Method for extracting 2′,3′-cyclic nucleoside monophosphates
10882888 · 2021-01-05
Assignee
Inventors
- Xiulan CHEN (Jinan, CN)
- Yuzhong ZHANG (Jinan, CN)
- Ang Liu (Jinan, CN)
- Yang Yu (Jinan, CN)
- Binbin Xie (Jinan, CN)
- Qilong Qin (Jinan, CN)
- Xiaoyan SONG (Jinan, CN)
- Mei Shi (Jinan, CN)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C12P19/32
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
C12P19/32
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
It relates to a method for preparation of four kinds of 2, 3-cNMPs (2, 3-cAMP, 2, 3-cGMP, 2, 3-cCMP and 2, 3-cUMP), comprising steps of: (1) extract genomic DNA and amplify gene If3; (2) ligate If3 gene to expression plasmid to construct a recombinant vector, and transfer the recombinant vector to E. coli to obtain a recombinant strain. Cultivate the recombinant strain and collect the fermentation broth; (3) collect the cells form the fermentation broth and disrupt the cells, and then purify the recombinant protein IF3 from the cell extract by Ni.sup.2+-nitrilotriacetic acid resin. Incubate the recombinant protein IF3 solution at 0 C. for 3 days to release 2, 3-cNMPs from IF3, and centrifuge the solution; (4) Ultrafiltrate the supernatant to remove proteins, and prepare four kinds of 2, 3-cNMPs by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column.
Claims
1. A method for preparing 2, 3-cNMPs comprising steps of: (1) extracting genomic DNA from Escherichia coli K12, and amplifying translation initiation factor If3 gene which encodes translation initiation factor IF3 protein by polymerase chain reaction (PCR), wherein the F-GGAATTCCATATGATTAAAGGCGGAAAACG (SEQ ID NO: 1) and R-CCGCTCGAGCTGTTTCTTCTTAGG (SEQ ID NO: 2); (2) digesting the gene If3 from step (1) with specific restriction enzymes, ligating the digested If3 gene into vector pET-22b (+) that has been digested with the same restriction enzymes to generate an expression vector, transforming the generated expression vector into E. coli BL21 (DE3) to obtain a recombinant strain; c culturing the obtained recombinant strain and collecting the fermentation broth; wherein the restriction enzymes are Nde I and Xho I, and digesting is performed with: TABLE-US-00008 buffer 2 l expression plasmid pET-22b/gene If3 8 l restriction enzyme Nde I 1 l restriction enzyme Xho I 1 l sterilized distilled water 8 l and under the following condition: water bath at 37 C. for 30 min; (3) collecting the cells from the fermentation broth of step (2) by centrifugation, breaking the collected cells and purifying the recombinant protein IF3 therein by Ni.sup.2+-nitrilotriacetic acid resin to obtain recombinant protein IF3 solution, incubating the recombinant protein IF3 solution at 0 C. for 2.5-3.5 days to release 2, 3-cNMPs from the recombinant protein IF3, centrifuging the recombinant protein IF3 solution and collecting the supernatant containing 2, 3-cNMPs; (4) ultra-filtrating the supernatant from step (3) to remove proteins and obtain filtrate, and preparing four kinds of 2, 3-cNMPs from the filtrate by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column.
2. The method of claim 1 wherein the PCR in step (1) is performed with: TABLE-US-00009 sterilized distilled water 32.2 l 5 reaction buffer 10 l dNTP mix 5 l primer F (50 M) 0.4 l primer R (50 M) 0.4 l genomic DNA 1 l DNA polymerase 1 l and under the following conditions: pre-denature at 95 C. for 5 min; denature at 95 C. for 30 sec; anneal at 55 C. for 30 sec; extend at 72 C. for 30 sec; 30 cycles; finally extend at 72 C. for 5 min.
3. The method of claim 1 wherein the ligating in step (2) is performed with: TABLE-US-00010 digested vector pET-22b 1 l digested gene If3 4 l solution I 5 l and under the following condition: incubation at 16 C. overnight.
4. The method of claim 1 wherein culturing the recombinant strain in step (2) comprises steps of: culturing the recombinant strain at 150-200 rpm and 35-38 C. until the OD.sub.600 of the culture reaches 0.8; then incubating the culture at 100-140 rpm and 18-22 C. for 30 min; adding 0.1 mM isopropul--D-thiogalactopyranoside into the culture as an inducer and continue to cultivate continuing to culture the strain at 100-140 rpm and 18-22 C. for 22-25 hours; wherein culturing is performed in a Luria-Bertani (LB) medium (1 liter medium contains 10 g NaCl, 10 g peptone and 5 g yeast extract dissolved in distilled water, pH 8.0).
5. The method of claim 1 wherein purifying the recombinant protein IF3 by Ni.sup.2+-nitrilotriacetic acid resin in step (3) comprises the steps of: loading the supernatant of step (3) on a nickel column containing 2 ml gel; equilibrating the column with 20 ml lysis buffer after the supernatant passes through the nickel column; washing the column with 20 ml washing buffer, eluting the column with 10 ml elution buffer and collecting the eluent containing the recombinant protein IF3; wherein the components of the lysis buffer are: 50 mM Tris-HCl, 150 mM NaCl, pH 8.0; wherein the components of the washing buffer are: 50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0; wherein the components of the elution buffer are: 50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0.
6. The method of claim 1 wherein the molecular weight cutoff for ultrafiltration in step (4) is 3000 Da.
7. The method of claim 1 wherein ultra-filtrating in step (4) is as follows (values are times in minutes and percentage of buffer B used): 0.0, 0; 2.5, 0; 5.0, 30; 10.0, 60; 14.0, 100; 21.0, 100; 22.0, 50 and 23.0, 0 at a flow rate of 10 ml/min; the detection wavelength is 254 nm; mobile phases of the C.sub.18 reversed-phase column in step (4) are: buffer A (10 mM ammonium acetate, pH 5.0) and buffer B (75% (v/v) buffer A, 25% (v/v) methanol).
8. The method of claim 1 wherein in step (3) the collected cells are suspended in lysis buffer comprising 50 mM Tris-HCl and 150 mM NaCl at pH 8.0, breaking of the collected cells is performed at a pressure of 950-1050 bar, and the centrifugation of the recombinant protein IF3 solution is performed at 12,000 rpm for 50 min.
Description
FIGURE LEGENDS
(1)
(2)
(3)
(4)
(5)
(6)
ILLUSTRATIVE EMBODIMENTS
(7) The following comprises a list of illustrative embodiments according to the present invention which represent various embodiments of the present invention. These examples are offered to illustrate, but not to limit the present invention. E. coli K12 was purchased from China Center of Industrial Culture Collection (CICC) in these examples. The address is: the 6.sup.th building, 24.sup.th courtyard of the Jiuxianqiao middle road, Chaoyang district, Beijing, China. The accession number is CICC 10424.
(8) E. coli BL21 (DE3) competent cell in these examples was purchased from Beijing TransGen Biotech Co., Ltd. The address is: the 4.sup.th floor of the B-3 building, Dongsheng Science Park of Zhongguancun, 66.sup.th of Xixiaokou Road, Haidian District, Beijing, China.
Example 1
(9) The method to construct the recombinant strain includes the following steps:
(10) 1. Cloning Gene If3 from E. coli K12.
(11) 1.1 Extraction of Genomic DNA from E. coli K12
(12) The genomic DNA was extracted according to the instructions of genome extraction kit from Bioteke Corporation, China.
(13) 1.2 Design and Synthesis of the Primers
(14) Primers were designed according to the If3 gene sequence. The primer sequences were as follows:
(15) TABLE-US-00004 F: (SEQIDNO:1) GGAATTCCATATGATTAAAGGCGGAAAACG; R: (SEQIDNO:2) CCGCTCGAGCTGTTTCTTCTTAGG.
(16) Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd, China.
(17) 1.3 Amplification of Gene If3 by PCR and its Recovery
(18) (1) Gene If3 was amplified with primers F and R, using the genomic DNA as a template. Conditions for PCR reaction were as follows: pre-denaturing at 95 C. for 5 min; denaturing at 95 C. for 30 sec; annealing at 55 C. for 30 sec; extending at 72 C. for 30 sec; 30 cycles; finally extending at 72 C. for 5 min.
(19) The PCR amplification system (50 l) was as follows:
(20) TABLE-US-00005 Sterilized distilled water 32.2 l 5 TransStart FastPfu buffer 10 l dNTP mix 5 l Primer F (50 M) 0.4 l Primer R (50 M) 0.4 l Genomic DNA 1 l TransStart FastPfu DNA polymerase 1 l
(21) (2) The PCR products were separated by 1% agarose gel electrophoresis. The DNA fragment of gene If3 was recovered from the gel with DNA purification kit from Omega.
(22) 2. Construction of the Recombinant Expression Vector and Recombinant Expression Strain.
(23) (1) Digestion of the Gene and Expression Vector
(24) The If3 gene obtained from step 1 and vector pET-22b were digested with restriction enzymes Nde I and Xho I. The reaction system for digestion was as follows:
(25) TABLE-US-00006 Buffer 2 l Expression plasmid pET-22b/gene If3 8 l Restriction enzyme NdeI 1 l Restriction enzyme XhoI 1 l Sterilized distilled water 8 l
(26) The sample was mixed smoothly, centrifuged for 2 sec and then incubated at 37 C. for 30 min. The digested products were separated by 1% agarose gel electrophoresis, and the target DNA segments of gene If3 and vector pET-22b were recovered from the gel using DNA purification kit from Omega.
(27) (2) Ligation of Gene If3 and Vector pET-22b to Construct the Recombinant pET-22b-If3 Vector
(28) The reaction system was as follows:
(29) TABLE-US-00007 Digested vector pET-22b 1 l Digested gene If3 4 l Solution I 5 l
(30) The sample was mixed smoothly, centrifuged for 2 sec and incubated at 16 C. overnight. Then the recombinant pET-22b-If3 vector was constructed.
(31) (4) The recombinant pET-22b-If3 vector was transformed into E. coli BL21 (DE3) according to the method described in Molecular Cloning Manual, and transformed E. coli cells were obtained.
(32) (5) The transformed E. coli cells were spread on LB agar plate containing 100 g/ml ampicilin and cultivated at 37 C. overnight.
(33) (6) The recombinant strain was screened from the plate and verified by recombinant plasmid extraction and sequencing in Sangon Biotech (Shanghai) Co., Ltd.
Example 2
(34) 1. Fermentation of the Recombinant Strain
(35) (1) Cultivation of Inoculum
(36) The recombinant E. coli strain was inoculated in liquid LB medium containing 100 g/ml ampicillin and incubated at 180 rpm and 37 C. overnight to obtain inoculum.
(37) (2) The inoculum was inoculated in 1 L fermentation medium with 1% inoculum size and cultivated at 180 rpm and 35-38 C. until the OD.sub.600 reached 0.8. Then, 0.1 mM isopropul--D-thiogalactopyranoside (IPTG) was added in the culture, which was further cultivated at 120 rpm and 20 C. for 24 hours.
(38) 2. Purification of Recombinant Protein IF3
(39) (1) Buffers used for Purification
(40) Lysis buffer: 50 mM Tris-HCl, 150 mM NaCl, pH 8.0
(41) Washing buffer: 50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0
(42) Elution buffer: 50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0
(43) (2) The cells of the fermented recombinant E. coli strain from step (1) were collected by centrifugation at 10,000 rpm, resuspended in 50 ml lysis buffer (for 1 liter broth), and broken at the pressure of 1,000 bar.
(44) (3) The solution from step (2) was centrifuged at 12,000 rpm and 4 C. for 50 min.
(45) (4) The supernatant from step (3) was loaded on a nickel column containing 2 ml nickel gel. After the supernatant flowed through the nickel column, equilibrate the column with 20 ml lysis buffer. Wash the column with washing buffer 20 ml, and elute the recombinant protein IF3 from the column with 10 ml elution buffer. Collect the eluent, which was the recombinant protein IF3 solution.
Example 3
(46) 1. Extraction of 2, 3-cNMPs
(47) (1) The recombinant protein IF3 solution obtained in example 2 was incubated at 0 C. for 3 days to release 2, 3-cNMPs from IF3, then centrifuged at 12,000 rpm for 20 min, and the supernatant was collected.
(48) (2) The supernatant obtained from step (1) was ultrafiltrated by using an ultrafiltration tube with a molecular weight cut-off of 3,000 Da to remove proteins. The filtrate containing four kinds of 2, 3-cNMPs was collected.
(49) 2. Purification of Four Kinds of 2, 3-cNMPs (2, 3-cAMP, 2, 3-cGMP, 2, 3-cCMP and 2, 3-cUMP).
(50) (1) Four kinds of 2, 3-cNMPs in the filtrate were separated by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column and collected separately.
(51) The mobile phases used in the gradient program were as follows: buffer A (10 mM ammonium acetate, pH 5.0) and buffer B (75% (v/v) buffer A, 25% (v/v) methanol).
(52) (2) The protocol used for purification was as follows (the values are times in minutes and percentage of buffer B used): 0.0, 0; 2.5, 0; 5.0, 30; 10.0, 60; 14.0, 100; 21.0, 100; 22.0, 50 and 23.0, 0 at a flow rate of 10 ml/min. The detection wavelength was 254 nm.
(53) The result of HPLC separation of four kinds of 2, 3-cNMPs was shown in