B lymphocyte lineage obtained from the transgenic rodent of claim 1, wherein the engineered immunoglobulin locus expresses a chimeric immunoglobulin heavy chain or light chain comprising a canine variable region and a rodent immunoglobulin constant region.
28. A hybridoma cell or immortalized cell line derived from a cell of B lymphocyte lineage according to claim 27.
29. Antibodies or antigen binding portions thereof produced by the cell of claim 27.
30. A nucleic acid sequence of a V.sub.H, D, or J.sub.H, or a V.sub.L or J.sub.L gene segment coding sequence derived from an immunoglobulin produced by the cell of claim 27.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
DEFINITIONS
[0119] The terms used herein are intended to have the plain and ordinary meaning as understood by those of ordinary skill in the art. The following definitions are intended to aid the reader in understanding the present invention, but are not intended to vary or otherwise limit the meaning of such terms unless specifically indicated.
[0120] The term locus as used herein refers to a chromosomal segment or nucleic acid sequence that, respectively, is present endogenously in the genome or is (or about to be) exogenously introduced into the genome. For example, an immunoglobulin locus may include part or all of the genes (i.e., V, D, J gene segments as well as constant region genes) and intervening sequences (i.e., introns, enhancers, etc.) supporting the expression of immunoglobulin H or L chain polypeptides. Thus, a locus (e.g., immunoglobulin heavy chain variable region gene locus) may refer to a specific portion of a larger locus (e.g., a portion of the immunoglobulin H chain locus that includes the V.sub.H, D.sub.H and J.sub.H gene segments). Similarly, an immunoglobulin light chain variable region gene locus may refer to a specific portion of a larger locus (e.g., a portion of the immunoglobulin L chain locus that includes the V.sub.L and J.sub.L gene segments). The term immunoglobulin variable region gene as used herein refers to a V, D, or J gene segment that encodes a portion of an immunoglobulin H or L chain variable domain. The term immunoglobulin variable region gene locus as used herein refers to part of, or the entire, chromosomal segment or nucleic acid strand containing clusters of the V, D, or J gene segments and may include the non-coding regulatory or scaffold sequences.
[0121] The term gene segment as used herein, refers to a nucleic acid sequence that encodes a part of the heavy chain or light chain variable domain of an immunoglobulin molecule. A gene segment can include coding and non-coding sequences. The coding sequence of a gene segment is a nucleic acid sequence that can be translated into a polypeptide, such the leader peptide and the N-terminal portion of a heavy chain or light chain variable domain. The non-coding sequences of a gene segment are sequences flanking the coding sequence, which may include the promoter, 5 untranslated sequence, intron intervening the coding sequences of the leader peptide, recombination signal sequence(s) (RSS), and splice sites. The gene segments in the immunoglobulin heavy chain (IGH) locus comprise the V.sub.H, D and J.sub.H gene segments (also referred to as IGHV, IGHD and IGHJ, respectively). The light chain variable region gene segments in the immunoglobulin and light loci can be referred to as V.sub.L and J.sub.L gene segments. In the light chain, the V.sub.L and J.sub.L gene segments can be referred to as V.sub. and J.sub. gene segments or IGKV and IGKJ. Similarly, in the light chain, the V.sub.L and J.sub.L gene segments can be referred to as V.sub. and J.sub. gene segments or IGLV and IGLJ.
[0122] The heavy chain constant region can be referred to as C.sub.H or IGHC. The C.sub.H region exons that encode IgM, IgD, IgG1-4, IgE, or IgA can be referred to as, respectively, C.sub., C.sub., C.sub.1-4, C.sub. or C.sub.. Similarly, the immunoglobulin or constant region can be referred to as C.sub. or C.sub., as well as IGKC or IGLC, respectively.
[0123] Partly canine as used herein refers to a strand of nucleic acids, or their expressed protein and RNA products, comprising sequences corresponding to the sequences found in a given locus of both a canine and a non-canine mammalian host. Partly canine as used herein also refers to an animal comprising nucleic acid sequences from both a canine and a non-canine mammal, for example, a rodent. In one aspect, the partly canine nucleic acids have coding sequences of canine immunoglobulin H or L chain variable region gene segments and sequences based on the non-coding regulatory or scaffold sequences of the endogenous immunoglobulin locus of the non-canine mammal.
[0124] The term based on when used with reference to endogenous non-coding regulatory or scaffold sequences from a non-canine mammalian host cell genome refers to the non-coding regulatory or scaffold sequences that are present in the corresponding endogenous locus of the mammalian host cell genome. In one aspect, the term based on means that the non-coding regulatory or scaffold sequences that are present in the partly canine immunoglobulin locus share a relatively high degree of homology with the non-coding regulatory or scaffold sequences of the endogenous locus of the host mammal. In one aspect, the non-coding sequences in the partly canine immunoglobulin locus share at least about 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with the corresponding non-coding sequences found in the endogenous locus of the host mammal. In one aspect, the non-coding sequences in the partly canine immunoglobulin locus are retained from an immunoglobulin locus of the host mammal. In one aspect, the canine coding sequences are embedded in the non-regulatory or scaffold sequences of the immunoglobulin locus of the host mammal. In one aspect, the host mammal is a rodent, such as a rat or mouse.
[0125] Non-coding regulatory sequences refer to sequences that are known to be essential for (i) V(D)J recombination, (ii) isotype switching, (iii) proper expression of the full-length immunoglobulin H or L chains following V(D)J recombination, and (iv) alternate splicing to generate, e.g., membrane and secreted forms of the immunoglobulin H chain. Non-coding regulatory sequences may further include the following sequences of endogenous origin: enhancer and locus control elements such as the CTCF and PAIR sequences (Proudhon, et al., Adv. Immunol. 128:123-182 (2015)); promoters preceding each endogenous V gene segment; splice sites; introns; recombination signal sequences flanking each V, D, or J gene segment. In one aspect, the non-coding regulatory sequences of the partly canine immunoglobulin locus share at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% and up to 100% homology with the corresponding non-coding sequences found in the targeted endogenous immunoglobulin locus of the non-canine mammalian host cell.
[0126] Scaffold sequences refer to sequences intervening the gene segments present in the endogenous immunoglobulin locus of the host cell genome. In certain aspects, the scaffold sequences are interspersed by sequences essential for the expression of a functional non-immunoglobulin gene, for example, ADAM6A or ADAM6B. In certain aspects, the scaffold sequences are derived (at least partially) from other sourcese.g., they could be rationally designed or artificial sequences, sequences present in the immunoglobulin locus of the canine genome, sequences present in the immunoglobulin locus of another species, or combinations thereof. It is to be understood that the phrase non-coding regulatory or scaffold sequence is inclusive in meaning (i.e., referring to both the non-coding regulatory sequence and the scaffold sequence existing in a given locus).
[0127] The term homology targeting vector refers to a nucleic acid sequence used to modify the endogenous genome of a mammalian host cell by homologous recombination; such nucleic acid sequence may comprise (i) targeting sequences with significant homologies to the corresponding endogenous sequences flanking a locus to be modified that is present in the genome of the non-canine mammalian host, (ii) at least one sequence-specific recombination site, (iii) non-coding regulatory or scaffold sequences, and (iv) optionally one or more selectable marker genes. As such, a homology targeting vector can be used to introduce a sequence-specific recombination site into particular region of a host cell genome.
[0128] Site-specific recombination or sequence-specific recombination refers to a process of DNA rearrangement between two compatible recombination sequences (also referred to as sequence-specific recombination sites or site-specific recombination sequences) including any of the following three events: a) deletion of a preselected nucleic acid flanked by the recombination sites; b) inversion of the nucleotide sequence of a preselected nucleic acid flanked by the recombination sites, and c) reciprocal exchange of nucleic acid sequences proximate to recombination sites located on different nucleic acid strands. It is to be understood that this reciprocal exchange of nucleic acid segments can be exploited as a targeting strategy to introduce an exogenous nucleic acid sequence into the genome of a host cell.
[0129] The term targeting sequence refers to a sequence homologous to DNA sequences in the genome of a cell that flank or are adjacent to the region of an immunoglobulin locus to be modified. The flanking or adjacent sequence may be within the locus itself or upstream or downstream of coding sequences in the genome of the host cell. Targeting sequences are inserted into recombinant DNA vectors which are used to transfect, e.g., ES cells, such that sequences to be inserted into the host cell genome, such as the sequence of a recombination site, are flanked by the targeting sequences of the vector.
[0130] The term site-specific targeting vector as used herein refers to a vector comprising a nucleic acid encoding a sequence-specific recombination site, an engineered partly canine locus, and optionally a selectable marker gene, which is used to modify an endogenous immunoglobulin locus in a host using recombinase-mediated site-specific recombination. The recombination site of the targeting vector is suitable for site-specific recombination with another corresponding recombination site that has been inserted into a genomic sequence of the host cell (e.g., via a homology targeting vector), adjacent to an immunoglobulin locus that is to be modified. Integration of an engineered partly canine sequence into a recombination site in an immunoglobulin locus results in replacement of the endogenous locus by the exogenously introduced partly canine region.
[0131] The term transgene is used herein to describe genetic material that has been or is about to be artificially inserted into the genome of a cell, and particularly a cell of a mammalian host animal. The term transgene as used herein refers to a partly canine nucleic acid, e.g., a partly canine nucleic acid in the form of an engineered expression construct or a targeting vector.
[0132] Transgenic animal refers to a non-canine animal, usually a mammal, having an exogenous nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line DNA (i.e., in the genomic sequence of most or all of its cells). In one aspect, a partly canine nucleic acid is introduced into the germ line of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal according to methods well known in the art.
[0133] A vector includes plasmids and viruses and any DNA or RNA molecule, whether self-replicating or not, which can be used to transform or transfect a cell.
[0134] Note that as used herein and in the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a locus refers to one or more loci, and reference to the method includes reference to equivalent steps and methods known to those skilled in the art, and so forth.
[0135] As used herein, the term or can mean and/or, unless explicitly indicated to refer only to alternatives or the alternatives are mutually exclusive. The terms including, includes and included, are not limiting.
[0136] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices, formulations and methodologies that may be used in connection with the presently described invention.
[0137] Where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the invention.
[0138] The practice of the techniques described herein may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and sequencing technology, which are within the skill of those who practice in the art. Such conventional techniques include polymer array synthesis, hybridization and ligation of polynucleotides, polymerase chain reaction, and detection of hybridization using a label. Specific illustrations of suitable techniques can be had by reference to the examples herein. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Green, et al., Eds. (1999), Genome Analysis: A Laboratory Manual Series (Vols. I-IV); Weiner, Gabriel, Stephens, Eds. (2007), Genetic Variation: A Laboratory Manual; Dieffenbach and Veksler, Eds. (2007), PCR Primer: A Laboratory Manual; Bowtell and Sambrook (2003), DNA Microarrays: A Molecular Cloning Manual; Mount (2004), Bioinformatics: Sequence and Genome Analysis; Sambrook and Russell (2006), Condensed Protocols from Molecular Cloning: A Laboratory Manual; and Sambrook and Russell (2002), Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry (4th Ed.) W.H. Freeman, New York N.Y.; Gait, Oligonucleotide Synthesis: A Practical Approach 1984, IRL Press, London; Nelson and Cox (2000), Lehninger, Principles of Biochemistry 3.sup.rd Ed., W. H. Freeman Pub., New York, N.Y.; and Berg et al. (2002) Biochemistry, 5.sup.th Ed., W.H. Freeman Pub., New York, N.Y., all of which are herein incorporated in their entirety by reference for all purposes.
DETAILED DESCRIPTION
[0139] In the following description, numerous specific details are set forth to provide a more thorough understanding of the present invention. However, it will be apparent to one of skill in the art that the present invention may be practiced without one or more of these specific details. In other instances, well-known features and procedures well known to those skilled in the art have not been described in order to avoid obscuring the invention.
[0140] Described herein is a transgenic rodent or rodent cell having a genome comprising an engineered partly canine immunoglobulin heavy chain or light chain locus. In one aspect, the partly canine immunoglobulin heavy chain locus comprises one or more canine immunoglobulin heavy chain variable region gene segments. In one aspect, the partly canine immunoglobulin light chain locus comprises one or more canine immunoglobulin light chain variable region gene segments. In one aspect, the partly canine immunoglobulin light chain locus comprises one or more canine immunoglobulin light chain variable region gene segments.
[0141] In one aspect, non-canine mammalian cells are provided that comprise an exogenously introduced, engineered partly canine nucleic acid sequence comprising coding sequences for canine variable regions and non-coding regulatory or scaffold sequences present in the immunoglobulin locus of the mammalian host genome, e.g., mouse genomic non-coding sequences when the host mammal is a mouse. In one aspect, one or more coding sequences for canine variable region gene segments are embedded in non-coding regulatory or scaffold sequences corresponding to those of an immunoglobulin locus in a mammalian host genome. In one aspect, the coding sequences for canine variable region gene segments are embedded in non-coding regulatory or scaffold sequences of a rodent or mouse immunoglobulin locus.
[0142] In one aspect, the partly canine immunoglobulin locus is synthetic and comprises canine V.sub.H, D, or J.sub.H or V.sub.L or J.sub.L gene segment coding sequences that are under the control of regulatory elements of the endogenous host. In one aspect, the partly canine immunoglobulin locus comprises canine V.sub.H, D, or J.sub.H or V.sub.L or J.sub.L gene segment coding sequences embedded in non-coding regulatory or scaffold sequences corresponding to those of an immunoglobulin locus in a mammalian host genome.
[0143] Methods are also provided for generating a transgenic rodent or rodent ES cell comprising exogenously introduced, engineered partly canine immunoglobulin loci, wherein the resultant transgenic rodent is capable of producing more immunoglobulin comprising light chain than immunoglobulin comprising light chain.
[0144] There are many challenges presented when generating a non-canine mammal such as a transgenic mouse or rat, that is capable of producing antigen-specific canine antibodies that are addressed by the constructs and methods described herein, including, but not limited to: [0145] 1. How to obtain : light chain usage ratio of 90:10 in an organism such as a mouse or rat that preferentially uses 90% light chains; [0146] 2. Whether mouse B cells can express a large number of dog V.sub. gene segments (the dog locus contains at least 70 functional, unique V.sub. gene segments) when the mouse locus contains only 3 functional V.sub. gene segments; [0147] 3. How to improve expression and usage of canine V.sub. in a non-canine mammal, such as a mouse, in view of the differences in structure between the mouse and dog light chain loci locus. [0148] a. The mouse light chain loci locus contains 2 clusters of V.sub. gene segment(s), J.sub. gene segment(s), and C.sub. exon(s): [0149] i. V.sub.2-V.sub.3-J.sub.2-C.sub.2 [0150] ii. V.sub.1-J.sub.3-C.sub.3-J.sub.1-C.sub.1; and [0151] b. the dog locus contains tandem V.sub. gene segments upstream of J.sub.-C.sub. clusters. [0152] 4. Whether mouse B cells can develop normally if mouse IgD is expressed with dog V.sub.H, in view of the fact that canine IgD is not functional and IgM and IgD are co-expressed as alternatively spliced forms in mouse and rat B cells.
Immunoglobulin Loci in Mice and Dog
[0153] In the humoral immune system, a diverse antibody repertoire is produced by combinatorial and junctional diversity of IGH and IGL chain gene loci by a process termed V(D)J recombination. In the developing B cell, the first recombination event to occur is between one D and one J.sub.H gene segment of the heavy chain locus, and the DNA between these two gene segments is deleted. This D-J.sub.H recombination is followed by the joining of one V.sub.H gene segment from a region upstream of the newly formed DJ.sub.H complex, forming a rearranged V.sub.HDJ.sub.H exon. All other sequences between the recombined V.sub.H and D gene segments of the newly generated V.sub.HDJ.sub.H exon are deleted from the genome of the individual B cell. This rearranged exon is ultimately expressed on the B cell surface as the variable region of the H-chain polypeptide, which is associated with an L-chain polypeptide to form the B cell receptor (BCR).
[0154] The light chain repertoire in the mouse is believed to be shaped by the order of gene rearrangements. The IGK light chain locus on both chromosomes is believed to undergo V.sub.-J.sub. rearrangements first before the IGL light chain locus on either chromosome becomes receptive for V.sub.-J.sub. recombination. If an initial rearrangement is unproductive, additional rounds of secondary rearrangement can proceed, in a process known as receptor editing (Collins and Watson. (2018) Immunoglobulin light chain gene rearrangements, receptor editing and the development of a self-tolerant antibody repertoire. Front. Immunol. 9:2249.) A process of serial rearrangement of the chain locus may continue on one chromosome until all possibilities of recombination are exhausted. Recombination will then proceed on the second chromosome. A failure to produce a productive rearrangement on the second chromosome after multiple rounds of rearrangement will be followed by rearrangement on the loci (Collins and Watson (2018) Immunoglobulin light chain gene rearrangements, receptor editing and the development of a self-tolerant antibody repertoire. Front. Immunol. 9:2249.)
[0155] This preferential order of light chain rearrangements is believed to give rise to a light chain repertoire in mouse that is >90% and <10% . However, immunoglobulins in the dog immune system are dominated by light chain usage, which has been estimated to be at least 90% to <10% (Arun et al. (1996) Immunohistochemical examination of light-chain expression (/ ratio) in canine, feline, equine, bovine and porcine plasma cells. Zentralbl Veterinarmed A. 43(9):573-6).
[0156] The murine and canine Ig loci are highly complex in the numbers of features they contain and in how their coding regions are diversified by V(D)J rearrangement; however, this complexity does not extend to the basic details of the structure of each variable region gene segment. The V, D and J gene segments are highly uniform in their compositions and organizations. For example, V gene segments have the following features that are arranged in essentially invariant sequential fashion in immunoglobulin loci: a short transcriptional promoter region (<600 bp in length), an exon encoding the 5 UTR and the majority of the signal peptide for the antibody chain; an intron; an exon encoding a small part of the signal peptide of the antibody chain and the majority of the antibody variable domain, and a 3 recombination signal sequence necessary for V(D)J rearrangement. Similarly, D gene segments have the following necessary and invariant features: a 5 recombination signal sequence, a coding region and a 3 recombination signal sequence. The J gene segments have the following necessary and invariant features: a 5 recombination signal sequence, a coding region and a 3 splice donor sequence.
[0157] The canine genome V.sub.H region comprises approximately 39 functional V.sub.H, 6 functional D and 5 functional J.sub.H gene segments mapping to a 1.46 Mb region of canine chromosome 8. There are also numerous V.sub.H pseudogenes and one J.sub.H gene segment (IGHJ1) and one D gene segment (IGHD5) that are thought to be non-functional because of non-canonical heptamers in their RSS. (Such gene segments are referred to as Open Reading Frames (ORFs).)
[0158] The sequences of the canine IGHC are in Table 4.
[0159] The canine IGL locus maps to canine chromosome 26, while the canine IGK coding region maps to canine chromosome 17.
[0160] The sequences of the canine IGKC and IGLC are in Table 4.
[0161] The canine locus (1217) is large (2.6 Mbp) with 162 V.sub. genes (1218), of which at least 76 are functional. The canine locus also includes 9 tandem cassettes or J-C units, each containing a J.sub. gene segment and a C.sub. exon (1219). See, Martin et al. (2018) Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci. Immunogenetics. 70:223-236.
[0162] The canine locus (1220) is small (400 Kbp) and has an unusual structure in that eight of the functional V.sub. gene segments are located upstream (1222) and five are located downstream (1226) of the J.sub. (1223) gene segments and C.sub. (1224) exon. The canine upstream V.sub. region has all functional gene segments in the same transcriptional orientation as the J.sub. gene segment and C.sub. exon, with two pseudogenes (IGKV3-3 and IGKV7-2) and one ORF (IGKV4-1) in the reverse transcriptional orientation (not shown). The canine downstream V.sub. region has all functional gene segments in the opposite transcriptional orientation as the J.sub. gene segment and C.sub. exon and includes six pseudogenes. The Ribose 5-Phosphate Isomerase A (RPIA) gene (1225) is also found in the downstream V.sub. region, between C.sub. and IGKV2S19. See, Martin et al. (2018) Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci. Immunogenetics. 70:223-236.
[0163] The mouse immunoglobulin locus is located on chromosome 6.
[0164] The mouse immunoglobulin locus is located on chromosome 16.
[0165] The partly canine nucleic acid sequence described herein allows the transgenic animal to produce a heavy chain or light chain repertoire comprising canine V.sub.H or V.sub.L regions, while retaining the regulatory sequences and other elements that can be found within the intervening sequences of the host genome (e.g., rodent) that help to promote efficient antibody production and antigen recognition in the host.
[0166] In one aspect, synthetic, or recombinantly produced, partly canine nucleic acids are engineered to comprise both canine coding sequences and non-canine non-coding regulatory or scaffold sequences of an immunoglobulin V.sub.H, V.sub. or V.sub. locus, or, in some aspects, a combination thereof.
[0167] In one aspect, a transgenic rodent or rodent cell that expresses immunoglobulin with a canine variable region can be generated by inserting one or more canine V.sub.H gene segment coding sequences into a V.sub.H locus of a rodent heavy chain immunoglobulin locus. In another aspect, a transgenic rodent or rodent cell that expresses immunoglobulin with canine a variable region can be generated by inserting one or more canine V.sub.L gene segment coding sequences into a V.sub.L locus of a rodent light chain immunoglobulin locus.
[0168] The existence of two light chain loci and means that a variety of light chain insertion combinations are possible for generating a transgenic rodent or rodent cell that expresses immunoglobulin with canine a variable region, including but not limited to: inserting one or more canine V.sub. or J.sub. gene segment coding sequences into a rodent V.sub. locus, inserting one or more canine V.sub. or J.sub. gene segment coding sequences into a rodent V.sub. locus, inserting one or more canine V.sub. or J.sub. gene segment coding sequences into a rodent V.sub. locus and inserting one or more canine V.sub. or J.sub. gene segment coding sequences into a rodent V.sub. locus.
[0169] The selection and development of a transgenic rodent or rodent cell that expresses partly canine immunoglobulin is complicated by the fact that more than 90% of light chains produced by mice are and less than 10% are whereas more than 90% of light chains produced by dogs are and less than 10% and the fact that the canine immunoglobulin locus is large and includes over 100 V.sub. gene segments, whereas the mouse immunoglobulin includes only 3 functional V.sub. gene segments.
[0170] Since mice produce mainly LC-containing antibodies, one reasonable method to increase production of LC-containing partly canine immunoglobulin by the transgenic rodent would be to insert one or more canine V.sub. or J.sub. gene segment coding sequences into a rodent locus. However, as shown in the Example 9 below, coupling canine V.sub. region exon with rodent C.sub. region exon results in sub-optimal expression of the partly canine immunoglobulin in vitro.
[0171] Provided herein is a transgenic rodent or rodent cell that is capable of expressing immunoglobulin comprising canine variable domains, wherein the transgenic rodent produces more or is more likely to produce immunoglobulin comprising light chain than immunoglobulin comprising light chain. While not wishing to be bound by theory, it is believed that a transgenic rodent or rodent cell that produces more, or is more likely to produce, immunoglobulin comprising light chain will result in a fuller antibody repertoire for the development of therapeutics.
[0172] A transgenic rodent or rodent cell having a genome comprising an engineered partly canine immunoglobulin light chain locus is provided herein. In one aspect, the partly canine immunoglobulin light chain locus comprises canine immunoglobulin light chain variable region gene segments. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulin comprising a canine variable domain. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulin comprising a canine variable domain. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulin comprising a canine variable domain. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine variable domain and a rodent constant domain. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine variable domain and a rodent constant domain. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine variable domain and a rodent constant domain.
[0173] In one aspect, the transgenic rodent or rodent cell produces more, or is more likely to produce, immunoglobulin comprising light chain than immunoglobulin comprising light chain. In one aspect, a transgenic rodent is provided in which more light chain producing cells than light chain producing cells are likely to be isolated from the rodent. In one aspect, a transgenic rodent is provided that produces at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% and up to about 100% immunoglobulin comprising light chain. In one aspect, a transgenic rodent cell, or its progeny, is provided that is more likely to produce immunoglobulin with light chain than immunoglobulin with light chain. In one aspect, the transgenic rodent cell, or its progeny, has at least about a 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% and up to about 100%, probability of producing immunoglobulin comprising light chain. In one aspect, a transgenic rodent or rodent cell is provided in which an endogenous rodent light chain immunoglobulin locus has been deleted and replaced with an engineered partly canine light chain immunoglobulin locus. In one aspect, the transgenic rodent is a mouse.
Immunoglobulin Light Chain Locus
[0174] In one aspect, a transgenic rodent or rodent cell is provided that has a genome comprising a recombinantly produced partly canine immunoglobulin variable region locus. In one aspect, the partly canine immunoglobulin variable region locus is a light chain variable region (V.sub.L) locus. In one aspect, the partly canine immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences or one or more canine J.sub. gene segment coding sequences. In one aspect, the partly canine immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences or one or more canine J.sub. gene segment coding sequences. In one aspect, the partly canine immunoglobulin variable region locus comprises one or more rodent constant domain genes or coding sequences. In one aspect, the partly canine immunoglobulin variable region locus comprises one or more rodent C.sub. genes or coding sequences. In one aspect, the partly canine immunoglobulin variable region locus comprises one or more rodent C.sub. genes or coding sequences. In one aspect, an endogenous rodent light chain immunoglobulin locus has been inactivated. In one aspect, an endogenous rodent light chain immunoglobulin locus has been deleted and replaced with an engineered partly canine light chain immunoglobulin locus.
[0175] In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine variable domain and rodent constant domain. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine variable domain and rodent constant domain.
[0176] In one aspect, the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising most or all of the V.sub. gene segments coding sequences from a canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising at least 20, 30, 40, 50, 60, 70 and up to 76 canine V.sub. gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub. gene segment coding sequences from a canine genome.
[0177] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising most or all of the J.sub. gene segment coding sequences found in the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 canine J.sub. gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising at least about 50%, 75%, and up to 100% of the J.sub. gene segment coding sequences found in the canine genome.
[0178] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising most or all of the V.sub. and J.sub. gene segment coding sequences from the canine genome. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub. and J.sub. gene segment coding sequences from the canine genome.
[0179] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising most or all of the V.sub. gene segment coding sequences from the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and up to 14 canine V.sub. gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub. gene segment coding sequences from the canine genome.
[0180] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising most or all of the J.sub. gene segment coding sequences found in the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising at least 1, 2, 3, 4 or 5 canine J.sub. gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising at least about 50%, 75%, and up to 100% of the J.sub. gene segment coding sequences found in the canine genome.
[0181] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.L locus comprising most or all of the V.sub. and J.sub. gene segment coding sequences from the canine genome. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.L locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub. and J.sub. gene segment coding sequences from the canine genome.
[0182] In one aspect, the engineered immunoglobulin locus comprises canine V.sub.L gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. or J.sub. gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the partly canine immunoglobulin locus comprises one or more rodent immunoglobulin constant region (C.sub.) coding sequences. In one aspect, the partly canine immunoglobulin locus comprises one or more canine V.sub. and J.sub. gene segment coding sequences and one or more rodent immunoglobulin C.sub. coding sequences. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and one or more rodent C.sub. coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain variable region gene locus.
[0183] In one aspect, the engineered immunoglobulin locus comprises canine V.sub. or J.sub. gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. or J.sub. gene segment coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and one or more rodent immunoglobulin C.sub. coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and one or more rodent immunoglobulin C.sub. coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain variable region gene locus.
[0184] In one aspect, one or more canine V.sub. gene segment coding sequences are located upstream of one or more J.sub. gene segment coding sequences, which are located upstream of one or more rodent C.sub. genes. In one aspect, one or more canine V.sub. gene segment coding sequences are located upstream and in the same transcriptional orientation as one or more J.sub. gene segment coding sequences, which are located upstream of one or more rodent lambda C.sub. genes.
[0185] In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences, one or more canine J.sub. gene segment coding sequences and one or more rodent C.sub. genes. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences, one or more canine J.sub. gene segment coding sequence and one or more rodent C.sub. region genes, wherein the V.sub. and J.sub. gene segment coding sequences and the rodent C.sub. region genes are inserted into a rodent immunoglobulin light chain locus. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences, one or more canine J.sub. gene segment coding sequence and one or more rodent C.sub. genes, wherein the V.sub. and J.sub. gene segment coding sequences and the rodent (C.sub.) region genes are embedded in non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain locus.
[0186] In one aspect, one or more canine V.sub. gene segment coding sequences are located upstream of one or more J.sub. gene segment coding sequences, which are located upstream of one or more rodent C.sub. genes, wherein the V.sub. and J.sub. gene segment coding sequences and rodent C.sub. genes are inserted into a rodent immunoglobulin light chain locus. In one aspect, one or more canine V.sub. gene segment coding sequences are located upstream of one or more J.sub. gene segment coding sequences, which are located upstream of one or more rodent C.sub. genes, wherein the V.sub. and J.sub. gene segment coding sequences and rodent C.sub. genes are embedded in non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain locus.
[0187] In one aspect, the rodent C.sub. coding sequence is selected from a rodent C.sub.1, C.sub.2, or C.sub.3 coding sequence.
[0188] In one aspect, a transgenic rodent or rodent cell is provided, wherein the engineered immunoglobulin locus comprises a rodent immunoglobulin locus in which one or more rodent V.sub. gene segment coding sequences and one or more rodent J.sub. gene segment coding sequences have been deleted and replaced by one or more canine V.sub. gene segment coding sequences and one or more J.sub. gene segment coding sequences, respectively, and in which rodent C.sub. coding sequences in the locus have been replaced by rodent C.sub.1, C.sub.2, or C.sub.3 coding sequence.
[0189] In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences and one or more J-C units wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and a rodent C.sub. gene. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences and one or more J-C units wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and rodent C.sub. region coding sequence, wherein the V.sub. gene segment coding sequences and the J-C units are inserted into a rodent immunoglobulin light chain locus. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences and one or more J-C units wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and rodent C.sub. coding sequence, wherein the V.sub. gene segment coding sequences and the J-C units are embedded in non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain locus.
[0190] In one aspect, one or more canine V.sub. gene segment coding sequences are located upstream and in the same transcriptional orientation as one or more J-C units, wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and a rodent C.sub. gene. In one aspect, one or more canine V.sub. gene segment coding sequences are located upstream and in the same transcriptional orientation as one or more J-C units, wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and a rodent C.sub. coding sequence. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences located upstream of one or more J-C units wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and rodent C coding sequence, wherein the V.sub. gene segment coding sequences and the J-C units are inserted into a rodent immunoglobulin light chain locus. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V.sub. gene segment coding sequences upstream and in the same transcriptional orientation as one or more J-C units wherein each J-C unit comprises a canine J.sub. gene segment coding sequence and rodent C coding sequence, wherein the V.sub. gene segment coding sequences and the J-C units are embedded in non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain locus. In one aspect, the rodent C.sub. coding sequence is selected from a rodent C.sub.1, C.sub.2, or C.sub.3 coding sequence.
[0191] In one aspect, the engineered immunoglobulin locus comprises canine V.sub. coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. or J.sub. gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region gene locus. In one aspect, the partly canine immunoglobulin locus comprises one rodent immunoglobulin C.sub. coding sequences. In one aspect, the partly canine immunoglobulin locus comprises one or more rodent immunoglobulin C.sub. coding sequences. In one aspect, the partly canine immunoglobulin locus comprises one or more canine V.sub. and J.sub. gene segment coding sequences and one rodent immunoglobulin C.sub. coding sequences. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and one rodent immunoglobulin C.sub. coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent light chain variable region gene locus. In one aspect, the engineered immunoglobulin locus comprises canine V.sub. and J.sub. gene segment coding sequences and one rodent immunoglobulin C.sub. coding sequences embedded in rodent non-coding regulatory or scaffold sequences of a rodent immunoglobulin light chain variable region gene locus.
[0192] While not wishing to be bound by theory, it is believed that inactivating or rendering nonfunctional an endogenous rodent light chain locus may increase expression of light chain immunoglobulin from the partly canine immunoglobulin locus. This has been shown to be the case in otherwise conventional mice in which the light chain locus has been inactivated in the germline (Zon, et al. (1995) Subtle differences in antibody responses and hypermutation of light chains in mice with a disrupted constant region. Eur. J. Immunol. 25:2154-2162). In one aspect, inactivating or rendering nonfunctional an endogenous rodent light chain locus may increase the relative amount of immunoglobulin comprising light chain relative to the amount of immunoglobulin comprising light chain produced by the transgenic rodent or rodent cell.
[0193] In one aspect, a transgenic rodent or rodent cell is provided in which an endogenous rodent immunoglobulin light chain locus is deleted, inactivated, or made nonfunctional. In one aspect, the endogenous rodent immunoglobulin light chain locus is inactivated or made nonfunctional by one or more of the following deleting or mutating all endogenous rodent V.sub. gene segment coding sequences; deleting or mutating all endogenous rodent J.sub. gene segment coding sequences; deleting or mutating the endogenous rodent C.sub. coding sequence; deleting, mutating, or disrupting the endogenous intronic enhancer (iE.sub.) and 3 enhancer sequence (3E.sub.); or a combination thereof.
[0194] In one aspect, a transgenic rodent or rodent cell is provided in which an endogenous rodent immunoglobulin light chain variable domain is deleted, inactivated, or made nonfunctional. In one aspect, the endogenous rodent immunoglobulin light chain variable domain is inactivated or made nonfunctional by one or more of the following: deleting or mutating all endogenous rodent V.sub. gene segments; deleting or mutating all endogenous rodent J.sub. gene segments; deleting or mutating all endogenous rodent C.sub. coding sequences; or a combination thereof.
[0195] In one aspect, the partly canine immunoglobulin locus comprises rodent regulatory or scaffold sequences, including, but not limited to enhancers, promoters, splice sites, introns, recombination signal sequences, and combinations thereof. In one aspect, the partly canine immunoglobulin locus comprises rodent regulatory or scaffold sequences. In one aspect, the partly canine immunoglobulin locus comprises rodent regulatory or scaffold sequences.
[0196] In one aspect, the partly canine immunoglobulin locus includes a promoter to drive gene expression. In one aspect, the partly canine immunoglobulin locus includes a V-region promoter. In one aspect, the partly canine immunoglobulin locus includes a V-region promoter. In one aspect, the partly canine immunoglobulin locus includes a V-region promoter to drive expression of one or more LC gene coding sequences created after V.sub. to J.sub. gene segment rearrangement. In one aspect, the partly canine immunoglobulin locus includes a V-region promoter to drive expression of one or more LC gene coding sequences created after V.sub. to J.sub. gene segment rearrangement. In one aspect, the partly canine immunoglobulin locus includes a V-region promoter to drive expression of one or more LC gene coding sequences created after V.sub. to J.sub. gene segment rearrangement. In one aspect, the partly canine immunoglobulin locus includes a V-region promoter to drive expression of one or more LC gene coding sequences created after V.sub. to J.sub. gene segment rearrangement.
[0197] In one aspect, the partly canine immunoglobulin locus includes one or more enhancers. In one aspect, the partly canine immunoglobulin locus includes a mouse iE.sub. or 3E enhancer. In one aspect, the partly canine immunoglobulin locus includes one or more V.sub. or J.sub. gene segment coding sequences and a moue iE.sub. or 3E.sub. enhancer. In one aspect, the partly canine immunoglobulin locus includes one or more V.sub. or J.sub. gene segment coding sequences and a iE or 3E enhancer.
Immunoglobulin Heavy Chain Locus
[0198] In one aspect, a transgenic rodent or rodent cell has a genome comprising a recombinantly produced partly canine immunoglobulin heavy chain variable region (V.sub.H) locus. In one aspect, the partly canine immunoglobulin variable region locus comprises one or more canine V.sub.H, D or J.sub.H gene segment coding sequences. In one aspect, the partly canine immunoglobulin heavy chain variable region locus comprises one or more rodent constant domain (C.sub.H) genes or coding sequences. In one aspect, an endogenous rodent heavy chain immunoglobulin locus has been inactivated. In one aspect, an endogenous rodent heavy chain immunoglobulin locus has been deleted and replaced with an engineered partly canine heavy chain immunoglobulin locus.
[0199] In one aspect, the synthetic H chain DNA segment contains the ADAM6A or ADAM6B gene needed for male fertility, Pax-5-Activated Intergenic Repeats (PAIR) elements involved in IGH locus contraction and CTCF binding sites from the heavy chain intergenic control region 1, involved in regulating normal VDJ rearrangement ((Proudhon, et al., Adv. Immunol., 128:123-182 (2015)), or various combinations thereof. The locations of these endogenous non-coding regulatory and scaffold sequences in the mouse IGH locus are depicted in
[0200] In one aspect, the engineered partly canine region to be integrated into a mammalian host cell comprises all or a substantial number of the known canine V.sub.H gene segments. In some instances, however, it may be desirable to use a subset of such V.sub.H gene segments, and in specific instances even as few as one canine V.sub.H coding sequence may be introduced into the cell or the animal.
[0201] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising most or all of the V.sub.H gene segment coding sequences from the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising at least 20, 30 and up to 39 functional canine V.sub.H gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.H locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub.H gene segment coding sequences from the canine genome.
[0202] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising most or all of the V.sub.H gene segment coding sequences from the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising at least 20, 30, 40, 50, 60, 70 and up to 80 canine V.sub.H gene segment coding sequences. In this aspect the V.sub.H gene segment pseudogenes are reverted to restore their functionality, e.g., by mutating an in-frame stop codon into a functional codon, using methods well known in the art. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.H locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub.H gene segment coding sequences from the canine genome.
[0203] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising most or all of the D gene segment coding sequences found in the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising at least 1, 2, 3, 4, 5 and up to 6 canine D gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.H locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the D gene segment coding sequences found in the canine genome.
[0204] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising most or all of the J.sub.H gene segment coding sequences found in the canine genome. In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising at least 1, 2, 3, 4, 5 and up to 6 canine J.sub.H gene segment coding sequences. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.H locus comprising at least about 50%, 75%, and up to 100% of J.sub.H gene segment coding sequences found in the canine genome.
[0205] In one aspect, the engineered partly canine immunoglobulin locus variable region comprises a V.sub.H locus comprising most or all of the V.sub.H, D and J.sub.H gene segment coding sequences from the canine genome. In one aspect the engineered partly canine immunoglobulin variable region locus comprises a V.sub.H locus comprising at least about 50%, 60%, 70%, 80%, 90% and up to 100% of the V.sub.H, D and J.sub.H gene segment coding sequences from the canine genome.
[0206] In one aspect, a transgenic rodent or rodent cell is provided that includes an engineered partly canine immunoglobulin heavy chain locus comprising canine immunoglobulin heavy chain variable region gene coding sequences and non-coding regulatory or scaffold sequences of the rodent immunoglobulin heavy chain locus. In one aspect, the engineered canine immunoglobulin heavy chain locus comprises canine V.sub.H, D or J.sub.H gene segment coding sequences. In one aspect, the engineered canine immunoglobulin heavy chain locus comprises canine V.sub.H, D or J.sub.H gene segment coding sequences embedded in non-coding regulatory or scaffold sequences of a rodent immunoglobulin heavy chain locus.
[0207] In one aspect, non-canine mammals and mammalian cells comprising an engineered partly canine immunoglobulin locus that comprises coding sequences of canine V.sub.H, canine D, and canine J.sub.H genes are provided that further comprises non-coding regulatory and scaffold sequences, including pre-D sequences, based on the endogenous IGH locus of the non-canine mammalian host. In certain aspects, the exogenously introduced, engineered partly canine region can comprise a fully recombined V(D)J exon.
[0208] In one aspect, the transgenic non-canine mammal is a rodent, for example, a mouse, comprising an exogenously introduced, engineered partly canine immunoglobulin locus comprising codons for multiple canine V.sub.H, canine D, and canine J.sub.H genes with intervening sequences, including a pre-D region, based on the intervening (non-coding regulatory or scaffold) sequences in the rodent. In one aspect, the transgenic rodent further comprises partly canine IGL loci comprising coding sequences of canine V.sub. or V.sub. genes and J.sub. or J.sub. genes, respectively, in conjunction with their intervening (non-coding regulatory or scaffold) sequences corresponding to the immunoglobulin intervening sequences present in the IGL loci of the rodent.
[0209] In an exemplary embodiment, as set forth in more detail in the Examples section, the entire endogenous V.sub.H immunoglobulin locus of the mouse genome is deleted and subsequently replaced with a partly canine immunoglobulin locus comprising 39 canine V.sub.H gene segments containing interspersed non-coding sequences corresponding to the non-coding sequences of the J558 V.sub.H locus of the mouse genome. The complete, exogenously introduced, engineered immunoglobulin locus further comprises canine D and J.sub.H gene segments, as well as the mouse pre-D region. Thus, the canine V.sub.H, D and J.sub.H codon sequences are embedded in the rodent intergenic and intronic sequences.
Preparation of a Partly Canine Immunoglobulin Locus
[0210] In one aspect, an endogenous immunoglobulin locus variable region of a non-canine mammal, such as a rodent, for example a rat or mouse, which contains V.sub.H, D and J.sub.H or V.sub.L and J.sub.L gene segments, is deleted using site-specific recombinases and replaced with an engineered partly canine immunoglobulin locus. In one aspect, the partly canine immunoglobulin locus is inserted into the genome of the host animal as a single nucleic acid or cassette. Because a cassette that includes the partly canine immunoglobulin locus is used to replace the endogenous immunoglobulin locus variable region, the canine coding sequences can be inserted into the host genome in a single insertion step, thus providing a rapid and straightforward process for obtaining a transgenic animal.
[0211] In one aspect, the engineered partly canine immunoglobulin locus variable region is prepared by deleting murine V.sub.H, D and J.sub.H or V.sub.L and J.sub.L coding sequences from a mouse immunoglobulin locus variable region and replacing the murine coding sequences with canine coding sequences. In one aspect, the non-coding flanking sequences of the murine immunoglobulin locus, which include regulatory sequences and other elements, are left intact.
[0212] In one aspect, the nucleotide sequence for the engineered partly canine immunoglobulin locus is prepared in silico and the locus is synthesized using known techniques for gene synthesis. In one aspect, coding sequences from a canine immunoglobulin variable region locus and sequences of the host animal immunoglobulin locus are identified using a search tool such as BLAST (Basic Local Alignment Search Tool). After obtaining the genomic sequences of the host immunoglobulin locus and the coding sequences of the canine immunoglobulin variable region locus, the host coding sequences can be replaced in silico with the canine coding sequences using known computational approaches to locate and delete the endogenous host animal immunoglobulin coding segments and replace the coding sequences with canine coding sequences, leaving the endogenous regulatory and flanking sequences intact.
Homologous Recombination
[0213] In one aspect, a combination of homologous recombination and site-specific recombination is used to create the cells and animals described herein. In some embodiments, a homology targeting vector is first used to introduce the sequence-specific recombination sites into the mammalian host cell genome at a desired location in the endogenous immunoglobulin loci. In one aspect, in the absence of a recombinase protein, the sequence-specific recombination site inserted into the genome of a mammalian host cell by homologous recombination does not affect expression and amino acid codons of any genes in the mammalian host cell. This approach maintains the proper transcription and translation of the immunoglobulin genes which produce the desired antibody after insertion of recombination sites and, optionally, any additional sequence such as a selectable marker gene. However, in some cases it is possible to insert a recombinase site and other sequences into an immunoglobulin locus sequence such that an amino acid sequence of the antibody molecule is altered by the insertion, but the antibody still retains sufficient functionality for the desired purpose. Examples of such codon-altering homologous recombination may include the introduction of polymorphisms into the endogenous locus and changing the constant region exons so that a different isotype is expressed from the endogenous locus. In one aspect, the immunoglobulin locus includes one or more of such insertions.
[0214] In one aspect, the homology targeting vector can be utilized to replace certain sequences within the endogenous genome as well as to insert certain sequence-specific recombination sites and one or more selectable marker genes into the host cell genome. It is understood by those of ordinary skill in the art that a selectable marker gene as used herein can be exploited to weed out individual cells that have not undergone homologous recombination and cells that harbor random integration of the targeting vector.
[0215] Exemplary methodologies for homologous recombination are described in U.S. Pat. Nos. 6,689,610; 6,204,061; 5,631,153; 5,627,059; 5,487,992; and 5,464,764, each of which is incorporated by reference in its entirety.
Site/Sequence-Specific Recombination
[0216] Site/sequence-specific recombination differs from general homologous recombination in that short specific DNA sequences, which are required for recognition by a recombinase, are the only sites at which recombination occurs. Depending on the orientations of these sites on a particular DNA strand or chromosome, the specialized recombinases that recognize these specific sequences can catalyze i) DNA excision or ii) DNA inversion or rotation. Site-specific recombination can also occur between two DNA strands if these sites are not present on the same chromosome. A number of bacteriophage- and yeast-derived site-specific recombination systems, each comprising a recombinase and specific cognate sites, have been shown to work in eukaryotic cells and are therefore applicable for use in connection with the methods described herein, and these include the bacteriophage P1 Cre/lox, yeast FLP-FRT system, and the Dre system of the tyrosine family of site-specific recombinases. Such systems and methods of use are described, e.g., in U.S. Pat. Nos. 7,422,889; 7,112,715; 6,956,146; 6,774,279; 5,677,177; 5,885,836; 5,654,182; and 4,959,317, each of which is incorporated herein by reference to teach methods of using such recombinases.
[0217] Other systems of the tyrosine family of site-specific recombinases such as bacteriophage lambda integrase, HK2022 integrase, and in addition systems belonging to the separate serine family of recombinases such as bacteriophage phiC31, R4Tp901 integrases are known to work in mammalian cells using their respective recombination sites, and are also applicable for use in the methods described herein.
[0218] Since site-specific recombination can occur between two different DNA strands, site-specific recombination occurrence can be utilized as a mechanism to introduce an exogenous locus into a host cell genome by a process called recombinase-mediated cassette exchange (RMCE). The RMCE process can be exploited by the combined usage of wild-type and mutant sequence-specific recombination sites for the same recombinase protein together with negative selection. For example, a chromosomal locus to be targeted may be flanked by a wild-type LoxP site on one end and by a mutant LoxP site on the other. Likewise, an exogenous vector containing a sequence to be inserted into the host cell genome may be similarly flanked by a wild-type LoxP site on one end and by a mutant LoxP site on the other. When this exogenous vector is transfected into the host cell in the presence of Cre recombinase, Cre recombinase will catalyze RMCE between the two DNA strands, rather than the excision reaction on the same DNA strands, because the wild-type LoxP and mutant LoxP sites on each DNA strand are incompatible for recombination with each other. Thus, the LoxP site on one DNA strand will recombine with a LoxP site on the other DNA strand; similarly, the mutated LoxP site on one DNA strand will only recombine with a likewise mutated LoxP site on the other DNA strand.
[0219] In one aspect, combined variants of the sequence-specific recombination sites are used that are recognized by the same recombinase for RMCE. Examples of such sequence-specific recombination site variants include those that contain a combination of inverted repeats or those which comprise recombination sites having mutant spacer sequences. For example, two classes of variant recombinase sites are available to engineer stable Cre-loxP integrative recombination. Both exploit sequence mutations in the Cre recognition sequence, either within the 8 bp spacer region or the 13-bp inverted repeats. Spacer mutants such as lox511 (Hoess, et al., Nucleic Acids Res, 14:2287-2300 (1986)), lox5171 and lox2272 (Lee and Saito, Gene, 216:55-65 (1998)), m2, m3, m7, and mu11 (Langer, et al., Nucleic Acids Res, 30:3067-3077 (2002)) recombine readily with themselves but have a markedly reduced rate of recombination with the wild-type site. This class of mutants has been exploited for DNA insertion by RMCE using non-interacting Cre-Lox recombination sites and non-interacting FLP recombination sites (Baer and Bode, Curr Opin Biotechnol, 12:473-480 (2001); Albert, et al., Plant J, 7:649-659 (1995); Seibler and Bode, Biochemistry, 36:1740-1747 (1997); Schlake and Bode, Biochemistry, 33:12746-12751 (1994)).
[0220] Inverted repeat mutants represent the second class of variant recombinase sites. For example, LoxP sites can contain altered bases in the left inverted repeat (LE mutant) or the right inverted repeat (RE mutant). An LE mutant, lox71, has 5 bp on the 5 end of the left inverted repeat that is changed from the wild type sequence to TACCG (Araki, et al, Nucleic Acids Res, 25:868-872 (1997)). Similarly, the RE mutant, lox66, has the five 3-most bases changed to CGGTA. Inverted repeat mutants are used for integrating plasmid inserts into chromosomal DNA with the LE mutant designated as the target chromosomal loxP site into which the donor RE mutant recombines. Post-recombination, loxP sites are located in cis, flanking the inserted segment. The mechanism of recombination is such that post-recombination one loxP site is a double mutant (containing both the LE and RE inverted repeat mutations) and the other is wild type (Lee and Sadowski, Prog Nucleic Acid Res Mol Biol, 80:1-42 (2005); Lee and Sadowski, J Mol Biol, 326:397-412 (2003)). The double mutant is sufficiently different from the wild-type site that it is unrecognized by Cre recombinase and the inserted segment is not excised.
[0221] In certain aspects, sequence-specific recombination sites can be introduced into introns, as opposed to coding nucleic acid regions or regulatory sequences. This avoids inadvertently disrupting any regulatory sequences or coding regions necessary for proper antibody expression upon insertion of sequence-specific recombination sites into the genome of the animal cell.
[0222] Introduction of the sequence-specific recombination sites may be achieved by conventional homologous recombination techniques. Such techniques are described in references such as e.g., Sambrook and Russell (2001) (Molecular cloning: a laboratory manual 3rd ed. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press) and Nagy, A. (2003). (Manipulating the mouse embryo: a laboratory manual, 3rd ed. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press). Renault and Duchateau, Eds. (2013) (Site-directed insertion of transgenes. Topics in Current Genetics 23. Springer). Tsubouchi, H. Ed. (2011) (DNA recombination, Methods and Protocols. Humana Press).
[0223] Specific recombination into the genome can be facilitated using vectors designed for positive or negative selection as known in the art. In order to facilitate identification of cells that have undergone the replacement reaction, an appropriate genetic marker system may be employed and cells selected by, for example, use of a selection tissue culture medium. However, in order to ensure that the genome sequence is substantially free of extraneous nucleic acid sequences at or adjacent to the two end points of the replacement interval, desirably the marker system/gene can be removed following selection of the cells containing the replaced nucleic acid.
[0224] In one aspect, cells in which the replacement of all or part of the endogenous immunoglobulin locus has taken place are negatively selected against upon exposure to a toxin or drug. For example, cells that retain expression of HSV-TK can be selected against by using nucleoside analogues such as ganciclovir. In another aspect, cells comprising the deletion of the endogenous immunoglobulin locus may be positively selected for by use of a marker gene, which can optionally be removed from the cells following or as a result of the recombination event. A positive selection system that may be used is based on the use of two non-functional portions of a marker gene, such as HPRT, that are brought together through the recombination event. These two portions are brought into functional association upon a successful replacement reaction being carried out and wherein the functionally reconstituted marker gene is flanked on either side by further sequence-specific recombination sites (which are different from the sequence-specific recombination sites used for the replacement reaction), such that the marker gene can be excised from the genome, using an appropriate site-specific recombinase.
[0225] The recombinase may be provided as a purified protein, or as a protein expressed from a vector construct transiently transfected into the host cell or stably integrated into the host cell genome. Alternatively, the cell may be used first to generate a transgenic animal, which then may be crossed with an animal that expresses said recombinase.
[0226] Because the methods described herein can take advantage of two or more sets of sequence-specific recombination sites within the engineered genome, multiple rounds of RMCE can be exploited to insert the partly canine immunoglobulin variable region genes into a non-canine mammalian host cell genome.
[0227] Although not yet routine for the insertion of large DNA segments, CRISPR-Cas technology is another method to introduce the chimeric canine Ig locus.
Generation of Transgenic Animals
[0228] In one aspect, methods for the creation of transgenic animals, for example rodents, such as mice, are provided that comprise the introduced partly canine immunoglobulin locus.
[0229] In one aspect, the host cell utilized for replacement of the endogenous immunoglobulin genes is an embryonic stem (ES) cell, which can then be utilized to create a transgenic mammal. In one aspect, the host cell is a cell of an early stage embryo. In one aspect, the host cell is a pronuclear stage embryo or zygote. Thus, in accordance with one aspect, the methods described herein further comprise: isolating an embryonic stem cell or a cell of an early stage embryo such as a pronuclear stage embryo or zygote, which comprises the introduced partly canine immunoglobulin locus and using said ES cell to generate a transgenic animal that contains the replaced partly canine immunoglobulin locus.
Methods of Use
[0230] In one aspect, a method of producing antibodies comprising canine variable regions is provided. In one aspect, the method includes providing a transgenic rodent or rodent cell described herein and isolating antibodies comprising canine variable regions expressed by the transgenic rodent. In one aspect, a method of producing monoclonal antibodies comprising canine variable regions is provided. In one aspect, the method includes providing B-cells from a transgenic rodent or cell described herein, immortalizing the B-cells; and isolating antibodies comprising canine variable domains expressed by the immortalized B-cells.
[0231] In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine HC variable domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise mouse HC constant domains. These can be of any isotype, IgM, IgD, IgG1, IgG2a/c, IgG2b, IgG3, IgE or IgA.
[0232] In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine HC variable domains and mouse HC constant domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine LC variable domains and mouse LC constant domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine HC variable domains and canine LC variable domains and mouse HC constant domains and mouse LC constant domains.
[0233] In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine LC variable domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise mouse constant domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine LC variable domains and mouse constant domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine LC variable domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise mouse constant domains. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise canine LC variable domains and mouse constant domains.
[0234] In one aspect, a method of producing antibodies or antigen binding fragments comprising canine variable regions is provided. In one aspect, the method includes providing a transgenic rodent or cell described herein and isolating antibodies comprising canine variable regions expressed by the transgenic rodent or rodent cell. In one aspect, the variable regions of the antibody expressed by the transgenic rodent or rodent cell are sequenced. Antibodies comprising canine variable regions obtained from the antibodies expressed by the transgenic rodent or rodent cell can be recombinantly produced using known methods.
[0235] In one aspect, a method of producing an immunoglobulin specific to an antigen of interest is provided. In one aspect, the method includes immunizing a transgenic rodent as described herein with the antigen and isolating immunoglobulin specific to the antigen expressed by the transgenic rodent or rodent cell. In one aspect, the variable domains of the antibody expressed by the rodent or rodent cell are sequenced and antibodies comprising canine variable regions that specifically bind the antigen of interest are recombinantly produced using known methods. In one aspect, the recombinantly produced antibody or antigen binding fragment comprises canine HC and LC, or , constant domains.
INCORPORATION BY REFERENCE
[0236] All references cited herein, including patents, patent applications, papers, text books and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated herein by reference in their entirety for all purposes.
EXAMPLES
[0237] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent or imply that the experiments below are all of or the only experiments performed. It will be appreciated by persons skilled in the art that numerous variations or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
[0238] Efforts have been made to ensure accuracy with respect to terms and numbers used (e.g., vectors, amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees centigrade, and pressure is at or near atmospheric.
[0239] The examples illustrate targeting by both a 5 vector and a 3 vector that flank a site of recombination and introduction of synthetic DNA. It will be apparent to one skilled in the art upon reading the specification that the 5 vector targeting can take place first followed by the 3, or the 3 vector targeting can take place first followed by the 5 vector. In some circumstances, targeting can be carried out simultaneously with dual detection mechanisms.
Example 1: Introduction of an Engineered Partly Canine Immunoglobulin Variable Region Gene Locus into the Immunoglobulin H Chain Variable Region Gene Locus of a Non-Canine Mammalian Host Cell Genome
[0240] An exemplary method illustrating the introduction of an engineered partly canine immunoglobulin locus into the genomic locus of a non-mammalian ES cell is illustrated in more detail in
[0241]
[0242] As illustrated in
[0243] Once the recombination sites are integrated into the mammalian host cell genome, the endogenous region of the immunoglobulin domain is then subjected to recombination by introducing one of the recombinases corresponding to the sequence-specific recombination sites integrated into the genome, e.g., either Flp or Cre. Illustrated in
[0244] ES cells that are insensitive to diphtheria toxin are then screened for the deletion of the endogenous variable region gene loci. The primary screening method for the deleted endogenous immunoglobulin locus can be carried out by Southern blotting, or by polymerase chain reaction (PCR) followed by confirmation with a secondary screening technique such as Southern blotting.
[0245]
[0246] The sequences of the canine V.sub.H, D and J.sub.H gene segment coding regions are in Table 1.
[0247] Primary screening procedure for the introduction of the partly canine immunoglobulin locus can be carried out by Southern blotting, or by PCR followed by confirmation with a secondary screening method such as Southern blotting. The screening methods are designed to detect the presence of the inserted V.sub.H, D and J.sub.H gene loci, as well as all the intervening sequences.
Example 2: Introduction of an Engineered Partly Canine Immunoglobulin Variable Region Gene Locus Comprising Additional Non-Coding Regulatory or Scaffold Sequences into the Immunoglobulin H Chain Variable Region Gene Locus of a Non-Canine Mammalian Host Cell Genome
[0248] In certain aspects, the partly canine immunoglobulin locus comprises the elements as described in Example 1, but with additional non-coding regulatory or scaffold sequences e.g., sequences strategically added to introduce additional regulatory sequences, to ensure the desired spacing within the introduced immunoglobulin locus, to ensure that certain coding sequences are in adequate juxtaposition with other sequences adjacent to the replaced immunoglobulin locus, and the like.
[0249]
[0250] The primary screening procedure for the introduction of the engineered partly canine immunoglobulin region can be carried out by Southern blotting, or by PCR with confirmation by a secondary screening method such as Southern blotting. The screening methods are designed to detect the presence of the inserted PAIR elements, the V.sub.H, D and J.sub.H gene loci, as well as all the intervening sequences.
Example 3: Introduction of an Engineered Partly Canine Immunoglobulin Locus into the Immunoglobulin Heavy Chain Gene Locus of a Mouse Genome
[0251] A method for replacing a portion of a mouse genome with an engineered partly canine immunoglobulin locus is illustrated in
[0252] The targeting vectors (803, 805) employed for introducing the site-specific recombinase sequences on either side of the V.sub.H (815), D (817) and J.sub.H (819) gene segment clusters and upstream of the constant region genes (821) in the wild-type mouse immunoglobulin locus (801) include an additional site-specific recombination sequence that has been modified so that it is still recognized efficiently by the recombinase, but does not recombine with unmodified sites. This mutant modified site (e.g., lox5171) is positioned in the targeting vector such that after deletion of the endogenous V.sub.H, D.sub.H and J.sub.H gene segments (802) it can be used for a second site-specific recombination event in which a non-native piece of DNA is moved into the modified IGH locus by RMCE. In this example, the non-native DNA is a synthetic nucleic acid comprising both canine and non-canine sequences (809).
[0253] Two gene targeting vectors are constructed to accomplish the process just outlined. One of the vectors (803) comprises mouse genomic DNA taken from the 5 end of the IGH locus, upstream of the most distal V.sub.H gene segment. The other vector (805) comprises mouse genomic DNA taken from within the locus downstream of the J.sub.H gene segments.
[0254] The key features of the 5 vector (803) in order from 5 to 3 are as follows: a gene encoding the diphtheria toxin A (DTA) subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (823); 4.5 Kb of mouse genomic DNA mapping upstream of the most distal V.sub.H gene segment in the IGH locus (825); a FRT recognition sequence for the Flp recombinase (827); a piece of genomic DNA containing the mouse Polr2a gene promoter (829); a translation initiation sequence (methionine codon embedded in a Kozak consensus sequence, 835)); a mutated loxP recognition sequence (lox5171) for the Cre recombinase (831); a transcription termination/polyadenylation sequence (pA. 833); a loxP recognition sequence for the Cre recombinase (837); a gene encoding a fusion protein with a protein conferring resistance to puromycin fused to a truncated form of the thymidine kinase (pu-TK) under transcriptional control of the promoter from the mouse phosphoglycerate kinase 1 gene (839); and 3 Kb of mouse genomic DNA (841) mapping close to the 4.5 Kb mouse genomic DNA sequence present near the 5 end of the vector and arranged in the native relative orientation.
[0255] The key features of the 3 vector (805) in order from 5 to 3 are as follows; 3.7 Kb of mouse genomic DNA mapping within the intron between the J.sub.H and C.sub.H gene loci (843); an HPRT gene under transcriptional control of the mouse Polr2a gene promoter (845); a neomycin resistance gene under the control of the mouse phosphoglycerate kinase 1 gene promoter (847); a loxP recognition sequence for the Cre recombinase (837); 2.1 Kb of mouse genomic DNA (849) that maps immediately downstream of the 3.7 Kb mouse genomic DNA fragment present near the 5 end of the vector and arranged in the native relative orientation; and a gene encoding the DTA subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (823).
[0256] Mouse embryonic stem (ES) cells (derived from C57B1/6NTac mice) are transfected by electroporation with the 3 vector (805) according to widely used procedures. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only in the prokaryotic plasmid sequence or the polylinker associated with it. The transfected cells are plated and after 24 hours they are placed under positive selection for cells that have integrated the 3 vector into their DNA by using the neomycin analogue drug G418. There is also negative selection for cells that have integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination results in retention of the DTA gene (823), which kills the cells when the gene is expressed, whereas the DTA gene is deleted by homologous recombination since it lies outside of the region of vector homology with the mouse IGH locus. Colonies of drug-resistant ES cells are physically extracted from their plates after they became visible to the naked eye about a week later. These picked colonies are disaggregated, re-plated in micro-well plates, and cultured for several days. Thereafter, each of the clones of cells is divided such that some of the cells can be frozen as an archive, and the rest used for isolation of DNA for analytical purposes.
[0257] DNA from the ES cell clones is screened by PCR using a widely practiced gene-targeting assay design. For this assay, one of the PCR oligonucleotide primer sequences maps outside the region of identity shared between the 3 vector (805) and the genomic DNA, while the other maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (845) or neomycin resistance (847) genes. According to the standard design, these assays detect pieces of DNA that would only be present in clones of ES cells derived from transfected cells that undergo fully legitimate homologous recombination between the 3 targeting vector and the endogenous mouse IGH locus. Two separate transfections are performed with the 3 vector (805). PCR-positive clones from the two transfections are selected for expansion followed by further analysis using Southern blot assays.
[0258] The Southern blot assays are performed according to widely used procedures using three probes and genomic DNA digested with multiple restriction enzymes chosen so that the combination of probes and digests allow the structure of the targeted locus in the clones to be identified as properly modified by homologous recombination. One of the probes maps to DNA sequence flanking the 5 side of the region of identity shared between the 3 targeting vector and the genomic DNA; a second probe maps outside the region of identity but on the 3 side; and the third probe maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (845) or neomycin resistance (847) genes. The Southern blot identifies the presence of the expected restriction enzyme-generated fragment of DNA corresponding to the correctly mutated, i.e., by homologous recombination with the 3 IGH targeting vector, part of the IGH locus as detected by one of the external probes and by the neomycin or HPRT probe. The external probe detects the mutant fragment and also a wild-type fragment from the non-mutant copy of the immunoglobulin IGH locus on the homologous chromosome.
[0259] Karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most commonly arising chromosomal aberrations that arise in mouse ES cells. Clones with such aberrations are excluded from further use. ES cell clones that are judged to have the expected correct genomic structure based on the Southern blot dataand that also do not have detectable chromosomal aberrations based on the karyotype analysisare selected for further use.
[0260] Acceptable clones are then modified with the 5 vector (803) using procedures and screening assays that are similar in design to those used with the 3 vector (805) except that puromycin selection is used instead of G418/neomycin for selection. The PCR assays, probes and digests are also tailored to match the genomic region being modified by the 5 vector (805).
[0261] Clones of ES cells that have been mutated in the expected fashion by both the 3 and the 5 vectors, i.e., doubly targeted cells carrying both engineered mutations, are isolated following vector targeting and analysis. The clones must have undergone gene targeting on the same chromosome, as opposed to homologous chromosomes (i.e., the engineered mutations created by the targeting vectors must be in cis on the same DNA strand rather than in trans on separate homologous DNA strands). Clones with the cis arrangement are distinguished from those with the trans arrangement by analytical procedures such as fluorescence in situ hybridization of metaphase spreads using probes that hybridize to the novel DNA present in the two gene targeting vectors (803 and 805) between their arms of genomic identity. The two types of clones can also be distinguished from one another by transfecting them with a vector expressing the Cre recombinase, which deletes the pu-TK (839), HPRT (845) and neomycin resistance (847) genes if the targeting vectors have been integrated in cis, and then comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene introduced by the 5 vector (803) and by analyzing the drug resistance phenotype of the surviving clones by a sibling selection screening procedure in which some of the cells from the clone are tested for resistance to puromycin or G418/neomycin. Cells with the cis arrangement of mutations are expected to yield approximately 10.sup.3 more ganciclovir-resistant clones than cells with the trans arrangement. The majority of the resulting cis-derived ganciclovir-resistant clones are also sensitive to both puromycin and G418/neomycin, in contrast to the trans-derived ganciclovir-resistant clones, which should retain resistance to both drugs. Doubly targeted clones of cells with the cis-arrangement of engineered mutations in the heavy chain locus are selected for further use.
[0262] The doubly targeted clones of cells are transiently transfected with a vector expressing the Cre recombinase and the transfected cells subsequently are placed under ganciclovir selection, as in the analytical experiment summarized above. Ganciclovir-resistant clones of cells are isolated and analyzed by PCR and Southern blot for the presence of the expected deletion between the two engineered mutations created by the 5 (803) and the 3 (805) targeting vectors. In these clones, the Cre recombinase causes a recombination (802) to occur between the loxP sites (837) introduced into the heavy chain locus by the two vectors to create the genomic DNA configuration shown at 807. Because the loxP sites are arranged in the same relative orientations in the two vectors, recombination results in excision of a circle of DNA comprising the entire genomic interval between the two loxP sites. The circle does not contain an origin of replication and thus is not replicated during mitosis and therefore is lost from the cells as they undergo proliferation. The resulting clones carry a deletion of the DNA that was originally between the two loxP sites. Clones that have the expected deletion are selected for further use.
[0263] ES cell clones carrying the deletion of sequence in one of the two homologous copies of their immunoglobulin heavy chain locus are retransfected (804) with a Cre recombinase expression vector together with a piece of DNA (809) comprising a partly canine immunoglobulin heavy chain locus containing canine V.sub.H, D and J.sub.H region gene coding region sequences flanked by mouse regulatory and flanking sequences. The key features of this piece of synthetic DNA (809) are the following: a lox5171 site (831); a neomycin resistance gene open reading frame (847) lacking the initiator methionine codon, but in-frame and contiguous with an uninterrupted open reading frame in the lox5171 site a FRT site (827); an array of 39 functional canine V.sub.H heavy chain variable region genes (851), each with canine coding sequences embedded in mouse noncoding sequences; optionally a 21.6 kb pre-D region from the mouse heavy chain locus (not shown); a 58 Kb piece of DNA containing the 6 canine D.sub.H gene segments (853) and 6 canine J.sub.H gene segments (855) where the canine V.sub.H, D and J.sub.H coding sequences are embedded in mouse noncoding sequences; a loxP site (837) in opposite relative orientation to the lox5171 site (831).
[0264] The transfected clones are placed under G418 selection, which enriches for clones of cells that have undergone RMCE in which the engineered partly canine donor immunoglobulin locus (809) is integrated in its entirety into the deleted endogenous immunoglobulin heavy chain locus between the lox5171 (831) and loxP (837) sites to create the DNA region illustrated at 811. Only cells that have properly undergone RMCE have the capability to express the neomycin resistance gene (847) because the promoter (829) as well as the initiator methionine codon (835) required for its expression are not present in the vector (809) but are already pre-existing in the host cell IGH locus (807). The remaining elements from the 5 vector (803) are removed via Flp-mediated recombination (806) in vitro or in vivo, resulting in the final canine-based locus as shown at 813.
[0265] G418-resistant ES cell clones are analyzed by PCR and Southern blot to determine if they have undergone the expected RMCE process without unwanted rearrangements or deletions. Clones that have the expected genomic structure are selected for further use.
[0266] ES cell clones carrying the partly canine immunoglobulin heavy chain DNA (813) in the mouse heavy chain locus are microinjected into mouse blastocysts from strain DBA/2 to create partially ES cell-derived chimeric mice according to standard procedures. Male chimeric mice with the highest levels of ES cell-derived contribution to their coats are selected for mating to female mice. The female mice of choice here are of C57B1/6NTac strain, and also carry a transgene encoding the Flp recombinase that is expressed in their germline. Offspring from these matings are analyzed for the presence of the partly canine immunoglobulin heavy chain locus, and for loss of the FRT-flanked neomycin resistance gene that was created in the RMCE step. Mice that carry the partly canine locus are used to establish a colony of mice.
Example 4: Introduction of an Engineered Partly Canine Immunoglobulin Locus into the Immunoglobulin Chain Gene Locus of a Mouse Genome
[0267] Another method for replacing a portion of a mouse genome with partly canine immunoglobulin locus is illustrated in
[0268] The targeting vectors employed for introducing the site-specific recombination sequences on either side of the V.sub. (915) and J.sub. (919) gene segments also include an additional site-specific recombination sequence that has been modified so that it is still recognized efficiently by the recombinase, but does not recombine with unmodified sites. This site is positioned in the targeting vector such that after deletion of the V.sub. and J.sub. gene segment clusters it can be used for a second site specific recombination event in which a non-native piece of DNA is moved into the modified V.sub. locus via RMCE. In this example, the non-native DNA is a synthetic nucleic acid comprising canine V.sub. and J.sub. gene segment coding sequences embedded in mouse regulatory and flanking sequences.
[0269] Two gene targeting vectors are constructed to accomplish the process just outlined. One of the vectors (903) comprises mouse genomic DNA taken from the 5 end of the locus, upstream of the most distal V.sub. gene segment. The other vector (905) comprises mouse genomic DNA taken from within the locus downstream (3) of the J.sub. gene segments (919) and upstream of the constant region genes (921).
[0270] The key features of the 5 vector (903) are as follows: a gene encoding the diphtheria toxin A (DTA) subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (923); 6 Kb of mouse genomic DNA (925) mapping upstream of the most distal variable region gene in the chain locus; a FRT recognition sequence for the Flp recombinase (927); a piece of genomic DNA containing the mouse Polr2a gene promoter (929); a translation initiation sequence (935, methionine codon embedded in a Kozak consensus sequence); a mutated loxP recognition sequence (lox5171) for the Cre recombinase (931); a transcription termination/polyadenylation sequence (933); a loxP recognition sequence for the Cre recombinase (937); a gene encoding a fusion protein with a protein conferring resistance to puromycin fused to a truncated form of the thymidine kinase (pu-TK) under transcriptional control of the promoter from the mouse phosphoglycerate kinase 1 gene (939); 2.5 Kb of mouse genomic DNA (941) mapping close to the 6 Kb sequence at the 5 end in the vector and arranged in the native relative orientation.
[0271] The key features of the 3 vector (905) are as follows: 6 Kb of mouse genomic DNA (943) mapping within the intron between the J.sub. (919) and C.sub. (921) gene loci; a gene encoding the human hypoxanthine-guanine phosphoribosyl transferase (HPRT) under transcriptional control of the mouse Polr2a gene promoter (945); a neomycin resistance gene under the control of the mouse phosphoglycerate kinase 1 gene promoter (947); a loxP recognition sequence for the Cre recombinase (937); 3.6 Kb of mouse genomic DNA (949) that maps immediately downstream in the genome of the 6 Kb DNA fragment included at the 5 end in the vector, with the two fragments oriented in the same transcriptional orientation as in the mouse genome; a gene encoding the diphtheria toxin A (DTA) subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (923).
[0272] Mouse embryonic stem (ES) cells derived from C57B1/6NTac mice are transfected by electroporation with the 3 vector (905) according to widely used procedures. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only in the prokaryotic plasmid sequence or the polylinker associated with it. The transfected cells are plated and after 24 hours they are placed under positive selection for cells that have integrated the 3 vector into their DNA by using the neomycin analogue drug G418. There is also negative selection for cells that have integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination results in retention of the DTA gene, which kills the cells when the gene is expressed, whereas the DTA gene is deleted by homologous recombination since it lies outside of the region of vector homology with the mouse IGK locus. Colonies of drug-resistant ES cells are physically extracted from their plates after they became visible to the naked eye about a week later. These picked colonies are disaggregated, re-plated in micro-well plates, and cultured for several days. Thereafter, each of the clones of cells is divided such that some of the cells could be frozen as an archive, and the rest used for isolation of DNA for analytical purposes.
[0273] DNA from the ES cell clones is screened by PCR using a widely used gene-targeting assay design. For this assay, one of the PCR oligonucleotide primer sequences maps outside the region of identity shared between the 3 vector (905) and the genomic DNA (901), while the other maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (945) or neomycin resistance (947) genes. According to the standard design, these assays detect pieces of DNA that are only present in clones of ES cells derived from transfected cells that had undergone fully legitimate homologous recombination between the 3 vector (905) and the endogenous mouse IGK locus. Two separate transfections are performed with the 3 vector (905). PCR-positive clones from the two transfections are selected for expansion followed by further analysis using Southern blot assays.
[0274] The Southern blot assays are performed according to widely used procedures; they involve three probes and genomic DNA digested with multiple restriction enzymes chosen so that the combination of probes and digests allowed for conclusions to be drawn about the structure of the targeted locus in the clones and whether it is properly modified by homologous recombination. One of the probes maps to DNA sequence flanking the 5 side of the region of identity shared between the 3 targeting vector (905) and the genomic DNA; a second probe also maps outside the region of identity but on the 3 side; the third probe maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (945) or neomycin resistance (947) genes. The Southern blot identifies the presence of the expected restriction enzyme-generated fragment of DNA corresponding to the correctly mutated, i.e., by homologous recombination with the 3 targeting vector (905) part of the locus, as detected by one of the external probes and by the neomycin resistance or HPRT gene probe. The external probe detects the mutant fragment and also a wild-type fragment from the non-mutant copy of the immunoglobulin locus on the homologous chromosome.
[0275] Karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most commonly arising chromosomal aberrations that arise in mouse ES cells. Clones with such aberrations are excluded from further use. Karyotypically normal clones that are judged to have the expected correct genomic structure based on the Southern blot data are selected for further use.
[0276] Acceptable clones are then modified with the 5 vector (903) using procedures and screening assays that are similar in design to those used with the 3 vector (905), except that puromycin selection is used instead of G418/neomycin selection, and the protocols are tailored to match the genomic region modified by the 5 vector (903). The goal of the 5 vector (903) transfection experiments is to isolate clones of ES cells that have been mutated in the expected fashion by both the 3 vector (905) and the 5 vector (903), i.e., doubly targeted cells carrying both engineered mutations. In these clones, the Cre recombinase causes a recombination (902) to occur between the loxP sites introduced into the locus by the two vectors, resulting in the genomic DNA configuration shown at 907.
[0277] Further, the clones must have undergone gene targeting on the same chromosome, as opposed to homologous chromosomes; i.e., the engineered mutations created by the targeting vectors must be in cis on the same DNA strand rather than in trans on separate homologous DNA strands. Clones with the cis arrangement are distinguished from those with the trans arrangement by analytical procedures such as fluorescence in situ hybridization of metaphase spreads using probes that hybridize to the novel DNA present in the two gene targeting vectors (903 and 905) between their arms of genomic identity. The two types of clones can also be distinguished from one another by transfecting them with a vector expressing the Cre recombinase, which deletes the pu-Tk (939), HPRT (945) and neomycin resistance (947) genes if the targeting vectors have been integrated in cis, and comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene introduced by the 5 vector (903) and by analyzing the drug resistance phenotype of the surviving clones by a sibling selection screening procedure in which some of the cells from the clone are tested for resistance to puromycin or G418/neomycin. Cells with the cis arrangement of mutations are expected to yield approximately 10.sup.3 more ganciclovir-resistant clones than cells with the trans arrangement. The majority of the resulting cis-derived ganciclovir-resistant clones should also be sensitive to both puromycin and G418/neomycin, in contrast to the trans-derived ganciclovir-resistant clones, which should retain resistance to both drugs. Clones of cells with the cis-arrangement of engineered mutations in the chain locus are selected for further use.
[0278] The doubly targeted clones of cells are transiently transfected with a vector expressing the Cre recombinase (902) and the transfected cells are subsequently placed under ganciclovir selection, as in the analytical experiment summarized above. Ganciclovir-resistant clones of cells are isolated and analyzed by PCR and Southern blot for the presence of the expected deletion (907) between the two engineered mutations created by the 5 vector (903) and the 3 vector (905). In these clones, the Cre recombinase has caused a recombination to occur between the loxP sites (937) introduced into the chain locus by the two vectors. Because the loxP sites are arranged in the same relative orientations in the two vectors, recombination results in excision of a circle of DNA comprising the entire genomic interval between the two loxP sites. The circle does not contain an origin of replication and thus is not replicated during mitosis and is therefore lost from the clones of cells as they undergo clonal expansion. The resulting clones carry a deletion of the DNA that was originally between the two loxP sites. Clones that have the expected deletion are selected for further use.
[0279] The ES cell clones carrying the deletion of sequence in one of the two homologous copies of their immunoglobulin chain locus are retransfected (904) with a Cre recombinase expression vector together with a piece of DNA (909) comprising a partly canine immunoglobulin chain locus containing V.sub. (951) and J.sub. (955) gene segment coding sequences. The key features of this piece of DNA (referred to as K-K) are the following: a lox5171 site (931); a neomycin resistance gene open reading frame (947, lacking the initiator methionine codon, but in-frame and contiguous with an uninterrupted open reading frame in the lox5171 site (931)); a FRT site (927); an array of 14 canine V.sub. gene segments (951), each with canine coding sequences embedded in mouse noncoding sequences; optionally a 13.5 Kb piece of genomic DNA from immediately upstream of the cluster of J.sub. region gene segments in the mouse chain locus (not shown); a 2 Kb piece of DNA containing the 5 canine J.sub. region gene segments (955) embedded in mouse noncoding DNA; a loxP site (937) in opposite relative orientation to the lox5171 site (931).
[0280] The sequences of the canine V.sub. and J.sub. gene coding regions are in Table 2.
[0281] In a second independent experiment, an alternative piece of partly canine DNA (909) is used in place of the K-K DNA. The key features of this DNA (referred to as L-K) are the following: a lox5171 site (931); a neomycin resistance gene open reading frame (947) lacking the initiator methionine codon, but in-frame and contiguous with an uninterrupted open reading frame in the lox5171 site (931); a FRT site (927); an array of 76 functional canine V), variable region gene segments (951), each with canine coding sequences embedded in mouse noncoding regulatory or scaffold sequences; optionally, a 13.5 Kb piece of genomic DNA from immediately upstream of the cluster of the J.sub. region gene segments in the mouse chain locus (not shown); a 2 Kb piece of DNA containing 7 canine J.sub. region gene segments embedded in mouse noncoding DNA (955); a loxP site (937) in opposite relative orientation to the lox5171 site (931). (The dog has 9 functional J.sub. region gene segments, however, the encoded protein sequence of J.sub.4 and J.sub.9 and of J.sub.7 and J.sub.8 are identical, and so only 7 J.sub. gene segments are included.)
[0282] The transfected clones from the K-K and L-K transfection experiments are placed under G418 selection, which enriches for clones of cells that have undergone RMCE, in which the partly canine donor DNA (909) is integrated in its entirety into the deleted immunoglobulin chain locus between the lox5171 (931) and loxP (937) sites that were placed there by 5 (903) and 3 (905) vectors, respectively. Only cells that have properly undergone RMCE have the capability to express the neomycin resistance gene (947) because the promoter (929) as well as the initiator methionine codon (935) required for its expression are not present in the vector (909) and are already pre-existing in the host cell IGH locus (907). The DNA region created using the K-K sequence is illustrated at 911. The remaining elements from the 5 vector (903) are removed via Flp-mediated recombination (906) in vitro or in vivo, resulting in the final canine-based light chain locus as shown at 913.
[0283] G418-resistant ES cell clones are analyzed by PCR and Southern blotting to determine if they have undergone the expected RMCE process without unwanted rearrangements or deletions. Both K-K and L-K clones that have the expected genomic structure are selected for further use.
[0284] The K-K ES cell clones and the L-K ES cell clones carrying the partly canine immunoglobulin DNA in the mouse chain locus (913) are microinjected into mouse blastocysts from strain DBA/2 to create partly ES cell-derived chimeric mice according to standard procedures. Male chimeric mice with the highest levels of ES cell-derived contribution to their coats are selected for mating to female mice. The female mice of choice for use in the mating are of the C57B1/6NTac strain, and also carry a transgene encoding the Flp recombinase that is expressed in their germline. Offspring from these matings are analyzed for the presence of the partly canine immunoglobulin or light chain locus, and for loss of the FRT-flanked neomycin resistance gene that was created in the RMCE step. Mice that carry the partly canine locus are used to establish colonies of K-K and L-K mice.
[0285] Mice carrying the partly canine heavy chain locus, produced as described in Example 3, can be bred with mice carrying a canine-based chain locus. Their offspring are in turn bred together in a scheme that ultimately produces mice that are homozygous for both canine-based loci, i.e., canine-based for heavy chain and . Such mice produce partly canine heavy chains with canine variable domains and mouse constant domains. They also produce partly canine proteins with canine variable domains and the mouse constant domain from their loci. Monoclonal antibodies recovered from these mice have canine heavy chain variable domains paired with canine variable domains.
[0286] A variation on the breeding scheme involves generating mice that are homozygous for the canine-based heavy chain locus, but heterozygous at the locus such that on one chromosome they have the K-K canine-based locus and on the other chromosome they have the L-K canine-based locus. Such mice produce partly canine heavy chains with canine variable domains and mouse constant domains. They also produce partly canine proteins with canine variable domains and the mouse constant domain from one of their loci. From the other locus, they produce partly canine proteins with canine variable domains the mouse constant domain. Monoclonal antibodies recovered from these mice have canine variable domains paired in some cases with canine variable domains and in other cases with canine variable domains.
Example 5: Introduction of an Engineered Partly Canine Immunoglobulin Locus into the Immunoglobulin Chain Gene Locus of a Mouse Genome
[0287] Another method for replacing a portion of a mouse genome with an engineered partly canine immunoglobulin locus is illustrated in
[0288] The key features of the gene targeting vector (1003) for accomplishing the 194 Kb deletion are as follows: a negative selection gene such as a gene encoding the A subunit of the diphtheria toxin (DTA, 1059) or a herpes simplex virus thymidine kinase gene (not shown); 4 Kb of genomic DNA from 5 of the mouse V.sub.x/V.sub.2 variable region gene segments in the locus (1025); a FRT site (1027); a piece of genomic DNA containing the mouse Polr2a gene promoter (1029); a translation initiation sequence (methionine codon embedded in a Kozak consensus sequence) (1035); a mutated loxP recognition sequence (lox5171) for the Cre recombinase (1031); a transcription termination/polyadenylation sequence (1033); an open reading frame encoding a protein that confers resistance to puromycin (1037), whereas this open reading frame is on the antisense strand relative to the Polr2a promoter and the translation initiation sequence next to it and is followed by its own transcription termination/polyadenylation sequence (1033); a loxP recognition sequence for the Cre recombinase (1039); a translation initiation sequence (a methionine codon embedded in a Kozak consensus sequence) (1035) on the same, antisense strand as the puromycin resistance gene open reading frame; a chicken beta actin promoter and cytomegalovirus early enhancer element (1041) oriented such that it directs transcription of the puromycin resistance open reading frame, with translation initiating at the initiation codon downstream of the loxP site and continuing back through the loxP site into the puromycin open reading frame all on the antisense strand relative to the Polr2a promoter and the translation initiation sequence next to it; a mutated recognition site for the Flp recombinase known as an F3 site (1043); a piece of genomic DNA upstream of the R3, C.sub.3, J.sub.1 and C.sub.1 gene segments (1045).
[0289] Mouse embryonic stem (ES) cells derived from C57B1/6 NTac mice are transfected (1002) by electroporation with the targeting vector (1003) according to widely used procedures. Homologous recombination replaces the native DNA with the sequences from the targeting vector (1003) in the 196 Kb region resulting in the genomic DNA configuration depicted at 1005.
[0290] Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only in the prokaryotic plasmid sequence or the polylinker associated with it. The transfected cells are plated and after 24 hours placed under positive drug selection using puromycin. There is also negative selection for cells that have integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination results in retention of the DTA gene, which kills the cells when the gene is expressed, whereas the DTA gene is deleted by homologous recombination since it lies outside of the region of vector homology with the mouse IGL locus. Colonies of drug-resistant ES cells are physically extracted from their plates after they became visible to the naked eye approximately a week later. These picked colonies are disaggregated, re-plated in micro-well plates, and cultured for several days. Thereafter, each of the clones of cells are divided such that some of the cells are frozen as an archive, and the rest used for isolation of DNA for analytical purposes.
[0291] DNA from the ES cell clones is screened by PCR using a widely used gene-targeting assay design. For these assays, one of the PCR oligonucleotide primer sequences maps outside the regions of identity shared between the targeting vector and the genomic DNA, while the other maps within the novel DNA between the two arms of genomic identity in the vector, e.g., in the puro gene (1037). According to the standard design, these assays detect pieces of DNA that would only be present in clones of cells derived from transfected cells that had undergone fully legitimate homologous recombination between the targeting vector (1003) and the native DNA (1001).
[0292] Six PCR-positive clones from the transfection (1002) are selected for expansion followed by further analysis using Southern blot assays. The Southern blots involve three probes and genomic DNA from the clones that has been digested with multiple restriction enzymes chosen so that the combination of probes and digests allow identification of whether the ES cell DNA has been properly modified by homologous recombination.
[0293] Karyotypes of the six PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most common chromosomal aberrations that arise in mouse ES cells. Clones that show evidence of aberrations are excluded from further use. Karyotypically normal clones that are judged to have the expected correct genomic structure based on the Southern blot data are selected for further use.
[0294] The ES cell clones carrying the deletion in one of the two homologous copies of their immunoglobulin chain locus are retransfected (1004) with a Cre recombinase expression vector together with a piece of DNA (1007) comprising a partly canine immunoglobulin chain locus containing V.sub., J.sub. and C.sub. region gene segments. The key features of this piece of DNA (1007) are as follows: a lox5171 site (1031); a neomycin resistance gene open reading frame lacking the initiator methionine codon, but in-frame and contiguous with an uninterrupted open reading frame in the lox5171 site (1047); a FRT site 1027); an array of 76 functional canine region gene segments, each with canine coding sequences embedded in mouse noncoding sequences (1051); an array of J-C units where each unit has a canine J.sub. gene segment and a mouse constant domain gene segment embedded within noncoding sequences from the mouse locus (1055) (the canine J.sub. gene segments are those encoding J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6, and J.sub.7, while the mouse constant domain gene segments are C.sub.1 or C.sub.2 or C.sub.3); a mutated recognition site for the Flp recombinase known as an F3 site (1043); an open reading frame conferring hygromycin resistance (1057), which is located on the antisense strand relative to the immunoglobulin gene segment coding information in the construct; a loxP site (1039) in opposite relative orientation to the lox5171 site.
[0295] The sequences of the canine V.sub. and J.sub. gene coding regions are in Table 3.
[0296] The transfected clones are placed under G418 or hygromycin selection, which enriches for clones of cells that have undergone a RMCE process, in which the partly canine donor DNA is integrated in its entirety into the deleted immunoglobulin chain locus between the lox5171 and loxP sites that were placed there by the gene targeting vector. The remaining elements from the targeting vector (1003) are removed via FLP-mediated recombination (1006) in vitro or in vivo resulting in the final caninized locus as shown at 1011.
[0297] G418/hygromycin-resistant ES cell clones are analyzed by PCR and Southern blotting to determine if they have undergone the expected recombinase-mediated cassette exchange process without unwanted rearrangements or deletions. Clones that have the expected genomic structure are selected for further use.
[0298] The ES cell clones carrying the partly canine immunoglobulin DNA (1011) in the mouse chain locus are microinjected into mouse blastocysts from strain DBA/2 to create partially ES cell-derived chimeric mice according to standard procedures. Male chimeric mice with the highest levels of ES cell-derived contribution to their coats are selected for mating to female mice. The female mice of choice here are of the C57B1/6NTac strain, which carry a transgene encoding the Flp recombinase expressed in their germline. Offspring from these matings are analyzed for the presence of the partly canine immunoglobulin chain locus, and for loss of the FRT-flanked neomycin resistance gene and the F3-flanked hygromycin resistance gene that were created in the RMCE step. Mice that carry the partly canine locus are used to establish a colony of mice.
[0299] In some aspects, the mice comprising the canine-based heavy chain and locus (as described in Examples 3 and 4) are bred to mice that carry the canine-based locus. Mice generated from this type of breeding scheme are homozygous for the canine-based heavy chain locus, and can be homozygous for the K-K canine-based locus or the L-K canine-based locus. Alternatively, they can be heterozygous at the locus carrying the K-K locus on one chromosome and the L-K locus on the other chromosome. Each of these mouse strains is homozygous for the canine-based locus. Monoclonal antibodies recovered from these mice has canine heavy chain variable domains paired in some cases with canine variable domains and in other cases with canine variable domains. The variable domains are derived from either the canine-based L-K locus or the canine-based locus.
Example 6: Introduction of an Engineered Partly Canine Immunoglobulin Minilocus into a Mouse Genome
[0300] In certain other aspects, the partly canine immunoglobulin locus comprises a canine variable domain minilocus such as the one illustrated in
[0301] A site-specific targeting vector (1131) comprising the partly canine immunoglobulin locus to be integrated into the mammalian host genome is introduced (1102) into the genomic region (1101) with the deleted endogenous immunoglobulin locus comprising the puro-TK gene (1105) and the following flanking sequence-specific recombination sites: mutant FRT site (1109), mutant LoxP site (1111), wild-type FRT site (1107), and wild-type LoxP site (1105). The site-specific targeting vector comprises i) an array of optional PAIR elements (1141); ii) a V.sub.H locus (1119) comprising, e.g., 1-39 functional canine V.sub.H coding regions and intervening sequences based on the mouse genome endogenous sequences; iii) a 21.6 kb pre-D region (1121) comprising mouse sequence; iv) a D locus (1123) and a J.sub.H locus (1125) comprising 6 D and 6 J.sub.H canine coding sequences and intervening sequences based on the mouse genome endogenous sequences. The partly canine immunoglobulin locus is flanked by recombination sitesmutant FRT (1109), mutant LoxP (1111), wild-type FRT (1107), and wild-type LoxP (1105)that allow recombination with the modified endogenous locus. Upon introduction of the appropriate recombinase, e.g., Cre) (1104), the partly canine immunoglobulin locus is integrated into the genome upstream of the constant gene region (1127) as shown at 1129.
[0302] As described in Example 1, the primary screening for introduction of the partly canine immunoglobulin variable region locus is carried out by primary PCR screens supported by secondary Southern blotting assays. The deletion of the puro-TK gene (1105) as part of the recombination event allows identification of the cells that did not undergo the recombination event using ganciclovir negative selection.
Example 7: Introduction of an Engineered Partly Canine Immunoglobulin Locus with Canine Variable Region Coding Sequences with Mouse Constant Region Sequences Embedded in Immunoglobulin Non-Coding Sequences
[0303] Dog antibodies mostly contain light chains, whereas mouse antibodies mostly contain light chains. To increase production of antibodies containing a LC, the endogenous mouse V.sub. and J.sub. are replaced with a partly canine locus containing V.sub. and J.sub. gene segment coding sequences embedded in mouse V.sub. region flanking and regulatory sequences, the L-K mouse of Example 4. In such a mouse, the endogenous regulatory sequences promoting high level locus rearrangement and expression are predicted to have an equivalent effect on the ectopic locus. However, in vitro studies demonstrated that canine V.sub. domains do not function well with mouse C.sub. (see Example 9). Thus, the expected increase in LC-containing antibodies in the L-K mouse might not occur. As an alternate strategy, the endogenous mouse V.sub. and J.sub. are replaced with a partly canine locus containing V.sub. and J.sub. gene segment coding sequences embedded in mouse V.sub. region flanking and regulatory sequences and mouse C.sub. is replaced with mouse C.sub..
[0304]
[0305] The method for replacing a portion of a mouse genome with a partly canine immunoglobulin locus is illustrated in
[0306] The targeting vectors employed for introducing the site-specific recombination sequences on either side of the V.sub. (1315) gene segments and the C.sub. exon (1321) also include an additional site-specific recombination sequence that has been modified so that it is still recognized efficiently by the recombinase, but does not recombine with unmodified sites. This site is positioned in the targeting vector such that after deletion of the V.sub. and J.sub. gene segment clusters and the C.sub. exon it can be used for a second site specific recombination event in which a non-native piece of DNA is moved into the modified V.sub. locus via RMCE. In this example, the non-native DNA is a synthetic nucleic acid comprises canine V.sub. and J.sub. gene segment coding sequences and mouse C.sub. exon(s) embedded in mouse IGK regulatory and flanking sequences.
[0307] Two gene targeting vectors are constructed to accomplish the process just outlined. One of the vectors (1303) comprises mouse genomic DNA taken from the 5 end of the locus, upstream of the most distal V.sub. gene segment. The other vector (1305) comprises mouse genomic DNA taken from within the locus in a region spanning upstream (5) and downstream (3) of the C.sub. exon (1321).
[0308] The key features of the 5 vector (1303) are as follows: a gene encoding the diphtheria toxin A (DTA) subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (1323); 6 Kb of mouse genomic DNA (1325) mapping upstream of the most distal variable region gene in the chain locus; a FRT recognition sequence for the Flp recombinase (1327); a piece of genomic DNA containing the mouse Polr2a gene promoter (1329); a translation initiation sequence (1335, methionine codon embedded in a Kozak consensus sequence); a mutated loxP recognition sequence (lox5171) for the Cre recombinase (1331); a transcription termination/polyadenylation sequence (1333); a loxP recognition sequence for the Cre recombinase (1337); a gene encoding a fusion protein with a protein conferring resistance to puromycin fused to a truncated form of the thymidine kinase (pu-TK) under transcriptional control of the promoter from the mouse phosphoglycerate kinase 1 gene (1339); 2.5 Kb of mouse genomic DNA (1341) mapping close to the 6 Kb sequence at the 5 end in the vector and arranged in the native relative orientation.
[0309] The key features of the 3 vector (1305) are as follows: 6 Kb of mouse genomic DNA (1343) mapping within the locus in a region spanning upstream (5) and downstream (3) of the C.sub. exon (1321); a gene encoding the human hypoxanthine-guanine phosphoribosyl transferase (HPRT) under transcriptional control of the mouse Polr2a gene promoter (1345); a neomycin resistance gene under the control of the mouse phosphoglycerate kinase 1 gene promoter (1347); a loxP recognition sequence for the Cre recombinase (1337); 3.6 Kb of mouse genomic DNA (1349) that maps immediately downstream in the genome of the 6 Kb DNA fragment included at the 5 end in the vector, with the two fragments oriented in the same transcriptional orientation as in the mouse genome; a gene encoding the diphtheria toxin A (DTA) subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (1323).
[0310] One strategy to delete the endogenous mouse IGK locus is to insert the 3 vector (1305) in the flanking region downstream of the mouse C.sub. exon (1321). However, the 3 enhancer, which needs to be retained in the modified locus, is located 9.1 Kb downstream of the C.sub. exon, which is too short to accommodate the upstream and downstream homology arms of the 3 vector, which total 9.6 Kb. Therefore, the upstream region of homology was extended.
[0311] Mouse embryonic stem (ES) cells derived from C57B1/6NTac mice are transfected by electroporation with the 3 vector (1305) according to widely used procedures. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only in the prokaryotic plasmid sequence or the polylinker associated with it. The transfected cells are plated and after 24 hours they are placed under positive selection for cells that have integrated the 3 vector into their DNA using the neomycin analogue drug G418. There is also negative selection for cells that have integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination retains the DTA gene, which kills the cells when the gene is expressed, but the DTA gene is deleted by homologous recombination since it lies outside of the region of vector homology with the mouse IGK locus. Colonies of drug-resistant ES cells are physically extracted from their plates after they are visible to the naked eye about a week later. These colonies are disaggregated, re-plated in micro-well plates, and cultured for several days. Thereafter, each of the clones of cells is dividedsome of the cells are frozen as an archive, and the rest are used to isolate DNA for analytical purposes.
[0312] DNA from the ES cell clones is screened by PCR using a widely used gene-targeting assay design. For this assay, one of the PCR oligonucleotide primer sequences maps outside the region of identity shared between the 3 vector (1305) and the genomic DNA (1301), while the other maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (1345) or neomycin resistance (1347) genes. According to the standard design, these assays detect pieces of DNA that are only present in clones of ES cells derived from transfected cells that had undergone fully legitimate homologous recombination between the 3 vector (1305) and the endogenous mouse IGK locus. Two separate transfections are performed with the 3 vector (1305). PCR-positive clones from the two transfections are selected for expansion followed by further analysis using Southern blot assays.
[0313] Southern blot assays are performed according to widely used procedures using three probes and genomic DNA digested with multiple restriction enzymes chosen so that the combination of probes and digests allowed for conclusions to be drawn about the structure of the targeted locus in the clones and whether it is properly modified by homologous recombination. A first probe maps to DNA sequence flanking the 5 side of the region of identity shared between the 3 targeting vector (1305) and the genomic DNA; a second probe also maps outside the region of identity but on the 3 side; a third probe maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (1345) or neomycin resistance (1347) genes. The Southern blot identifies the presence of the expected restriction enzyme-generated fragment of DNA corresponding to the correctly mutated, i.e., by homologous recombination with the 3 targeting vector (1305) part of the locus, as detected by one of the external probes and by the neomycin resistance or HPRT gene probe. The external probe detects the mutant fragment and also a wild-type fragment from the non-mutant copy of the immunoglobulin locus on the homologous chromosome.
[0314] Karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most commonly arising chromosomal aberrations that arise in mouse ES cells. Clones with such aberrations are excluded from further use. Karyotypically normal clones that are judged to have the expected correct genomic structure based on the Southern blot data are selected for further use.
[0315] Acceptable clones are then modified with the 5 vector (1303) using procedures and screening assays that are similar in design to those used with the 3 vector (1305), except that puromycin selection is used instead of G418/neomycin selection, and the protocols are tailored to match the genomic region modified by the 5 vector (1303). The goal of the 5 vector (1303) transfection experiments is to isolate clones of ES cells that have been mutated in the expected fashion by both the 3 vector (1305) and the 5 vector (1303), i.e., doubly targeted cells carrying both engineered mutations. In these clones, the Cre recombinase causes a recombination (1302) to occur between the loxP sites introduced into the locus by the two vectors, resulting in the genomic DNA configuration shown at 1307.
[0316] Further, the clones must have undergone gene targeting on the same chromosome, as opposed to homologous chromosomes; i.e., the engineered mutations created by the targeting vectors must be in cis on the same DNA strand rather than in trans on separate homologous DNA strands. Clones with the cis arrangement are distinguished from those with the trans arrangement by analytical procedures such as fluorescence in situ hybridization of metaphase spreads using probes that hybridize to the novel DNA present in the two gene targeting vectors (1303 and 1305) between their arms of genomic identity. The two types of clones can also be distinguished from one another by transfecting them with a vector expressing the Cre recombinase, which deletes the pu-Tk (1339), HPRT (1345) and neomycin resistance (1347) genes if the targeting vectors have been integrated in cis, and comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene introduced by the 5 vector (1303) and by analyzing the drug resistance phenotype of the surviving clones by a sibling selection screening procedure in which some of the cells from the clone are tested for resistance to puromycin or G418/neomycin. Cells with the cis arrangement of mutations are expected to yield approximately 10.sup.3 more ganciclovir-resistant clones than cells with the trans arrangement. The majority of the resulting cis-derived ganciclovir-resistant clones should also be sensitive to both puromycin and G418/neomycin, in contrast to the trans-derived ganciclovir-resistant clones, which should retain resistance to both drugs. Clones of cells with the cis-arrangement of engineered mutations in the chain locus are selected for further use.
[0317] The doubly targeted clones of cells are transiently transfected with a vector expressing the Cre recombinase (1302) and the transfected cells are subsequently placed under ganciclovir selection, as in the analytical experiment summarized above. Ganciclovir-resistant clones of cells are isolated and analyzed by PCR and Southern blot for the presence of the expected deletion (1307) between the two engineered mutations created by the 5 vector (1303) and the 3 vector (1305). In these clones, the Cre recombinase causes a recombination to occur between the loxP sites (1337) introduced into the chain locus by the two vectors. Because the loxP sites are arranged in the same relative orientations in the two vectors, recombination results in excision of a circle of DNA comprising the entire genomic interval between the two loxP sites. The circle does not contain an origin of replication and thus is not replicated during mitosis and is therefore lost from the clones of cells as they undergo clonal expansion. The resulting clones carry a deletion of the DNA that was originally between the two loxP sites and have the genomic structure show at 1307. Clones that have the expected deletion are selected for further use.
[0318] The ES cell clones carrying the sequence deletion in one of the two homologous copies of their immunoglobulin chain locus are retransfected (1304) with a Cre recombinase expression vector together with a piece of DNA (1309) comprising a partly canine immunoglobulin chain locus containing V.sub. (1351) and J.sub. (1355) gene segment coding sequences and mouse C.sub. exon(s) (1357). The key features of this piece of DNA are the following: a lox5171 site (1331); a neomycin resistance gene open reading frame (1347, lacking the initiator methionine codon, but in-frame and contiguous with an uninterrupted open reading frame in the lox5171 site (1331); a FRT site (1327); an array of 1-76 functional canine V.sub. variable region gene segments (1351), each with canine coding sequences embedded in mouse noncoding regulatory or scaffold sequences; optionally, a 13.5 Kb piece of genomic DNA from immediately upstream of the cluster of the J.sub. region gene segments in the mouse chain locus (not shown); a 2 Kb piece of DNA containing 1-7 canine J.sub. region gene segments embedded in mouse noncoding DNA (1355) and mouse C.sub. exon(s) (1357); a loxP site (1337) in opposite relative orientation to the lox5171 site (1331). The piece of DNA also contains the deleted iE (not shown).
[0319] The sequences of the canine V.sub. and J.sub. gene coding regions are in Table 3.
[0320] The transfected cells are placed under G418 selection, which enriches for clones of cells that have undergone RMCE, in which the partly canine donor DNA (1309) is integrated in its entirety into the deleted immunoglobulin chain locus between the lox5171 (1331) and loxP (1337) sites that were placed there by 5 (1303) and 3 (1305) vectors, respectively. Only cells that have properly undergone RMCE have the capability to express the neomycin resistance gene (1347) because the promoter (1329) as well as the initiator methionine codon (1335) required for its expression are not present in the vector (1309) and are already pre-existing in the host cell IGK locus (1307). The DNA region created by RMCE is illustrated at 1311. The remaining elements from the 5 vector (1303) are removed via Flp-mediated recombination (1306) in vitro or in vivo, resulting in the final canine-based light chain locus as shown at 1313.
[0321] G418-resistant ES cell clones are analyzed by PCR and Southern blotting to determine if they have undergone the expected RMCE process without unwanted rearrangements or deletions. Clones that have the expected genomic structure are selected for further use.
[0322] Clones carrying the partly canine immunoglobulin DNA in the mouse chain locus (1313) are microinjected into mouse blastocysts from strain DBA/2 to create partly ES cell-derived chimeric mice according to standard procedures. Male chimeric mice with the highest levels of ES cell-derived contribution to their coats are selected for mating to female mice. The female mice of choice for use in the mating are of the C57B1/6NTac strain, and also carry a transgene encoding the Flp recombinase that is expressed in their germline. Offspring from these matings are analyzed for the presence of the partly canine immunoglobulin light chain locus, and for loss of the FRT-flanked neomycin resistance gene that was created in the RMCE step. Mice that carry the partly canine locus are used to establish colonies of mice.
[0323] Mice carrying the partly canine heavy chain locus, produced as described in Example 3, can be bred with mice carrying a canine -based chain locus. Their offspring are in turn bred together in a scheme that ultimately produces mice that are homozygous for both canine-based loci, i.e., canine-based for heavy chain and -based . Such mice produce partly canine heavy chains with canine variable domains and mouse constant domains. They also produce partly canine proteins with canine variable domains and the mouse constant domain from their loci. Monoclonal antibodies recovered from these mice have canine heavy chain variable domains paired with canine variable domains.
[0324] A variation on the breeding scheme involves generating mice that are homozygous for the canine-based heavy chain locus, but heterozygous at the locus such that on one chromosome they have the K-K canine-based locus described in Example 4 and on the other chromosome they have the partly canine -based locus described in this example. Such mice produce partly canine heavy chains with canine variable domains and mouse constant domains. They also produce partly canine proteins with canine variable domains and the mouse constant domain from one of their loci. From the other locus, partly canine proteins comprising canine variable domains and the mouse constant domain are produced. Monoclonal antibodies recovered from these mice include canine variable domains paired in some cases with canine variable domains and in other cases with canine variable domains.
Example 8. Introduction of an Engineered Partly Canine Immunoglobulin Locus with Canine Variable Region Coding Sequences with Mouse Constant Region Sequences Embedded in Mouse Immunoglobulin Non-Coding Sequences
[0325] This example describes an alternate strategy to Example 7 in which the endogenous mouse V.sub. and J.sub. are replaced with a partly canine locus containing canine V.sub. and J.sub. gene segment coding sequences embedded in mouse V.sub. region flanking and regulatory sequences and mouse C.sub. is replaced with mouse C.sub.. However, in this example the structure of the targeting vector containing the partly canine locus is different. The canine V gene locus coding sequences include an array of anywhere from 1 to 76 functional V.sub. gene segment coding sequences, followed by an array of J.sub.-C.sub. tandem cassettes in which the J.sub. is of canine origin and the C.sub. is of mouse origin, for example, C.sub.1, C.sub.2 or C.sub.3. The number of cassettes ranges from one to seven, the number of unique functional canine J.sub. gene segments. The overall structure of the partly canine locus in this example is similar to the endogenous mouse locus, whereas the structure of the locus in Example 7 is similar to the endogenous mouse locus, which is being replaced by the partly canine locus in that example.
[0326]
[0327] The method for replacing a portion of a mouse genome with a partly canine immunoglobulin locus is illustrated in
[0328] The targeting vectors employed for introducing the site-specific recombination sequences on either side of the V.sub. (1415) gene segments and the C.sub. exon (1421) also include an additional site-specific recombination sequence that has been modified so that it is still recognized efficiently by the recombinase, but does not recombine with unmodified sites. This site is positioned in the targeting vector such that after deletion of the V.sub. and J.sub. gene segment clusters and the C.sub. exon it can be used for a second site specific recombination event in which a non-native piece of DNA is moved into the modified V.sub. locus via RMCE. In this example, the non-native DNA is a synthetic nucleic acid comprising an array of canine V.sub. gene segment coding sequences and an array of J.sub.-C.sub. tandem cassettes in which the J.sub. is of canine origin and the C.sub. is of mouse origin, for example, C.sub.1, C.sub.2 or C.sub.3 embedded in mouse IGK regulatory and flanking sequences.
[0329] Two gene targeting vectors are constructed to accomplish the process just outlined. One of the vectors (1403) comprises mouse genomic DNA taken from the 5 end of the locus, upstream of the most distal V.sub. gene segment. The other vector (1405) comprises mouse genomic DNA taken from within the locus in a region spanning upstream (5) and downstream (3) of the C.sub. exon (1321).
[0330] The key features of the 5 vector (1403) and the 3 vector (1405) are described in Example 7.
[0331] Mouse embryonic stem (ES) cells derived from C57B1/6NTac mice are transfected by electroporation with the 3 vector (1405) according to widely used procedures as described in Example 7. DNA from the ES cell clones is screened by PCR using a widely used gene-targeting assay as described in Example 7. The Southern blot assays are performed according to widely used procedures as described in Example 7.
[0332] Karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most commonly arising chromosomal aberrations that arise in mouse ES cells. Clones with such aberrations are excluded from further use. Karyotypically normal clones that are judged to have the expected correct genomic structure based on the Southern blot data are selected for further use.
[0333] Acceptable clones are modified with the 5 vector (1403) using procedures and screening assays as described in Example 7. The resulting correctly targeted ES clones have the genomic DNA configuration of the endogenous locus in which the 5 vector (1403) is inserted upstream of endogenous V.sub. gene segments and the 3 vector (1405) is inserted downstream of the endogenous C.sub.. In these clones, the Cre recombinase causes recombination (1402) to occur between the loxP sites introduced into the locus by the two vectors, resulting in the genomic DNA configuration shown at 1407.
[0334] Acceptable clones undergo gene targeting on the same chromosome, as opposed to homologous chromosomes; such that the engineered mutations created by the targeting vectors are in cis on the same DNA strand rather than in trans on separate homologous DNA strands. Clones with the cis arrangement are distinguished from those with the trans arrangement by analytical procedures as described in Example 7.
[0335] The doubly targeted clones of cells are transiently transfected with a vector expressing the Cre recombinase (1402) and the transfected cells are subsequently placed under ganciclovir selection and analyses using procedures described in Example 7. In selected clones, the Cre recombinase has caused a recombination to occur between the loxP sites (1437) introduced into the chain locus by the two vectors. Because the loxP sites are arranged in the same relative orientations in the two vectors, recombination results in excision of a circle of DNA comprising the entire genomic interval between the two loxP sites. The circle does not contain an origin of replication and thus is not replicated during mitosis and is therefore lost from the clones of cells as they undergo clonal expansion. The resulting clones carry a deletion of the DNA that was originally between the two loxP sites and have the genomic structure show at 1407. Clones that have the expected deletion are selected for further use.
[0336] The ES cell clones carrying the deletion of sequence in one of the two homologous copies of their immunoglobulin chain locus are retransfected (1404) with a Cre recombinase expression vector together with a piece of DNA (1409) comprising a partly canine immunoglobulin chain locus containing V.sub. (1451) segment coding sequences and a tandem array of cassettes containing canine J.sub. gene segment coding sequences and mouse C.sub. exon(s) embedded in mouse IGK flanking and regulatory DNA sequences (1457). The key features of this piece of DNA are the following: a lox5171 site (1431); a neomycin resistance gene open reading frame (1447, lacking the initiator methionine codon, but in-frame and contiguous with an uninterrupted open reading frame in the lox5171 site (1431); a FRT site (1427); an array of 1-76 functional canine V.sub. variable region gene segments (1451), each containing canine coding sequences embedded in mouse noncoding regulatory or scaffold sequences; optionally, a 13.5 Kb piece of genomic DNA from immediately upstream of the cluster of the J.sub. region gene segments in the mouse chain locus (not shown); DNA containing a tandem array of cassettes containing canine J.sub. gene segment coding sequences and mouse C.sub. exon(s) embedded in mouse IGK flanking and regulatory DNA sequences (1457); a loxP site (1437) in opposite relative orientation to the lox5171 site (1431).
[0337] The sequences of the canine V.sub. and J.sub. gene coding regions are in Table 3.
[0338] The transfected cells are placed under G418 selection, which enriches for clones of cells that have undergone RMCE, in which the partly canine donor DNA (1409) is integrated in its entirety into the deleted immunoglobulin chain locus between the lox5171 (1431) and loxP (1437) sites placed there by the 5 (1403) and 3 (1405) vectors, respectively. Only cells that properly undergo RMCE have the capability to express the neomycin resistance gene (1447) because the promoter (1429) as well as the initiator methionine codon (1435) required for its expression are not present in the vector (1409) and are already pre-existing in the host cell IGK locus (1407). The DNA region created by RMCE is illustrated at 1411. The remaining elements from the 5 vector (1403) are removed via Flp-mediated recombination (1406) in vitro or in vivo, resulting in the final canine-based light chain locus as shown at 1413.
[0339] G418-resistant ES cell clones are analyzed by PCR and Southern blotting to determine if they have undergone the expected RMCE process without unwanted rearrangements or deletions. Clones that have the expected genomic structure are selected for further use.
[0340] Clones carrying the partly canine immunoglobulin DNA in the mouse chain locus (1413) are microinjected into mouse blastocysts from strain DBA/2 to create partly ES cell-derived chimeric mice according to standard procedures. Male chimeric mice with the highest levels of ES cell-derived contribution to their coats are selected for mating to female mice. The female mice of choice for use in the mating are of the C57B1/6NTac strain, and also carry a transgene encoding the Flp recombinase that is expressed in their germline. Offspring from these matings are analyzed for the presence of the partly canine immunoglobulin light chain locus, and for loss of the FRT-flanked neomycin resistance gene that was created in the RMCE step. Mice that carry the partly canine locus are used to establish colonies of mice.
[0341] Mice carrying the partly canine heavy chain locus, produced as described in Example 3, can be bred with mice carrying a canine -based chain locus. Their offspring are in turn bred together in a scheme that ultimately produces mice that are homozygous for both canine-based loci, i.e., canine-based for heavy chain and -based . Such mice produce partly canine heavy chains with canine variable domains and mouse constant domains. They also produce partly canine proteins with canine variable domains and the mouse constant domain from their loci. Monoclonal antibodies recovered from these mice have canine heavy chain variable domains paired with canine variable domains.
[0342] A variation on the breeding scheme involves generating mice that are homozygous for the canine-based heavy chain locus, but heterozygous at the locus such that on one chromosome they have the K-K canine-based locus described in Example 4 and on the other chromosome they have the partly canine -based locus described in this example. Such mice produce partly canine heavy chains with canine variable domains and mouse constant domains. They also produce partly canine proteins with canine variable domains and the mouse constant domain from one of their loci. From the other locus, they produce partly canine proteins with canine variable domains and the mouse constant domain. Monoclonal antibodies recovered from these mice have canine variable domains paired in some cases with canine variable domains and in other cases with canine variable domains.
[0343] The method described above for introducing an engineered partly canine immunoglobulin locus with canine variable region coding sequences and mouse constant region sequences embedded in mouse immunoglobulin non-coding sequences involve deletion of the mouse C.sub. exon. An alternate method involves inactivating the C.sub. exon by mutating its splice acceptor site. Introns must be removed from primary mRNA transcripts by a process known as RNA splicing in which the spliceosome, a large molecular machine located in the nucleus, recognizes sequences at the 5 (splice donor) and 3 (splice acceptor) ends of the intron, as well as other features of the intron including a polypyrimidine tract located just upstream of the splice acceptor. The splice donor sequence in the DNA is NGT, where N is any deoxynucleotide and the splice acceptor is AGN (Cech T R, Steitz J A and Atkins J F Eds. (2019) (RNA Worlds: New Tools for Deep Exploration, CSHL Press) ISBN 978-1-621822-24-0).
[0344] The mouse C.sub. exon is inactivated by mutating its splice acceptor sequence and the polypyrimidine tract. The wild type sequence upstream of the C.sub. exon is CTTCCTTCCTCAG (SEQ ID NO: 470) (the splice acceptor site is underlined). It is mutated to AAATTAATTAACC (SEQ ID NO: 471), resulting in a non-functional splice acceptor site and thus a non-functional C.sub. exon. The mutant sequence also introduces a PacI restriction enzyme site (underlined). As an eight base pair recognition sequence, this restriction site is expected to be present only rarely in the mouse genome (every 65,000 bp), making it simple to detect whether the mutant sequence has been inserted into the IGK locus by Southern blot analysis of the ES cell DNA that has been digested with PacI and another, more frequently cutting restriction enzyme. The wild type sequence is replaced with the mutant sequence by homologous recombination, a technique widely known in the art, as to insert the 3 RMCE vector. The key features of the homologous recombination vector (MSA, 1457) to mutate the C.sub. exon splice acceptor sequence and the polypyrimidine tract are as follows: 6 Kb of mouse genomic DNA (1443) mapping within the locus in a region spanning upstream (5) and downstream (3) of the C.sub. exon (1421) and containing the mutant AAATTAATTAACC (SEQ ID NO: 471) (1459) sequence instead of the wild type CTTCCTTCCTCAG (SEQ ID NO: 470) sequence in its natural position just upstream of the C.sub. exon; a neomycin resistance gene under the control of the mouse phosphoglycerate kinase 1 gene promoter (1447) and flanked by mutant FRT sites (1461); 3.6 Kb of mouse genomic DNA (1449) that maps immediately downstream in the genome of the 6 Kb DNA fragment included at the 5 end in the vector, with the two fragments oriented in the same transcriptional orientation as in the mouse genome; a gene encoding the diphtheria toxin A (DTA) subunit under transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcriptional enhancers from the polyoma virus (1423). Mutant FRT sites (1461), e.g., FRT F3 or FRT F5 (Schlake and Bode (1994) Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci. Biochemistry 33:12746-12751 PMID: 7947678 DOI: 10.1021/bi00209a003), are being used here because, once the spicing mutation is introduced and the Neo gene is deleted by transient transfection of a FLP recombinase expression vector (1406), the ES cells are subjected to further genetic manipulation. This process requires wild type FRT sites to delete another Neo selection gene (1447 at 1403). If the FRT site (1461) remaining in the IGK locus (1469) after introduction of the splicing mutation is wild type, attempted FRT-mediated deletion of this second Neo gene (1406 at 1413) may inadvertently result in deletion of the entire newly-introduced partly canine locus and the inactivated mouse C.sub. exon.
[0345] Mouse embryonic stem (ES) cells derived from C57B1/6NTac mice are transfected by electroporation with the MSA vector (1457) according to widely used procedures. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that cuts only in the prokaryotic plasmid sequence or the polylinker associated with it. The transfected cells are plated and after 24 hours they are placed under positive selection for cells that have integrated the MSA vector into their DNA by using the neomycin analogue drug G418. There is also negative selection for cells that have integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination results in retention of the DTA gene, which kills the cells when the gene is expressed, whereas the DTA gene is deleted by homologous recombination since it lies outside of the region of vector homology with the mouse IGK locus. Colonies of drug-resistant ES cells are physically extracted from their plates after they became visible to the naked eye about a week later. These picked colonies are disaggregated, re-plated in micro-well plates, and cultured for several days. Thereafter, each of the clones of cells is divided such that some of the cells are frozen as an archive, and the rest used to isolate DNA for analytical purposes.
[0346] The IGK locus in ES cells that are correctly targeted by homologous recombination has the configuration depicted at 1463.
[0347] DNA from the ES cell clones is screened by PCR using a widely used gene-targeting assay design. For this assay, one of the PCR oligonucleotide primer sequences maps outside the region of identity shared between the MSA vector (1457) and the genomic DNA (1401), while the other maps within the novel DNA between the two arms of genomic identity in the vector, i.e., the neomycin resistance (1447) gene. According to the standard design, these assays detect pieces of DNA that are only present in clones of ES cells derived from transfected cells that had undergone fully legitimate homologous recombination between the MSA vector (1457) and the endogenous mouse IGK locus. Two separate transfections are performed with the MSA vector (1457). PCR-positive clones from the two transfections are selected for expansion followed by further analysis using Southern blot assays.
[0348] The Southern blot assays are performed according to widely used procedure using three probes and genomic DNA digested with multiple restriction enzymes chosen so that the combination of probes and digests allowed for conclusions to be drawn about the structure of the targeted locus in the clones and whether it is properly modified by homologous recombination. In in this particular example, the DNA is double digested with Pac1 and another restriction enzyme such as EcoRI or HindIII, as only cells with the integrated MSA vector contains the PacI site. A first probe maps to DNA sequence flanking the 5 side of the region of identity shared between the MSA vector (1457) and the genomic DNA; a second probe also maps outside the region of identity but on the 3 side; a third probe maps within the novel DNA between the two arms of genomic identity in the vector, i.e., in the neomycin resistance (1447) gene. The Southern blot identifies the presence of the expected restriction enzyme-generated fragment of DNA corresponding to the correctly mutated, i.e., by homologous recombination with the MSA targeting vector (1457) part of the locus, as detected by one of the external probes and by the neomycin resistance gene probe. The external probe detects the mutant fragment and also a wild-type fragment from the non-mutant copy of the immunoglobulin locus on the homologous chromosome. The Southern blot assays are performed according to widely used procedures described in Example 7.
[0349] Karyotypes of PCR- and Southern blot-positive clones of ES cells are analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most commonly arising chromosomal aberrations that arise in mouse ES cells. Clones with such aberrations are excluded from further use. Karyotypically normal clones that are judged to have the expected correct genomic structure based on the Southern blot data are selected for further use.
[0350] Although the ability of the ES cell DNA to be digested by PacI in the mutated IGK allele confirms the presence of the TTAATTAA sequence, DNA sequencing focusing on the region upstream of the C.sub. exon is performed to confirm the presence of the complete expected splicing mutation. The region is amplified by genomic PCR using primers that flank the mutation [1465 and 1467 (Table 6: SEQ ID NO: 450 and SEQ ID NO:451)]. An alternate primer pair is shown in SEQ ID NO: 452 and SEQ ID NO: 453. These primers are designed using NCBI Primer-Blast and verified in silico to lack any predicted off-target binding sites in the mouse genome.
[0351] Sequence-verified ES cell clones are transiently transfected (1406) with a FLP recombinase expression vector to delete the neomycin resistance gene (1427). The cells are then subcloned and the deletion is confirmed by PCR. The IGK locus in the ES cells have the genomic configuration depicted at 1469.
[0352] The ES cells are electroporated with the 5 and 3 RMCE vectors, as described above. The only differences are that the 3 vector (1405) is inserted upstream of the mutant C.sub. exon at the position shown in
Example 9: Canine V Domains do not Function Well with Mouse C Domains and Canine V Domains do not Function Well with Mouse C Domains
[0353] For the proposed L-K mouse (Example 4), canine V.sub. and J.sub. gene segment coding sequences flanked by mouse non-coding and regulatory sequences are embedded in the mouse IGK locus from which endogenous V.sub. and J.sub. gene segments have been deleted. After productive V.sub..fwdarw.J.sub. gene rearrangement, the resulting Ig gene encodes a LC with a canine variable domain and a mouse constant domain. To test whether such a hybrid LC was properly expressed and forms an intact Ig molecule, a series of transient transfection assays were performed with different combinations of Vs, both V.sub. and V.sub., and C light chain exons, both C.sub. and C.sub., together with an Ig HC and tested for cell surface and intracellular expression and secretion of the encoded Ig.
[0354] For these experiments canine IGHV3-5 (Accession No. MF785020.1), IGHV3-19 (Accession No. FJ197781.1) or IGHV4-1 (Accession No. DN362337.1) linked to a mouse IgM.sup.b allotype HC was individually cloned into a pCMV vector. Each V.sub.H-encoding DNA contained the endogenous canine L1-intron-L2 and germline, i.e., unmutated VDJ sequence. Unmutated canine IGLV3-28 (Accession No. EU305423) or IGKV2-5 (Accession No. EU295719.1) were cloned into a pFUSE vector. Each canine V.sub.L exon was linked to the constant region of mouse C.sub., C.sub.1 or C.sub.2 (C.sub.3 was presumed to have the same properties as C.sub.2 since they have nearly identical protein sequence.) L1-intron-L2 sequences in each VL were of canine origin. 293T/17 cells were co-transfected with a human CD4 expression vector as a transfection control plus one of the HC and LC constructs and a CD79a/b expression vector. The CD79a/b heterodimer was required for cell surface expression of the IgM. Approximately 24 h later, the transfected cells were subjected to cell surface or intracellular staining by flow cytometry. For analysis of Ig secretion, the same V.sub.H genes as above were cloned into a pFUSE vector containing mouse IgG2a Fc. 293T/17 cells were co-transfected with a human CD4 (hCD4) expression vector as a transfection control plus one of the HC and LC constructs described above. (In these experiments C.sub.3 was also tested.) Approximately 48 hr later, the transfected cells and their corresponding supernatants were harvested and analyzed for HC/LC expression/secretion by western blotting.
[0355] To summarize the data obtained from these experiments, when canine IGLV3-28 was linked to mouse C.sub., IgM expression on the cell surface was at least two times less than when the same dog V.sub. was linked to C.sub.1 or C.sub.2. Likewise, when IGKV2-5 was linked to mouse C.sub. the level of surface IgM was drastically decreased. The extent of the expression defect was dependent of the particular V.sub.H gene being used; some V.sub.H genes allowed for some cell surface expression of the hybrid light chains, but others were more stringent. The same trends were seen with Ig secretion.
[0356]
[0357]
[0358]
[0359]
[0360] The results of this analysis indicate that hybrid light chains that include canine V), and mouse C.sub. or canine V.sub. and mouse C.sub.1 or C.sub.2 were often poorly expressed on the cell surface with HC. The level of cell surface IgM was dependent on the particular V.sub.H used by the HC, but there was no discernable pattern that would allow prediction of whether a particular V.sub.H would allow modest or no cell surface IgM expression. Since B cell survival depends on IgM BCR expression, pairing of canine V.sub. and mouse C.sub. would result in a major reduction in the development of LC-expressing B cells. Similarly, pairing of canine V.sub. with mouse C.sub.1 or C.sub.2 would reduce the development of -LC expressing B cells.
[0361] Expression and secretion of the Ig with hybrid or homologous LC was also tested. Supernatants and cell lysates of the transiently transfected cells were analyzed by western blotting.
[0362] In another set of experiments, the stability of the canine IGVL3-28-mouse C.sub. LC in transfected cells (
[0363] The results in
Example 10: Expression of Partly Canine Immunoglobulin with Mouse IgD
[0364] IgD is co-expressed with IgM on mature B cells in most mammals. However, the issue of whether dogs have a functional constant region gene to encode the HC is quite controversial. Early serological studies using a mAb identified an IgD-like molecule that was expressed on canine lymphocytes (Yang, et al. (1995) Identification of a dog IgD-like molecule by a monoclonal antibody. Vet. Immunol. and Immunopath. 47:215-224. PMID: 8571542). However, serum levels of this IgD increased upon immunization of dogs with ragweed extract. This is not typical of bona fide IgD, which is present in vanishingly small amounts in serum and is not boosted by immunization; IgD is primarily a BCR isotype, especially in mice. Later, Rogers, et al. ((2006) Molecular characterization of immunoglobulin D in mammals: immunoglobulin heavy constant delta genes in dogs, chimpanzees and four old world monkey species. Immunol. 118:88-100 (doi:10.1111/j.1365-2567.2006.02345.x)) cloned a cDNA by RT-PCR of RNA isolated from dog blood that, by sequence homology, encoded an authentic HC. However, the most recent annotation of the canine IGH locus by the international ImMunoGeneTics information System/www.imgt.org, (IMGT) lists Co as a non-functional open reading frame because of a non-canonical splice donor site, NGC instead of NGT, for the hinge 2 exon. It is possible that some low level of correct leaky splicing and IgD expression may occur in the dog, thus accounting for the ability of Rogers, et al. to isolate a C cDNA clone. However, the concern was that the canine V.sub.H domains might not fold properly when linked to mouse C, since the dog V.sub.H gene region has apparently been evolving with a partial or completely non-functional C.sub. gene. A problem with partial or absent assembly of the partly canine IgD could disturb normal B cell development.
[0365] To test whether canine V.sub.H domains with a C backbone can assemble into an IgD molecule expressible on the cell membrane, transient transfection and flow cytometry analyses were conducting using methods similar to those described in Example 8.
[0366] 293T/17 cells were co-transfected with a human CD4 (hCD4) expression vector as a transfection control plus one of the HC constructs from Example 8, except that C was replaced with C, and one of the or LC constructs, along with a CD79a/b expression vector. As can be seen in
[0367]
[0368]
[0369]
[0370] This data demonstrates that canine V.sub.H genes were expressed with a mouse IgD backbone, although the level of cell surface expression varied depending on the particular HC/LC combination. It is believed that HC/LC combinations that can be expressed as IgD on the cell surface are selected into the follicular B cell compartment during B cell development, generating a diverse BCR repertoire.
[0371] The preceding merely illustrates the principles of the methods described herein. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. In the claims that follow, unless the term means is used, none of the features or elements recited therein should be construed as means-plus-function limitations pursuant to 35 U.S.C. 112 6. All references cited herein are incorporated by reference in their entirety for all purposes.
Sequence Tables
Canine Ig
[0372] (NB, the sequence and annotation of the dog genome is still incomplete. These tables do not necessarily describe the complete canine V.sub.H, D and J.sub.H, V.sub.
(F=Functional, ORF=open reading frame, P=pseudogene, *0X indicates the IMGT allele number)
TABLE-US-00001 TABLE1 CanineIGHlocus GermlineV.sub.Hsequences SEQIDNO.1IGHV1-4-1(P) >IGHV1-4-1*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtccagctggtgcagtctggggctgaggtgaggaaaccagtttcatctgtgaaggtc tcctggaaggcatctggatacacctacatggatgcttatatgcactggttatgacaagct tcaggaataaggtttgggtgtatgggatggattggtcccaaagatggtgccacaagatat tcacagaagttccacagcagagtctccctgatggcagacatgtccaaagcacagcctaca tgctgctgagcagtcagaggcctgaggacacacctgcatattactgtgtgggacact SEQIDNO.2IGHV1-15(P) >IGHV1-15*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtccagctggtgcagtctggggctgaggtgaagaagccaggtacatccgtgaaggtc tcatgcaagacatctggatacaccttcactgactactatatgtactgggtacgacaggct tcaggagcagggcttgattggatgggacagattggtccctaagatggtgccacaaggtat gcacagaagtttcagggcagagtcaccctgtcaacagacacatccacaagcacagcctac atggagctgagcagtctgagagctgaggacacagccatgtactactctgtgaga SEQIDNO.3IGHV1-17(P) >IGHV1-17*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtccagctggtgcagtctggggctgaggtgaagaagctaagggcatcagtgatagtc ccctgcaagacatctggatacagcttcactgactacattttggaatgggtatgacaggct ccaggaccagggcttgagtggatgggatggattggtcctgaagatggtgagacaaagtat gtgcagaagttccaggcagagtcaccctgatggcagacacaaccacaagcacagccaaca tggagctgaccagtctgagagctgaggacacagccatgtactactgtgtga SEQIDNO.4IGHV1-30(F) >IGHV1-30*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtccagctggtgcagtctggggctgaggtgaagaagccaggggcatctgtgaaggtc tcctgcaagacatctggatacaccttcattaactactatatgatctgggtacgacaggct ccaggagcagggcttgattggatgggacagattgatcctgaagatggtgccacaagttat gcacagaagttccagggcagagtcaccctgacagcagacacatccacaagcacagcctac atggagctgagcagtctgagagctggggacatagctgtgtactactgtgcgaga SEQIDNO.5IGHV3-2(F) >IGHV3-2*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactc tcctgtgtggcctctggattcaccttcagtagcaactacatgagctggatccgccaggct ccagggaaggggctgcagtgggtctcacaaattagcagtgatggaagtagcacaagctac gcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagatgaggacacggcagtgtattactgtgcaaggga SEQIDNO.6IGHV3-3(F) >IGHV3-3*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacatggtgaagcctggggggtccctgagactc tcctgtgtggcctctggatttaccttcagtagttactacatgtattgggcccgccaggct ccagggaaggggcttcagtgggtctcacacattaacaaagatggaagtagcacaagctat gcagacgctgtgaagggccgattcaccatctccagagacaacgcaaagaatacgctgtat ctgcagatgaacagcctgagagctgaggacacagcggtgtattactgtgcaaagga SEQIDNO.7IGHV3-4(P) >IGHV3-4*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggagacctgatgaagcctgggggggtccctgagact ctcctgtgtggcctctgaattcatcttcagtggctactggaagtactggatccaccaagc tccagggaaggggctgcagtgggtcacatggattagcaatgatggaagtagcaaaagcta tgcagacgctgtgaagggccaattcaccatctccaaagacaatgccaaatacacgctgta tctgcagatgaacagcctgagagccgaggacatggccgtgtattactgtatgatgca SEQIDNO.8IGHV3-5(F) >IMGT000001|IGHV3-5*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactt tcctgtgtggcctctggattcaccttcagtagctaccacatgagctgggtccgccaggct ccagggaaggggcttcagtgggtcgcatacattaacagtggtggaagtagcacaagctat gcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtat cttcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagtga SEQIDNO.9IGHV3-5-1(P) >IMGT000001|IGHV3-5-1*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggagccctggtgaagcctgggggggtccctgagact ctcctatgtggcctctggattcaccttcagtagctaccacatgagctgggtccgccaggc tccagggaaggggctgcagtgggtcgcatacattaacagtggtggaagtagggatccctg ggtggcgcagtggtttggcgcctgcctttggcccagggcacgatcctggagacccgggat cgaatcccacgtcgggctccctgcatggagcctgcttctccctctgcctgtgtctct SEQIDNO.10IGHV3-6(F) >IGHV3-6*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactc tcctgtgtagcctctggattcaccttcagtagctccgacatgagctggatccgccaggct ccaggaaaggggcttcagtgggtcgcatacattagcaatgatggaagtagcacaagctac gcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctctat ctgcagatgaacagcctcagagccgaggacacggccgtgtattactgtgcaga SEQIDNO.11IGHV3-7(F) >IGHV3-7*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggagcaactggtggagtttggaggacacatggtgaatcctgggggttccctgggtctc tcctgtcaggcctctggattcaccttcagtagctatggcatgagctgggtccgccaggct caaaagaaggggctgcagtgggtcggacatattagctatgatggaagtagtacatactac gcagacactttgagggacagattcaccatctccagagacaacaccaagaacatgctgtat ctgcagatgaacagcctgagagccgaggacacagccgtgtattactgcatgaggaa SEQIDNO.12IGHV3-8(F) >IGHV3-8*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactc tcctgtgtggcctctggattcaccttcagtaactacgaaatgtactgggtccgccaggct ccagggaaagggctggagtgggtcgcaaggatttatgagagtggaagtaccacatactat gcagaagctgtaaagggccgattcaccatctccagagacaacgccaagaacatggcgtat ctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagtga SEQIDNO.13IGHV3-9(F) >IGHV3-9*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctggaggagacctggtgaagcctggggggtccctgagactt tcctgtgtggcctctggattcaccttcagtagctatgacatggactgggtccgccaggct ccagggaaggggctgcagtggctctcagaaattagcagtagtggaagtagcacatactac gcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcaaggga SEQIDNO.14IGHV3-10(F) >IGHV3-10*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagactgagggagacctggtgaagcctgggggatccctgagactt tcctgtgtggcctctggattcaccttcagtagctacgacatggactgggtctaccaggct ccagggaaagggttacagtgggtcacatacattagcaatggtggaagtagcacaaggtat gcagacgctgtgaagggccaattcaccatctccagagacaacgccaggaacacgctctat ctgcagatgaacagcctgagagacaaggacatggccgtgtattactgtgtgagtga SEQIDNO.15IGHV3-11(P) >IMGT000001|IGHV3-11*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctaggggagacgtggtgaagcctggggaggtccctctcctg tgtggcctctagattcaccttcagtagctactacatgggctgggtccactaggctccagg gaaggggctgcagtgggtcgcaggtattaccaatgatagaagtagcacaagctatgcaga cgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgca gatgaacagcctgggagccgaggacacggctgtgtattattgtgtgaaacaga SEQIDNO.16IGHV3-12(P) >IGHV3-12*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctggggagacctggtgaagcctggggggtctctgagactct cctgtgtggcctctggattcaccttcagtagctactacatgagctgggtccgccaggctc cagggaaggggctgcagtgggtcggatacattaacagtggtggaagtagcacatactatg cagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatc tgcagatgaacagcctgagagccgaggacacagctgtgtattactgtgggaaggga SEQIDNO.17IGHV3-13(F) >IGHV3-13*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggagcaactggtggagtttggaggacacatggtgaatcctgggggttccctgggtctc tcctgtcaggcctctggattcaccttcagtagctatggcatgagctgggtccgccaggct caaaagaaggggctgcagtgggtcggacatattagctatgatggaagtagcacatactac acagacactgtgagggacagattcaccatctccagagacaacaccaagaacatgctgtat ctgcagatgaacagcctgagagccgaggacacagccgtgtattactgcatgaggaa SEQIDNO.18IGHV3-14(P) >IGHV3-14*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagatggtggagtctgggggagacctggtgaagcctgggggatccctgagactc tcctgtgtggcctctggattcaccttcagtaactacaaaatgtactgggtccaccaggct ccagggaaagggctggagtgggtcgcaaggatttatgagagtggaagtaccacatactac gcagaagctgtaaagggccgattcaccatctccagagacaacgccaagaacatggtgtat ctgcagatgaacagcctgagagcctaggacacggccgtgtattactgtgtgagtga SEQIDNO.19IGHV3-16(F) >IGHV3-16*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtacagctggtggagtctggaggagacctggtgaagcctggggggtccctgagactc tcctgtgtggcctctggattcacctttagtagttactacatgttttggatccgccaggca ccagggaagggcaatcagtgggtcggatatattaacaaagatggaagtagcacatactac ccagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacactgtat ctgcagatgaacagcctgacagtggaggacacagccctttattactgtgcgagaga SEQIDNO.20IGHV3-18(F) >IGHV3-18*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagaccttgtgaaacctgaggggtccctgagactc tcctgtgtggtctctggcttcaccttcagtagctacgacatgagctgggtccgccaggct ccagggaaggggctgcagtgggtcgcatacattagcagtgatggaaggagcacaagttac acagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagaactgaggacacagccgtgtattactgtgcgaagga SEQIDNO.21IGHV3-19(F) >IGHV3-19*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctgcggggtccctgagactg tcctgtgtggcctctggattcaccttcagtagctacagcatgagctgggtccgccaggct cctgagaaggggctgcagttggtcgcaggtattaacagcggtggaagtagcacatactac acagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacagtgtat ctgcagatgaacagcctgagagccgaggacacggccatgtattactgtgcaaagga SEQIDNO.22IGHV3-20(P) >IGHV3-20*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggatacctggtgaagcctggagggtcctgagactct cctctgtgtcctctggattcaccttcagtatctactgcatgtgatgggtctgccaggctc caggaaaggggctgcagtgagtcgcatacagtaacagtggtggaagtagcactaggtaca cagacgctgtgaagggctgattcaccacctccagagacaatgccaagaacacactgtatc tgcagatgaacagcctgagagtgaggacacagcggtgtattactgtgcaggtga SEQIDNO.23IGHV3-21(P) >IGHV3-21*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctgttggagtctgggggagacctggtgaagcctggggggtccctgagactg tcctgtgtggtctctggattcaccttcagtaagtatggcatgagctgggtctgccaggct ttggggaaggggctacagttggtcgcagctattagctaagatggaaggagcacatactac acagacactgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtac ctgcagatgaacagcttgagagctgaggacacggccgtgtattactgtgagagtga SEQIDNO.24IGHV3-21-1(P) >IGHV3-21-1*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgaagctagtggagtctgggggagacctggtgaagcctgggggatcaattagactc tcctatgtgacctctggattcaccttcaggagctactggatgagctgggtcagccaggct ccagggaaggggctgcagtgggtcatatgggttaatactggtggaagcagaaaaagctat gcagatgctgtgaaggggtgattcaccatctccagagacaatgccaagaacacgctgtat ctgcatatgaacagcctgagagccctgtattattatgtgagtga SEQIDNO.25IGHV3-22(P) >IGHV3-22*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagatgatggagtctgggggagaactgatgaagcctgcaggatccctgagacct cctgtgtggcctctggattcaccttcagtagctactggatgtactggatccaccaaactc cggggaaggggctgcagtgggtcgcaggtattagcacagatggaagtagcacaagctacg tagacgctctgaagggctgattcaccatctccagagacaacgccaagaacacgctctatc tgcagatgaacagcctgagagccgaggacatggccatgtattactgtgcaga SEQIDNO.26IGHV3-23(F) >IGHV3-23*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggagaagcctgggggatccctgagactg tcctgtgtggcctctggattcaccttcagtagctacggcatgagctgggtccgccaggct ccagggaaggggctgcagggggtctcattgattaggtatgatggaagtagcacaaggtat gcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacagccgtgtattcctgtgcgaagga SEQIDNO.27IGHV3-24(F) >IGHV3-24*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagaccttgtgaagcctgaggggtccctgagactc tcctgtgtggcctctggattcaccttcagtagcttctacatgagctggttctgccaggct ccaaggaaggggctacagtgggttgcagaaattagcagtagtggaagtagcacaagctac gcagacattgtgaagggccgattcaccatctccagagacaatgccaagaacatgctgtat ctgcagatgaacagcctgagagccgaggacatggccgtatattattgtgcaaggta SEQIDNO.28IGHV3-25(P) >IGHV3-25*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagcctgggggagaactggtgaagcctggggcgtccctgagactc tcctgtgtggtccctggattcaccttcagtagctacaacatgggctgggctcaccagcct ccagggaaggggatgcagtgggtcgcaggttttaacagcggtggaagtagcacaagctac acagatgctgtgaagggtgaattcaccatctccagagacaatgtcaagaacacgctgtat ctgcagatgaacagcctgagatccgaggacacggccgtgtattactgtgtgaagga SEQIDNO.29IGHV3-26(P) >IGHV3-26*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgtagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactc tcctgtgtgggctctggattcaccttcagtagctactggatgagctgggtccgccaggct ccagggaaggggctacagtgggttgcagaaattagcggtagtggaagtagcacaaactat gcagacgctgtgaagggccgattcatcatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccatgtattactgtgcaaggga SEQIDNO.30IGHV3-27(P) >IGHV3-27*01|Canislupusfamiliaris_boxer|P|V-REGION| aaggtgcatctggtggagtctgcgggagacgtggtgaagcctaggaggtccctgagactc tcctgtgtgggctctggattcaccttcagtagctacagcatgtggtgggcccgtgaggct cccgggatggggctacagggggtcgcaggtattagatatgatggaagtagcacaagctac gcagacgctctgaagggccgattcaccatctccagagacaatgccaaaaacacactgtat ctgtagaagaacagcctgagagccgagggaggacacggccgtgtattactgtgcgaggga SEQIDNO.31IGHV3-28(P) >IGHV3-28*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctagtggagtctgggggagacctggtgaagtctgggggggtccctgagagt ctcctgtgtgggctctggattcaccttcagtagctactggatgtactgggtccaccaggc tccagggaaggggctccatgggtcgcatggattaggtatgatggaagtagcacaagctac gcagaagctgtgaaaggccgattcactgtttctagagacaacgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgtgaggga SEQIDNO.32IGHV3-29(P) >IGHV3-29*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtcctggggagacctggtgaagactggaggtttcctgagactc tcctgtctcctgtgtggcttccggattcaccttcagtaactacagcatgatctgggtccg ccaggctccaaggaaggggctgcagtggatcacaactattagcaatagtggaagtagcac aaatcacgcagacacagtaaagggccgatttaccatctccagagacaacaccaagaacac gctgtatctacagatgagcagcctgggagccgatgacacggccctgtattactgtgtgag gga SEQIDNO.33IGHV3-31(P) >IGHV3-31*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggagaactggtgaagcctggggggtccctgagactc tcctgtgtggcctctggattcaccttcagtagctactacatgagctggatccgccaggct cctgggaaggggctgcagtgggtcgcagatattagtgacagtggaggtagcacatactac actgacgctgtgaagggccgattcaccatctccagagacaacgtcaagaactcgctgtat ttgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgaagga SEQIDNO.34IGHV3-32(ORF) >IGHV3-32*01|Canislupusfamiliaris_boxer|ORF|V-REGION| ggggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgacactc tcctgtgtggcctatggattcaccttcagtagctacagcatgcaatgggtctgtcaggct ccagggaagggggtgcagtgggtcgcatacattaacagtggtggaagtagcacaagctcc gcagatgctgtgaagggtcgattcatcatctccagagacaacgtcaagaacacgctatat ctgcagatgaacagcctgagagccgaggacaccgccgtgtattactgtgcgggtga SEQIDNO.35IGHV3-33(P) >IGHV3-33*01|Canislupusfamiliaris_boxer|P|V-REGION| gagatgcagctggtggaggctgggggagacctggtgaagcttggggggtccctgagactc ttctgtgtggcctctggatttaccttcagtagctattggatgagctgggtcggccaggct ccagggaaagggttgcagtgggttgcatacattaacagtggtggaagtagcacatactat gcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaactgcctgagagccgaggacacggccgtatattactgtgtggga SEQIDNO.36IGHV3-34(F) >IGHV3-34*01|Canislupusfamiliaris_boxer|F|V-REGION| cagacactgtgaagggccgattcaccatctccagagacaacgccaagaacacgctctatc tgcagatgaacagcctgagagctgaggacacggccgtgtattactgtgcgaagga (Incompletesequenceindatabase) SEQIDNO.37IGHV3-35(F) >IGHV3-35*01|Canislupusfamiliaris_boxer|F|V-REGION||| gaggtgcagctggtggagtctgggggagacctggtgaagcctgtgggatccctgagactc tcctgtgtggcctctggattcaccttcagtagctatgacatgaactgggtccgccaggct ccagggaaggggctgcagtgggtcgcatacattagcagtggtggaagtagcacatactat gcagatgctgtgaagggccggttcaccatctccagagacaacgccaagaacacgctgtat cttcagatgaacagcctgagagccgaggacacggccatgtattactgtgcgggtga SEQIDNO.38IGHV3-36(P) >IGHV3-36*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggggcagctggcggagtctgggggagacctggtgaagcctgagaggtccctgagactc gcccgtgtggcctctggattcaccttcatttcctataccatgagctgggtccacaaggct cctgggaaggggctgccgtgagtcgcatgaatttattctagtggaagtaacatgagctat gcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacatgctgtat ctgcagatgaacagcctgagagctgaggacatggccatgtattactgtgtgaatga SEQIDNO.39IGHV3-37(F) >IGHV3-37*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtacagctggtggagtctggggaagatttggtgaagcctggagggtccctgagactc tcctgtgtggcctctggattcaccttcagtagcagtgaaatgagctgggtccaccaggct ccagggcaggggctgcagtgggtctcatggattaggtatgatggaagtatctcaaggtat gcagacactgtgaagggccgattcaccatctccagagacaatgtcaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccatatattactgtgcaga SEQIDNO.40IGHV3-38(F) >IGHV3-38*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggaccttgagactg tcctgtgtggcctctggattcacctttagtagctatgacatgagctgggtccgtcagtct ccagggaaggggctgcagtgggtcgcagttatttggaatgatggaagtagcacatactac gcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgaagga SEQIDNO.41IGHV3-39(F) >IGHV3-39*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtacagctggtggaatctgggggagacctcgtgaagcctgggggttccctgagactc tcctgtgtggcctcgggattcaccttcagtagctactacatgagctggatccgccaggct cctgggaaggggctgcagtgggtcgcagatattagtgatagtggaggtagcacaggctac gcagacgctgtgaagggccggttcaccatctccagagagaacgccaagaacaagctgtat cttcagatgaacagcctgagagccgaggacacagccgtgtattactgtgcgaagga SEQIDNO.42IGHV3-40(P) >IGHV3-40*01|Canislupusfamiliaris_boxer|P|V-REGION| atgcaatgggtccgtcaggctcctgggaagggggtgcagtgggtcgcatacattaacagt ggtggaagtagcacaagcttcgcagatgctgtgaagggcatgagctggtttcgccaggct ccagggaaggggctgcaatgggttacatggattgggtatgatggaagtagcacatactac acagacactgtaaagggccgattcactatctccatagacaacgccaagaacatgctgtat ctgcagatgaacagcctgagagccgaggacatagccctgtattactgtgcgaggga SEQIDNO.43IGHV3-41(F) >IGHV3-41*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactc tcctgtgtagcctctggattcaccttcagtaactacgacatgagctgggtccgccaggct cctgggaaggggctgcagtgggtcgcagctattagctatgatggaagtagcacatactac actgacgctgtgaagggccgattcaccatctccagagacaacgccaggaacacagtgtat ctgcagatgaacagcctgagagccgaggacacggctgtgtattactgtgcgaagga SEQIDNO.44IGHV3-42(P) IGHV3-42*01|Canislupusfamiliaris_boxer|P|V-REGION| gaagtgcagctggtggagtctgggggaagacctggtgaagccaggggggtccctgagact ctcctgtgtgacctctggattcaccttcagtaggtatgccatgagctgggtcggccaggc tccagggaagggcctgcagtgggttgcagctattagcagtagtggaagtagcacatacta cgtagatgctgtgaagggccgattcaccatctccatagacaacgccaagaacatggtgta tctgcagatgaacagcctgagagctgaggatattgctgtgtattactgtgggaagga SEQIDNO.45IGHV3-43(P) >IGHV3-43*01|Canislupusfamiliaris_boxer|P|V-REGION| aaggtgtagctggtggagtctgggggagacctgatgaagcctgggggttccctgagactg tcctgtgtggcctctggattcaccttcaggagctatggcatgagctgggtctgccaggct tcagggaaggggctgcagtgggtcgcagctattagctatgatggaaggagcacatactac acagacactgtgaagggccgattcaccatctccagagacaatggcaagaacacgctgtac ctgcagatgaacagcttgagagctgaggacacggccgtgtattactgtgcgagtga SEQIDNO.46IGHV3-44(ORF) >IGHV3-44*01|Canislupusfamiliaris_boxer|ORF|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctgggggttccctgagactc tcatgtgtgacttctggattcaccttcagtagctattggatgagctgtgtccgccaggct ccagggaaggagctgcagtgggtcgcgtacattaacagtggtggaagtagcacatggtac acagacgctgtgaagggtcgattcaccatctccagagacaacgccaagaacacgctgtat ctgcagatgaacaacctgagagccgaagacacggccgtgtattactgtgcgaggga SEQIDNO.47IGHV3-45(P) >IGHV3-45*01|Canislupusfamiliaris_boxer|P|V-REGION| gaagtacagctgctggagtctgggggagaccgagtgaaacctggggggtcccagagactc tcctgtgtggcctcaaggttcaccttcagtagctacagcatgcattgtctccgtcagtct cctgggatggggctacagtgggtcacatacattagcagtaatggaagcagcacatactat gcagacgctgtgaagggtcgattcaccatctccagagacaaagccaagaacatgctttat ctacagatgaacagcctgagagctcaggacatagccctgtattactgtgcagatg SEQIDNO.48IGHV3-46(F) >IGHV3-46*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtacagctggtggagtctggggaagatttggtgaagcctggagggtccctgagactc tcctgtgtggcctctggattcaccttcagtagcagtgaaatgagctgggtccaccaggct ccagggcaggggctgcagtgggtctcatggattaggtatgatggaagtagctcaaggtat gcagacactgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccatatattactgtgcaga SEQIDNO.49IGHV3-47(F) >IGHV3-47*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggcgaagcctggggggtccctgagactc tcctgtgtggcctctggattaaccttcagtagctacagcatgagctgggtccgccaggct cctgggaaggggctgcagtgggtcacagctattagctatgatggaagtagcacatactac actgacgctgtgaagggccgattcaccatctccagagacaacgccaggaacacagtgtat ctgcagatgaacagcctgagagccgaggacacagctgtgtattactgtgtgga SEQIDNO.50IGHV3-47-1(P) >IGHV3-47-1*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgccactggtggaatctgggggagagctggtgaagcctggggggtccctgagactc tcctttgtagcctctgcattcactttcagtagttactggataagctgggtccgccaagct ccagggaaagggctgcactgagtctcagtaattaacaaagatggaagtaccacataccac gcagatgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagctgaggacacggctgtgtattactgtgcaca SEQIDNO.51IGHV3-48(P) >IGHV3-48*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggagcagttggtgaaatctaggggagacctggtgaagcctggcgggtccctgagactc ttctgtgagtcctctacattcacctttcatagcaacagcatacattggctccaccagtct cccggtagtggctacagtgggtcatatccaatagcagtaatggaagtagcatgtactatg cagacgctgtaaagggctgattcaccatctccagagacagcaccaggaacatgctgtatc tgcagatgaacagcctgagagctgaggacacagccgtgcattgctgtgcgaggga SEQIDNO.52IGHV3-49(P) >IGHV3-49*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggagacctcatgaagcctggggggtccctgagactc tcctgtgtggccgctggattcaccttcagtagctacagcatgagctgggtccgccaggct cccgggaaggggattcagtgggtcgcatggatttaagctagtggaaatagcacaagctac acagatgctgtgaagggccgattcaccatctccagagaacgccaagaacacagtgtttct gcagatgaacagcctgagagctgaggacaaggccatgtattactgtgcgaggga SEQIDNO.53IGHV3-50(F) >IGHV3-50*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccttgagactc tcctgtgtggcctctggtttcaccttcagtagcaacgacatggactgggtccgccaggct ccagggaaggggctgcagtggctcacacggattagcaatgatggaaggagcacaggctac gcagatgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtat ctgcagatgaacagcctgagagctgaggacacagccgtgtattactgtgcgaagga SEQIDNO.54IGHV3-51(P) >IGHV3-51*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggaggagtctgggggagacctggtgaagcctggggttccctaagactgt cctgtgtgacctccggattcactttcagtagctatgccatgcactgggtccgccaggctc cagggaaggggctgcagtgggtcgcagttattagcagggatggaagtagcacaaactacg cagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacatgctgtatc tacagatgaacagcctgagagctgaggacacggccatgtattactgtgcgaagga SEQIDNO.55IGHV3-52(P) >IGHV3-52*01|Canislupusfamiliaris_boxer|P|V-REGION|| gaagtgcagctggtggagtatgggggagagctggtgaagcctggggggtccctgagactg tcctgtgtggcctccggattcaccttcagtatctactacatgcactgggtccaccaggct ccagggaaggggctgcagtggttcgcatgaattaggagtgatggaagtagcacatactac actgatgctgtgaagggccgattcaccatctccagagacaattccaagaacactctgtat ctgcagatgaccagcctgagagccgaggacacggccctatattactgtgcgatgga SEQIDNO.56IGHV3-53(P) >IGHV3-53*01|Canislupusfamiliaris_boxer|P|V-REGION| gagatgcagctggtggagtctagggaggcctggtgaagcctggggggtccctgagactct cctgtgtggaccctggattcaccttcagtagctactggatgtactgggtccaccaggctc cagggatggggctgcagtggcttgcagaaattagcagtactggaagtagcacaaactatg cagacgctgtgaggggcccattcaccatctccagagacaatgccaagaacacgctgtacc tgcaggtgaacagcctgagagccgaagacacggccgtgtattactgtgtgagtga SEQIDNO.57IGHV3-54(F) >IGHV3-54*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctgatgaagcctggggggtccctgagactc tcctgtgtggcctccggattcactatcagtagcaactacatgaactgggtccgccaggct ccagggaaggggctgcagtgggtcggatacattagcagtgatggaagtagcacaagctat gcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgtgaaggga SEQIDNO.58IGHV3-55(P) >IGHV3-55*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctggggaaacctggtgaagcctggggagtctctgagactct cttgtgtggcctctggattcaccttcagtagctactggatgcattgggtctgccaggctc cagggaaagggttggggtgggttgcaattattaacagtggtggaggtagcacatactatg cagacacagtgaagggccaattcaccatcttcagagacaatgccaagaacatgctgtatc tgcagatgaacagcctgagagcccaggacatgaccgcgtattactgtgtgagtga SEQIDNO.59IGHV3-56(P) >IGHV3-56*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggaatctgggggagacctggtgaagcctgggggatccctgagactc tcctgtgtggcctctggattcaccttcagtagctactatatggaatgggtctgccaggct ccagggaggggctgaagtgggtcgcacggattagcagtgacggaagtagcacatactaca cagacgctgtgaagggccgattcaccatctccagagacaatgccaagacggccgtgtatt actgtgcgaagga SEQIDNO.60IGHV3-57(P) >IGHV3-57*01|Canislupusfamiliaris_boxer|P|V-REGION| gaagtgcagcttgtggagtctgggggagagctggtgaagcctgggggttccctgagactg tcctgtgtggcctctggattcaccttcagtagctactacatgcactgggtctgcaggctc cagggaaggggctgcagtgggttgcaagaattaggagtgatggaagtagcacaagctacc cagacgctgtgaagggcagattcaccatctccagagacaattccaagaacactctgtatc tgcagatgaacagcctgagagctgatgatacggccctatattactgtgcaaggga SEQIDNO.61IGHV3-58(F) >IGHV3-58*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctgggggatccctgagactc tcttgtgtggcctccggattcaccttcagtagccatgccaagagctgggtccgccaggct ccagggaaggggctgaagtgggtagcagttattagcagtagtggaagtagcacaggctcc gcagacactgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagctgaggacacagccgtgtattactgtgcgaagga SEQIDNO.62IGHV3-59(P) >IGHV3-59*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtacagctggtggagtctggaggagaccttgtgaagactgagcggtccctgagactc tcctgtgtggcctctggattcaccttcagtagcttctacatgaggtgtctgccagactcc agggaagggactacagtgggttgcagaaattagcagtagtggaagtagcacaagctacac agatgctctgaagggctgattctccatctccaaaaacaatgccaagaacacgctgtatct gcagatgaacagcctgagagccgaggtcacagccgtatattactgtgcaaggta SEQIDNO.63IGHV3-60(P) >IGHV3-60*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgaagctggtggagtctgggggagacctgttgaagcctgggggatcaattaaactc tcctatgtgacctctggattcaccttcaggagctactggatgagctgggtcagccaggct ccagggaaggggctgcagtgggtcacatgggttaatactggtggaagcagcaaaagctat gcagatgctgtgaaggggcaattcaccatctccagagacaatgccaagaacacgctgtat ctgcatatgaacagcctgatagccctgtattattgtgtgagtga SEQIDNO.64IGHV3-61(F) >IGHV3-61*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctggtggaaacctggtgaagcctgggggttccctgagactg tcctgtgtggcctctggattaaccttctatagctatgccatttactgggtccacgaggct cctgggaaggggctgcagtgggtcgcagctattaccactgatggaagtagcacatactac actgacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagctgaggacatgcccgtgtattactgtgcgaggga SEQIDNO.65IGHV3-62(P) >IGHV3-62*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggagcagctggtggagtctcggggagatctggtgaagtctggggggtccctgagactc tcctgtgtggccccttgattcaccttcagtaactgtgacatgagctgggtccattaggct ccaggaaagggctgcagtgtgttgcatacattagctatgatggaagtagcacaggttaca aagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacatgctgtatc ttcagatgaacagcctgagagctgaggacacggctctgtattactgtgcaga SEQIDNO.66IGHV3-63(P) IGHV3-63*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggagcagttggtgaaatctaggggagacctggtgaagcctggcgggtccctgagactc ttctgtgagtcctctacgttcacctttcatagctacagcatgcattggctccaccagtct cccggtagtggctacagtgggtcatatccaatagcagtaatggaagtagcatgtactatg cagacgctgtaaagggctgatacaccatctccagagacaacaccaggaacatgctgtatc tgcagatgaataacctgagagctgaggacacagccgtgcattgctgtgcgaggga SEQIDNO.67IGHV3-64(P) >IGHV3-64*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgcgggagaccccgtgaagcctggggggtccctgagactc tcctgtgtggccgctggattcaccttcagtagctacagcatgagctgggtccgccaggct cccgggaaggggatgcagtgggtcgcatggatatatgctagcggaagtagcacaagctac gcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacactgttt ctgcagatgcctgagagctgaggacacggccatgtattcctgtgcagggga SEQIDNO.68IGHV3-65(P) >IGHV3-65*01|Canislupusfamiliaris_boxer|P|V-REGION| gatgtacagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactg tcctgtgtggcctctggattcacctgcagtagctactacatgtactagacccaccaaatt ccagggaaggggatgcagggggttgcacggattagctatgatggaagtagcacaagctac accgacgcaatgaaaggccgattcaccatctccagagacaacgccaagaacatgctgtat ctgcaatgaacagcctgagagccgaggacacagccgtgtattactgtgtgaagga SEQIDNO.69IGHV3-66(P) >IGHV3-66*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctggcggagacctggtgaagcctgggcggtccctgagactg tcctgtatggcctctggattcacttcagtagctacagcatgagctgtgtccgccaggctc ctgggaagggctgcagtgggtcgcaaaaattagcaatagtggaagtagcacatactacac agatgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctctatct gcagatgaacagcctgagagccgaggacacggccttgtattactgtgcaga SEQIDNO.70IGHV3-67(F) >IGHV3-67*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactg tcctgtgtggcctctggattcaccttcagtagctactacatgtactgggtccgccaggct ccagggaaggggcttcagtgggtcgcacggattagcagtgatggaagtagcacatactac gcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagccgaggacacggctatgtattactgtgcaaagga SEQIDNO.71IGHV3-68(P) >IGHV3-68*01|Canislupusfamiliaris_boxer|P|V-REGION| gaagtgcagctggtggagtctgggggagagctggtgaagcctggggggtccctgagactc tcctgtgtggcctctggattcaccttcagtagctactacatgtactgggtccgccaggct ccagggaaatggctgctgtgggtcacatgaattaggagtgatggaagtagcacatataca ctgatgctgtgaaggaccgatacaccatctccaaagacaattccaagaacattctgtatc tgcagatgaacagcctgagagccaaggacacggccctatatccctgtgcaatgga SEQIDNO.72IGHV3-69(F) >IGHV3-69*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtacagctggtggagtctgggggagacctggtgaagcctgggggatccctgagactg tcctgtgtggcctctggattcaccttcagtagctatgccatgagctgggtccgccaggct ccagggaaggggctgcagtgggtcgcatacattaacagtggtggaagtagcacatactac gcagatgctgtgaagggccggttcaccatctccagagacaatgccaggaacacactgtat ctgcagatgaacagcctgagatccgaggacacagccgtgtattactgtccgaagga SEQIDNO.73IGHV3-70(F) >IGHV3-70*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctggaggagaccttgtgaagcctgagcggtccctgagactc tcctgtgtggcctctggattcaccttcagtagcttctacatgagctggttctgccaggct ccagggaaggggctacagtgtgttgcagaaattagcagtagtggaaatagcacaagctac gcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtat ctacggatgcacagcctgagagccgaggacacggctgtatattactgtgcaaggta SEQIDNO.74IGHV3-71(P) >IGHV3-71*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgaagctggtggagtgtgggggagacctggtgaagcccgggggatcgattagactc tcctttgtgacctctggattcaccttcaggagctattggatgggctgtgtcagccaggct ccagggaaggggctgcagtgggtcacatgggttaatactggtggaagcagcaaaagctat gcagatgctatgaaggggcgatttaccatctccaggcacaaagccaagaacacactatct gcatatgaacagcctgagagccgtgtattattgtgtgagtga SEQIDNO.75IGHV3-72(P) >IGHV3-72*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctggcggagacctggtgaagcctggggattccctgagactg tcctgtgtggcctctggattcaccttcagtagctatgccatgagctgggtccgccaggct cctaggaaggggctgcagtgggtcggatacattagcagtgatggaagtagcacataatac gcagacgctgtgaagggccgattcaccatttccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagctgaggatacggccctgtataactgtgcaaggga SEQIDNO.76IGHV3-73(P) >IGHV3-73*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctgatggagtctgggggagacctggtgaagcctggggggtccctgagactc tcctgtgtggcccctggattcaccttcagtaactatgacatgagctcggtccattagact ccaggaaagggctgcagtgtattgcatatattagctatgatggaagtagcacaggttaca aagacgctgtgcagggccgattcaccatctccagagacaacgccaagaacacgctgtatc ttcagatgaacagcctgagagctgagcacacggccctgtattactgtgcaga SEQIDNO.77IGHV3-74(P) >IGHV3-74*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggagacttggtgaagccttgtgggctcctgagactc tcctgtgtggcttctggattcaccttcagtagctacatcatgagctgggtccgccaggct ccagggaagtggctgcagtgggtcgcatacattaacagtggtggaagtagcacaaggtac acagatgctgtgaagggccgattcacctctccagagacaacgccaagaacatgctgtatc tgcagttgaacagcctgagagccgaggacaccgctgtgtattactgtgcgaggga SEQIDNO.78IGHV3-75(F) >IGHV3-75*01|Canislupusfamiliaris_boxer|F|V-REGION| gaattgcagctggtggagcttgggggagatctggtgaagccaggggggtccctgagactc tcctgtgtggcctctggattcaccttcagtagctatgccatgagttgggtctgccaggct ccagggaaggggctgcagtgggttgcagctattagcagtagtggaagtagcacataccat gtagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacagtgtat ctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcaga SEQIDNO.79IGHV3-76(F) >IGHV3-76*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgccactggtggaatctgggggagagctggtgaagcctgaggggtccctgagattc tcctgtgtagcctctggattcactttcagtagttactggataagctgggtccgccaagct ccagggaaagggctgcactgggtctcagtaattaacaaagatggaagtaccacataccac gcagatgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgagagctgagggcacgactgtgtattactgtgcaca SEQIDNO.80IGHV3-77(P) >IGHV3-77*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggagcagttggtgaagtctgggggagacctggtgaagcttggcaggtccctgagtcct ctacattcacctttcatagctacagcatgcattggctccaccagtctcccggtagtggct acagtgggtcatatccaatagcagtaatggaagtagcatgtactatgcagacgctgtaaa gggttgattcaccatctccagagacaacaccaggaacacgctgtatctgcagatgaacag cctgagagccgacgacacggccgtgtgttgctgtgcgaggga SEQIDNO.81IGHV3-78(P) >|IGHV3-78*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggtgcagctggtggagtctgggggagaccttgtgaagccggaggggtccctgagactc tcctgtgtggccgctggattcacctttagtagctacagcatgagctgggtccgccaggct cccgggaagggggtgcagtgggtcacatagatttatgctagtggaagtagcacaagctac acagatgctgtgaagggccgattcaccatctccagagacaacgccaagaacacagtgttt ctgcagatgaacagcctgagagctgagaacacggccatgtattcctgtgcaaggga SEQIDNO.82IGHV3-79(P) >IGHV3-79*01|Canislupusfamiliaris_boxer|P|V-REGION| tggggaattccctctggtgtggcctctggattcacctgcagtagctccctcacctccctc tcctgtgtggcctctagattcaccttcagtagctactacatatactgtatccaccaagct ccagggaaggggctgcaggtggtcgcatggattagctatgatggaagtagaacaagctac gccgacgctatgtagggccaattcatcatctccagagaaaacaccaagaacacgctgtat ctgtagatgaacagcctgagtgccaaggacacggcactatatccctgtgcgaggaa SEQIDNO.83IGHV3-80(F) >IGHV3-80*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctgggggagatctggtgaagcctgggggatccctgagactc tcttgtgtggcctctggattcaccttcagtagctactacatggaatgggtccgccaggct ccagggaaggggctgcagtgggtcgcacagattagcagtgatggaagtagcacatactac ccagacgctgtgaagggtcaattcaccatctccagagacaatgccaagaacacgctgtat ctgcagatgaacagcctgggagccgaggacacggccgtgtattactgtgcaaagga SEQIDNO.84IGHV3-81(F) >IGHV3-81*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctggaggaaacctggtgaagcctggggggtccctgagactc tcttgtgtggcctctggattcaccttcagtagctactacatggactgggtccgccaggct ccagggaagaggctgcagtgggtcgcagggattagcagtgatggaagtagcacatactac ccacaggctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctctat ctgcagatgaacagcctgagagccgaggactctgctgtgtattactgtgcgatgga SEQIDNO.85IGHV3-82(F) >IGHV3-82*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggtgcagctggtggagtctggaggagacctggtgaagtctggggggtccctgagactc tcttgtgtggcctctggattcaccttcagtagctactacatgcactgggtccgccaggct acagggaaggggctgcagtgggtcacaaggattagcaatgatggaagtagcacaaggtac gcagacgccatgaagggccaatttaccatctccagagacaattccaagaatacgctgtat ctgcagatgaacagccagagagccgaggacatggccctatattactgtgcaaggga SEQIDNO.86IGHV3-83(P) >IGHV3-83*01|Canislupusfamiliaris_boxer|P|V-REGION| gagttgcagctggtagagtctgggggagacctggtgaagcctggggggtctctgagactt tcttgtgtgtcctctggattcaccttcagtagctactggatgcactgggtcctccaggct ccagggaaagggctggagtgggtcgcaattattaacagtggtggaggtagcatatactac gcagacacagtgaagggccgattcaccatctccagagaaaacgccaagaacacgctctat ctgcagatgaacagcctgagagctgaggacagggccatgcattactgtgcgaaggga SEQIDNO.87IGHV4-1(F) >IGHV4-1*01|Canislupusfamiliaris_boxer|F|V-REGION| gaactcacactgcaggagtcagggccaggactggtgaagccctcacagaccctctctctc acctgtgttgtgtccggaggctccgtcaccagcagttactactggaactggatccgccag cgccctgggaggggactggaatggatggggtactggacaggtagcacaaactacaacccg gcattccagggacgcatctccatcactgctgacacggccaagaaccagttctccctgcag ctgagctccatgaccaccgaggacacggccgtgtattactgtgcaagaga SEQIDNO.88IGHV(II)-1(P) >IGHV(II)-1*01|Canislupusfamiliaris_boxer|P|V-REGION| ctggcacccctgcaggagtctgtttctgggctggggaaacccaggcagatccttacactc acctgctccttctctgggttcttattgagcatgtcagtatgggtgtcacatgggtccttt acccaccaggggaaggcactggagtcaatgccacatctggtgggagaacgctaagtacca cagcctgtctctgaacagcagcaagatgtatagaaagtccaacacttggaaagataaagg attatgtttcacaccagaagcacatctattcaacctgatgaacagccagcctgat SEQIDNO.89IGHV(II)-2(P) >IGHV(II)-2*01|Canislupusfamiliaris_boxer|P|V-REGION| ctggcacccctgcaggagtctgtttctgggctggggaaacccaggcagacccttacactc acctgctccttctctgggttcttattgagcatgtcagtgtgggtgtcacatgggtccttt acccaccaggggaaggcactggagtcaatgccacgtctggtgggagaacactaagtacca cagcctgtctctgaacagcagcaagatgtatagaaagtccaacacttggaaagataaagg attatgtttcacaccagaagcacatctattcaacctgatgaacaatcagcctgatgaga GermlineDsequences SEQIDNO.90IGHD1(F) >IGHD1*01|Canislupusfamiliaris_boxer|F|D-REGION| gtactactgtactgatgattactgtttcaac SEQIDNO.91IGHD2(F) >IGHD2*01|Canislupusfamiliaris_boxer|F|D-REGION| ctactacggtagctactac SEQIDNO.92IGHD3(F) >IGHD3*01|Canislupusfamiliaris_boxer|F|D-REGION| tatatatatatggatac SEQIDNO.93IGHD4(F) >IGHD4*01|Canislupusfamiliaris_boxer|F|D-REGION| gtatagtagcagctggtac SEQIDNO.94IGHD5(ORF) >IGHD5*01|Canislupusfamiliaris_boxer|ORF|D-REGION| agttctagtagttggggct SEQIDNO.95IGHD6(F) >IGHD6*01|Canislupusfamiliaris_boxer|F|D-REGION| ctaactggggc GermlineJ.sub.Hsequences SEQIDNO.96IGHJ1(ORF) >IGHJ1*01|Canislupusfamiliaris_boxer|ORF|J-REGION| tgacatttactttgacctctggggcccgggcaccctggtcaccatctcctcag SEQIDNO.97IGHJ2(F) >IGHJ2*01|Canislupusfamiliaris_boxer|F|J-REGION| aacatgattacttagacctctggggccagggcaccctggtcaccgtctcctcag SEQIDNO.98IGHJ3(F) >IGHJ3*01|Canislupusfamiliaris_boxer|F|J-REGION| caatgcttttggttactggggccagggcaccctggtcactgtctcctcag SEQIDNO.99IGHJ4(F) >IGHJ4*01|Canislupusfamiliaris_boxer|F|J-REGION| ataattttgactactggggccagggaaccctggtcaccgtctcctcag SEQIDNO.100IGHJ5(F) >IGHJ5*01|Canislupusfamiliaris_boxer|F|J-REGION| acaactggttctactactggggccaagggaccctggtcactgtgtcctcag SEQIDNO.101IGHJ6(F) >IGHJ6*01|Canislupusfamiliaris_boxer|F|J-REGION| attactatggtatggactactggggccatggcacctcactcttcgtgtcctcag
TABLE-US-00002 TABLE2 CanineIGKSequenceInformation GermlineVsequences SEQIDNO.102IGKV2-4(F) >IGKV2-4*01|Canislupusfamiliaris_boxer|F|V-REGION| gatattgtcatgacacagacgccaccgtccctgtctgtcagccctagagagacggcctcc atctcctgcaaggccagtcagagcctcctgcacagtgatggaaacacctatttggattgg tacctgcaaaagccaggccagtctccacagcttctgatctacttggtttccaaccgcttc actggcgtgtcagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctaacgatactggagtttattactgcgggcaaggtacacagcttcct cc SEQIDNO.103IGKV2-5(F) >IGKV2-5*01|Canislupusfamiliaris_boxer|F|V-REGION| gatattgtcatgacacagaccccactgtccctgtccgtcagccctggagagccggcctcc atctcctgcaaggccagtcagagcctcctgcacagtaatgggaacacctatttgtattgg ttccgacagaagccaggccagtctccacagcgtttgatctataaggtctccaacagagac cctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgatgatgctggagtttattactgcgggcaaggtatacaagatcct cc SEQIDNO.104IGKV2-6(F) >IIGKV2-6*01|Canislupusfamiliaris_boxer|F|V-REGION| gatattgtcatgacacagaccccactgtccctgtctgtcagccctggagagactgcctcc atctcctgcaaggccagtcagagcctcctgcacagtgatggaaacacgtatttgaactgg ttccgacagaagccaggccagtctccacagcgtttaatctataaggtctccaacagagac cctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatactggagtttattactgcgggcaaggtatacaagatcct cc SEQIDNO.105IGKV2-7(F) >IGKV2-7*01|Canislupusfamiliaris_boxer|F|V-REGION|| gatattgtcatgacacagaacccactgtccctgtccgtcagccctggagagacggcctcc atctcctgcaaggccagtcagagcctcctgcacagtaacgggaacacctatttgaattgg ttccgacagaagccaggccagtctccacagggcctgatctataaggtctccaacagagac cctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatgctggagtttattactgcatgcaaggtatacaagctcct cc SEQIDNO.106IGKV2-8(F) >IGKV2-8*01|Canislupusfamiliaris_boxer|F|V-REGION| gatattgtcatgacacagaccccaccgtccctgtccgtcagccctggagagccggcctcc atctcctgcaaggccagtcagagcctcctgcacagtaacgggaacacctatttgaattgg ttccgacagaagccaggccagtctccacagggcctgatctatagggtgtccaaccgctcc actggcgtgtcagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatgctggagtttattactgcgggcaaggtatacaagatcct cc SEQIDNO.107IGKV2-9(F) >IGKV2-9*01|Canislupusfamiliaris_boxer|F|V-REGION| gatattgtcatgacacagaccccactgtccctgtctgtcagccctggagagactgcctcc atctcttgcaaggccagtcagagcctcctgcacagtgatggaaacacgtatttgaattgg ttccgacagaagccaggccagtctccacagcgtttgatctataaggtctccaacagagac cctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatactggagtttattactgcgggcaagttatacaagatcct cc SEQIDNO.108IGKV2-10(F) >IGKV2-10*01|Canislupusfamiliaris_boxer|F|V-REGION| gatattgtcatgacacagaccccactgtccctgtccgtcagccctggagagactgcctcc atctcctgcaaggccagtcagagcctcctgcacagtgatggaaacacgtatttgaattgg ttccgacagaagccaggccagtctccacagcgtttgatctataaggtctccaacagagac cctggggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatactggagtttattactgcatgcaaggtacacagtttcct cg SEQIDNO.109IGKV2-11(F) >IGKV2-11*01|Canislupusfamiliaris_boxer|F|V-REGION| gatatcgtcatgacacagaccccactgtccctgtccgtcagccctggagagactgcctcc atctcctgcaaggccagtcagagcctcctgcacagtaacgggaacacctatttgttttgg ttccgacagaagccaggccagtctccacagcgcctgatcaacttggtttccaacagagac cctggggtcccacacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatgctggagtttattactgcgggcaaggtatacaagctcct cc SEQIDNO.110IGKV2S12(P) >IGKV2S12*01|Canislupusfamiliaris_boxer|P|V-REGION| gatatcgtgatgacccagaccccattgtccttgcctgtcacccctggagagctagcctca tcactgtgcaggaggccagtcagagcctcctgcacagtgatggatatatttatttgaatt ggtactttcagaaatcaggccagtctccatactcttgatctatatgctttacaaccagac ttctggagtcccaggctggttcattggcagtggatcagggacagatttcaccctgaggat cagcagggtggaggctgaagatgctggagtttattattgccaacaaactctacaaaatcc tcc SEQIDNO.111IGKV2S13(F) >IGKV2S13*01|Canislupusfamiliaris_boxer|F|V-REGION| gatatcgtcatgacgcagaccccactgtccctgtctgtcagccctggagagccggcctcc atctcctgcagggccagtcagagcctcctgcacagtaatgggaacacctatttgtattgg ttccgacagaagccaggccagtctccacagggcctgatctacttggtttccaaccgtttc tcttgggtcccagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacgatgctggagtttattactgcgggcaaaatttacagtttcct tc SEQIDNO.112IGKV2S14(P) >IGKV2S14*01|Canislupusfamiliaris_boxer|P|V-REGION| gaggttgtgatgatacagaccccactgtccctgtctgtcagccctggagagccggcctcc atctcctgcagggccagtcagagtctccggcacagtaatggaaacacctatttgtattgg tacctgcaaaagccaggccagtctccacagcttctgatcgacttggtttccaaccatttc actggggtgtcagacaggttcagtggcagcgggtctggcacagattttaccctgaggatc agcagggtggaggctgaggatgttggagtttattactgcatgcaaagtacacatgatcct cc SEQIDNO.113IGKV2S15(P) >IGKV2S15*01|Canislupusfamiliaris_boxer|P|V-REGION| gatatcatgatgacacagaccccactctccctgcctgccacccctggggaattggctgcc atcttctgcagggccagagtctcctgcacaataatggaaacacttatttacactggttcc tgcagacatcaggccaggttccaaggcatctgaaccatttggcttccagctgttactctg gggtctcagacaggttcagtggcaacgggtcagggacagatttcacactgaaaatcagca gagtggaggctgaggatgttagtgtttattagtgcctgcaagtacacaaccttccatc SEQIDNO.114IGKV2S16(F) >IGKV2S16*01|Canislupusfamiliaris_boxer|F|V-REGION| gaggccgtgatgacgcagaccccactgtccctggccgtcacccctggagagctggccact atctcctgcagggccagtcagagtctcctgcgcagtgatggaaaatcctatttgaattgg tacctgcagaagccaggccagactcctcggccgctgatttatgaggcttccaagcgtttc tctggggtctcagacaggttcagtggcagcgggtcagggacagatttcacccttaaaatc agcagggtggaggctgaggatgttggagtttattactgccagcaaagtctacattttcct cc SEQIDNO.115IGKV2S18(P) >IGKV2S18*01|Canislupusfamiliaris_boxer|P|V-REGION| gatatcgtcatgacacagaccccactgtccgtgtctgtcagccctggagagacggcctcc atctcctgcagggccagtcagagcctcctgcacagtgatggaaacacctatttggattgg tacctgcagaagccaggccagattccaaaggacctgatctatagggtgtccaactgcttc actggggtgtcagacaggttcagtggcagcgggtcagggacagatttcaccctgagaatc agcagagtggaggctgacaacgctggagtttattactgcatgcaaggtatacaagatcct cc SEQIDNO.116IGKV2S19(F) >IGKV2S19*01|Canislupusfamiliaris_boxer|F|V-REGION| gatatcgtcatgacacagactccactgtccctgtctgtcagccctggagagacggcctcc atctcctgcagggccaatcagagcctcctgcacagtaatgggaacacctatttggattgg tacatgcagaagccaggccagtctccacagggcctgatctatagggtgtccaaccacttc actggcgtgtcagacaggttcagtggcagcgggtcagggacagatttcaccctgaagatc agcagagtggaggctgacgatgctggagtttattactgcgggcaaggtacacactctcct cc SEQIDNO.117IGKV3-3(P) >IGKV3-3*01|Canislupusfamiliaris_boxer|P|V-REGION| gaaatagtcttgacctagtctccagcctccctggctatttcccaaggggacagagtcaac catcacctatgggaccagcaccagtaaaagctccagcaacttaacctggtaccaacagaa ctctggagcttcttctaagctccttgtttacagcacagcaagcctggcttctgggatccc agctggcttcattggcagtggatgtgggaactcttcctctctcacaatcaatggcatgga ggctgaaggtgctgcctactattactaccagcagtagggtagctatctgct SEQIDNO.118IGKV3S1(F) >IGKV3S1*01|Canislupusfamiliaris_boxer|F|V-REGION| gaaatcgtgatgacacagtctccagcctccctctccttgtctcaggaggaaaaagtcacc atcacctgccgggccagtcagagtgttagcagctacttagcctggtaccagcaaaaacct gggcaggctcccaagctcctcatctatggtacatccaacagggccactggtgtcccatcc cggttcagtggcagtgggtctgggacagacttcagcttcaccatcagcagcctggagcct gaagatgttgcagtttattactgtcagcagtataatagcggatata SEQIDNO.119IGKV3S2(P) >IGKV3S2*01|Canislupusfamiliaris_boxer|P|V-REGION| gagattgtgccaacctagtctctagccttctaagactccagaagaaaaagtcaccatcag ctgctgggcagtcagagtgttagcagctacttagcctggtaccagcaaaaacctggacag gctcccaggctcttcatctatggtgcatccaacagggccactggtgtcccagtccgcttc agcggcagtgggtgtgggacagatttcaccctcatcagcagcagtctggagtcagtctga agatgttgcaacatattactgccagcagtataatagctacccacc SEQIDNO.120IGKV4S1(F) >IGKV4S1*01|Canislupusfamiliaris_boxer|F|V-REGION| gaaatcgtgatgacccagtctccaggctctctggctgggtctgcaggagagagcgtctcc atcaactgcaagtccagccagagtcttctgtacagcttcaaccagaagaactacttagcc tggtaccagcagaaaccaggagagcgtcctaagctgctcatctacttagcctccagctgg gcatctggggtccctgcccgattcagcagcagtggatctgggacagatttcaccctcacc atcaacaacctccaggctgaagatgtgggggattattactgtcagcagcattatagttct cctcc SEQIDNO.121IGKV4-1(ORF) >IGKV4-1*01|Canislupusfamiliaris_boxer|ORF|V-REGION| gacatcacgatgactcagtgtccaggctccctggctgtgtctccaggtcagcaggtcacc acgaactgcagggccagtcaaagcgttagtggctacttagcctggtacctgcagaaacca ggacagcgtcctaagctgctcatctacttagcctccagctgggcatctggggtccctgcc cgattcagcagcagtggatctgggacagatttcaccctcaccgtcaacaacctcgaggct gaagatgtgagggattattactgtcagcagcattatagttctcctct SEQIDNO.122IGKV7-2(P) >IGKV7-2*01|Canislupusfamiliaris_boxer|P|V-REGION| gacattatgctgacccagtctccagcctccttgaccatgtgtctccaggagagagggcca ccatctcttgcagggccagtcagaaagccagtgatatttggggcattacccaccatatta ccttgtaccaacagaaatcagaacagcatcctaaagtcctgattaatgaagcctccagtt gggtctggggtcctaggcaggttcagtggctgtgggtctgggactgatttcagcctcaca attgatcctgtggaggctggcgatgctgtcaactattactgccagcagagtaaggagtct cctcc SEQIDNO.123IGKV(II)-1(P) >IGKV(II)-1*01|Canislupusfamiliaris_boxer|P|V-REGION| gaaattgcagattgtcaaatggataataccaggatgcggtctctagcctccctgactccc aggggagagaaccatcattacccataaaataaatcctgatgacataataagtttgcttgg tatcaatagaaaccaggtgagattcctcgagtcctggtatacgacacttccatccttaca ggtcccaaactggttcagtggcagtgtctccaagtcagatcttactctcatcatcagcaa tgtgggcacacctgatgctgctacttattactgttatgagcattcagga GermlineJsequences SEQIDNO.124IGKJ1(F) >GKJ1*01|Canislupusfamiliaris_boxer|F|-REGION| gtggacgttcggagcaggaaccaaggtggagctcaaac SEQIDNO.125IGKJ2(ORF) >IGKJ2*01|Canislupusfamiliaris_boxer|ORF|J-REGION| tttatactttcagccagggaaccaagctggagataaaac SEQIDNO.126IGKJ3(F) >IGKJ3*01|Canislupusfamiliaris_boxer|F|J-REGION| gttcacttttggccaagggaccaaactggagatcaaac SEQIDNO.127IGKJ4(F) >IGKJ4*01|Canislupusfamiliaris_boxer|F|J-REGION| gcttacgttcggccaagggaccaaggtggagatcaaac SEQIDNO.128IGKJ5(F) >IGKJ5*01|Canislupusfamiliaris_boxer|F|J-REGION| gatcacctttggcaaagggacacatctggagattaaac
TABLE-US-00003 TABLE3 CanineIgSequenceInformation GermlineV.sub.sequences SEQIDNO.129IGLV1-35(P) >IGLV1-35*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagctggcctcggtgtctggggccctgggccacagggtcagcatc tcctggactggaagcagctccaacataagggttgattatcctttgagctgataccaacag ctcccagaatgaagaacgaacccaaactcctcatctatggtaacagcaattggctctcag gggttccagatccattctctagaggctccaagtctggcacctcaggctccctgaccaact ctggcctccaggctgaggacgaggctgattgttactgcgcagcgtgggacatggatctca gtgctc SEQIDNO.130IGLV1-37(ORF) >IGLV1-37*01|Canislupusfamiliaris_boxer|ORF|V-REGION| caatctgtgctgactcagctggcctcagtgtctgggtccttgggccagagggtcaccatc tcctgctctggaagcacaaatgacattggtattattggtgtgaactggtaccagcagctc ccagggaaggcccctaaactcctcatatacgataatgagaagcgaccctcaggtatcccc gatcgattctctggctccaagtctggcaactcaggcaccctgaccatcactgggctccag gctgaggacgaggctgattattactgccagtccatggatttcagcctcggtggt SEQIDNO.131IGLV1-41(ORF) >IGLV1-41*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagtctgtgctgactcagccagcctccgtgtctgggtccctgggccagagggtcaccatt tcctgcactggaagcagctccaacgttggttatagcagtagtgtgggctggtaccagcag ttcccaggaacaggccccagaaccatcatctattatgatagtagccgaccctcgggggtc cccgatcgattctctggctccaagtctggcagcacagccaccctgaccatctctgggctc caggctgaggatgaggctgattattactgctcatcttgggacaacagtctcaaagctcc SEQIDNO.132IGLV1-44(F) >IGLV1-44*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgaatcagccggcctcagtgtctggggccctgggccagaaggtcaccatc tcctgctctggaagcacaaatgacattgatatatttggtgtgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtggacagtgatggggatcgaccctcaggggtccct gacagattttctggctccagctctggcaactcaggcaccctgaccatcactgggctccag gctgaggacgaggctgattattactgtcagtctgttgattccacgcttggtgctca SEQIDNO.133IGLV1-45(P) >IGLV1-45*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtactgactcaatcagcctcagcgtctgggtccttgggccagagggtctccgtc tcctgctctagcagcacaaacaacattggtattattggtgtgaagtggtaccagcagatc ccaagaaaggcccctaaactcctcatatatgataatgagaagagaccctcaggtgtcccc aattgattctctggctccaagtctggcaacttaggcaccctaaccatcaatgggcttcag gctgagggcgaggctgattattactgccagtccatggatttcagcctcggtggt SEQIDNO.134IGLV1-46(F) >IGLV1-46*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcaaccagcctcagtgtccgggtctctgggccagagggtcaccatc tcctgcactggaagcagctccaacattggtagagattatgtgggctggtaccaacagctc ccgggaacacgccccagaaccctcatctatggtaatagtaaccgaccctcgggggtcccc gatcgattctctggctccaagtcaggcagcacagccaccctgaccatctctgggctccag gctgaggacgaggctgattattactgctctacatgggacaacagtctcactgttcc SEQIDNO.135IGLV1-48(F) >IGLV1-48*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctatgctgactcagccagcctcagtgtctgggtccctgggccagaaggtcaccatc tcctgcactggaagcagctccaacatcggtggtaattatgtgggctggtaccaacagctc ccaggaataggccctagaaccgtcatctatggtaataattaccgaccttcaggggtcccc gatcgattctctggctccaagtcaggcagttcagccaccctgaccatctctgggctccag gctgaggacgaggctgagtattactgctcatcatgggatgatagtctcagaggtca SEQIDNO.136IGLV1-49(F) >IGLV1-49*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgactcagccgccctcagtgtctgcggtcctgggacagagggtcaccatc tcctgcactggaagcagcaccaacattggcagtggttatgatgtacaatggtaccagcag ctcccaggaaagtcccctaaaactatcatctatggtaatagcaatcgaccctcaggggtc ccggatcgcttctctggctccaagtcaggcagcacagcctctctgaccatcactgggctc caggctgaggacgaggctgattattactgccagtcctctgatgacaacctcgatgatca SEQIDNO.137IGLV1-50(P) >IGLV1-50*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccggcctca...gtgtccgggtctctgggccagagagtcacc atctcctgcactggaagcagctccaacatc..................gatagaaaatat gttggctggtaccaacagctc...ccgggaacaggccccagaaccgtcatctatgataat .....................agtaaccgaccctcgggggtccct...gatcgattctct ggctccaag......tcaggcagcacagccaccctgaccatctctgggctccaggctgag gacgaggctgat...tattactgctcaacatacgacagcagtctcagtagtgg SEQIDNO.138IGLV1-52(P) >IGLV1-52*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcagtagatataatgtgaactggtaccaacagctc ctgggaacaggccccagaaccctcatctatggtagtagtaaccgaccctcgggggtcccc gattgattctctggctccaagtcaggcagcccagctaccctgaccatctctgggctccag gctgaggatgaggctgattattactgctcaacatacgacaggggtctcagtgctcg SEQIDNO.139IGLV1-54(P) >IGLV1-54*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgactcagccgccctcagggtctgggggcctgggccagaggttcagcatc tcctgttctggaagcacaaacaacatcagtgattattatgtgaactggtactaacagctc ccagggacagcccctaaaaccattatctatttggatgataccagaccccctggggtcccg gattgattctctgtctccaagtctagcagctcagctaccctgaccatctctgggctccag gctgaggatgaagctgattattactgctcatcctggggtgatagtctcaatgctcc SEQIDNO.140IGLV1-55(F) >IGLV1-55*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagaggatcaccatc tcctgcactggaagcagctccaacattggaggtaataatgtgggttggtaccagcagctc ccaggaagaggccccagaactgtcatctatagtacaaatagtcgaccctcgggggtgccc gatcgattctctggctccaagtctggcagcacagccaccctgaccatctctgggctccag gctgaggatgaggctgattattactgctcaacgtgggatgatagtctcagtgctcc SEQIDNO.141IGLV1-56(ORF) >IGLV1-56*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cggtctgtgctgactcagccgccctcagtgtcgggatctgtgggccagagaatcaccatc tcccgctctggaagcacaaacagcattggtatacttggtgtgaactggtaccaagagctc ccaggaaaggcccctaaactcctcgtagatggtactgggaatagaccctcaggggtccct gaccgattttctggctccaaatctggcaactcaggcactctgaccatcactgggcttcag cctgaggacgaggctgattattattgtcagtccattgaacccatgcttggtgctcc SEQIDNO.142IGLV1-57(F) >IGLV1-57*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgactccgctgccctcagtgtctgcggccctgggacagacggtcaccatc tcttgtactggaaatagcacccaaatcagcagtggttatgctgtacaatggtaccagcag ctcccaggaaagtcccctgaaactatcatctatggtgatagcaatcgaccctcgggggtc ccagatcgattctctggcttcagctctggcaattcagccacactggccatcactgggctc caggatgaggacgaggctgattattactgccagtccttagatgacaacctcaatggtca SEQIDNO.143IGLV1-58(F) >IGLV1-58*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagatatagtgttggctggttccagcagctc ccgggaaaaggccccagaaccgtcatctatagtagtagtaaccgaccctcaggggtccct gatcgattctctggctccaagtcaggcagcacagccaccctgaccatctctgggctccag gctgaggacgaggctgattattactgctcaacatacgacagcagtctcagtagtag SEQIDNO.144IGLV1-61(P) >IGLV1-61*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgacatagccaccctcagtgtctggggccctgggccagagggtcaccatc tcctgcactggaagcagctcaagcatgggtagttattatgtgagctggcacaagcagctc ccaggaacaggccccagaaccatcatgtgttgtaaaaacatcgaccttcgggaatctcca atcaagtctctggctcccattctggcaacacagccaccctgaccatcactgggctcctgg ctgaggatgaggctgattattactgttcaacatgggatgacaatctcaatgcacc SEQIDNO.145IGLV1-63(P) >IGLV1-63*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagctgccctcagtgtctggggccctgggccagagggtcaccatc tcctgctctggaagcagctctaaacttggggcttatgctctgaactagaaccaacaattc ccaggaacagattccaatttcctcatctatgatgatagtaattgatctttctggatgcct gattaattctgtggctccacatccagcagttcaggctccctgaccatcactgggctctgg gatgaggacaaggctgattattactgccagtgccattaccatagcctccgtgct SEQIDNO.146IGLV1-65(P) >IGLV1-65*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccagcctcagtgtctggatccctgggccaaagggtcaccatc tcctgcactggaagcacaaacaacatcggtggtgataattatgtgcactggtaccaacag ctcccaggaaaggcacccagtctcctcatctatggtgatgataacagagaatctggggtc ccggaacgattctctggctccaagtcaggcagctcagccactctgaccatcactgggctc catgctgaggacgaggctgatattattgccagtcctacgatgacagcctcaatactca SEQIDNO.147IGLV1-66(F) >IGLV1-66*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccgccctcagtgtcaggatctgtgggccagagaatcaccatc tcctgctctggaagcacaaacagcattggtatacttggtgtgaactggtaccaactgctc tcaggaaaggcccctaaactcctcgtagatggtactggaaatcgaccctcaggggtccct gaccgattttctggctccaaatctggcaactcaggcactctgaccatcactgggcttcag cctgaggacgaggctgattattattgtcagtccattgaacccatgcttggtgctcc SEQIDNO.148IGLV1-67(F) >IGLV1-67*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtcctgactcagccggcctcagtgtctggggttctgggccagagggtcaccatc tcctgcactggaagcagctccaacattggtggaaattatgtgagctggcaccagcaggtc ccagaaacaggccccagaaacatcatctatgctgataactaccgagcctcgggggtccct gatcgattctctggctccaagtcaggcagcacagccaccctgaccatctctgtgctccag gctgaggatgaggctgattattactgctcagtgggggatgatagtctcaaagcacc SEQIDNO.149IGLV1-68(P) >IGLV1-68*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtccatcctgactcagcagccctcagtctctgggtcactgggccagagggtcaccatc tcttgcactggattccctagcaacaatgattatgatgcaatgaaaattcatacttaagtg ggctggtaccaacagtccccaggaaagtcacccagtctcctcatttatgatgaaaccaga aactctggggtccctgatcgattctctggctccagaactggtagctcagcctccctgccc atctctggactccaggctgaggacaagactgagtattactgctcagcatgggatgatcgt cttgatgctca SEQIDNO.150IGLV1-69(P) >IGLV1-69*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctaactcagccaccctcagtgtcggggtcgctgggccagagggtcaccatc tcctgctctggaagcacaaacaacatcagtattgttggtgcgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtggacagtgatggggatcgaccgtcaggggtccct gaccgattttctggctctaagtctggcaaatcagccaccctgaccatcactgggcttcag gctgaggacgaggctgattattactgtatattggtcccacgctttgtgctca SEQIDNO.151IGLV1-69-1(P) >IGLV1-69-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccactgttagggcctggggccctgggcagagggtcaccctct cctgacctggaagagtcccagtattggtgattatggtatgaaatggtacaagcagcttgc aaggacagaccccagactcgtcatctatggcaatagcaattgatcctcgggtccccaatc aattttctggctctggttttggcatcactggctccttgaccacctctgggctccagactg aaaaataggctgattactagtgcttctccagtgatccaggcctgt SEQIDNO.152IGLV1-70(F) >IGLV1-70*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcaaccggcctccgtgtctgggtccctgggccagagagtcaccatc tcttgcactagaagcagctcgaacgttggctatggcaatgatgtgggatggtaccagcag ctcccaggaacaggccccagaaccatcatctataataccaatactcgaccctctggggtt cctgatcgattctctggctccaaatcaggcagcacagccaccctgaccatctctggactc caggctgaggacgaggctgattattactgctcttcctatgacagcagtctcaatgctca SEQIDNO.153IGLV1-72(ORF) >IGLV1-72*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagtctgtgctaactcagccggcctcagtgtctggttccctgggtcagagggtcaccatc tgcactggaagcagctccaacattggtacatatagtgtaggctggtaccaacagctccca ggatcaggccccagaaccatcatctatggtagtagtaaccgaccgttgggggtccctgat cgattctctggctccaggtcaggcagcacagccaccctgaccatctctgggctccaggct gaggacgaagctgattattactgcttcacatacgacagtagtctcaaagctcc SEQIDNO.154IGLV1-73(F) >IGLV1-73*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgaatcagccaccttcagtgtctggatccctgggccagagaatcaccatc tcctgctctggaagcacgaatgacatcggtatgcttggtgtgaactggtaccaacagctc ccaggaaatgcccctaaactccttgtagatggtactgggaatcgaccctcaggggtccct gaccaattttctggctccaaatctggcaattcaggcactctgaccatcactgggctccag gctgaggacgaggctgattattattgtcagtcctatgatctcacgcttggtgctcc SEQIDNO.155IGLV1-74(P) >IGLV1-74*01|Canislupusfamiliaris_boxer|P|V-REGION|| cagtccatgatgactcagccaccctcagtgtctgggtcactgggccagagggtcaccatc tactgcactggaatccctagcaacactgattatagtggattggaaatttatacttatgtg agctggtaccaacagtataaggaaaggcacccagtctcctcatctatggggatgataccg gaaactctgaggtccctgatcaattctctggctccaggtctggtagctcaacctccctga ccatctctggactccaggctgaggatagtcttaatgctca SEQIDNO.156IGLV1-75(F) >IGLV1-75*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgactgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtggatataatgttggctggttccagcagctc ccgggaacaggccccagaaccgtcatctatagtagtagtaaccgaccctcgggggtcccg gatcgattctctggctccaggtcaggcagcacagccaccctgaccatctctgggctccag gctgaggacgaggctgagtattactgctcaacatgggacagcagtctcaaagctcc SEQIDNO.157IGLV1-78(P) >IGLV1-78*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccggcctcagtgtccaggtccctgggccagatagtcaccatc tcttgcgctggaagcagctccaacatccgtacaaaatatgtgggctggtactaacagctc ccgagaacaggccccagaaccgtcatctatggtaatagtaactgaccctcgggggtcctc gatcaattctctggctccaagtcaggcagcatagccaccctgaccatctctgtgctccag gctgaggacgaggcttattattactgctcaacatatgacagcagtctcagtgctct SEQIDNO.158IGLV1-79(P) >IGLV1-79*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccggcctctgtgtctggggccctgggccagaggtcaccatct cctgcactaggagcagctccaatgttggttatagcagttatgtgggctggtaccagcagc tcccaggaacaggccccaaaaccatcatctataataccaatactcgaccctctggggttc ctgatcgattctctggctccaaatcaggcagcacagccacccttaccattgctggactcc aggctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaagctcc SEQIDNO.159IGLV1-79-1(P) >IGLV1-79-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctatgctgactcaccctggccagaggatcaccctctcctgacctggaagagtccca gtattggtgattatggtgtgaaatggtacaggcagctagcaagaacagaccccagactcc tcatttatagcaatagcaatcgatccttgagtccccaatcaattttccgcctctggtttt gacattactggctccttgaccacctccaggctccagactgaaaaataggctgattactag tgcttatacagtgatccaggcttgtggggctg SEQIDNO.160IGLV1-80(F) >IGLV1-80*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccgacctcagtgtcgtggtccctgggccagagggtcacaatc tcatgctctagaagcacgaataacatcggtattgtcggggcgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtggacagtgatggggatcaactgtcaggggtccct gaccgattttctggctccaagtctggcaactcagccaacctgaccatcactgggctccag gctgaggacaaggctgattattactgccagtcctttgatcacacgcttggtgctcg SEQIDNO.161IGLV1-81(P) >IGLV1-81*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgttgagtcagccagcctcagtgtctggggttctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtggaaattacgtgagctggcaccagcaggtc ccagaaacaggccccagaaacatcatctatgctgataactactgagcctcgggggtccct gatggattctctggctccaagtaaggcagcacagccaccccgaccatctctgtgctccag gctgaggatgaggctgattattactgctcagtgggggataatagtctcaaagcacc SEQIDNO.162IGLV1-82(F) >IGLV1-82*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccagcctcagtgtcggggtccctgggccagagagtcaccatc tcctgctctggaaggacaaacatcggtaggtttggtgctagctggtaccaacagctccca ggaaaggcccctaaactcctcgtggacagtgatggggatcgaccgtcaggggtccctgac cgattttccggctccaagtctggcaactcggccactctgaccatcactggtctccatgct gaggacgaggctgattattactgtctgtctattggtcccacgcttggtgctca SEQIDNO.163IGLV1-82-1(P) >IGLV1-82-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccactgttagggcctggggccctggccagaggctcactctct cctgccctggaagagtcccagtattggtgattatgatgtgaagtggtacaggcagctcac aagaacagaccctagactcctcatccatggtgatagcaattgatcctcgggtccccaatc acttttctggctctgtttttggcatcactggctgcttgaccacctctgggctccagactg aaaaataggctgattactagtgcttatccagtgatccag SEQIDNO.164IGLV1-83(P) >IGLV1-83*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccggcctctgtgtctggggccctgggccagaggtcaccatct cctgcactaggagcagctccaatgttggttatagcagttatgtgggctggtaccagcagc tcccaggaacaggccccaaaaccatcatctataataccaatactcgaccctctggggtcc ctgatcgattctctggctccaaatcaggcaggacagccacccttaccattgctggactcc aggctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaagctcc SEQIDNO.165IGLV1-84(F) >IGLV1-84*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaatgttggttatggcaattatgtgggctggtaccagcag ctcccaggaacaggccccagaaccctcatctatggtagtagttaccgaccctcgggggtc cctgatcgattctctggctccagttcaggcagctcagccacactgaccatctctgggctc caggctgaggatgaagctgattattactgctcatcctatgacagcagtctcagtggtgg SEQIDNO.166IGLV1-84-1(ORF) >IGLV1-84-1*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagtctgtgctgactcagccagcctcagcgtctgggtccttgggccagagggtcactgtc tcctgctctagcagcacaaacaacatcggtattattggtgtgaagtggtaccagcagatc ccaggaaaggcccataaactcctcatatatgataatgagaagcgaccctcaggtgtcccc aatcgattctctggctccaagtctggcgacttaagcaccctgaccatcaatgggcttcag ggtgaggacgaggctgattattattgccagtccatggatttcagcctcggtggtca SEQIDNO.167IGLV1-86(ORF) >IGLV1-86*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagtctgtgctgactcagccagcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaatccccagcaacacagattttgatggaatagaatttgatacttctgtg agctggtaccaacagctcccagaaaagccccctaaaaccatcatctatggtagtactctt tcattctcgggggtccccgatcgattctctggctccaggtctggcagcacagccaccctg accatctctgggctccaggctgaggacgaggctgattattactgctcatcctgggatgat agtctcaaatcata SEQIDNO.168IGLV1-87(F) >IGLV1-87*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccagcctcagtgtctggatccctgggccaaagggtcaccatc tcctgcactggaagcacaaacaacatcggtggtgataattatgtgcactggtaccaacag ctcccaggaaaggcacccagtctcctcatctatggtgatgataacagagaatctggggtc cctgaacgattctctggctccaagtcaggcagctcagccactctgaccatcactgggctc caggctgaggacgaggctgattattattgccagtcctacgatgacagcctcaatactca SEQIDNO.169IGLV1-88(P) >IGLV1-88*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccgccctcagtgtcgggatctgtgggccagagaatcaccatc tcctgctctggaagcacaaacagctaccaacagctctcaggaaaggcctctaaactcctc gtagatggtactgggaaccgaccctcaggggtccccgaccgattttctggctccaaatct ggcaactcaggcactctgaccatcactgggcttgggacgaggctgaggacgaggctgagg acgaggctgattattattgttagtccactgatctcacgcttggtgctcc SEQIDNO.170IGLV1-88-2(P) >IGLV1-88-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caggccgccctgggcaatgagttcgtgcaggtcaaggctgagacagacctgcagaattca ggtttgtctgagacacagctcatcagatgtgtgcagtgtgtgtcctggtaccaacggctc ccatgaatgggtcctaaatccttatctagaaataacatttagatcactttgtggcccgga tccattctctggctccatgtctggcaactctggcctcatgaacatcactgggctatggtc tgaagatggagctgctcttcacaggccctcttgggacaaaattcttggggct SEQIDNO.171IGLV1-88-3(P) >IGLV1-88-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtccatcctgactcagccgccctcagtctctgggtcactgggccagagggtcaccatc tcctgcaatggaatccctgacagcaatgattatgatgcatgaaaattcatacttacgtga gctggtaccaacagttcccaagaaagtcaccagtctcctcatctacgatgataccagaaa ctctggggaccctgatcaattctctggctccagatctggtaactcagcctccctgcccat ctctggactccaggctgaggacgaggctgagtattactgctcagcatgggatgatcgtct tgatgctca SEQIDNO.172IGLV1-89(P) >IGLV1-89*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtactgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtggatattatgtgagctggctctagcagctc ccgggaacaggccccagaaccatcatctatagtagtagtaaccgaccttcaggggtccct gatcgattctctggctccaggtcaggcagcacagccaccctgaccatctctgggctccag gctgaggatgaggctgattattactgttcaacatacgacagcagtctcaaagctcc SEQIDNO.173IGLV1-89-2(P) >IGLV1-89-2*01|Canislupusfamiliaris_boxer|P|V-REGION| cttcctgtgctgacccagccaccctcaaggtctgggggtctggttcagaagatcaccatc ttctgttctggaagcacaaacaacatgggtgataattatgttaactggtacaaacagctt ccaggaacggcccctaaaaccatcatctaagtggatcatatcagaccctcaggggtcctg gagagattctctgtctccaattctggcagctcagccaacctgaccatctctgggctccag gatgaggactaggctgattattattgctcatcctggcatgatagtctcagtgctcc SEQIDNO.174IGLV1-91(P) >IGLV1-91*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgctgactcagctgccctcagtgtctgcagccctgggacagagggtcaccatc tgcactggaagcagcaccaacatcggcagtggttattatacactatggtaccagcagctg caggaaagtcccctaaaactatcatctatggtaatagcaatcgacccttgagggtcccgg atcgattctctggctccaagtatggcaattcagccacgctgaccatcactgggctccagg ctgaggacgaggatgattattactgccagtcctctgatgacaacctcgatggtca SEQIDNO.175IGLV1-92(F) >IGLV1-92*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcggtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaatgttggttatggcaattatgtgggctggtaccagcag cttccaggaacaggccccagaaccattatctgttataccaatactcgaccctctggggtt cctgatcgatactctggctccaagtcaggcagcacagccaccctgaccatctctgggctc caggctgaagacgagactgattattactgtactacgtgtgacagcagtctcaatgctag SEQIDNO.176IGLV1-94(F) >IGLV1-94*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagcctccctcagtgtccgggttcctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagaggttatgtgcactggtaccaacagctc ccaggaacaggccccagaaccctcatctatggtattagtaaccgaccctcaggggtcccc gatcgattctctggctccaggtcaggcagcacagccactctgacaatctctgggctccag gctgaggatgaggctgattattactgctcatcctgggacagcagtctcagtgctct SEQIDNO.177IGLV1-95-1(P) >IGLV1-95-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccactgttagggcctgggttcctggccagagggtcaccctct cctgccctggaagagtctcagttttggtgattatggtgtgaaacggtacaggaagctcgc atggacagaccccagactcctcatctatggcaatagcaattgattctcgggtccccagtc tattttctggctctggttttggcatcactggctccttgaccacctccgggctccagactg aaaaataggctgatttctagtgcttctccagtgatccaggccttt SEQIDNO.178IGLV1-96(F) >IGLV1-96*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgcgctgactcaaacggcctccatgtctgggtctctgggccagagggtcaccgtc tcctgcactggaagcagttccaacgttggttatagaagttatgtgggctggtaccagcag ctcccaggaacaggccccagaaccatcatctataataccaatactcgaccctctggggtt cctgatcgattctctggctccatatcaggcagcacagccaccctgactattgctggactc caggctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaagctcc SEQIDNO.179IGLV1-97(P) >IGLV1-97*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgaatcagctgccttcagtgttaggatccctgggccagagaatcaccatc tcctgctctggaagcacgaatgacatcggtatgcttggtgtgaactggtaccaagagccg ccaggaaaggcccctaaactcctcgtagatggtactgggaatcgaccctcagggtccctg ccgattttctggctccaaatctggcaactcaggcactctgaccatcactgggctccaggc tgaggacgaggctgattattattgtcagtccactgatctcacgcttggtgctcc SEQIDNO.180IGLV1-97-4(F) >IGLV1-97-4*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagcctccctcagtgttcaggtccctgggccagagggtcactata tcctgcactggaagcagctccaacgtcggtagaggttatgtgatctggtaccaacagctc ctgggaacacgcccaagaaccctcatatatggtagtagtaaccaaccctcaggggtcccc aatcaattctctggctccaggtcaggcagcacagacactctgacaatctctgggttccag gctgaggatgaggctgattattactgctcatcctgggacagcagtctcagtgctct SEQIDNO.181IGLV1-98(P) >IGLV1-98*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccagtctcagtgtctggggccctgtgccagagggtcaccatc tcctgcactggaaacagctccaacattggttatagcagttgtgtgagctgatatcagcag ctcccaggaacaggccccagaaccatcatctatagtatgaatactcaaccctctggggtt cctgatcgattctctggctccaggtcaggcaactcagccaccctaaccatctctgggctc caggctgaggacaaggctgactattactgctcaacatatgacagcagtctcagtgctca SEQIDNO.182IGLV1-100(F) >IGLV1-100*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccgacctcagtgtcggggtcccttggccagagggtcaccatc tcctgctctggaagcacgaacaacatcggtattgttggtgcgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtggacagtgatggggatcgaccgtcaggggtccct gaccggttttccggctccaagtctggcaactcagccaccctgaccatcactgggcttcag gctgaggacgaggctgattattactgccagtcctttgataccacgcttgatgctca SEQIDNO.183IGLV1-100-1(P) >IGLV1-100-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtactgactcagcagccgttagtgcttggggccctggccagagggtcagcttct cctgccttggaagagtcccagtattggtaattatggtgtgaaatggtacaagcagctcaa aaggacagaccccagacttctcatctatggcaatagcaattgatcctcgggtccccaatc aattttctggctctggttttggcatcactggctccttgaccacctatgggctccagactg aaaaataggctgattactagtgcttttccagtgatccagtcctgaggggc SEQIDNO.184IGLV1-101(P) >IGLV1-101*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccggcctccgtgtctggggccttgggccagagggtcaccatc tcctgcactggaagcagctccaatgttggttatagcagctatgtgggcttgtaccagcag ctcccaggaacaggcctcaaaaccatcatctataataccaatactcgaccctctggggtt cctgatcaattctctggctccaaatcaggcagcacagccacctgaccattgctggacttc aggctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaagctcc SEQIDNO.185IGLV1-103(F) >IGLV1-103*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgactcagccaccctctgtgtctgcagccctggggcagagggtcaccatc tcctgcactggaagtaacaccaacatcggcagtggttatgatgtacaatggtaccagcag ctcccaggaaagtcccctaaaactatcatttatggtaatagcaatcgaccctcgggggtc ccggttcgattctctggctccaagtcaggcagcacagccaccctgaccatcactgggatc caggctgaggatgaggctgattattactgccagtcctatgatgacaacctcgatggtca SEQIDNO.186IGLV1-104(P) >IGLV1-104*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccagcttcagtgtctgggtccctgggccagaggatcaccatc tcctgcactaaaagcagctccaacatcggtaggtattatgtgagctgacaacagctccca ggaacaggccccagaaccgtcatctatgataataataactgaccctcgggggtccctgat caattttctggctctaaatcaggcagcacagccaccctgaccatctctaggctccaggct gaggacgatgctgattattactgctcgccatatgccagcagtctcagtgctgg SEQIDNO.187IGLV1-106(F) >IGLV1-106*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgttgactcaaccggcctcagtgtctgggtccctgggccagagggtcatcatc tcctgcactggaagcagctccagcattggcagaggttatgtgggctggtaccaacagctc ccaggaacaggccccagaaccctcatctatggtattagtaacctacccccgggagtcccc aatagattctctggttcgaggtcaggcagcacagccaccctgaccatcgctgagctccag gctgaggacgaggctgattattactgctcatcgtgggacagaagtctcagtgctcc SEQIDNO.188IGLV1-107(P) >IGLV1-107*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgctgactcagcccgccctcagtgtctgcggccttgggacagagggtcaccat ctcctgcactggaagcagcaccaacatcagcagtggttacgttgtacaatggtaccagca gctcccaggaaagtcccctaaaacaatctatggtactagcaagtgacccttggggatccc ggttcaattctctggctccaagtcaggcagcacagccaccctgaccatcactggtatcta ggctgaggacgaggctgattattactgccaatcctatgatgacaacctcgatggtca SEQIDNO.189IGLV1-110(P) >IGLV1-110*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtacggaatcaaccgccctcagagtctgcagccctgggacagagagtcaccatc tcctgcacgggaagcagatccaacattggcagtggttatgctgtacaatggtaccaacgg ctcacaggaaagtctccttaaaactatcatctatggtaatagcaatcaaccctcgggggt cctggatcaattctctggctccaagtgaggcagcacagccaccctgaccatcactgggat ccagtctgaggacgaggctgattattactgccagtcctatgatagaagtctctgtgctca SEQIDNO.190IGLV1-111(ORF) >IGLV1-111*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggcctgagggtcaccatc tgctgcactggaagcagctccaacatcagtagttattatgtgggctggtaccaaccactc gcgggaacaggccccagaactgtcatctatgataatagtaaccgtccctcgggggtccct gatcaattctctggctccaagtcaggcagcacagccaccctgaccatctctcggctccag gctgaggacgaggctgattattacggctcatcatatgacagcagtctcaatgctgg SEQIDNO.191IGLV1-112(P) >IGLV1-112*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccagcctcagtgtctcagtccctgggtcagagggtcaccatc tcctgtactggaagcagctccaatgttggttataacagttatgtgagctggtaccagcag ctcccaggaacagtccccagaaccatcatctattataccaatactcgaccctatggggtt cctgatcgattctctggctccaaatcaggcaactcagccaccctgaccattgctggactc caggctgaggacgaggctgattattattgctcaacatatgacagcagtctcagtggtgc SEQIDNO.192IGLV1-113(P) >IGLV1-113-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgaatcagacgccctcagtgtcggggtccctgggccagagagtcgccatc tcctgctctggaagcacaaacatcagtaggtttggtgcgagctggtaacaacagctcctg ggaaaggcttcaaaactcctcctagacagtgatggggatcaaccatcagtggtccctgac tgattttccggctccaagtctggcaactcaggtgccctgaccatcactgggctccaggct gaggacgaggctgattattactgccagtcctttgatcccacacttggtgctca SEQIDNO.193IGLV1-114(P) >IGLV1-114*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctttgctgactcagccaccctcagtgtctgaggccctgggacagagggtcaccatc tcctgcactggaagcagcaccaacatcggcagtggttatgatgtacaatggtaccagcag ctcccaggaaagtcccctcaaactatcgtatacggtaatagcaattgaccctcgggggtc ccagatcaattctctggctccaagtctcacaattcagccaccctgaccatcactgggctc cagactgaggacgaggctgattattactgccagtcctctgatgacaacctcga SEQIDNO.194IGLV1-115(P) >IGLV1-115*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccagcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagatatagtgtaggctgataccagcagctc ccgggaacaggccccagaactgtcatctatggtagtagtagccgaccctcgggggtcccc gatcgattctctggctccaagtcaggcagcacagccaccctgaccatctcagggctccag gctgaggacgaggctgattattactgttcaacatacgacagcagtctcaaagctcc SEQIDNO.195IGLV1-116(F) >IGLV1-116*01|Canislupusfamiliaris_boxer|F|V-REGION| cagcctgtgctcactcagccgccctcagtgtctgggttcctgggacagagggtcactatc tcctgcactggaagcagctccaacatccttggtaattctgtgaactggtaccagcagctc acaggaagaggccccagaaccgtcatctattatgataacaaccgaccctctggggtccct gatcaattctctggctccaagtcaggcaactcagccaccctgaccatctctgggctccag gctgaggacgagactgattattactgctcaacgtgggacagcaggctcagagctcc SEQIDNO.196IGLV1-118(P) GLV1-118*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactgaaagcagctccaacatcggtggatattatgtgggctggtaccaacagctc ccaggaacaggccccagaaccatcatctatagtagtagtaaccgaccctcaggggtccct gattgattctctggctccaggtcaggcagcacagccaccctgaccatctctgggctccag gctgaggacgaggctgattattactgctctacatgggacagcagtctcaaagctcc SEQIDNO.197IGLV1-118-2(P) >IGLV1-118-2*01|Canislupusfamiliaris_boxer|P|V-REGION| ctgcctgtgctgacccagccgccctcaaggtctgggggtctggttcagaggttcaccatc ttctgttctggaagcacaaacaacataggtgataattattttaactggtacaaacagctt ccaggaacggcccctaaaaccatcatctaagtggatcatatcagaccctcaggggtcctg gagagattctctgtctccaattctggcagctcagccaacctgaccatctctgggctccag gctgaggactaggctgattattattgctcatcctgggatgatagtctcaatgctcc SEQIDNO.198IGLV1-122(P) >IGLV1-122*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgctgactcagctgccctcagtgtctgcagccctgggacagagggtcaccatc tgcactggaagcagcaccaacatcggcagtggttattatacactatggtaccagtagctg caggaaagtcccctaaaactatcatctatggtaatagcaatcgacccttgagggtcccgg atcgattctctggctccaagtatggcaattcagccacgctgaccatcactgggctccagg ctgaggacgaggatgattattactgccagtcctctgatgacaacctcgatggtca SEQIDNO.199IGLV1-123(P) >IGLV1-123*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggtcagagggtcaccatc tcctgcactggaagcagctccaacatcggtgaatattatgtgagttggctccagcagctc ccgggaacacgccccagaaccgtcatctatagtagtagtaaccgaccctcaggggtccct gatcgattctctggctccaagtcaggtagcatagccaccctatctctgggctccaggctg aagacgaggctgattattactgtactacgtgggacagcagtctcaatgctgg SEQIDNO.200IGLV1-125(F) >IGLV1-125*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtccgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagaggttatgtgggctggtaccaacagctc ccgggaacaggccccagaaccctcatctatggtaatagtaaccgaccctcaggggtcccc gatcggttctctggctccaggtcaggcagcacagccaccctgaccatctctgggctccag gctgaggatgaggctgattattactgctcatcgtgggacagcagtctcagtgctct SEQIDNO.201IGLV1-127(P) >IGLV1-127*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagcctccctcagtgtctgggtccctgggccagaggtcaccgtct cctgcactggaagctgcttcaacattggtagatatagtgtgagctggctccagcagctcc cgggaacaggccccagaaccatcatctattatgatcgtagccgaccctcaggggttcccg atcgattctctggctccaagtcaggcagcacagccaccctgaccatctctgggctccagg ctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaaggtca SEQIDNO.202IGLV1-129(P) >IGLV1-129*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccagtctcagtgtctggggccctgtgccagagggtcaccatc tcctgcactggaagcagctccaacattggttatagcagctgtgtgagctgatatcagcag ctcccaggaacaggccccagaaccatcatctatagtatgaatactctaccctctggggtt cctgatcgattgtctggctccaggtcaggcaactcagccaccctaaccatctctgggctc caggctgaggacaaggctgactattactgctcaacatatgacagcagtctcaatgctca SEQIDNO.203IGLV1-130(P) >IGLV1-130*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgacccagctggcctcagtgtctgggtccctgggccagagggtcaccatc acctgcactggaagcagctccaacattggtagtgattatgtgggctggttccaacagctc ccaggaacaggccctagaaccctcatctaaggcaatagtaaccgaccctcgggggtccct gatcaattctctggctccaagtctggcagtacagccaccctgaccatctctgggctccag gctgaggatgatgctgattattactgcacatcatgggatagcagtctcaaggctcc SEQIDNO.204IGLV1-132(ORF) >IGLV1-132*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagtctgtgctgactcagcctccctcagtgtctgggaccctggggcaaagggtcatcatc tcctgcactggaatccccagcaacataaatttagaagaattgggaatcgctactaaggtg aactggtaccaacagctcccaggaaaggcacccagtctcctcatctatgatgatgatagc agaggttctgggattcctgatcgattctctggctccaagtctggcaactcaggcaccctg accatcactgggctccaggctgaggatgaggctgattattattgccaatcctatgatgaa agccttggtgtt SEQIDNO.205IGLV1-133(P) >IGLV1-133*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagcctccctcagtgttcaggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacgtcggtagaggttatgtgatctggtaccaaagctcc tgggaacacgcccaagaaccctcatatatggtagtagtaaccaaccctcaggggtcccca atcgattctctggctccaggtcaggcagcacagacactctgacaatctctgtgttccagg ctgaggatgaggctgattattactgctcatcctgggacagcagtctcagtgctct SEQIDNO.206IGLV1-135(F) >IGLV1-135*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgaatcagctgccttcagtgttaggatccctgggccagagaatcaccatc tcctgctctggaagcacgaatgacatcggtatgcttggtgtgaactggtaccaagagctc ccaggaaaggcccctaaactcctcgtagatggtactgggaatcgaccctcaggggtccct gaccgattttctggctccaaatctggcaactcaggcactctgaccatcactgggctccag gctgaggacgaggctgattattattgtcagtccactgatctcacgcttggtgctcc SEQIDNO.207IGLV1-136(F) >IGLV1-136*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagaggttatgtgggctggtaccagcagctc ccaggaacaggccccagaaccctcatctatgatagtagtagccgaccctcgggggtccct gatcgattctctggctccaggtcaggcagcacagcaaccctgaccatctctgggctccag gctgaggacgaggctgattattactgctcagcatatgacagcagtctcagtggtgg SEQIDNO.208IGLV1-138(F) >IGLV1-138*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaatgttggttatggcaattatgtgggctggtaccagcag ctcccaggaacaagccccagaaccctcatctatgatagtagtagccgaccctcgggggtc cctgatcgattctctggctccaggtcaggcagcacagcaaccctgaccatctctgggctc caggctgaggatgaagccgattattactgctcatcctatgacagcagtctcagtggtgg SEQIDNO.209IGLV1-139(F) >IGLV1-139*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgactccgctgccctcagtgtctgcggccctgggacagacggtcaccatc tcttgtactggaaatagcacccaaatcagcagtggttatgctgtacaatggtaccagcag ctcccaggaaagtcccctgaaactatcatctatggtgatagcaatcgaccctcgggggtc ccagatcgattctctggcttcagctctggcaattcagccacactggccatcactgggctc caggatgaggacgaggctgattattactgccagtccttagatgacaacctcaatggtca SEQIDNO.210IGLV1-140(P) >IGLV1-140*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccggcctccgtgtctggggacttgggccagagggtcaccatc tcctgcactggaagcagctccaattttggttatagcagctatgtgggcttgtaccagcag ctcccaggaacaggccccagaaccatcatctataataccaatactcgaccctctggggtt cctgatcgattctctggctccaaatcaggcagcacagccacctgaccattgctggacttc aagctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaagctcc SEQIDNO.211IGLV1-140-1(P) >IGLV1-140-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtactgactcagccgccattagtgcttggggccctggccagagggtcaccttct cctgccttggaagagtcccagtattggtgattatggtgtgaaatggtacaagcagctcaa aaggacagaccccagacttctcatctatggcaatagcaattgatcctcgggtccccaatc aattttctggctctggttttggcatcactggctccttgaccacctatgggctccagactg aaaaataggctgattactagtgcttctccggtgatccag SEQIDNO.212IGLV1-141(F) >IGLV1-141*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccgacctcagtgtcggggtcccttggccagagggtcaccatc tcctgctctggaagcacgaacaacatcggtattgttggtgcgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtgtacagtgttggggatcgaccgtcaggggtccct gaccggttttccggctccaactctggcaactcagccaccctgaccatcactgggcttcag gctgaggacgaggctgattattactgccagtcctttgataccacgcttggtgctca SEQIDNO.213IGLV1-143(P) >IGLV1-143*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccagtctcagtgtctggggccctgtgccagagggtcaccatc tcctgcactggaagcagctccaacattggttatagcagctgtgtgagctgatatcagcag ctcccaggaacaggccccagaaccatcatctatagtatgaatactctaccctctggggtt cctgatcgattgtctggctccaggtcaggcaactcagccaccctaaccatctctgggctc caggctgaggacaaggctgactattactgctcaacatatgacagcagtctcaatgctca SEQIDNO.214IGLV1-144(F) >IGLV1-144*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagcctccctcagtgttcaggtccctgggccagagggtcaccatc tcctgcactggaagcagctgcaacgtcggtagaggttatgtgatctggtaccaacagctc ctgggaacacgcccaagaaccctcatatatggtagtagtaaccaaccctcaggggtcccc aatcgattctctggctccaggtcaggcagcacagccactctgacaatctctgggttccag gctgaggatgaggctgattattactgctcatcctgggacagcagtctcagtgctct SEQIDNO.215IGLV1-146(P) >IGLV1-146*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgaatcagctgccttcagtgttaggatccctgggccagagaatcaccatc tcctgctctggaagcacgaatgacatcggtatgcttggtgtgaactggtaccaagagctc ccaggaaaggcccctaaactcctcgtagatggtactgggaatcgaccctcaggggtccct gactgattttctggctccaaatctggcaactcaggcactctgaccatcactgggctccag gctgaggacgaggctgattattattgtcagtccactgatctcacgcttggtgctcc SEQIDNO.216IGLV1-147(F) >IGLV1-147*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagaggttatgtgggctggtaccagcagctc ccaggaacaggccccagaaccctcatctatgataatagtaaccgaccctcgggggtccct gatcgattctctggctccaagtcaggcagcacagccaccctgaccatctctgggctccag gctgaggacgaggctgattattactgctcaacatacgacagcagtctcagtggtgg SEQIDNO.217IGLV1-149(F) >IGLV1-149*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaatgttggttatggcaattatgtgggctggtaccagcag ctcccaggaacaggccccagaaccctcatctatcgtagtagtagccgaccctcgggggtc cctgatcgattctctggctccaggtcaggcagcacagcaaccctgaccatctctgggctc caggctgaggatgaagccgattattactgctcatcctatgacagcagtctcagtggtgg SEQIDNO.218IGLV1-150(F) >IGLV1-150*01|Canislupusfamiliaris_boxer|F|V-REGION| caggctgtgctgactccgctgccctcagtgtctgcggccctgggacagacggtcaccatc tcttgtactggaaatagcacccaaatcggcagtggttatgctgtacaatggtaccagcag ctcccaggaaagtcccctgaaactatcatctatggtgatagcaatcgaccctcgggggtc ccagatcgattctctggcttcagctctggcaattcagccacactggccatcactgggctc caggatgaggacgaggctgattattactgccagtccttagatgacaacctcgatggtca SEQIDNO.219IGLV1-151(F) >IGLV1-151*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgcgctgactcaaacggcctccatgtctgggtctctgggccagagggtcaccgtc tcctgcactggaagcagttccaacgttggttatagaagttatgtgggctggtaccagcag ctcccaggaacaggccccagaaccatcatctataataccaatactcgaccctctggggtt cctgatcgattctctggctccatatcaggcagcacagccaccctgactattgctggactc caggctgaggacgaggctgattattactgctcatcctatgacagcagtctcaaagctcc SEQIDNO.220IGLV1-151-1(P) >IGLV1-151-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcagccactgttagggcctgggttcctggccagagggtcaccctct cctgccctggaagagtctcagttttggtgattatggtgtgaaacggtacaggaagctcgc atggacagaccccagactcctcatctatggcaatagcaattgattctcgggtccccagtc tattttctggctctggttttggcatcactggctccttgaccacctccgggctccagactg aaaaataggctgatttctagtgcttc SEQIDNO.221IGLV1-152(P) >IGLV1-152*01|Canislupusfamiliaris_boxer|P|V-REGION| caatctgtgctgatccagccggcctcagtgtcgggatccctgggccagagagtcaccatc tcctgctctggaaggacaaacaacatcggtaggtttggtgcgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtggacagtgatggggattgaccgtcaggggtccct gaccggttttccggctccaggtctggcagctcagccaccctgaccatcactggggtccag gctgaggatgaggctgattattactgccagtcctttgatcccacgcttggtgctca SEQIDNO.222IGLV1-154(P) >IGLV1-154*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccgtcctcagtgtccgggtccctgggccagagggtcactgtc ccctgcactggaagcagctccaacattggtagatatagtgtgagctggctatatctgctg gctccagcagctcccgggaacaggccccagaaccatcatctattatgattgtagccgacc ctcaggggttcccgatcgattctctggctccaagtcaggcagcacagccaccctgaccat ctctgggctccaggctgaggacgaggctgattattactgctcatcctatgacagcagtct caaaggtca SEQIDNO.223IGLV1-155(F) >IGLV1-155*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagcctccctcagtgtccgggttcctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagaggttatgtgcactggtaccaacagctc ccaggaacaggccccagaaccctcatctatggtattagtaaccgaccctcaggggtcccc gatcgattctctggctccaggtcaggcagcacagccactctgacaatctctgggctccag gctgaggatgaggctgattattactgctcatcctgggacagcagtctcagtgctct SEQIDNO.224IGLV1-157(F) >IGLV1-157*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccggcctcagtgtctgggtccctgggccagagggtcaccatc tcctgcactggaagcagctccaacatcggtagaggttatgtgggctggtaccagcagctc ccaggaacaggccccagaaccctcatctatgataatagtaaccgaccctcgggggtccct gatcgattctctggctccaagtcaggcagcacagccaccctgaccatctctgggctccag gctgaggacgaggctgattattactgctcaacatacgacagcagtctcagtggtgg SEQIDNO.225IGLV1-158(F) >IGLV1-158*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgaatcagctgccttcagtgttaggatccctgggccagagaatcaccatc tcctgctctggaagcacgaatgacatcggtatgcttggtgtgaactggtaccaagagctc ccaggaaaggcccctaaactcctcgtagatggtactgggaatcgaccctcaggggtccct gaccgattttctggctccaaatctggcaactcaggcactctgaccatcactgggctccag gctgaggacgaggctgattattattgtcagtccactgatctcacgcttggtgctcc SEQIDNO.226IGLV1-159(F) >IGLV1-159*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagcctccctcagtgttcaggtccctgggccagagggtcaccatc tcctgcactggaagcagctgcaacgtcggtagaggttatgtgatctggtaccaacagctc ctgggaacacgcccaagaaccctcatatatggtagtagtaaccaaccctcaggggtcccc aatcgattctctggctccaggtcaggcagcacagccactctgacaatctctgggttccag gctgaggatgaggctgattattactgctcatcctgggacagcagtctcagtgctct SEQIDNO.227IGLV1-160(P) >IGLV1-160*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgtgctgactcaaccagtctcagtgtctggggccctgtgccagagggtcaccatc tcctgcactggaagcagctccaacattggttatagcagctgtgtgagctgatatcagcag ctcccaggaacaggccccagaaccatcatctatagtatgaatactctaccctctggggtt cctgatcgattgtctggctccaggtcaggcaactcagccaccctaaccatctctgggctc caggctgaggacaaggctgactattactgctcaacatatgacagcagtctcaatgctca SEQIDNO.228IGLV1-161(P) >IGLV1-161-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caaggtcagctgccctgaggacagagtccatgacaggtcagggcagaaacagggactctg aatccagctctgagtcaggacacatcaggagtgtccaatatgtgtcctgctaccaacagc tccatgagtgggcagtcaaatcctcatgtattatgatggcttgaccttctgtggaccctg gtccattctctgcctccatgtctggcagctctggctctctggccattgctgggctgagcc aggaggatgaggtcatgcttcactgcccctccagtgacagcatttcaaggat SEQIDNO.229IGLV1-162(F) >IGLV1-162*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgtgctgactcagccgacctcagtgtcggggtcccttggccagagggtcaccatc tcctgctctggaagcacgaacaacatcggtattgttggtgcgagctggtaccaacagctc ccaggaaaggcccctaaactcctcgtgtacagtgatggggatcgaccgtcaggggtccct gaccggttttccggctccaactctggcaactcagacaccctgaccatcactgggcttcag gctgaggacgaggctgattattactgccagtcctttgataccacgcttgatgctca SEQIDNO.230IGLV2-31(F) >IGLV2-31*01|Canislupusfamiliaris_boxer|F|V-REGION| cagtctgccctgactcaaccttcctcggtgtctgggactttgggccagactgtcaccatc tcctgtgatggaagcagcagtaacattggcagtagtaattatatcgaatggtaccaacag ttcccaggcacctcccccaaactcctgatttactataccaataatcggccatcagggatc cctgctcgcttctctggctccaagtctgggaacacggcctccttgaccatctctgggctc caggctgaagatgaggctgattattactgcagcgcatatactggtagtaatactttc SEQIDNO.231IGLV2-31-1(P) >IGLV2-31-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctaacctaattgagcccccctttttgtccaggattctaggatggactgtcactgtc tcctgtgttttaagcagctgtgacatcaggagtgataatgaaatatcctggtaccaatag cacccgagcatgactcagaaattcctgatttactataccagttcttgggcatcagatatc cctgattgctttcctggctcccagtctggaaacatggcctgtctgaccatttccaggctc caggctaatgatgacgctgattatcattgttacttatatgatggtagtggcgctttt SEQIDNO.232IGLV2-32(P) >IGLV2-32*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgccctgactcagcctccctcgatgtctgggacactgggacagaccatcatcatt tcctgtactggaagcggcagtgacattgggaggtatagttatgtctcctggtaccaagag ctcccaagcacgtcccccacactcctgatttatggtaccaataatcggccattagagatc cctgctcgcttctctggctccaagtctggaaacacagcccccatgaccatctctgggctt caggctgaagatgaggctaattattactgttgctcatatacaaccagtggcacaca SEQIDNO.233IGLV2-32-1(P) >IGLV2-32-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagtctgccttgacccaacctccctttgtgtctgggactttgagacaaactgtcacatct cttgcaatggaagcagcagccacactggaacttataaccctacctctggcaccagcaatg tctggaaaggcccccacactccagatagatgctgtgagttctttgccttcagggcttcca gctctgtcctcaggctctgagtctagcaacacagcctccagtccatttttggactgcacc ctgaggacaaggctgattattactgattgtccagggacagccagag SEQIDNO.234IGLV3-1(P) >IGLV3-1*01|Canislupusfamiliaris_boxer|P|V-REGION| gccaacaagctgactcaatccctgtttatgtcagtggccctgggacagatggccaggatc acctgtgggagagacaactctggaagaaaaagtgctcactggtaccagcagaagccaagc caggctcccgtgatgcttatcgatgatgattgcttccagccctcaggattctctgagcaa ttctcaggcactaactcggggaacacagccaccctgaccattagtgggcccccagcgagg acgcggctattactgtgccaccagccatggcagttggagcacct SEQIDNO.235IGLV3-1-1(P) >IGLV3-1-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tccaatgtactgacacagccacccttggtgtcagtgaacctgggacagaaggccagcctc acctgtggaagaaacagcattgaagataaatatgtttcatggtcccagcaggagccaggc caggcccccatgctggtcatctattatagtacacaagaaaccctgagcgattttctgcct ccagctctagctcggggtacatgatcaccctgaccaacagtggggcctaggacaaggacg aggatggctattactgtcagtcctatgacagtagtggtactcct SEQIDNO.236IGLV3-2(F) >IGLV3-2*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgactcagtcaccctcagtgtcagtgaccctgggacagacggccagcatc acctgtaggggaaacagcattggaaggaaagatgttcattggtaccagcagaagccgggc caagcccccctgctgattatctataatgataacagccagccctcagggatccctgagcga ttctctgggaccaactcagggagcacggccaccctgaccatcagtgaggcccaaaccaac gatgaggctgactattactgccaggtgtgggaaagtagcgctgatgct SEQIDNO.237IGLV3-3(F) >IGLV3-3*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgacacagctgccatccaaaaatgtgaccctgaagcagccggcccacatc acctgtgggggagacaacattggaagtaaaagtgttcactggtaccagcagaagctgggc caggcccctgtactgattatctattatgatagcagcaggccgacagggatccctgagcga ttctccggcgccaactcggggaacacggccaccctgaccatcagcggggccctggccgag gacgaggctgactattactgccaggtgtgggacagcagtgctaaggct SEQIDNO.238IGLV3-4(F) >IGLV3-4*01|Canislupusfamiliaris_boxer|F|V-REGION| tccactgggttgaatcaggctccctccatgttggtggccctgggacagatggaaacaatc acctgctccggagatatcttagggaaaagatatgcatattggtaccagcataagccaagc caagcccctgtgctcctaatcaataaaaataatgagcgggcttctgggatccctcactgg ttctctggttccaactcgggcaacatggccaccctgaccatcagtggggcccgggctgag gacgaggctgactattactgccagtcctatgacagcagtggaaatgct SEQIDNO.239IGLV3-7(P) >IGLV3-7*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatgtgctgactctgctgctatcagtgaccgtgaacctgggacagaccaccagcatc acctgtggtggagacagcattggagggagaactgtttactggtaccagcagaagcctggc cagcgccccctgctgattatctataatgatagcaattgaccctcagggatccctgcctga ttctctggctccaactcagggaacagggcctccctaaccatcattggggcctgggcctaa gacgagtctgagtattacggagaggtgtgggacagcagtgctaaggct SEQIDNO.240IGLV3-7-1(P) >IGLV3-7-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatatgctgactcagcagccattggcaagtgtaaacctcagccagtgggccagcacc acctgtggtggagataacattggagaaaaaaccgtccaatggaaccagcagaagcctggc taagctcccattacggctatctataaaggtagtgatctgccctcagggatccctgagcaa ttccctggccccaatttggggaacggggcctccctgaacatcagcggggctaagccgacg acgaggctattactgccagtcagcagacattagtggtaaggct SEQIDNO.241IGLV3-8(F) >IGLV3-8*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgacacagctgccatccgtgagtgtgaccctgaggcagacggcccgcatc acctgtgggggagacagcattggaagtaaaagtgtttactggtaccagcagaagctgggc caggcccctgtactgattatctatagagatagcaacaggccgacagggatccctgagcga ttctctggcgccaactcggggaacacggccaccctgaccatcagcggggccctggccgag gacgaggctgactattactgccaggtgtgggacagcagtactaaggct SEQIDNO.242IGLV3-9(P) >IGLV3-9*01|Canislupusfamiliaris_boxer|P|V-REGION| tccactgggttgaatcaggctccctccgtgttgctggcactgggacagatggcaacaatc acctgatccagagatgtctttgggaaaaatatgcatattggtaccagcagaagccaagcc aagcccctgtgctcctaatcaataaaaataatgagcaggattctgggatccctgaccggt tctctggctccaactcgggcaacacggccaccctgaccatcagtggggcccgggccgagg acgaggctgactattactgccagtcctatgacagcagtggaaatgtt SEQIDNO.243IGLV3-11(F) >IGLV3-11*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgtctcagccgccatcagcgactgtgactctgaggcagacggcccgcctc acctgtgggggagacagcattggaagtaaaagtgttgaatggtaccagcagaagccgggc cagccccccgtgctcattatctatggtgatagcagcaggccgtcagggatccctgagcga ttctccggcgccaactcggggaacacggccaccctgaccatcagcggggccctggccgag gacgaggctgactattactgccaggtgtgggacagcagtactaaggct SEQIDNO.244IGLV3-13(P) >IGLV3-13*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatgtactgactcagctgccatcagtgactgtgaacctgggacagaccaccagcatc acctgtggtggagacagcattggagggagaactgtttactggtaccagcagaagcctggc cagcgccccctgctgattatctataatgatagcaattggccctcagagatccctgcctga ttctctggctccaactcagggaacagggcctccctaaccatcattggggcctgggcctaa gatgagtctgagtattacggagaggtgtgggacagcagtgctaaggct SEQIDNO.245IGLV3-13-1(P) >IGLV3-13-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatatgctgactcagcagccattggcaagtgtaaacctcagccagtgggccagcacc acctgtggtggagataacattggagagaaaactgtccaatggaaccagcagaagcctggc taagctctcattatggctatctataaaggtagtgatctaccctcagggatccctgagcaa ttccctggccccaactcgggtcggggcctccctgaacatcagcggggctacgccgacgac taggctattactgccagtcagcagacattagtggtaaggct SEQIDNO.246IGLV3-14(F) >IGLV3-14*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgacacagctgccatccatgagtgtgaccctgaggcagacggcccgcatc acctgtgagggagacagcattggaagtaaaagagtttactggtaccagcagaagctgggc caggtccctgtactgattatctatgatgatagcagcaggccgtcagggatccctgagcga ttctccggcgccaactcggggaacacagccaccctgaccatcagcggggccctggccgag gacgaggctgactattactgccaggtgtgggacagcagtactaaggct SEQIDNO.247IGLV3-15(P) >IGLV3-15*01|Canislupusfamiliaris_boxer|P|V-REGION| tccactgggttgaatcaggctccctccgtgttggtggccctgggacagatggaaacaatc acctgctcgagagatgtcttagggaaaagatatgcatataggtaccagcataagccaagc caagcccctgtgctcctaatcaataaaaataatgagcaggattctgggatccctgaccgg ttctctggctccaactcgggcaacacggccaccctgaccatcagtggggcccgggctgag gacgaggctgagtattactgccagtcctatgacagcagtggaaatgtt SEQIDNO.248IGLV3-18(P) >IGLV3-18*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatgtgctgacacagctgccatccgtgaatgtgacccagaggcagacggcccgcatc acctgtgggggagacagcattggaagtaaaagtgtttactggtaccagcagaagctgggc caggcccctgttgattatctatagagacagcaacaggccgacagggatccctgagcgatt ctctggcgccaacacggggaacatggccaccctgactatcagcggggccctggccgtgga cgaggctgactattactgccaggtgtgggacagcagtgctaaggct SEQIDNO.249IGLV3-19(ORF) >IGLV3-19*01|Canislupusfamiliaris_boxer|ORF|V-REGION| tcccctgggctgaatcagcctccctccgtgttggtggccctgggacagatggcaacaaac acctgctccggagatgtcttagggaaaagatatgcatattggtaccagcataagccaagc caagcccctgtgctcctaatcaataaaaataatgagctgggttctgggatccctgaccga ttctctggctccaactcgggcaacacggccaccctgaccatcagtggggcccgggccgag gacgaggctgactattactgccagtcctatgacagcagtggaaatgct SEQIDNO.250IGLV3-21(F) >IGLV3-21*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgagctgactcagccaccatccgtgaatgtgaccctgagggagacggcccacatc acctgtgggggagacagcattggaagtaaatatgttcaatggatccagcagaatccaggc caggcccccgtggtgattatctataaagatagcaacaggccgacagggatccctgagcga ttctctggcgccaactcagggaacacggctaccctgaccatcagtggggccctggccgaa gacgaggctgactattactgccaggtgggggacagtggtactaaggct SEQIDNO.251IGLV3-23(P) >IGLV3-23*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatgtactgactcagctgccatcagtgactgtgaacctgggacagaccaccagcatc acctgtggtggagacagcattggagggagaactgtttactggtaccagcagaagcctggc cagcgccccctgctgattatctataatgatagcaattggccctcagagatccctgcctga ttctctggctccaactcagggaacagggcctccctaaccatcattggggcctgggcctaa gacgagtctgagtattacggagaggtgtgggacagcagtgctaaggct SEQIDNO.252IGLV3-23-1(P) >IGLV3-23-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tcctatatgctgactcagcagccattggcaagtgtaaacctcagccagtgggccagcacc acctgtggtggagataacattggagaaaaaactgtccaatggaaccagcagaagcctggc taagctcccattacggctatctataaaggtagtgatctgccctcagggattcctgagcaa ttccctggccccaactcgggaaacggggcctccctgaacatcagcggggctaagccgacg actaggctattactgccagtcagcagacattagtggtaaggct SEQIDNO.253IGLV3-24(F) >IGLV3-24*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgacacagctgccatccgtgagtgtgaccctgaggcagacggcccgcatc acctgtgggggagacagcattggaagtaaaaatgtttactggtaccagcagaagctgggc caggcccctgtactgattatctatgatgatagcagcaggccgtcagggatccctgagcga ttctccggcgccaactcggggaacacggccaccctgaccatcagcggggccctggccgag gatgaggctgactattactgccaggtgtgggacagcagtactaagcct SEQIDNO.254IGLV3-25(ORF) >IGLV3-25*01|Canislupusfamiliaris_boxer|ORF|V-REGION| tccactgggttgaatcaggcttcctccgtgttggtggccctgggacagatggaaacaatc acctgctcgagagatgtcttagggaaaagatatgcatataggtaccagcataagccaagc caagcccctgtgctcctaatcaataaaaataatgagcaggattctgggatccctgaccgg ttctctggctccaactcgggcaacacggccaccctgaccatcagtggggcccgggctgag gacgaggctgagtattactgccagtcctatgacagcagtggaaatgtt SEQIDNO.255IGLV3-26(F) >IGLV3-26*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgctgacacagctgccatccgtgaatgtgaccctgaggcagccggcccacatc acctgtgggggagacagcattggaagtaaaagtgttcactggtaccaacagaagctgggc caggcccctgtactgattatctatggtgatagcaacaggccgtcagggatccctgagcga ttctctggtgacaactcggggaacacggccaccctgaccatcagtggggccctggccgag gacgaggcttactattactgccaggtgtgggacagcagtgctcaggct SEQIDNO.256IGLV3-27(F) >IGLV3-27*01|Canislupusfamiliaris_boxer|F|V-REGION| tccagtgtgctgactcagcctccttcagtatcagtgtctctgggacagacagcaaccatc tcctgctctggagagagtctgagtaaatattatgcacaatggttccagcagaaggcaggc caagtccctgtgttggtcatatataaggacactgagcggccctctgggatccctgaccga ttctccggctccagttcagggaacacacacaccctgaccatcagcggggctcgggccgag gacgaggctgactattactgcgagtcagaagtcagtactggtactgct SEQIDNO.257IGLV3-28(F) >IGLV3-28*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctatgtgttgactcagctgccttcagtgtcagtgaacctgggaaagacagccagcatc acctgtgagggaaataacataggagataaatatgcttattggtaccagcagaagcctggc caggcccccgtgctgattatttatgaggatagcaagcggccctcagggatccctgagcga ttctctggctccaactcggggaacacggccaccctgaccatcagcggggccagggccgag gatgaggctgactattactgtcaggtgtgggacaacagtgctaaggct SEQIDNO.258IGLV3-29(F) >IGLV3-29*01|Canislupusfamiliaris_boxer|F|V-REGION| tccagtgtgctgactcagcctccctcggtgtcagtgtccctgggacagacggcgaccatc acctgctctggagagagtctgagcagatactatgcacaatggtatcagcagaagccaggc caagcccccatgacagtcatatatggggacagagagcgaccctcagggatccctgaccga ttctccagctccagttcagagaacacacacaccttgacaatcagtggagcccaggctgag gatgaggctgaatattactgtgagatatgggacgccagtgctgatgat SEQIDNO.259IGLV3-30(F) >IGLV3-30*01|Canislupusfamiliaris_boxer|F|V-REGION| tcctacgtggtgacccagccaccctcagtgtcagtgaacctgggacagacggccagcatc acctgtgggggagacaacattgcaagcacatatgtttcctggcagcagcagaagtcgggt caagcccctgtgacgattatctatcgtgatagcaaccggccctcagggatccctgagcga ttctctggctccaactcggggaacacggccaccctgaccatcagcagggcccaggccgag gatgaggctgactattactgccaggtgtggaagagtggtaataaggct SEQIDNO.260IGLV4-5(F) >IGLV4-5*01|Canislupusfamiliaris_boxer|F|V-REGION| ttgcccgtgctgacccagcctacaaatgcatctgcctccctggaagagtcggtcaagctg acctgcactttgagcagtgagcacagcaattacattgttcagtggtatcaacaacaacca gggaaggcccctcggtatctgatgtatgtcaggagtgatggaagctacaaaaggggggac gggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatctcc aacatcaagtctgaagatgaggatgactattattactgtggtgcagactatacaatcagt ggccaatacggttaagc SEQIDNO.261IGLV4-6(P) >IGLV4-6*01|Canislupusfamiliaris_boxer|P|V-REGION| ttgcccgtgctgacccagcctccaagtgcatctgcctccctggaagcctcggtcaagctc acatgcactctgagcagtgagcacagcagttactatatttactggtatgaacaacaacaa ccagggaaggcccctcggtatctgatgagggttaacagtgatggaagccacagcaggggg gacgggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatc tccaacatccagtctgaggatgaggcagattattactgtggtgcacccgctggtagcagt agc SEQIDNO.262IGLV4-10(F) >IGLV4-10*01|Canislupusfamiliaris_boxer|F|V-REGION| ttgcccgtgctgacccagcctacaaatgcatctgcctccctggaagagtcggtcaagctg acctgcactttgagcagtgagcacagcaattacattgttcattggtatcaacaacaacca gggaaggcccctcggtatctgatgtatgtcaggagtgatggaagctacaaaaggggggac gggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatctcc aacatcaagtctgaagatgaggatgactattattactgtggtgcagactatacaatcagt ggccaatacggttaagc SEQIDNO.263IGLV4-12(P) >IGLV4-12*01|Canislupusfamiliaris_boxer|P|V-REGION| ttgcccgtgctgacccagcctccaagtgcatctgcctccctggaagcctcggtcaagctc acatgcactctgagcagtgagcacagcagttactatatttactggtatcaacaacaacca gggaaggcccctcggtatctgatgaaggttaacagtgatggaagccacagcaggggggac gggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatctcc aacatccagtctgaggatgaggcaggttattactatggtgtacccctggtagcagtagc SEQIDNO.264IGLV4-16(ORF) >IGLV4-16*01|Canislupusfamiliaris_boxer|ORF|V-REGION| ttgcccatgctgacccagcctacaaatgcatctgcctccctggaagagtcggtcaagctc acatgcactttgagcagtgagcacagcaattacattgttcaatggtatcaacaacaacca gggaaggcccctcggtatctgatgcatgtcaggagtgatggaagctacaacaggggggac gggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatctcc aacatcaagtctgaagatgaggatgactattattacagtggtgcatactatacaatcagt ggccaatacggttaagc SEQIDNO.265IGLV4-17(P) >IGLV4-17*01|Canislupusfamiliaris_boxer|P|V-REGION| ttgcccatgctgacccagcctccaagtgcatctgcctccctggaagcctcggtcaagctc acatgcactctgagcagtgagcaaagcagttactatatttactggtatcaacaacaacaa ccagggaaggcccctcggtatctgatgaaggttaacagtgatggaagccacagcagggcg tcgggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatct ccaacatccagtctgaggatgaggcagattattactgtggtgtacccactggtagcagta gc SEQIDNO.266IGLV4-20(ORF) >IGLV4-20*01|Canislupusfamiliaris_boxer|ORF|V-REGION| ttgcccatgctgaccgagcctacaaatgcatctgcctccctggaagagtcagtcaagctc acctgcactttgagcagtgagcacagcaattacattgttcgatggtatcaacaacaacca gggaaggcccctcggtatctgatgtatgtcaggagtgatggaagctacaacaggggggac gggatccccagtcgcttttcaggctccagctctggggctgaccgctatttaaccatctcc aacatcaagtctgaagatgaggctgagtattattacggtggtgcagactataaaatcagt gaccaatatggttaaga SEQIDNO.267IGLV4-22(F) >IGLV4-22*01|Canislupusfamiliaris_boxer|F|V-REGION| ttgcccgtgctgacccagcctccaagtgcatctgcctgcctggaaacctcggtcaagctc acatgcactctgagcagtgagcacagcagttactatatttactggtatcaacaacaacaa ccagggaaggcccctcggtatctgatgaaggttaacagtgatggaagccacagcaggggg gacgggatccccagtcgcttctcaggctccagctctggggctgaccgctatttaaccatc tccaacatccagtctgaagatgaggcagattattactgtggtgtacccgctggtagcagt agc SEQIDNO.268IGLV5-34(P) >IGLV5-34*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgctgacccagccgccctccctctctgcatccctgggatcaacagccagactc acctgcaccctgagcagtggcttcagtgttggcagctactacatatactggtaccagtag aagccagggagccctccccggtatctcctgtactaactactactcaagtacacagctggg ccccggggtccccagccatttctctggatccaaagacaactcggccaatgcagggctcct gctcacctctgggctgcagcctgaggacgaggctgactactactgtgctacaggttattg ggatgggagcaactatgcttacc SEQIDNO.269IGLV5-38(P) >IGLV5-38*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccctccctctctgcatccctgggaacagcggccagaaat acctgcactctgagcagtgacctcagtgttggcagctgtgctataagctgatcccagcag aagccagggagccctccctggtatctcctgaactactaaacacacccatgcaagcaccag gactcacatctgtagccgcttctctggatttgaggatgcctctgccagtgcagggctctg ctcatctctggaggctgaccatcactgtgctaagatcatggcagtgggggcagctagtgt taca SEQIDNO.270IGLV5-38-1(P) >IGLV5-38-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccgtcctctctgcatccctgggaacaacagccagactca cctgcaccctgagcagtggcttcaatatgtggggctaccatatattctggtaccagcaga agccagggagccctccccggtatctgctgaacttctactcagataagcaccagggctcca aggacacctcggccaatgcagggatcctgctcatctctgggctccagcctgaggacgagg ctgactactactgtaaaatctggtacagtggtctggt SEQIDNO.271IGLV5-40-1(P) >IGLV5-40-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctctgctacccagccacccccttctctgcgtctccaggtactacagccagacccac ctgcaccctgagcagtggcaacagtgttggcagctgttccttataacggctcccacaaag acagagggccctccctggtatctgctgaggttcccctctaatagacaccatgtctctgga tccacacataccttggccaatgcagggctcctgctcat SEQIDNO.272IGLV5-42(P) >IGLV5-42*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgaccaagtgccctctctttctgcatctcctggaacaacagtcagactca cttgcacctggagcagtggctccagcactggcagctactatatacactggttccagagcc acagagccagagccacagagctctccctggtatctcctgtactactactcagactcagat aagcaccagggctctggggttctcagctctgtctcctgatccaaggatgcctcagttatt ggagggctctctcatctctgggctgcagcctgaggattagactgaccttcactgtctaat cagaaacaataatgcttct SEQIDNO.273IGLV5-47(P) >IGLV5-47*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagctgccctccctctctgcataccggggaacaaactccagatgt acctacaccctgagcagtgtcgccaactactaaacatacttctcaaagagaatacagggc accttccacagtacatcctgtactactactcagactcaagtgcatgattgggatttgggg tcccaggcacttctctggatccaaagatgcctcagccaatgcagggatcctgctgatctc tgggctgcagccagaggacaagtctgactgtcactgtgctacagatcatggcagtgggag cagcttccgatact SEQIDNO.274IGLV5-47-1(P) >IGLV5-47-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagggctgacccagccacactccctctctgcatatcagggagaaacagccacacat acctgcaccctgagcggtggcttcagtgttggcagctgccatatatactggatccagaag aagccagagagccctccctgatgtctcctgaactactactaagactcagataaggcctcg acgtccccagccctactctgaatccaaagacaccttgcccaaggtgggaatcctgctcat ctctgggctgcagccggaggacaaggctgtctcttactgtataatatggcacagtggttc tggtcacagggaca SEQIDNO.275IGLV5-48-1(P) >IGLV5-48-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caccctgtgctgacccagctgccctccctctctgcatccctgggaacaacagccagactc atgtgcaccctgagcagtggctgcagtggtggccatacgctggttccagcagccaggagg cctcctgagtacctgctgatggtctactgagactcaccagggccccggtggccccagccg cttctctggctccaaggacacctcggccaatgcagggctcctgctcatctctaggctgca gcctgaggacgaggctgactgtcactgtgttacagaccatggcagtgggagcagctcccg aaactca SEQIDNO.276IGLV5-49-1(P) >IGLV5-49-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagggctggcccagcttccccccacctccctctgcatctccaggaacaacagccag actcacatgaaccatgagcagtggcttcatcgttggcgctgctacatatactggttccaa cagaagccagggagcaccgccccagtatctcctgaggttctactcagactcagataagca ctagggctcaacgaccccagccctgttctggatctgaagacacctccgccgaagcagggc ctctgctcatctctgggctgcagcgtgaggacaaggctgactcttatgggacaatctggc acagtggtcctggtcacagggacaca SEQIDNO.277IGLV5-51(P) >IGLV5-51*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagctgccctccctttctgcatccctgggaacaacagccagactc acatgcaccctgagcagcggctgcagcggtggccacacattggttccagcagccaggagg cctcctgagtacctgctgatggtctactgagactcaccagggccccggtgttgccagcct cttctctggctccaaggacacctcggccaatgcaggactcctgctcatctctgggctgca gcctgaggatgaggctgactgtcactgtgctacagaccatggcagtgggagcagctccgg atact SEQIDNO.278IGLV5-53(P) >IGLV5-53*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagctgccctccctttctgcatccctgagaacaacagccagactc acctgcaccctgagcagtggctgcagtggtggccatatgctggttccagcagccaggaag cctcctgagtatctgctgacggtcttctgagactcaccagggccccgaggtccccagcct cttctctggctccaaggacacctcagccaatgcaggactcctgctcatctctgggctgca gcctgaggatgaggctgactgtcactgtgctacagaccatggcagtgggagcagctcccg atact SEQIDNO.279IGLV5-53-1(P) >IGLV5-53-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caccctgggctgacccagtcgtcctccctctctgcatccctgggaacaacagccagactc acctgcaccctgagcagtggcttcagaaatgacaggtatgtaataagttggttccagcag aaatcagggagcccttcctggtgtctcctgtattattactcgaactcaagtacacatttg ggctctgaggttcccagctgcttctctggatccaagacaaggccacacccacactgagta gacccctctctgggtgggtctagagctccagctccacctgaggctgatgcacaattgcag SEQIDNO.280IGLV5-57-1(P) >IGLV5-57-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagggctggcccagctgccctccctctctgcatctccaggaacaacagccagactc acatgaaccatgagcagtggcttcattgttggtggctgctacatatactggttccaacag aagccagggagcatgccccccagtatctcctgaggttctactcagactcagataagcacc aggtctcaacatccccagcccggctctggatctgaagacactcagccgaagcagggcctc tgctcatctctgggctgcagcatgaggacaaggctgactcttactgtacaatctggcaca gtggtcctggtcacagggaca SEQIDNO.281IGLV5-58-1(P) >IGLV5-58-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccattgccctccctctctgcatcctgggaaataacaaccagactca cctgcactctgagcagcggctgcagcggtggccatacagtggttccagcagcaaggaagc ctcctgagtacctgctgacgttctactgagactcaccagggctctagggtccccagccac ttctctggtttcaaggacaccacggccaatgcagggcact SEQIDNO.282IGLV5-59(P) >IGLV5-59*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagtcgccctccctctcggcatctttggaacaacagtcagactca cctgtaccctgatcagtggctccagtgttggcagctattacatcaactggttccagaaga agccacggagccctccccagtatctcctgtactactacttagactcagataagcaccagg gctctggggtccccagctgcttctcctgatccaaggatgcctcagtcattggaggacacc ctcatctctgaactgcagcctgaggactagactgaccttcgctgtctaatcagaaacaat aatgcttct SEQIDNO.283IGLV5-62(P) >IGLV5-62*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagcctccctctctctctgcatctctgggaacaatagccagacaa acatgcagcctgagcaggggctacagtatggggacttatgtcatacgctggttccagcag tagcaagaaactctcctgagtatctgctgaggttatactgagcctcagcaggtctctggg gaccccagctgagtctttagatccaagatgcctcagccaattcagggctcctgcttatct ctgtgctgcagcctgaggacaagggttactattactgttctgtacatcatggaattgtga gcagctatacttacc SEQIDNO.284IGLV5-64(F) >IGLV5-64*01|Canislupusfamiliaris_boxer|F|V-REGION| cagcttgtggtgacccagccgccctccctctctgcatccctgggatcatccgccagactc acctgcaccctgagcagtggcttcagtgttggcagttattctgtaacttggttccagcag aagccagggagccctctctggtacctcctgtactaccactcagactcagataagcaccag ggctccagggtccccagccgcttctctggatccaaggacacctcggccaatgcagggctc ctgctcatctctgggctgcagcctgaggatgaggctgactactactgtgcctccgctcat ggcagtgggagcaactaccattact SEQIDNO.285IGLV5-67-1(P) >IGLV5-67-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagtgctgacccagctgccctccttctctgtatctctgggaacaacagtcagactc acctgcaccctgagcagtgttggcagctactaaacatccttttcaaggagaaaccaagga gccccccaccccggtatctcctatactactattcagactcagataaaccccaggtctctg gggtccccagccacttctctgcatccaaagactcctaggccaatgcagggctcctgctcg cctctgggctgcagcctgaggacgaggctgactatcactgtgctataaatcatgacagtg ggagtagttcctgatact SEQIDNO.286IGLV5-70-1(P) >IGLV5-70-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctttggtgacccagcgccctccctctctgcatctcctgaaacaacagtcagactca catgcaccctgagcagtggccccagtgctggcagctactacatacactggttccagtgga agccacggtgcccgccccggtatctcctgtactactactcagactcagatgagcaccagg gctctggggtccccagccgcttctcctgatccaaggatgcctcagccagggcagggctcc ctcatctctgggctacagtctgaggtctacactgaccttcactgtctaatcggaaacaat aatgtttct SEQIDNO.287IGLV5-72-1(P) >IGLV5-72-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagcgacctccctctctgcatccctgggaacaacagccagactca cctgcaccctgagcagcggctgaagcggtggccatacgctggttccagcagccaggaagc ctcctgagtacctgctgatggtctactgagactcaccaggctatggggtccccagcatct tctctggctccaaggacacctcggccaatgcagggctcctgctcatctctgggctgcagc ctgaggtcgaggctgactgtcactgtgctacagaccatggcagtgggagcagctcccgat act SEQIDNO.288IGLV5-76(P) >IGLV5-76*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagtcgccctccctctcagcatctttggaacaacagtcagactca cctgtaccctgatcagtggctccagtgttggcagctattacatcaactggttccagaaga agccacggagccctccccagtatctcctatactactacttagactcagataagcaccagg gctctggggtccccagctgcttctcctgatccaaggatgcctcagtcattggagggcacc ctcatctctgagctgcagcctgaggactagactgaccttcgctgtctaatcggaaacaat aatgcttct SEQIDNO.289IGLV5-77(P) >IGLV5-77*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccaccctccctctctgcatccccgggaacaacagccagactc acctgcaccctgagcagtggcttcagtgttggtgactatgacatgtactggtaccagaag aagccaggaagcccccaccccgggatctcctgtactactactcagactcatataaacacc agggctccggggtctccagcagcttctctggatccaaggatacctcagccaatacagggc tcctgctcatctctgggccacagcctgaggacgaggctgactactactgtgctacagatc atggcagtgagagcaggtactcttacc SEQIDNO.290IGLV5-77-1(P) >IGLV5-77-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctctgctacccagcacccccttcgctgcgtttccaggtactacagccagaatcacc tgcaccctgagcaggggcatcagtgttgggagctgttccttataacggctcccgcagagg cagggagccctgcctggtatctgctgaggttcccctctaatagacaccacatctctggat ccaaagaaacctcggccaatgcagggctcctgctcattgttgtgctgccacctgacaact agtctatcagtggtggttgaggactaggactattactgggatgctttggttt SEQIDNO.291IGLV5-78-1(P) >IGLV5-78-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctttgctgatccagcgccctccctctctgcatctcctggaacaacagtcagactca cctgcacccagagcagtggcccctgtgttggcagctactacatacactggttccagtgga agccatggagccctccctggtatcttctgtactactaatcagactcagatgagcaccagg gctctggggtccccagccgcttctcctgatccaaggatgcctcagccagagcagggctcc ctcatctctggactgcagcctgaggactagactgaccttcactgtctaatcagaaacaat aatgttt SEQIDNO.292IGLV5-83-1(P) >IGLV5-83-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tgcaggtccctgtcccagcctttgccctccctctttgcatctcctggaagaacagtcaga tccacctgcacccagagcagtggcccctgtgttggcagctactacatacaccggttccag tggaagccacggagccgtctccatatctcctgtactactactcagactcagatgagcacc agagctctggagtccccaactgcttctcctgatccaaggatgcctcagggaaggcagggc tccctcatctctgggctacaggctgaggacaagactgacctttactgtctaatccaaaac aataatgtttct SEQIDNO.293IGLV5-85(F) >IGLV5-85*01|Canislupusfamiliaris_boxer|F|V-REGION| cagcctgtgctgacccagccaccctccctctctgcatccctgggatcaacagccagaccc acctgcaccctgagcagtggcttcagtgttggaagctaccatatactctggttccagcag aagtcagagagccctccccggtatctcctgaggttctactcagattctaatgaacaccag ggtcccggggtccccagccgcttctctggatccaaggacacctcaacctatgcagggctc ttgctcatctctgggctgcagcctgaggacgaggctgactactactgtgctacagaccat ggcagtgggagcagctacacttacc SEQIDNO.294IGLV5-86-1(P) >IGLV5-86-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctttgctgacccagcgccctccctctctgcatctcctggaacaaaagtcagactca cctgcatccagagcagtggatccagcgttggcagctactacatacactggttccagtaga agccatggagccctccccagtatctcctgtactactacttagactcagataagcactagg cctatggggaacccagatccttcccctgatccaaggatgcctcagtcaatgcagggtcaa agagaggggattatttagagtggacaattggggcctttggccaggag SEQIDNO.295IGLV5-88-1(P) >IGLV5-88-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagtgcagacccagctgccctccttctctgtacctctgggaacaacagccagactc acctgcaccctgagcagtgttggcggccagtaaacatccttttcaaggagaaaccaagga gccccccagtctctcctgtactattacccagactcagataaaccccaggtctctggggtc cccagccacttctctgaatccaaagactcctaggccaatgcagggctcctgctcgcctct gggctgcagcctgaggacgaggctgactatcactgtgctgtaaatcatgacagtgggagc agctccggatact SEQIDNO.296IGLV5-89-1(P) >IGLV5-89-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtggtgacccagcttccttctctgcatccctgggaacaacagccagactcacat gcaccctgagctgtggcttcagtattgatagatatgctataaactggttccagcagaagg cagagagccttccctggtacctactgtgctattactggtactcaagtacacagttgggct tcagcgtccccagctgcatctctggatccaagacaaggccacattcacaaacgagtagac ccatctctggttgggtctagagctccagccccacctgagactgatgcacaattgcagc SEQIDNO.297IGLV5-92-2(P) >IGLV5-92-2*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtatagacccagtcaccctccctttctgcatctttggaacaacagtcagagtca cctgtaccctgagcagtggctccagtgttggcagctactacatatactggttccaggaga agccatggagcaatccccggtatctcctgtactactcaggctcagatgagcaccagggct ctgggatccgtagctgcttctcctgatacaatgatgcctcagccaaggcagagctcccta atctctgggctgcagcctgaggactatactgaccttcactgtctaatcagaaacaataat cctttt SEQIDNO.298IGLV5-94-1(P) >IGLV5-94-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tagcctgtgctgacccagcgccctcccactctgcatccctgggaacaacagccagactca cctgcgccctgagcagcggctgcagcagtgaccatacgctggttccagcagccagaaggc ctcctgagtacctgctgacggtctactgagactcaccagcgccccggggtcctcagcctc ttctctggctccaaggacacctcggccaatgcagggcactcagatgg SEQIDNO.299IGLV5-95(P) >IGLV5-95*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgatgacccagctgtcctccctctctgcatccctggaaacaacaaccagacac acctgcaccctgagcagtggcttcagaaataacagctgtgtaataagttgattccagcag aagtcagggagccctccctggtgtctcctgtactattactcagactcaagtatacatttg ggctctgaggttcccagctgcttctctggatccaagacaaggccacacccacactgagta gacccatccctgggtgggtctagagctccagccccactggaggctgatgcacaattgcag c SEQIDNO.300IGLV5-96-1(P) >IGLV5-96-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caacctttgcggacccagcgcactccctctgcatctcctggaacaacagttagactcatc tgcacccagagcagtggccccagtgttggcagctactacaaacactggttccagcagaag ccacggagccctccccggtacttcctgtactacttctcagactcagatgagcaccagggc tctggggaccgcagccacttctcctgatccaaggatgactcaggaaaggcagggctccct catctctgggctacagcctgaggactagactgaccttcactgtctaatcagaaacaataa tgcttct SEQIDNO.301IGLV5-97-1(P) >IGLV5-97-1*01|Canislupusfamiliaris_boxer|P|V-REGION| ttaaaaccaaccaaaccaaaccaaaccaaaacaaaacaaaacaaaataacagccagattc acctgctccctgagcagtggcttcagtgttggtggctataacacactggtaccagcagaa gccagggagccctccctgttacctcctgtactactactcagaatcagataaacaccatgg ctccgggatcaccagctgcttccctggccctatggacacctcggccaatgcagggctcct gctcatctcagggctgcagcctgaggacgaggctgactactactgcggtatactccacag cagtgggagcagctactcttacc SEQIDNO.302IGLV5-97-2(P) >IGLV5-97-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgaggacacactcctccttcctctctgcacctttgggatcatcaaccagactc acctgcatccttcccagggcctgaatgttggcaggtactgaacatactggacaaggagaa tcaaggagacatcaggagttccctcagatccagataagtgccagggcacggggttctcag ccacttctatggatctaatgatgcctcaggcaatgcaggtctcctgctcatgtctgggct gcagcctgaggacgaggctgactatgactatgctgcacattgtggggtgggagcagctcc cgatact SEQIDNO.303IGLV5-97-3(P) >IGLV5-97-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccctccctctctgcatccctgggaacaacagccagactc acctgcaccctgagcagcagctgcagcggtggccatatgctggttccagcatgcaagagg cctcctgagtacctgctgatggtctactgagactcaccagggccctggggtccccagcct cttctctggctccaaggaagcctcggccaatgcagggctcctgctcatctctgggctgca gcctgagaatgaggctgactgtcactgtgctacagaccatggcagtgggaacagctccca atact SEQIDNO.304IGLV5-101-1(P) >IGLV5-101-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctttgctgacccagcgtcctccctctctgcatctcctggaacaacagtcagactca catgtaccctgagcagtggccccggtgctggcagctactacacacactggttccagcaga ggccacagagtcctccccggtatctcctgtactactactcagactcagatgatctccagg gctccgggttccccagccactcctcctgatccaaggatgcctcagccagggcagggctcc catctctggggtacagcctgaggactacactgaccttcactgtctaatcggaaacaataa tgtttct SEQIDNO.305IGLV5-103-1(P) >IGLV5-103-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagggctggcccagctgccccccacctccctctgcatctccaggaacaacagccag actcacatgaaccatgagcagtggcttcattgttggcagctgctacatatactggttcca acagaagccagggagcccccctcccccaatatctcttgaggttgtattcagaatcagata aacaccagggctcaatgtccccagccctgctctggatctgaagacacctccgccgaagca gggcctctgctcatctctgggctgcagcgtgaggacaaggctgactcttactgtacaatc tgg SEQIDNO.306IGLV5-105(P) >IGLV5-105*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccctccctctctgcatccctgggaacaacagccagactc acctgcaccatgagcagcagctacagtggtggccatacactggttccagcagccaggagg cctcctgagtacctgctgatggtctactgagatttaccagggccccggggtccccagccg cttctctggctccaaggacatctcggccaatgcagggctcctgctcatctctgggctgta gcctgaggacgaggctgactgtcactgtgctacagaacatggcagcgggagcagctccca atact SEQIDNO.307IGLV5-105-1(P) >IGLV5-105-1*01|Canislupusfamiliaris_boxer|P|V-REGION| ctgcctctgctacccagccaccgccttctctgcatctccaggtactacagccagacccac ctgcaccctgaacagtggcatcagtattcgcagctgttccttataatggctcccgcaaag gcagggagccctgcctggtatctgctaaggttgtactctaataaataccatggctctagg gtcccaagccacatctctggatccaaagaaacctc SEQIDNO.308IGLV5-106-1(P) >IGLV5-106-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctttgctgacccagcgtcctccctctctgcatctcctggaacaacagtcagactca cctgtatccagagcagtggccccagtgttggcagctactacatacaccggttccagcgga aaccacggagccctcccctgtatctcctgtactactactcagactcagataagcactagg cctacagggtccccagctgcttctcctgatccatggatgcctcagccagtgcagtgctcc ctcatctctgggctacagcctgaggactagactgaccttcactgtctaatcggaaacaat aatgcttct SEQIDNO.309IGLV5-109(F) >IGLV5-109*01|Canislupusfamiliaris_boxer|F|V-REGION| cagcttgtgctgacccagccgccctccctctctgcatccctgggatcaacaaccagactc acctgcaccctgagcagtggcttcagtgttggtggctatagcatatactggcaccagcag aagccagggagcactccctggtacctcctgtactactactcaagtacagagttgggacct ggggtccccagctgcttctctggatccaaagacacctcagccaatgtagggctcctgctc atctcagggctgcagcctgaggatgagactgactactactgtgctataggtcacggcagt gggagcagctacacttacc SEQIDNO.310IGLV5-110-1(P) >IGLV5-110-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagggctggcccagctgcccccccacctccctctgcatctccaggaataacagcca gactcacatgaaccatgagcagtggcttcattgttggccgctgctacatatactgattcc aacagaagccaaggagcccccgctccaccagtatctcctgatattctactcagactcaga taagcaccagggctcaacgtccccagccctgctctgaatctgaagacacctccgcgaagc agggcttctgctcatctctgggctcagcgtgaggacaaggctgactcttactgtacaatc tgg SEQIDNO.311IGLV5-111-1(P) >IGLV5-111-1*01|Canislupusfamiliaris_boxer|P|V-REGION| tagcctgtgctgacccagtgctctccctctctgcatccctgggaacaacagccagactcc cctgcaccctgagcagcggctgcagcggtgtccatacgcaggttccagcagccaggaggc ctcctgaatacctgctgatggtctacggtgactcaccagggccccggggtccccagccgc ttctctggctccgaggacacctcggccaatgcagggctcctgctcatctctgggctgcag cctgaggacaagactgactgtcactgtgctacagaccatggcagtaggagcagttcccaa tact SEQIDNO.312IGLV5-111-2(P) >IGLV5-111-2*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagctgcccttcctctctgcatccctggagacaacaagcagatgt acctacacccagagcggtgtcggcagctactacacatactcatcaaggacaatccaggga gacctccctggtatttcctgtactactactcagactcaactacatggttgggatttggtg tccccaaccacttctctgtatccaaagatgcctcagccaatgcagggctcctgctcatct ctgggctgcagccagaggacaaggatgactgtcactgtgctgcattcagatcatggcagt gggagcagctcccgatact SEQIDNO.313IGLV5-113-2(P) >IGLV5-113-2*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctttgctgatccagtgccctccctctctgcatctcctggaacaagagtcagactca cctgcacccagagcagtggccccagggttggcagctactacatacactggttgcagcgga aaccacggagccctcctcagtatctcctgtactactactcagaatcagatgagcaccagg gctctggggtccccagccacttctcctgatccaaggatgcctcaggcaaggcagggctcc ctcatccctgggctacagcctgagggctagactgaccttcactgtctaatccgaaacaat aatgtttct SEQIDNO.314IGLV5-114-1(P) >IGLV5-114-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagccagggctggcccagctgccctccctctctgcatctccaggaacaacagccagactc acatgaaccatgaacagtggcttcattcttggcggctgatacatatacttgttccaacag aaaccagggaacccccgctccccgtattgcctgaggttctactcagactcagataagcac cagggctcaacatccccagccctgctctggatctgaagacacctcaactgaagcagggcc tctgctcatctctggatgtccagcgtgaggacaaggttgattcttactgtacaatctggc acagtggtcctggt SEQIDNO.315IGLV5-115-1(P) >IGLV5-115-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctctgctgacccagccaccctccctctctgcatccctgggaacaagacccagagtc acctgcaccctgagcaacaactgcagtggtggccatacgctggttccagcagccaggaag cctcctgaatacctattgatggtttactgagacttaccagggcccccggggccccagctg cttctctggctccaaggacaccttggccaatgcaggactcctgctcatctctgggctgta gcctgaggatgaggctgactgtcactgtgctacagaccatggcagtgggagcagctcccg atact SEQIDNO.316IGLV5-118-1(P) >IGLV5-118-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtggtgacccagcttccttctctgcatccctgggaacaacagccagattcacat gcaccctgagctatggcttcagtattgatagatatgttataagctggttccagcagaagg cagagagccttccctggtacctactgtactattactgatactcaagtacacagttgggct tcggcattcccagctgcgtctctggatccaagacaaggccacattcacaaatgagtagac ccatctctggttgggtctagagctccagccccacctgagactgatgcacaattgcagcca cattgtcttgatatcggaaa SEQIDNO.317IGLV5-124-1(P) >IGLV5-124-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtatagacccagtcaccctccctttctgcatctttggaacaacagtcagactca cctgtaccctgagcagtggctccagtgttggcagctactacatatactggttccaggaga agccatggagcaatccccggtatctcctgtactattcaggctcagatgagcaccagggct ctgggatccctagctgcttctcctgatccaaggatgcctcagccaaggcagagctccctc atctctgggctgcagcctgaggactagactgaccttcactgtctaatcagaaacaataat gcttct SEQIDNO.318IGLV5-125-1(P) >IGLV5-125-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagcgccctcccactctgcatccctgggaacaacagccagactca cctgcaccctgagcagcggctgcagcggtggccatatgctggttccagcagccagaaggc ctcctgagtacctgctgacggtctactgagactcaccagggcccctgggtcctcagcctc ttctctgactccaaagacacctcggccaatgcagggcactcagatggctgtgaagttcat acaacagggtcctcatgggggctcatggtaccacttcacgttt SEQIDNO.319IGLV5-126(P) >IGLV5-126*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgatgacccagctgtcctccctctcagcatccctggaaacaacaacaagactc acctgaaccctgagcagtggcttcagaaatgacagatgtgtaataagttggttccagcag aagtcagggagccctccctggtgtctcctgtactattactcggactcaagtacacatttg ggctctgaggttcccagctgcttctctggatccaagacaaggccacacccacactgagta gacccatccccgggtgggtctagagctccagccccactggaggctgatgcacaattgcag c SEQIDNO.320IGLV5-128-1(P) >IGLV5-128-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caacctttgcggacccagcgccctccctctctgcatctcctggaacaacagttagactca tctgcacccagagcagtggccccagtgttggcagctactacaaacactggttccagcaga agccacggagccctccccggtacctcctgtactactactcagactcagatgagcaccagg gctctggggaccacagccacttctcctgatccaaggatgcctcaggaaaggcagggctcc ctcatctctgggctacagcctgaggactagactgaccttcactgtctaatcagaaacaat aatgcttct SEQIDNO.321IGLV5-129-1(P) >IGLV5-129-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgaccagctgccctctctgcatccctgggaacaacaggcagatgtactta caccctgagcagttttggcagctactacacatactcgtcaaggagaatacagggagacct ccctggtatttcctgtactactactcagactcaactacatggttgggatttggggtcccc aaccacttctctggatccaaagatgcctcagccaatgcagggctcctgctcatctctggg ctgcagccagaggacaaggatgactgtcactgtgctgcatacatatcaaggcagtggaag cagctcccaatact SEQIDNO.322IGLV5-129-2(P) >IGLV5-129-2*01|Canislupusfamiliaris_boxer|P|V-REGION| ctgcctgtgctgacccagtgccctccctctctgcatccctgggaacaacagccagactca cctgcaccctgagcagtggctgcagcggtggccatatgctggttccagcagccaggaggc ctcctaagtacctgctgatggtctactgagactcatcacggtcctggggtccctagcctc ttctctggctccaaggacacctcggccaatgcagggctcctgctcatctctgggctgcag cctgaggacgaggctgactgtcattgtgctacagaccatggcagtgggagcagctcctga tact SEQIDNO.323IGLV5-131(F) >IGLV5-131*01|Canislupusfamiliaris_boxer|F|V-REGION| cagcctgtgctgacccagccaccctccctctctgcatccctgggaacaacagccagactc acctgcaccctgagcagtggcttcagtgttggtgactatgacatgtactggtaccagcag aagccagggagccctccccgggatctcctgtactactactcggactcatataaaaaccag ggctctggggtctccaaaagcttctctggatccaaggatacctcagccaatgcagggctc ctgctcatctctgggctgcagcctgaggacgaggctgactactactgtgctacagatcat ggcagtgagagcagctactcttacc SEQIDNO.324IGLV5-132-1(P) >IGLV5-132-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtatagacccagtcaccctccctttctgcatctttggaacaacagtcagactca cctgtaccctgagcagtggctccagtgttggcagctactacatatactggttccaggaga agccatggagcaatccccggtatctcctgtactactcaggctcagatgagcaccagggct ctgggatccctagctgtttctcctgatccaaggatgcctcagccaaggcagagctccctc atctctgggctgcagcctgaggactatactgaccttcactgtctaatcagaaacaataat gcttct SEQIDNO.325IGLV5-134(P) >IGLV5-134*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccctccctctctgcatccctgggaacaacagccagactc acctgcaccatgagcagcagctgcagcggtggccatatgctggtaccagcatgcaagagg cctcctgagtacctgctgatggtctactgagactcaccagggccctggggtccccagcct cttctctggctccaaggacaccttggccaatgcagggctcctgctcatctctgggctgca gcctgagaatgaggctgactgtcactgtgctacagaccatggcagtgggaacagctccca atact SEQIDNO.326IGLV5-134-1(P) >IGLV5-134-1*01|Canislupusfamiliaris_boxer|P|V-REGION| taaaaccaaaccaaaccaaaccaaaccaaaacaaaacaaaacaaaataacagccagattc acctgctccctgagcagtggcttcagtgttggtggctataacacactggtaccagcagaa gccagggagccctccctgttacctcctgtactactactcagaatcagataaacaccatgg ctccgggatcaccagctgcttccctggccctatggacacctcggccaatgcagggctcct gctcatccttgggctgcagcctgaggacgaggctgactactactgcggtatactccacag cagtgggagcagctactcttacc SEQIDNO.327IGLV5-135-1(P) >IGLV5-135-1*01|Canislupusfamiliaris_boxer|P|V-REGION| aagcctgtgctgacccagcgccctccctctctgcatccctgggaacaacagccagactca cctgcaccctgagcagcggctggagtggtggctataggctggttccagcagccaggaagc ctcctgagtacctgctgatggtctactgagactcaccaggctatggggtccccagcatct tctctggctccaaggaagcctcggccaatgcagggctcctgctcatctctggcctgcagc ctgaggtcgaggctgactgtcactgtgctacagaccatggcagtgggagcagctcccgat ac SEQIDNO.328IGLV5-137-1(P) >IGLV5-137-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctaacccagtcgctctccctcttgacatctttggaacaacagtcagactca cctgtaccgtgaacagtggctccagtgttggcagctattacatcaactggttccagtata agccatggagctctccctagtatcacctgtactactacttagactcagataagcaccagg gctctggggtccccagctgcttctcctgatccaaggatgcctcagtcattggagggcacc ctcatctctgggctgcagcctgaggactagactgaccttcacgtctaatcagaaacaata atgcttct SEQIDNO.329IGLV5-137-2(P) >IGLV5-137-2*01|Canislupusfamiliaris_boxer|P|V-REGION| ctgcctgtgctgacccagccgccctccctctctgcatccctgggatcaacagccagactc acctgcacactgagcagtggctgcagcggtggccatatgctggttccagcagccaggagg cctcctgtgtacctgctgatggtctactgagactcaccagggccccagtgtccccagcca ctactctggtttcaaagacacctcggccaatgcaggtcactcagatagctgcgaaattca tacaacaagggtcctcatggggactcatgggcaccccttcagattttcctgcctgcatga acag SEQIDNO.330IGLV5-138-1(P) >IGLV5-138-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagggatggcccagctgttcccccacctccctctgcatctccaggaacaacagccagact cacatgaaccatgagcagtggcttcattgttggcggctgctacatatactggttccaaca gaagccagggagtccccttccccccatatctcctgagtttctactcagactcagataagc accagggctcaaaatccccagccctgttctggatctgaagacacctcagccaaagcagcg cctctgctcatctctgggctgcagggtgaggataagaatgactcttactctacaatctgg SEQIDNO.331IGLV5-139-1(P) >IGLV5-139-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caacctttgcggacccagtgccctccctctctgcatctcctggaacaacagttagactca tctgcacccagagcagtggccccagtgttggcagctactacaaacactggttccagcaga agccacggagccctccccagtacctcctgtactacttctcagactcagatgagcaccagg gctctggggactgcagccacttcccctgatccaaggatgcctcaggaaagcagggctccc tcatctctgggctacagcctgaggactagactgaccttcactgtctaatcagaaacaata atgcttcttacagt SEQIDNO.332IGLV5-145(P) >IGLV5-145*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccctccctctctgcatccctgggaacaacattcagactc acctgcaccctgagcagcagctgcagcggtggccatatgctggttccagcatgcaagagg cctcctgagtacctactgatggtctactgagactcaccagggccctggggtccccagcct cttctccggctccaaggacaccttggccaatgcagggctcctgctcatctctgggctgca gcctgagaatgaggctgactgtcactgtgctacagaccatggcagtgggaacagctccca atact SEQIDNO.333IGLV5-145-1(P) >IGLV5-145-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgacgacacactcctccttcctctctgcacctttgggatcatcaaccagactc acctgcatccttcccagggcctgaatgttggcaggtactgaacatactggacaaggagaa tcaaggaggcatcaggagttccctcagatccagataagtgccagggcacggggttctcag ccacttctatggatctaatgatgcctcaggcaatgcaggtctcctgctcatgtctgggct gcagcctgaggacgaggctgactatgactatgctgcacattgtggggtgggagcagctcc cgatact SEQIDNO.334IGLV5-146-1(P) >IGLV5-146-1*01|Canislupusfamiliaris_boxer|P|V-REGION| aagcctgtgctgacccagcgccctttctctctgcatccctgggaacaacagccagactca cctgcaccctgagcagcggctggagtggtggctataggctggttccagcagccaggaagc ctcctgagtacctgctgatggtctactgagactcaccaggctatggggtccccagcatat tctctggctccaaggaagcctcggccaatgcagggctcctgctcatctctgggctgcagc ctgaggtcgaggctgactgtcactgtgctacagaccatggcagtgggagcagctcccgat act SEQIDNO.335IGLV5-148(P) >IGLV5-148*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcaccaaggatccatcactctcagtgtttccaggagggacagtcacattc acatgtggcctcagctctgggtcagtctttacaagtaactaccccagctggtaccagcag acccatggccgggctcctcacatgcttatctacagcacaagcagctgcccccccggggtc cctgatcgcttctctggatccatctctgggaacaaagttgccctcaccatcacaggagcc cagcctgaggatgagactattattgttcactgcgtatgggtagtacattta SEQIDNO.336IGLV5-148-1(P) >IGLV5-148-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctaacccagtcgccctccctcttgacatctttggaacaacagtcagactca cctgtaccgtgaacagtggctccagtattggcagctattacatcaactggttccaggaga agccatggagctctccctggtatcacctatactacttcttagactcagataagcaccagg gctctggggtccccagctgcttctcctgatccaaggatgcctcagtcattggagggcacc ctcatctctgggctgcagcctgaggactagactgaccttcactgtctaatcagaaacaat aatgcttct SEQIDNO.337IGLV5-148-2(P) >IGLV5-148-2*01|Canislupusfamiliaris_boxer|P|V-REGION| ctgcctgtgctgacccagccgccctccctctctgcatccctgggatcaacagccagactc acctgcacactgagcagtggctgcagcggtagccatatgctggttccagcagccaggagg cctcctgggtacctgctgatggtctactgagactcaccagggccccagtgtccccagcca ctactctggatgcaaagacacctcggccaatgcaggt SEQIDNO.338IGLV5-149-1(P) >IGLV5-149-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagggatggcccagctgttcccccacctccctctgcatctccaggaacaacagccagact cacatgaaccatgagcagtggcttcattgttggcggctgctacatatactggttccaaca gaagccagggagtccccttccccccatatctcctgagtttctactcagactcagataagc accagggctcaaaatccccagccctgttctggatctgaagacacctcagccaaagcagcg cctctgctcatctctgggctgcagggtgaggataagaatgactcttactctacaatctgg SEQIDNO.339IGLV5-150-2(P) >IGLV5-150-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caacctttgcggacccagcgcactccctctgcatctcctggaacaacagttagactcatc tgcacccagagcagtggccccagtgttggcagctactacaaacactggttccagcagaag ccacggagccctccccggtacttcctgtactacttctcagactcagatgagcaccagggc tctggggaccgcagccacttctcctgatccaaggatgactcaggaaaggcagggctccct catctctgggctacagcctgaggactagactgaccttcactgtctaatcagaaacaataa tgcttct SEQIDNO.340IGLV5-154-1(P) >IGLV5-154-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgatgacccagctgtcctccctctctgcatccctggaaacaacaaccagacac acctgcaccctgagcagtggcttcagaaataacagctgtgtaataagttgattccagcag aagtcagggagccctccctggtgtctcctgtactattactcagactcaagtatacatttg ggctctgaggttcccagctgcttctctggatccaagacaaggccacacccacactgagta gacccatccctgggtgggtctagagctccagccccactggaggctgatgcacaattgcag c SEQIDNO.341IGLV5-155-1(P) >IGLV5-155-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctaacccagtcgctctccctcttgacatctttggaacaacagtcagactca cctgtaccgtgaacagtggctccagtgttggcagctattacatcaactggttccagtata agccatggagctctccctagtatcacctgtactactacttagactcagataagcaccagg gctctggggtccccagctgcttctcctgatccaaggatgcctcagtcattggagggcacc ctcatctcggggctgcagcctgaggactagactgaccttcactgtctaatcagaaacaat aatgcttctaacagtga SEQIDNO.342IGLV5-157-1(P) >IGLV5-157-1*01|Canislupusfamiliaris_boxer|P|V-REGION|| cccagcgccctttctctctgcatccctgggaacaacagccagactcacctgcaccctgag cagcggctagagtggtggctataggctggttccagcagccaggaagcctcctgagtacct gctgatggtctactgagactcaccaggctatggggtccccagcatcttctctggctccaa ggacacctcggccaatgcagggctcctgctcatctctgggctgcagcctgaggtcgaggc tgactgtcactgtgctacagaccatggcagtgggagcagctcccgata SEQIDNO.343IGLV5-158-1(P) >IGLV5-158-1*01|Canislupusfamiliaris_boxer|P|V-REGION| ataacagccagattcacctgctccctgagcagtggcttcagtgttggtggctataacaca ctggtaccagcagaagccagggagccctccctgttacctcctgtactactactcagaatc agataaacaccatggctccgggatcaccagctgcttccctggccctatggacacctcggc caatgcagggctcctgctcatctcagggctgcagcctgaggacgaggctgactactactg cggtatactccacagcagtgggagcagctactcttacc SEQIDNO.344IGLV5-158-2(P) >IGLV5-158-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgacgacacactcctccttcctctctgcacctttgggatcatcaaccagactc acctgcatccttcccagggcctgaatgttggcaggtactgaacatactggacaaggagaa tcaaggaggcatcaggagttccctcagatccagataagtgccagggcacggggttctcag ccacttctatggatctaatgatgcctcaggcaatgcaggtttcctgctcatgtctgggct gcagcctgaggacgaggctgactatgactatgctgcacattgtggggtgggagcagctcc cgatact SEQIDNO.345IGLV5-158-3(P) >IGLV5-158-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagcctgtgctgacccagccgccctccctctctgcatccctgggaacaacattcagactc acctgcaccctgagcagcagctgcagcggtggccatatgctggttccagcatgcaagagg cctcctgagtacctactgatggtctactgagactcaccagggccctggggtccccagcct cttctctggctccaaggacaccttggccaatgcagggctcctgctcatctctgggctgca gcctgagaatgaggctgactgtcactgtgctacagaccatggcagtgggaacagctccca atact SEQIDNO.346IGLV7-32-2(P) >IGLV7-32-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtggtgactccagagcccttctgaccatccccaggagtgacagtcacttttacc tgtgactccagcactggagagtcattaatagtgactatccacgttagttccagcagaagc ctagacaaactcgcaccacacacacaacaaacactcacggactcccacccagttctcagg ctccctccaggctcaaaactgccctcacctttttggggtcccagcctgagaaagaaggtg agtactaccatatgctggtctatcttggttcttgg SEQIDNO.347IGLV7-33(P) >IGLV7-33*01|Canislupusfamiliaris_boxer|P|V-REGION|| caggctgtggtgactcaggaaccctcactgaccgtgtccctggagggacagtcactctca cctgtgcctccagcactggcgaggtcaccaatggacactatccatactggttccagcaga agcctggccaagtccccaggacattgatttataatacacacataatactcctggacccct acccggttctcaggctgcctctttgggggcaaagctgccttgaccatcacaggggcccag cccgaggatgaagctgaggactactgctggctagtatatatggtaatagg SEQIDNO.348IGLV7-36-1(P) >IGLV7-36-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtggtgattcaggaatcctcactaacagtgcccccaggaggaacactctcacct gtgcctcgaacactggcacagtcaccaatgtcagtatccttactggtttcagcagaaccc tagtcaagtccccagggcattgacttaggatacaagcaataaacacttctggatccctac caagctttcagtttccctccttggatgtaaaactcccctgaccttctctggttccctagc ctgaggccaaggctgattaccactggtgggtactcatagtggtgctgca SEQIDNO.349IGLV7-38-2(P) >IGLV7-38-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caggtcatggtgactcaggagccttcatggccatgtccccaggagggacagtcactctca cctatgcctccagcacaggacactatccatactggatccaagaaaatattggccaagtca gggccatttatttataataaaaacaacaaatactgatttctcatgctcccttcttgggag caaatctgacatgaccatctcctagtgcccagcctgaggacgaggatgagtacccatggg ggctacactatagtggtgctggg SEQIDNO.350IGLV7-43-1(P) >IGLV7-43-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtgactcaggagccttcatggtcgtgtccccaggagggacagtcactctca ctatgcctccagcacagaacactatccatactggatccaggaaaatattggccaagtcta gagcatttatttataaaagaaacaataaatactgatttctaggctcccttcttgggaata aatctgacttgaccatctgctagtgcgcagcctgaggacgaggctgagtacccctagggg ttacac SEQIDNO.351IGLV7-44-1(P) >IGLV7-44-1*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgatgactcaggagtcctcactaacagtgtccccaggagggacattcactctc acctgtgcctccagccactggcatagtaacaatgctcagtatccttcctggttttaccag aagcctggccaagttcccagggcattgatttaggatacaagcaatgaaaattcctggacc cccaccaagtgctcaggttccctttgtggagcaatattctcctgaccctctacagtgcct tggtgagaacatagctgagtggcactggtggctgcttttattgtgatgctgggtgc SEQIDNO.352IGLV7-84-2(P) >IGLV7-84-2*01|Canislupusfamiliaris_boxer|P|V-REGION| caggctgtgatgactcaagagtcctcactaacagtgtccccaggagggacattcactctc acctgcgcctccagctactggcatagtaacaatgctcagtatccttactggttttagcag aatcctggccaagtccccagggcattgatttaggatacaagcaatgaacacacctggacc cccaccatgtgctcaggttccctttgtggagcaatattctcctgaccctctacagtgcct tggtgagaacatagctgagtggcactggtggctgcttttattgtgatg SEQIDNO.353IGLV7-90-2(P) >IGLV7-90-2*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtggcataggagccttcatggccatatccccaggagggacagtcactctca cctatccctccagcacaggacactatctatactggatctagtagcatactggccaagtct aggtcatttatttataataaaaacaataaatactcatagacctccactcatttctcaggc tcccatcttgggggcaaatctgactggattgtcccctagtgcccagcctgaggatgaggc tgagtaccgctggggctacactatggtggtgtggg SEQIDNO.354IGLV7-120-1(P) >IGLV7-120-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtggcataggagccttcatggccatatccccaggagggacagtcactctca cctatccctccagcacaggacactatctatactggatctagtagcatactggccaagtct aggtcatttatttataataaaaacaataaatactcatagacctccactcatttctcaggc tcccatcttgggggcaaatctgactggattgtcccctagtgcccagcctgaggatgaggc tgagtaccgctggggctacactatggtggtgtggg SEQIDNO.355IGLV8-36(F) >IGLV8-36*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtgacccaggagccatcactctcagtgtctctgggagggacagtcaccctc acatgtggcctcagctccgggtcagtctctacaagtaactaccccaactggtcccagcag accccagggcaggctcctcgcacgattatctacaacacaaacagccgcccctctggggtc cctaatcgcttcactggatccatctctgggaacaaagccgccctcaccatcacaggagcc cagcctgaggacgaggctgactactactgtgctctgggattaagtagtagtagtagtta SEQIDNO.356IGLV8-39(F) >IGLV8-39*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtaacccaggagccatcactctcagtgtctccaggagggacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaaccaccctagctggtaccagcag acccaagggaaggctcctcgcatgcttatctacaacacaaacaaccgcccctctgggatc cctaattgcttctctggatccatctctgggaacaaagcctccctcaccatcacaggagcc cagcctgaggacgagactgactattactgtttattgtatatgggtagtaacattta SEQIDNO.357IGLV8-40(P) >IGLV8-40*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtgacccaggagccatcactctaagtttctccaggagggacagtcacactc acatgtggcctcagctctgggtcagtccctacaagtaactaccccagctggtttcagcag accccaggccgggctcctagaacagttatctacaacacaaacagctgcccctctggggtc cctaatcgcttcactggatccatctctggcaacaaagccgccctcaccatcacaagagcc cagcctgaggatgaggctgactcctgctgtgctgaatatcaaagcagtgggagcagctac acttacc SEQIDNO.358IGLV8-43(P) >IGLV8-43*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtaacccaggaaccatcactctcagtgtctccatgagggacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaactaccccaactggtaccagcag acccaaggccgggctcctcacagggttatctacaacacaaacaaccgcccctctggggtc cctgatcgcttctctggatccatctctgggaacaaagccgccctcaccatcacagctgcc cagcctgaggacgaggctgactattactgttcattgtatatgggtagtaacatttg SEQIDNO.359IGLV8-60(P) >IGLV8-60*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtgatcacccaagatacatcactctcagtgtctccaggagggacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaactaccccagctggtaccagcag acccaaggccgggatcctcgcatgcttatctacagcacaaacagccacccctctggggtc cctaattgcttcactagatccatctctgggaagaaagctgccctcaccatcacaggagcc cagcctgaggatgagactattattgttcactaaatatgggtagtacatgta SEQIDNO.360IGLV8-71(P) >IGLV8-71*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtgacccaggacccatcactgtcagtgtctagaggagggacagtcacactc acttgtggcctcagctctgggtcagtcactacaataaataccccagctggtcccagcaga ccccagggcaggctcctcgcatgattatctatgacacaaacagccgcccctctggggtcc ctgatcgcttctctggatccatctgtgggaacaaagctgccctcaccatcacaggagccc atcctgaggatgagactgactactactgtggtatacaacatggcagtgggagcagcctca cttacc SEQIDNO.361IGLV8-74-1(ORF) >IGLV8-74-1*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagattgtggtgacccaggagccatcactgtcagtgtctccaggaggaacagttacactc acatgtggcctaagctctgggtcagtcactataagtaactaccctgattggtaccagcag actccaggcaggtctcctcgcatgcttatctacaacacaaacaaccgcccctctggggtc cctaatcacttctctggatccatctctgggaacaaagccgccctcaccatcacaggagcc cagcctgaggatgaggcttactactactgtgctgtgtatcaaggcagtgggagcagctac acttacc SEQIDNO.362IGLV8-76-1(P) >IGLV8-76-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcacccaggatccatcactctcagtgtctccaggaggaacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaactaccccggctggtaccagcag acccaagtgaaagctccttgcatgcttatctacagcacaaacagctacccctctggggtt cctaattgcttcactggatccatctctgggaagaaagctgccctcaccatcacaggagac cagcctgaggatgagactattattgttcactgcatatgggtagtacactta SEQIDNO.363IGLV8-88-4(P) >IGLV8-88-4*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtggctcaggagtcatcagtctcagtgtctccaggagggacagtcacactc acttgtggcctcagctctgggtcagtgactacaagtaactaccacagctggtaccagcgg acccaaggccggtctcctcacatgcttatctatgacacaagcagccgtccttctgaggtc ctgatcgcttccctggttccatctctgggaacaaagctgccctcactgtcagaggagccc agcctgaggacgaggctgactactactgtggcatgcatgatgtcagtgggaggaattaca attacc SEQIDNO.364IGLV8-89-3(P) >IGLV8-89-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtggccaggaggcattgttgtcagtgtctccaggagggagagtcacactca cttgtggcctcagctctgggtcagtcactacaagtaactaccccaactggttccagcaga ccccagggcgggctcctggcacgattatctacagcacaaaagactgcccctctggggtcc ctgactgcttctctagatccatctctgggaacaaagccgccctcaccatcacaggagccc agtctgaggacgaggctattactgttttacacgacatggtagtgggagctgctacactta cc SEQIDNO.365IGLV8-90(P) >IGLV8-90*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtaacccaggagccatcactctcagtgtctccaggagggacagtcacactc acttgtggcctcagctctgggtcagtctctacaggtaacaaacctggctggtaccagcac accccaggccaggctcctcgcaggattatctatgacacaagcagccgcccttctggggtc cctgatcgcttctctggatccatctctgagaacaaaactgccctcaccatcacagaagcc caacctgaggatgaggctgactacatcatatatgagtggtggtgctta SEQIDNO.366IGLV8-90-1(P) >IGLV8-90-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtgacccaggaggcatcgttgttagtgtctcctggagggatagtcacactc acttgtggcctcagctctggatcaatcactacaagtaactaccccaactggctccagcag accccagggcgggctcctcgcagatgatctatggcacaaaaagccgcccctctggggtcc ctgatcgcttctgtagatccatctctgggaacaaagccgccctcaccatcacaggagccc agtctgaggatgaggctgactattactgttttacacgacatggcagtgggagcagctaca attac SEQIDNO.367IGLV8-90-3(P) >IGLV8-90-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtgacccaggagtcatcagtctcagtgtctccaggaggaacagtcacactc ccttgtggcctcagctctgggtcactgactacaagtaacactacaccagctggtaccagc agacccaaggccagtctcctcgcatgcttgtctatgacacaagcagctgtccctctgagg ttcctgatcacttctctggatccatttctgggaacaaagccaccctcaccatcacaggag cccagcctgaggacgaggctgactactactgtggcatgcatgatgtcagtgggagcagct aaaattacc SEQIDNO.368IGLV8-90-4(P) >IGLV8-90-4*01|Canislupusfamiliaris_boxer|P|V-REGION| catattttggtgactcaggagccatcactgtcagtgtctccatgagggacagtcacactc acttgtggcctcagctctgggtcagtcactacaagtaactaccccaggtataccagcaga acccaggcaaggctcctagcacagttatctacaacaaaaacagctgcccctctggggtcc atggtcgattctctggatccatctctggaagcaaagccgccttcacaatcacaggagccc agcctgaggttgaggctgactactactgtgttacagaacatggctcctcacatgggaaca gcctcactcac SEQIDNO.369IGLV8-92-1(P) >IGLV8-92-1*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcacccaggatccgtcactctcagtgtctccaggagggacagtcacattc acatgtggcctcagctctgggtaagtctctacaagaaactaccccagctggtaccagcag acccaaggccaggctccttgcatgcttatctacagcacaagcagacacccttctggggtc cctgatcgcttctctggatccatctctgggaacaaagtcgccctcaccatcacaggagcc cagcctgaggataagactattattgttcactgcatatgggtagtacattta SEQIDNO.370IGLV8-93(F) >IGLV8-93*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtaacccaggagccatcactctcagtgtctccaggagggacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaattaccctggctggtaccagcag acccaaggccgggctcctcgcacgattatctacaacacaagcagccgcccctctggggtc cctaatcgcttctctggatccatctctggaaacaaagccgccctcaccatcacaggagcc cagcccgaggatgaggctgactattactgttccttgtatacgggtagttacactga SEQIDNO.371IGLV8-99(F) >IGLV8-99*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtcacccagaagccatcactctcagtgtctccaggagggacagtcacactc atatgtggcttcagctctgggtcagtctctacaagtaattaccctggctggtaccagcag acccaaggccgggcttctcgcacaattatctacagcacaagcagccgcccctctggggtc cctaatcgcttccctggatccatctctgggaacaaagccgccctcaccatcacaggagcc cagcctgaggacgaggctgactattactgttccttgtatatgggtagttacactga SEQIDNO.372IGLV8-102(ORF) >IGLV8-102*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagattgtagtgacccaggaaccatcactgtctccaggagggacagtcctactcacttgt ggcctcagctctgggtcagtcactacaagtaactactccagctggtaccagcagacccca gggcgggctcctcgcacgattatctacaacactaacagccacccctctggagtccctgat cgcttctctggatccatctctgggaacaaagcggcgctcaccatcacaggagcccagcct gaggacgaggctgactactactgtgttacagaacatggtagtgggagcagcttcacttac SEQIDNO.373IGLV8-108(F) >IGLV8-108*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtgactcaggagtcatcagtctcagtgtctccaggagggacagtcacactc acgtgtgacctcagctctgggtcagtgactacaagtaacaaccccagctggtaccagcag acccaaggccgatctcctcgcatgcttatctatgacacaagcagctgtccctcggaggtc cctgatcgcttctctggatccatttctgggaacacagctgccctcaccatcacaggagcc cagcctgaggacaaggctgactactactgtagtatgcatgatgtcagtgggagcagctac aattacc SEQIDNO.374IGLV8-113(P) >IGLV8-113*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcacccaggagccatcactctcagtgtctccaggagggacagtcacactc acatgtggcctcagttctgggtcagtcactataagtaactaccccagctggtcccagcag accccagggcaggctcctcacacaataatctacaggacaaacagctgaccctctggggtc cctgatcgcttctctggatccatctctgggaacaacgccgccctcagcatcacagtcgcc cagcctgaggacgaggctgactattactgttcattgtatatgggtagtaacattta SEQIDNO.375IGLV8-113-3(P) >IGLV8-113-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtgacccaggagccatcactctcagtgtctagaggagggacagtcacactc acttgtggcctcagctctgagtcaatcactacaactaccccagctgatcccagcagaccc cagggcaggctcctcacacaattatctatgacaaaaacagccgcccctctggggtccctg atcacttctcaggatccatctgtgggaacaaagccaccctcaccatcacaggaacccagc ctgaggacaaggctgactactactgtggtatccaacatggcagtaggaggagcctcatta acc SEQIDNO.376IGLV8-117(P) >IGLV8-117*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgttgtgactcaggagtcatcagtctcagtgtctccaggagggacagtaacactc acgtgtagcctcagctctgggtcagtgactacaagtaagtactccagctggaccagtaga cccaaggccgatctcctcgcatgcttatctatgacacaagcagccgtccctctgaggtcc ctgatcgcttctctggatccatctccgggaacaaagctgccctcaccatcacaggagccc agcctgaggacgaggctgactactactgtggtatgcatgatgtcagtgggaggagttaca attacc SEQIDNO.377IGLV8-118-3(P) >IGLV8-118-3*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtggccaggaggcattgttgtcagtgtcctctggagggagagtcacactca cttgtggcctcagctctgggtcagtcactacaagtaactaccccaactggttccagcaga ccccagggcgggctcctggcacgattatgtacagcacaaaagactgcccctctggggtcc ctgattgcttctctagatccatctctgggaacaaagccgccctcaccatcacaggagccc agtctgaggacgaggttattactgttttacacgacatggtagtgggagctgctacactta cc SEQIDNO.378IGLV8-119(P) >IGLV8-119*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtaacccaggagccatcactctcagtgtctccaggagggacagtcacactc acttgtggcctcagctctgggtcagtctctacaggtaacaaacctggctggtaccagcac accccaggccaggctcctcgcaggattatctatgacacaagcagccgcccttctggggtc cctgatcgcttctctggatccatctctgagaacaaagctgccctcaccatcacagaagcc cagcctgaggatgaggctgcctaccactgttcgctgtatatgagtggtggtgctta SEQIDNO.379IGLV8-120(P) >IGLV8-120*01|Canislupusfamiliaris_boxer|P|V-REGION| cagattgtggtgacccaggaggcatcgttgtcagtgtctcctggagggatagtcacactc acttgtggcctcagctctggatcaatcactacaagtaactaccccaactggttccagcag accccagggcgggctcctcgcagatgatctatggcacaaaaagccgcccctctggggtcc ctgatcgcttctgtagatccatctctgggaacaaagccgccctcaccatcacaggagccc agtctgaggatgaggctgactattactgttttacacgacatggcagtgggagcagctaca attacc SEQIDNO.380IGLV8-121(P) >IGLV8-121*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtgacccaggagtcatcagtctcagtgtctccagtcggaacagtcacactc acttgtggcctcagctctgggtcactgactacaagtaactacaccagctggtaccagcag acccaaggccagtctcctcgcatgcttgtctatgacacaagcagctgtccctctgaagtt cctgatcacttctctggatccatttctgggaacaaagccgccctcaccatcacaggagcc cagcctgaggacgaggctgactactactgtggtatgcatgatgtcagtgggagcagctaa aattacc SEQIDNO.381IGLV8-121-1(P) >IGLV8-121-1*01|Canislupusfamiliaris_boxer|P|V-REGION| catattttggtgactcaggagccatcactgtcagtgtctccatgagggacagtcacactc acttgtggcctcagctctgggtcagtcactacaagtaactaccccaggtataccagcaga acccaggcaaggctcctagcacagttatctacaacaaaaacagctgcccctctggggtcc atggtcgattctctggatccatctctggaagcaaagccgccttcacaatcacaggagccc agcctgaggttgaggctgactactactgtgttacagaacatggctcct SEQIDNO.382IGLV8-124(P) >IGLV8-124*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcaaccaggatccgtcactctcagtgtctccaggagggacagtcacattc acatgtggcctcagctctgggtaagtctctgcaagaaactaccccagctggtaccagcag acccaaggccaggctccttgcatgcttatctacagcacaagcagccgcccttctggggtc cctgatcgcttctctggatccatctctgggaacaaagtcgccctcaccatcacaggagcc cagcctgaggatgagactattattgttcactgcatatgggtagtacattta SEQIDNO.383IGLV8-128(F) >IGLV8-128*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtaacccaggagccatcactctcagtgtctccaggagggacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaattaccctggctggtaccagcag accctaggccgggctcctcgcacgattatctacagaacaagcagccgcccctctggggtc cctaatcgcttctctggatccatctctgggaacaaagccgccctcaccatcacaggagcc cagcctgaggacgaggctgactattactgttccttgtatatgggtagttacactga SEQIDNO.384IGLV8-137(P) >IGLV8-137*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcaccaaggatccatcactctcagtgtctccaggagggacagtcacattc acatgtggcctcagctctgggtcagtctttacaagtaactaccccagctggtaccagcag acccatggccgggctcctcgcatgcttatctacagcacaaggagctgcccccccggggtc cctgatcgcttctctggatccatctctgggaacaaagttgccctcaccatcacaggagcc cagcctgaggatgagactattattgttcactgtgtatgggtagtacattta SEQIDNO.385IGLV8-142(F) >IGLV8-142*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtcacccagaagccatcactctcagtgtctccaggagggacagtcacactc atatgtggcctcagctctgggtcagtctctacaagtaattaccctggctggtaccagcag acccaaggccgggcttctcgcacaattatctacagcacaagcagccgcccctctggggtc cctaatcgcttcactggatccatctctgggaacaaagccgccctcaccatcacaggagcc cagcctgaggacgaggctgactattactgttccttgtatatgggtagttacactga SEQIDNO.386IGLV8-150-1(ORF) >IGLV8-150-1*01|Canislupusfamiliaris_boxer|ORF|V-REGION| cagattgtggtgacccaggaaccatcactgtcagtgtctccaggagggacactcacactc acttgtggcctcagctctgggtcagtcactacaagtaactaccccagctggtaccagcag accccaggccaggctcctagcacagttatctacaacacaaacagccgcccctctggtgtc cctgatcacttctctggatccgtctctgggaacaaagccgccctcatcatcacaggagcc cagcctgaggacgaggctgatgactactctgttgcagaacatgtcagtgggagcagcttc acttacc SEQIDNO.387IGLV8-153(F) >IGLV8-153*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtaacccaggagccatcactctcagtgtctccaggagggacagtcacactc acatgtggcctcagctctgggtcagtctctacaagtaattaccctggctggtaccagcag acccaaggccgggctcctcgcacgattatctacaacacaagcagccgcccctctggggtc cctaatcgcttctctggatccatctctggaaacaaagccgccctcaccatcacaggagcc cagcccgaggatgaggctgactattactgttccttgtatacgggtagttacactga SEQIDNO.388IGLV8-156(P) >IGLV8-156*01|Canislupusfamiliaris_boxer|P|V-REGION| cagactgtggtcaccaaggatccatcactctcagtgtttccaggagggacagtcacattc acatgtggcctcagctctgggtcagtctttacaagtaactaccccagctggtaccagcag acccatggccgggctcctcgcatgcttatctacagcacaagcagctgcccccccggggtc cctgatcgcttctctggatccatctctgggaacaaagttgccctcaccatcacaggagcc cagcctgaggatgagactattattgttcactgtgtatgggtagtacattta SEQIDNO.389IGLV8-161(F) >IGLV8-161*01|Canislupusfamiliaris_boxer|F|V-REGION| cagactgtggtcacccagaagccatcactctcagtgtctccaggagggacagtcacactc atatgtggcctcagctctgggtcagtctctacaagtaattaccctggctggtaccagcag acccaaggccgggcttctcgcacaattatctacagcacaagcagccgcccctctggggtc cctaatcgcttccctggatccatctctgggaacaaagccgccctcatcatcacaggagcc cagcctgaggacgaggctgactattactgttccttgtatatgggtagttacactga GermlineJ.sub.sequences SEQIDNO.390IGLJ1(F) >IGLJ1*01|Canislupusfamiliaris_boxer|F|J-REGION| ttgggtattcggtgaagggacccagctgaccgtcctcg SEQIDNO.391IGLJ2(F) >IGLJ2*01|Canislupusfamiliaris_boxer|F|J-REGION| tatggtattcggcagagggacccagctgaccatcctcg SEQIDNO.392IGLJ3(F) >IGLJ3*01|Canislupusfamiliaris_boxer|F|J-REGION| tagtgtgttcggcggaggcacccatctgaccgtcctcg SEQIDNO.393IGLJ4(F) >IGLJ4*01|Canislupusfamiliaris_boxer|F|J-REGION|| ttacgtgttcggctcaggaacccaactgaccgtccttg SEQIDNO.394IGLJ5(F) >IGLJ5*01|Canislupusfamiliaris_boxer|F|J-REGION| tattgtgttcggcggaggcacccatctgaccgtcctcg SEQIDNO.395IGLJ6(F) >IGLJ6*01|Canislupusfamiliaris_boxer|F|J-REGION| tggtgtgttcggcggaggcacccacctgaccgtcctcg SEQIDNO.396IGLJ7(F) >IGLJ7*01|Canislupusfamiliaris_boxer|F|J-REGION| tgctgtgttcggcggaggcacccacctgaccgtcctcg SEQIDNO.397IGLJ8(F) >IGLJ8*01|Canislupusfamiliaris_boxer|F|J-REGION| tgctgtgttcggcggaggcacccacctgaccgtcctcg SEQIDNO.398IGLJ9(F) >IGLJ9*01|Canislupusfamiliaris_boxer|F|J-REGION| ttacgtgttcggctcaggaacccaactgaccgtccttg
TABLE-US-00004 TABLE4 Canineconstantregiongenes IGHCsequences Functionalityisshownbetweenbrackets,[F]and[P],whenthe accessionnumber(underlined)referstorearrangedgenomicDNA orcDNAandthecorrespondinggermlinegenehasnotyetbeen isolated. IGHA(F) SEQIDNO.399 >IGHA*01|Canislupusfamiliaris_boxer|F|CH1| nagtccaaaaccagccccagtgtgttcccgctgagcctctgccaccaggagtcagaaggg tacgtggtcatcggctgcctggtgcagggattcttcccaccggagcctgtgaacgtgacc tggaatgccggcaaggacagcacatctgtcaagaacttcccccccatgaaggctgctacc ggaagcctatacaccatgagcagccagttgaccctgccagccgcccagtgccctgatgac tcgtctgtgaaatgccaagtgcagcatgcttccagccccagcaaggcagtgtctgtgccc tgcaaa SEQIDNO.400 >IGHA*01|Canislupusfamiliaris_boxer|F|H-CH2| gataactgtcatccgtgtcctcatccaagtccctcgtgcaatgagccccgcctgtcacta cagaagccagccctcgaggatctgcttttaggctccaatgccagcctcacatgcacactg agtggcctgaaagaccccaagggtgccaccttcacctggaacccctccaaagggaaggaa cccatccagaagaatcctgagcgtgactcctgtggctgctacagtgtgtccagtgtccta ccaggctgtgctgatccatggaaccatggggacaccttctcctgcacagccacccaccct gaatccaagagcccgatcactgtcagcatcaccaaaaccaca SEQIDNO.401 >>IGHA*01|Canislupusfamiliaris_boxer|F|CH3-CHS| gagcacatcccgccccaggtccacctgctgccgccgccgtcggaagagctggccctcaat gagctggtgacactgacgtgcttggtgaggggcttcaaaccaaaagatgtgctcgtacga tggctgcaagggacccaggagctaccccaagagaagtacttgacctgggagcccctgaag gagcctgaccagaccaacatgtttgccgtgaccagcatgctgagggtgacagccgaagac tggaagcagggggagaagttctcctgcatggtgggccacgaggctctgcccatgtccttc acccagaagaccatcgaccgcctggcgggtaaacccacccacgtcaacgtgtctgtggtc atggcagaggtggacggcatctgctac SEQIDNO.402 >>IGHA*01|Canislupusfamiliaris_boxer|F|M| gactcacagtgtcttgcaggttaccgggagccacttccctggctggtgctggacctgtcg caggaggacctggaggaggatgccccaggagccagcctgtggcccactaccgtcaccctt ctcaccctcttcctactgagtctcttctacagcacagcactgactgtgacaagcgtgcgg ggcccaactgacagcagagagggcccccagtac IGHD(ORF) SEQIDNO.403 >>|IGHD*01|Canislupusfamiliaris_boxer|ORF|CH1| gaatcgtcacttctgctccccttggtctcaggatgtaaggtcccaaaaaatggtgaggac ataaccctggcctgcttggcaaaaggacccttcctagattctgtgcgggtcacgacaggc ccagagtcacaggcccagatggaaaagaccacactgaagatgctaaagataccggaccac actcaggtgtctctcctgtccaccccctggaaaccaggcctgcactactgcgaagccatc aggaaagataacaaagagaagctgaagaaagccatccactggcca SEQIDNO.404 >>IGHD*01|Canislupusfamiliaris_boxer|ORF|H1| gcatcctgggaaactgctatctccctgttgactcatgcgccatcccgaccccaggaccac acccaagcccccagcatggccagggtctca SEQIDNO.405 >>IGHD*01|Canislupusfamiliaris_boxer|ORF|H2| gtgcctcccaccagccacacccagacgcaagcccaggagccaggatgcccagtggacacc atcctcaga SEQIDNO.406 >>IGHD*01|Canislupusfamiliaris_boxer|ORF|CH2| gagtgttggaaccacacccaccctcccagcctctacatgctgcgccctcccctgcgggga ccatggctccagggagaagctgctttcacctgcctggtggtgggagatgaccttcagaag gcccacctgtcctgggaggtagccggggcgccccccagcgaggctgtggaggagaggcca ctgcaggagcatgagaatggctcccagagctggagcagccgcctggtcttgcccatatcc ctgtgggcctcaggagccaacatcacctgcacgctgagcctccccagcatgccttcccag gtggtgtccgcagcagccagagagcat SEQIDNO.407 >>IGHD*01|Canislupusfamiliaris_boxer|ORF|CH3| gctgccagagcacccagcagcctcaatgtccatgccctgaccatgcccagagcagcctcc tggttcctgtgcgaggtgtccggcttctcaccccctgacatcctcctcacctggatcaag gaccagattgaggtggacccttcttggttcgccactgcaccccccatggcccagccgggc agtggcacgttccagacctggagtctcctgcgtgtcctcgctccccagggccctcacccg cccacctacacgtgtgtagtcaggcacgaggcctcccggaagctgctcaacaccagctgg agcctggacagt SEQIDNO.408 >>IGHD*01|Canislupusfamiliaris_boxer|ORF|M1| ggtctgaccatgacccccccagcccctcagagccacgacgagagcagcggggactccatg gatctggaagatgccagcggactgtggcccacgttcgctgccctcttcgtcctcactctg ctctacagcggcttcgtcaccttcctcaaa SEQIDNO.409 >>IGHD*01|Canislupusfamiliaris_boxer|ORF|M2| gtgaag IGHE(F) SEQIDNO.410 >IGHE*01|Canislupusfamiliaris_boxer|F|CH1| nccaccagccaggacctgtctgtgttccccttggcctcctgctgtaaagacaacatcgcc agtacctctgttacactgggctgtctggtcaccggctatctccccatgtcgacaactgtg acctgggacacggggtctctaaataagaatgtcacgaccttccccaccaccttccacgag acctacggcctccacagcatcgtcagccaggtgaccgcctcgggcgagtgggccaaacag aggttcacctgcagcgtggctcacgctgagtccaccgccatcaacaagaccttcagt SEQIDNO.411 >IGHE*01|Canislupusfamiliaris_boxer|F|CH2| gcatgtgccttaaacttcattccgcctaccgtgaagctcttccactcctcctgcaacccc gtcggtgatacccacaccaccatccagctcctgtgcctcatctctggctacgtcccaggt gacatggaggtcatctggctggtggatgggcaaaaggctacaaacatattcccatacact gcacccggcacaaaggagggcaacgtgacctctacccacagcgagctcaacatcacccag ggcgagtgggtatcccaaaaaacctacacctgccaggtcacctatcaaggctttaccttt aaagatgaggctcgcaagtgctca SEQIDNO.412 >IGHE*01|Canislupusfamiliaris_boxer|F|CH3| gagtccgacccccgaggcgtgagcagctacctgagcccacccagcccccttgacctgtat gtccacaaggcgcccaagatcacctgcctggtagtggacctggccaccatggaaggcatg aacctgacctggtaccgggagagcaaagaacccgtgaacccgggccctttgaacaagaag gatcacttcaatgggacgatcacagtcacgtctaccctgccagtgaacaccaatgactgg atcgagggcgagacctactattgcagggtgacccacccgcacctgcccaaggacatcgtg cgctccattgccaaggcccct SEQIDNO.413 >IGHE*01|Canislupusfamiliaris_boxer|F|CH4-CHS| ggcaagcgtgcccccccggatgtgtacttgttcctgccaccggaggaggagcaggggacc aaggacagagtcaccctcacgtgcctgatccagaacttcttccccgcggacatttcagtg caatggctgcgaaacgacagccccatccagacagaccagtacaccaccacggggccccac aaggtctcgggctccaggcctgccttcttcatcttcagccgcctggaggttagccgggtg gactgggagcagaaaaacaaattcacctgccaagtggtgcatgaggcgctgtccggctct aggatcctccagaaatgggtgtccaaaacccccggtaaa SEQIDNO.414 >IGHE*01|Canislupusfamiliaris_boxer|F|M1| gagctccaggagctgtgcgcggatgccactgagagtgaggagctggacgagctgtgggcc agcctgctcatcttcatcaccctcttcctgctcagcgtgagctacggcgccaccagcacc ctcttcaag SEQIDNO.415 >IGHE*01|Canislupusfamiliaris_boxer|F|M2| gtgaagtgggtactcgccaccgtcctgcaggagaagccacaggccgcccaagactacgcc aacatcgtgcggccggcacag IGHG1[F] SEQIDNO.416 >AF354264|IGHG1*01|Canislupusfamiliaris|(F)|CH1|| gcctccaccacggccccctcggttttcccactggcccccagctgcgggtccacttccggc tccacggtggccctggcctgcctggtgtcaggctacttccccgagcctgtaactgtgtcc tggaattccggctccttgaccagcggtgtgcacaccttcccgtccgtcctgcagtcctca gggcttcactccctcagcagcatggtgacagtgccctccagcaggtggcccagcgagacc ttcacctgcaacgtggtccacccagccagcaacactaaagtagacaagcca SEQIDNO.417 >IGHG1*01|Canislupusfamiliaris|(F)|H| Gtgttcaatgaatgcagatgcactgatacacccccatgccca SEQIDNO.418 >IGHG1*01|Canislupusfamiliaris|(F)|CH2| gtccctgaacctctgggagggccttcggtcctcatctttcccccgaaacccaaggacatc ctcaggattacccgaacacccgaggtcacctgtgtggtgttagatctgggccgtgaggac cctgaggtgcagatcagctggttcgtggatggtaaggaggtgcacacagccaagacccag tctcgtgagcagcagttcaacggcacctaccgtgtggtcagcgtcctccccattgagcac caggactggctcacagggaaggagttcaagtgcagagtcaaccacatagacctcccgtct cccatcgagaggaccatctctaaggccaga SEQIDNO.419 >IGHG1*01|Canislupusfamiliaris|(F)|CH3-CHS| gggagggcccataagcccagtgtgtatgtcctgccgccatccccaaaggagttgtcatcc agtgacacagtcagcatcacctgcctgataaaagacttctacccacctgacattgatgtg gagtggcagagcaatggacagcaggagcccgagaggaagcaccgcatgaccccgccccag ctggacgaggacgggtcctacttcctgtacagcaagctctctgtggacaagagccgctgg cagcagggagaccccttcacatgtgcggtgatgcatgaaactctacagaaccactacaca gatctatccctctcccattctccgggtaaa IGHG2(F) SEQIDNO.420 >IGHG2*01|Canislupusfamiliaris_boxer|F|CH1| ncctccaccacggccccctcggttttcccactggcccccagctgcgggtccacttccggc tccacggtggccctggcctgcctggtgtcaggctacttccccgagcctgtaactgtgtcc tggaattccggctccttgaccagcggtgtgcacaccttcccgtccgtcctgcagtcctca gggctctactccctcagcagcatggtgacagtgccctccagcaggtggcccagcgagacc ttcacctgcaacgtggcccacccggccagcaaaactaaagtagacaagcca SEQIDNO.421 >|IGHG2*01|Canislupusfamiliaris_boxer|F|H| Gtgcccaaaagagaaaatggaagagttcctcgcccacctgattgtcccaaatgccca SEQIDNO.422 >IGHG2*01|Canislupusfamiliaris_boxer|F|CH2| gcccctgaaatgctgggagggccttcggtcttcatctttcccccgaaacccaaggacacc ctcttgattgcccgaacacctgaggtcacatgtgtggtggtggatctggacccagaagac cctgaggtgcagatcagctggttcgtggacggtaagcagatgcaaacagccaagactcag cctcgtgaggagcagttcaatggcacctaccgtgtggtcagtgtcctccccattgggcac caggactggctcaaggggaagcagttcacgtgcaaagtcaacaacaaagccctcccatcc ccgatcgagaggaccatctccaaggccaga SEQIDNO.423 >IGHG2*01|Canislupusfamiliaris_boxer|F|CH3-CHS| gggcaggcccatcaacccagtgtgtatgtcctgccgccatcccgggaggagttgagcaag aacacagtcagcttgacatgcctgatcaaagacttcttcccacctgacattgatgtggag tggcagagcaatggacagcaggagcctgagagcaagtaccgcacgaccccgccccagctg gacgaggacgggtcctacttcctgtacagcaagctctctgtggacaagagccgctggcag cggggagacaccttcatatgtgcggtgatgcatgaagctctacacaaccactacacacag aaatccctctcccattctccgggtaaa SEQIDNO.424 >IGHG2*01|Canislupusfamiliaris_boxer|F|M1| gagctgatcctggatgacagctgtgctgaggaccaggacggggagctggacgggctgtgg accaccatctccatcttcatcaccctcttcctgctcagcgtgtgctacagcgccactgtc accctcttcaag SEQIDNO.425 >|IGHG2*01|Canislupusfamiliaris_boxer|F|M2| gtgaagtggatcttctcatcagtggtggagctgaagcgcacgattgtccccgactacagg aatatgatcgggcagggggcc IGHG3[F] SEQIDNO.426 >AF354266|IGHG3*01|Canislupusfamiliaris|(F)|CH1| gcctccaccacggccccctcggttttcccactggcccccagctgtgggtcccaatccggc tccacggtggccctggcctgcctggtgtcaggctacatccccgagcctgtaactgtgtcc tggaattccgtctccttgaccagcggtgtgcacaccttcccgtccgtcctgcagtcctca gggctctactccctcagcagcatggtgacagtgccctccagcaggtggcccagcgagacc ttcacctgcaatgtggcccacccggccaccaacactaaagtagacaagcca SEQIDNO.427 >IGHG3*01|Canislupusfamiliaris|(F)|H| Gtggccaaagaatgcgagtgcaagtgtaactgtaacaactgcccatgccca SEQIDNO.428 >IGHG3*01|Canislupusfamiliaris|(F)|CH2| ggttgtggcctgctgggagggccttcggtcttcatctttcccccaaaacccaaggacatc ctcgtgactgcccggacacccacagtcacttgtgtggtggtggatctggacccagaaaac cctgaggtgcagatcagctggttcgtggatagtaagcaggtgcaaacagccaacacgcag cctcgtgaggagcagtccaatggcacctaccgtgtggtcagtgtcctccccattgggcac caggactggctttcagggaagcagttcaagtgcaaagtcaacaacaaagccctcccatcc cccattgaggagatcatctccaagacccca SEQIDNO.429 >IGHG3*01|Canislupusfamiliaris|(F)|CH3-CHS| gggcaggcccatcagcctaatgtgtatgtcctgccgccatcgcgggatgagatgagcaag aatacggtcaccctgacctgtctggtcaaagacttcttcccacctgagattgatgtggag tggcagagcaatggacagcaggagcctgagagcaagtaccgcatgaccccgccccagctg gatgaagatgggtcctacttcctatacagcaagctctccgtggacaagagccgctggcag cggggagacaccttcatatgtgcggtgatgcatgaagctctacacaaccactacacacag atatccctctcccattctccgggtaaa IGHG4[F] SEQIDNO.430 >AF354267|IGHG4*01|Canislupusfamiliaris|(F)|CH1| gcctccaccacggccccctcggttttcccactggcccccagctgcgggtccacttccggc tccacggtggccctggcctgcctggtgtcaggctacttccccgagcctgtaactgtgtcc tggaattccggctccttgaccagcggtgtgcacaccttcccgtccgtcctgcagtcctca gggctctactccctcagcagcacggtgacagtgccctccagcaggtggcccagcgagacc ttcacctgcaacgtggtccacccggccagcaacactaaagtagacaagcca SEQIDNO.431 >IGHG4*01|Canislupusfamiliaris|(F)|H| Gtgcccaaagagtccacctgcaagtgtatatccccatgccca SEQIDNO.432 >IGHG4*01|Canislupusfamiliaris|(F)|CH2| gtccctgaatcactgggagggccttcggtcttcatctttcccccgaaacccaaggacatc ctcaggattacccgaacacccgagatcacctgtgtggtgttagatctgggccgtgaggac cctgaggtgcagatcagctggttcgtggatggtaaggaggtgcacacagccaagacgcag cctcgtgagcagcagttcaacagcacctaccgtgtggtcagcgtcctccccattgagcac caggactggctcaccggaaaggagttcaagtgcagagtcaaccacataggcctcccgtcc cccatcgagaggactatctccaaagccaga SEQIDNO.433 >IGHG4*01|Canislupusfamiliaris|(F)|CH3-CHS| gggcaagcccatcagcccagtgtgtatgtcctgccaccatccccaaaggagttgtcatcc agtgacacggtcaccctgacctgcctgatcaaagacttcttcccacctgagattgatgtg gagtggcagagcaatggacagccggagcccgagagcaagtaccacacgactgcgccccag ctggacgaggacgggtcctacttcctgtacagcaagctctctgtggacaagagccgctgg cagcagggagacaccttcacatgtgcggtgatgcatgaagctctacagaaccactacaca gatctatccctctcccattctccgggtaaa IGHM(F) SEQIDNO.434 >IGHM*01|Canislupusfamiliaris_boxer|F|CH1| nagagtccatcccctccaaacctcttccccctcatcacctgtgagaactccctgtccgat gagaccctcgtggccatgggctgcctggcccgggacttcctgcctggctccatcaccttc tcctggaagtacgagaacctcagtgcaatcaacaaccaggacattaagaccttcccttca gttctgagagagggcaagtatgtggcgacctctcaggtgttcctgccctccgtggacatc atccagggttcagacgagtacatcacatgcaacgtcaagcactccaatggtgacaaatct gtgaacgtgcccatcaca SEQIDNO.435 >IGHM*01|Canislupusfamiliaris_boxer|F|CH2| gggcctgtaccaacgtctcccaacgtgactgtcttcatcccaccccgcgacgccttctct ggcaatggccagcgcaagtcccagctcatctgccaggctgcaggtttcagccccaagcag atttccgtgtcttggttccgtgatggaaagcagattgagtctggcttcaacacagggaag gcagaggccgaggagaaagagcatgggcctgtgacctacagcatcctcagcatgctgacc atcaccgagagtgcctggctcagccagagcgtgttcacctgccacgtggagcacaatggg atcatcttccagaagaacgtgtcctccatgtgcacctcc SEQIDNO.436 >IGHM*01|Canislupusfamiliaris_boxer|F|CH3| aatacacccgttggcatcagcatcttcaccatccccccctcctttgccagcatcttcaac accaagtcagccaagctgtcctgcctggtcactgacctggccacttatgacagcctgacc atctcctggacccgtcagaatggcgaggctctgaaaacccacaccaacatctctgagagc catcccaacaacaccttcagtgccatgggggaagccactgtctgcgtggaggaatgggag tcaggcgagcagttcacctgcacagtgacccacacagatctgccctcaccgctgaagaag accatctccaggcccaag SEQIDNO.437 >IGHM*01|Canislupusfamiliaris_boxer|F|CH4-CHS| gatgtcaacaagcacatgccttctgtctacgtcctgcccccgagccgggagcagctgagc ctgcgggaatcggcctcactcacctgcctggtgaaaggcttctcacccccagatgtgttc gtgcagtggctgcagaagggccagcccgtgccccctgacagctacgtgaccagcgccccg atgcccgagccccaagcccccggcctctactttgtccacagcatcctgaccgtgagtgag gaggactggaatgccggggagacctacacctgtgttgtaggccatgaggccctgccccat gtggtgaccgagaggagcgtggacaagtccaccggtaaacccaccttgtacaacgtgtcc ctggtcttatctgacacagccagcacctgctac SEQIDNO.438 >IGHM*01|Canislupusfamiliaris_boxer|F|M1| gggggggaggtgagtgccgaggaggaaggcttcgagaacctgaataccatggcatccacc ttcatcgtcctcttcctcctcagtgtcttctacagcaccacagtcactctgttcaag SEQIDNO.439 >IGHM*01|Canislupusfamiliaris_boxer|F|M2| gtgaaa IGKCsequences IGKC(F) SEQIDNO.440 >IGKC*01|Canislupusfamiliaris_boxer|F|C-REGION| cggaatgatgcccagccagccgtctatttgttccaaccatctccagaccagttacacaca ggaagtgcctctgttgtgtgcttgctgaatagcttctaccccaaagacatcaatgtcaag tggaaagtggatggtgtcatccaagacacaggcatccaggaaagtgtcacagagcaggac aaggacagtacctacagcctcagcagcaccctgacgatgtccagtactgagtacctaagt catgagttgtactcctgtgagatcactcacaagagcctgccctccaccctcatcaagagc ttccaaaggagcgagtgtcagagagtggac IGLCsequences [F],Functionalitydefinedfortheavailablesequenceof thegene(partialgenein3becauseofgapsinthesequence) SEQIDNO.441IGLC1(F) >IGLC1*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaagtcctcccccttggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggctaccctggtgtgcctcatcagcgacttctaccccagtggcctgaaagtg gcttggaaggcagatggcagcaccatcatccagggcgtggaaaccaccaagccctccaag cagagcaacaacaagtacacggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcaccaggggagcaccgtggagaagaaggtg gcccctgcagagtgctct SEQIDNO.442IGLC2(F) >IGLC2*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcagtcacactcttcccaccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggcgtgacggtg gcctggaaggcagacggcagccccggcatccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcatgaggggagcaccgtggagaagaaggtg gcccccgcagagtgctct SEQIDNO.443IGLC3(F) >IGLC3*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagtggcgtgacggtg gcctggaaggcagacggcagccccgtcacccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacacacgaggggagcaccgtggagaagaaggtg gcccccgcagagtgctct SEQIDNO.444IGLC4[F] >IGLC4*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggtgtgacggtg gcctggaaggcagacggcagccccgtcacccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacacacgaggggagcactgtgg SEQIDNO.445IGLC5(F) >IGLC5*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccttcggtcacactcttcccgccctcctctgaggagcttggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggcgtgacagtg gcctggaaggcagacggcagccccatcacccagggtgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcacgaggggagcaccgtggagaagaaggtg gcccccgcagagtgctct SEQIDNO.446IGLC6(F) >IGLC6*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggtgtgacggtg gcctggaaggcagacggcagccccgtcacccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcacgaggggagcaccgtggagaagaaggtg gcccccgcagagtgctct SEQIDNO.447IGLC7(F) >IGLC7*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggcgtgacggtg gcctggaaggcagacggcagccccgtcacccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcacgaggggagcaccgtggagaagaaggtg gcccccgcagagtgctct SEQIDNO.448IGLC8(F) >IGLC8*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggcgtgacggtg gcctggaaggcagacggcagccccgtcacccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcacgaggggagcaccgtggagaagaaggtg gcccccgcagagtgctct SEQIDNO.449IGLC9(F) >IGLC9*01|Canislupusfamiliaris_boxer|F|C-REGION| ggtcagcccaaggcctccccctcggtcacactcttcccgccctcctctgaggagctcggc gccaacaaggccaccctggtgtgcctcatcagcgacttctaccccagcggcgtgacggtg gcctggaaggcagacggcagccccatcacccagggcgtggagaccaccaagccctccaag cagagcaacaacaagtacgcggccagcagctacctgagcctgacgcctgacaagtggaaa tctcacagcagcttcagctgcctggtcacgcacgaggggagcactgtggagaagaaggtg gcccccgcagagtgctct //EndofcanineIgsequences
TABLE-US-00005 TABLE5 PCRPrimers SEQIDNO.450 1F:ACATAATACACTGAAATGGAGCCC SEQIDNO.451 IR:GTCCTTGGTCAACGTGAGGG SEQIDNO.452 2F:CATAATACACTGAAATGGAGCCCT SEQIDNO.453 2R:GCAACAGTGGTAGGTCGCTT
TABLE-US-00006 TABLE6 Miscellaneoussequencedata Pre-DJ Thisisa21609bpfragmentupstreamoftheIghd-5 DHgene.Thepre-DJsequencecanbefoundinMus musculusstrainC57BL/6Jchromosome12,Assembly: GRCm38.p4,Annotationrelease106,SequenceID: NC_000078.6 Theentiresequenceliesbetweenthetwo100bp sequencesshownbelow: UpstreamoftheIghd-5DHgenesegment, correspondingtopositions113526905-113527004in NC_000078.6: ATTTCTGTACCTGATCTATGTCAATATCTGTACCATGGCTCTAGCAGAGAT GAAATATGAGACAGTCTGATGTCATGTGGCCATGCCTGGTCCAGACTTG (SEQIDNO.454) 2kbupstreamoftheADAM6Agenecorrespondingto positions113548415-113548514inNC_000078.6: GTCAATCAGCAGAAATCCATCATACATGAGACAAAGTTATAATCAAGAAAT GTTGCCCATAGGAAACAGAGGATATCTCTAGCACTCAGAGACTGAGCAC (SEQIDNO.455) ADAM6A ADAM6A(adisintegrinandmetallopeptidasedomain 6A)isageneinvolvedinmalefertility.The ADAM6AsequencecanbefoundinMusmusculusstrain C57BL/6Jchromosome12,Assembly:GRCm38.p4, Annotationrelease106,SequenceID:NC_000078.6at position113543908-113546414. ADAM6AsequenceID:OTTMUSG00000051592(VEGA)
TABLE-US-00007 TABLE7 Chimericcanine/mouseIggenesequences IGKVersionA SequenceupstreamofmouseIgkv1-133(SEQIDNO:456) GCATTGAATAAACCAGTATAAACAAGCAAGCAAAGATAGATAGATAGATAGATAGATAGATAGATAGATAC ATAGATAGATAGATAGATAGATAGATGATAGATAGATAGATAGATAGATAGATTTTTACGTATAATACAAT AAAAACATTCATTGTCCCTCTATTGGTGACTACTCAAGGAAAAAAATGTTCATATGCAAGAAAAAATGTTA TCATTACCAGATGATCCAGCAATCTAGCAATATATATATTGTTTATTCACAAAACATGAATGAACCTTTTA AGAAGCTGTTACAGTGTAAAAATTAAGTTAAATCACTGAAGAACATATACTGTGTGATTTCATTCAAATGA AATTTGAGAAGTAAATATATATGTATATATATATATATGTAAAAAATATAAGTCTGAACTACAAAAATTCA ATTTGTTTGATATGTAAGAATAAGAAAAATTGACCCCCAAAATTTGTTAATAATTAGGTATGTGTATTTTT ATGAATATATAAGTATAATAATGCTTATAGTATACACTATTCTGAATCACATTTATTCCCTAAGTGTGTTC CCTTGATTATAATTAAAAGTATATTTTTTAAATACAGAGTCAGAGTACAGTCAATAAGGCGAAAATATAGT TGAATGATTTGCTTCAGCTTTTGTAATGTACTAGAGATTGTGAGTACAAAGTCTCAGAGCTCATTTTATCC CTGACAATAACCAGCTCTGTGCTTCAAGTACATTTCCATCTTTCTCTGAAATTTAGTCTTATATAGATAGA CAAAATTTAAGTAAATTTCAAACTACACAGAACAACTAAGTTGTTGTTTCATATTGATAATGGATTTGAAC TGCATTAACAGAACTTTAACATCCTGCTTATTCTCCCTTCAGCCATCATATTTTGCTTTATTATTTTCACT TTTTGAGTTATTTTTCACATTCAGAAAGCTCACATAATTGTCACTTCTTTGTATACTGGTATACAGACCAG AACATTTGCATATTGTTCCCTGGGGAGGTCTTTGCCCTGTTGGCCTGAGATAAAACCTCAAGTGTCCTCTT GCCTCCACTGATCACTCTCCTATGTTTATTTCCTCAAA Canineexon1(leader)fromLOC475754(SEQIDNO.457): atgaggttcccttctcagctcctggggctgctgatgctctggatcc Canineintron1fromLOC475754(SEQIDNO.458) Caggtaaggacagggcggagatgaggaaagacatgggggcgtggatggtgagctcccctggtgctgtttct ctccctgtgtattctgtgcatgggacagattgccctccaacagggggaatttaatttttagactgtgagaa ttaagaagaatataaaatatttgatgaacagtactttagtgagatgctaaagaagaaagaagtcactctgt cttgctatcttgggttttccatgataattgaatagatttaaaatataaatcaaaatcaaaatatgatttag cctaaaatatacaaaacccaaaatgattgaaatgtcttatactgtttctaacacaacttgtacttatctct cattattttaggatccagtggg Canine5partofexon2(leader)fromLOC475754(SEQIDNO.459) aggatccagtggg CanineVfromLOC475754(SEQIDNO.460) Gatattgtcatgacacagaccccactgtccctgtctgtcagccctggagagactgcctccatctcctgcaa ggccagtcagagcctcctgcacagtgatggaaacacgtatttgaactggttccgacagaagccaggccagt ctccacagcgtttaatctataaggtctccaacagagaccctggggtcccagacaggttcagtggcagcggg tcagggacagatttcaccctgagaatcagcagagtggaggctgacgatactggagtttattactgcgggca aggtatacaagat MouseRSSheptamer(SEQIDNO:461) CACAGTG MousesequencedownstreamofRSSheptamer(SEQIDNO.462) ATACAGACTCTATCAAAAACTTCCTTGCCTGGGGCAGCCCAGCTGACAATGTGCAATCTGAAGAGGAGCAG AGAGCATCTTGTGTCTGTGTGAGAAGGAGGGGCTGGGATACATGAGTAATTCTTTGCAGCTGTGAGCTCTG IGKversionB SequenceupstreamofmouseIgkv1-133(SEQIDNO.463) GCATTGAATAAACCAGTATAAACAAGCAAGCAAAGATAGATAGATAGATAGATAGATAGATAGATAGATAC ATAGATAGATAGATAGATAGATAGATGATAGATAGATAGATAGATAGATAGATTTTTACGTATAATACAAT AAAAACATTCATTGTCCCTCTATTGGTGACTACTCAAGGAAAAAAATGTTCATATGCAAGAAAAAATGTTA TCATTACCAGATGATCCAGCAATCTAGCAATATATATATTGTTTATTCACAAAACATGAATGAACCTTTTA AGAAGCTGTTACAGTGTAAAAATTAAGTTAAATCACTGAAGAACATATACTGTGTGATTTCATTCAAATGA AATTTGAGAAGTAAATATATATGTATATATATATATATGTAAAAAATATAAGTCTGAACTACAAAAATTCA ATTTGTTTGATATGTAAGAATAAGAAAAATTGACCCCCAAAATTTGTTAATAATTAGGTATGTGTATTTTT ATGAATATATAAGTATAATAATGCTTATAGTATACACTATTCTGAATCACATTTATTCCCTAAGTGTGTTC CCTTGATTATAATTAAAAGTATATTTTTTAAATACAGAGTCAGAGTACAGTCAATAAGGCGAAAATATAGT TGAATGATTTGCTTCAGCTTTTGTAATGTACTAGAGATTGTGAGTACAAAGTCTCAGAGCTCATTTTATCC CTGACAATAACCAGCTCTGTGCTTCAAGTACATTTCCATCTTTCTCTGAAATTTAGTCTTATATAGATAGA CAAAATTTAAGTAAATTTCAAACTACACAGAACAACTAAGTTGTTGTTTCATATTGATAATGGATTTGAAC TGCATTAACAGAACTTTAACATCCTGCTTATTCTCCCTTCAGCCATCATATTTTGCTTTATTATTTTCACT TTTTGAGTTATTTTTCACATTCAGAAAGCTCACATAATTGTCACTTCTTTGTATACTGGTATACAGACCAG AACATTTGCATATTGTTCCCTGGGGAGGTCTTTGCCCTGTTGGCCTGAGATAAAACCTCAAGTGTCCTCTT GCCTCCACTGATCACTCTCCTATGTTTATTTCCTCAAA MouseIGKV1-133exon1(leader)(SEQIDNO.464) ATGATGAGTCCTGCCCAGTTCCTGTTTCTGTTAGTGCTCTGGATTCAGG MouseIGKV1-133intron1(SEQIDNO.465) GTAAGGAGTTTTGGAATGTGAGGGATGAGAATGGGGATGGAGGGTGATCTCTGGATGCCTATGTGTGCTGT TTATTTGTGGTGGGGCAGGTCATATCTTCCAGAATGTGAGGTTTTGTTACATCCTAATGAGATATTCCACA TGGAACAGTATCTGTACTAAGATCAGTATTCTGACATAGATTGGATGGAGTGGTATAGACTCCATCTATAA TGGATGATGTTTAGAAACTTCAACACTTGTTTTATGACAAAGCATTTGATATATAATATTTTTAAATCTGA AAAACTGCTAGGATCTTACTTGAAAGGAATAGCATAAAAGATTTCACAAAGGTTGCTCAGGATCTTTGCAC ATGATTTTCCACTATTGTATTGTAATTTCAG MouseIGKV1-1335partofexon2(leader)(SEQIDNO.466) AAACCAACGGT CanineVfromLOC475754(SEQIDNO.467) Gatattgtcatgacacagaccccactgtccctgtctgtcagccctggagagactgcctccatctcctgcaa ggccagtcagagcctcctgcacagtgatggaaacacgtatttgaactggttccgacagaagccaggccagt ctccacagcgtttaatctataaggtctccaacagagaccctggggtcccagacaggttcagtggcagcggg tcagggacagatttcaccctgagaatcagcagagtggaggctgacgatactggagtttattactgcgggca aggtatacaagat MouseRSSheptamer(SEQIDNO:468) CACAGTG MousesequencedownstreamofRSSheptamer(SEQIDNO.469) ATACAGACTCTATCAAAAACTTCCTTGCCTGGGGCAGCCCAGCTGACAATGTGCAATCTGAAGAGGAGCAG AGAGCATCTTGTGTCTGTGTGAGAAGGAGGGGCTGGGATACATGAGTAATTCTTTGCAGCTGTGAGCTCTG