PRODUCTION CELL AND PACKAGING CELL FOR RETROVIRAL VECTOR AND PREPARATION METHOD THEREFOR
20230051793 · 2023-02-16
Inventors
- Bofu XUE (Nanshan Shenzhen, Guangdong, CN)
- Yinhui YANG (Nanshan Shenzhen, Guangdong, CN)
- Ke LIU (Nanshan Shenzhen, Guangdong, CN)
Cpc classification
C12N2740/16052
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2740/16022
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N2740/15021
CHEMISTRY; METALLURGY
C12N2740/15052
CHEMISTRY; METALLURGY
C12N2740/16222
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
C12N2830/002
CHEMISTRY; METALLURGY
C12N2760/20222
CHEMISTRY; METALLURGY
C12N2740/16122
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to a method for constructing a producer cell and the producer cell obtained by the method, wherein the producer cell is for producing a retroviral vector carrying a nucleic acid fragment of interest.
Claims
1. A method for preparing a producer cell for producing a retroviral vector carrying a nucleic acid fragment of interest, comprising: integrating one or more but not all of sequences of gag and pol genes of a retrovirus, a coding sequence of a viral envelope protein, and a viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of a host cell using a Sleeping Beauty (SB) transposon system, and further integrating the remaining one or more of the sequences of gag and pol genes of the retrovirus, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of the host cell using a PiggyBac (PB) transposon system, or integrating one or more but not all of sequences of gag and pol genes of a retrovirus, a coding sequence of a viral envelope protein, and a viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of a host cell using a PB transposon system, and further integrating the remaining one or more of the sequences of gag and pol genes of the retrovirus, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of the host cell using a SB transposon system.
2. The method of claim 1, wherein the retrovirus is a lentivirus, and the method comprises: integrating one or more but not all of sequences of gag, pol and rev genes of a lentivirus, a coding sequence of a viral envelope protein, and a viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of a host cell using an SB transposon system, and further integrating the remaining one or more of the sequences of gag, pol and rev genes of the lentivirus, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of the host cell using a PB transposon system, or integrating one or more but not all of sequences of gag, pol and rev genes of a lentivirus, a coding sequence of a viral envelope protein, and a viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of a host cell using a PB transposon system, and further integrating the remaining one or more of the sequences of gag, pol and rev genes of the lentivirus, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of the host cell using an SB transposon system.
3. The method of claim 2, wherein the integrating of the sequences of gag, pol and rev genes of the lentivirus and the coding sequence of the viral envelope protein into the genome of the host cell is achieved using the SB transposon system, and the further integrating of the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of the host cell is achieved using the PB transposon system, or the integrating of the sequences of gag, pol and rev genes of the lentivirus and the coding sequence of the viral envelope protein into the genome of the host cell is achieved using the PB transposon system, and the further integrating of the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest into the genome of the host cell is achieved using the SB transposon system.
4. The method of claim 2, wherein the sequences of gag, pol and rev genes of the lentivirus, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest are located in two or more constructs.
5. The method of claim 4, wherein the sequences of gag and pol genes are located in a first construct, the sequence of rev gene is located in a second construct, the coding sequence of the viral envelope protein is located in a third construct, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest is located in a fourth construct.
6. The method of claim 2, wherein the gag, pol, and rev genes of the lentivirus are gag, pol, and rev genes of HIV-1 virus.
7. The method of claim 2, wherein the viral envelope protein is selected from the group consisting of feline leukemia virus (RD114) envelope protein, amphotropic retrovirus envelope protein, ecotropic retrovirus envelope protein, Baboon ape leukemia virus envelope protein, nipah virus envelope protein, Mokola virus envelope protein, Lymphocytic choriomeningitis virus envelope protein, chikungunya virus envelope protein, Ross river virus envelope protein, Semliki forest virus envelope protein, Sindbis virus envelope protein, Venezuelan equine encephalitis virus envelope protein, Western equine encephalitis virus envelope protein, influenza virus envelope protein, Fowl Plague Virus envelope protein, Chandipura virus and Piry virus envelope protein, simian immunodeficiency virus envelope protein, feline immunodeficiency virus envelope protein, equine infectious anemia virus envelope protein, Ebola virus envelope protein, rabies virus envelope protein, baculovirus envelope protein, hepatitis C virus envelope protein, feline endogenous retrovirus envelope protein, measles virus envelope protein, murine leukemia virus facultative 4070A and 10A1, Gibbon ape leukemia virus envelope protein, human immunodeficiency virus gp120 and a vesicular stomatitis virus glycoprotein (VSV-G).
8. The method of claim 2, wherein the viral envelope protein is a vesicular stomatitis virus glycoprotein (VSV-G).
9. The method of claim 2, wherein SB100X is used as a transposase in the SB system, and/or ePiggyBac is used as a transposase in the PB system.
10. The method of claim 2, wherein the transcription of one or more of the gag, pol and rev genes, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette carrying the nucleic acid fragment of interest is controllable;
11-14. (canceled)
15. The method of claim 10, wherein the genes or sequences are under a single control of a Tet-On inducible expression system or under a dual control of a Tet-On inducible expression system and a Cumate inducible expression system.
16. The method of claim 15, wherein the viral envelope protein is a VSV-G, and when under the single control of the Tet-On inducible expression system, the transcription of rev is under the control of a TRE.sub.3G sequence, and/or the transcription of the coding sequence of VSV-G is under the control of a TRE.sub.3G-intron sequence, and/or the transcription of gag and pol is under the control of a eukaryotic promoter-intron sequence or a TRE.sub.3G-intron sequence; when under the dual control of the Tet-On inducible expression system and the Cumate inducible expression system, the transcription of rev is under the control of a TRE.sub.advCuO sequence, a TRE.sub.advCuO-intron sequence, a TRE.sub.3G sequence, a TRE.sub.3GCuO sequence or a TRE.sub.3GCuO-intron sequence, and/or the transcription of VSV-G is under the control of a TRE.sub.advCuO sequence, a TRE.sub.advCuO-intron sequence, a TRE.sub.3G-intron sequence or a TRE.sub.3GCuO-intron sequence, and/or the transcription of gag and pol is under the control of a eukaryotic promoter-intron sequence, a TRE.sub.adv-intron sequence, a TRE.sub.advCuO-intron sequence, a TRE.sub.3G-intron sequence or a TRE.sub.3GCuO-intron sequence.
17. The method of claim 16, wherein, when under the single control of the Tet-On inducible expression system, the transcription of rev is under the control of a TRE.sub.3G sequence, and the transcription of the coding sequence of VSV-G is under the control of a TRE.sub.3G-intron sequence, and the transcription of gag and pol is under the control of a eukaryotic promoter-intron sequence or a TRE.sub.3G-intron sequence; when under the dual control of the Tet-On inducible expression system and the Cumate inducible expression system, the transcription of rev is under the control of a TRE.sub.3G sequence or a TRE.sub.3GCuO sequence, and the transcription of VSV-G is under the control of a TRE.sub.3GCuO-intron sequence, and the transcription of gag and pol is under the control of a eukaryotic promoter-intron sequence or a TRE.sub.3GCuO-intron sequence.
18. The method of claim 17, wherein, when under the dual control of the Tet-On inducible expression system and the Cumate inducible expression system, the transcription of rev is under the control of a TRE.sub.3G sequence, and the transcription of VSV-G is under the control of a TRE.sub.3GCuO-intron sequence, and the transcription of gag and pol is under the control of a TRE.sub.3GCuO-intron sequence; and the copy number of gag/pol gene inserted into the genome of the host cell is 2-8 copies/cell, and the ratio of the copy number of gag/pol to VSV-G inserted into the genome of the host cell is 1:1 to 4:1.
19. (canceled)
20. The method of claim 15, wherein a coding sequence of a Tet-On transactivator protein, or a coding sequence of a Tet-On transactivator protein and a coding sequence of a repressor CymR protein of Cumate operon, is/are integrated into the genome of the host cell using an SB transposon system or a PB transposon system.
21. The method of claim 20, wherein the Tet-On transactivator protein is rtTA.sub.3G.
22. The method of claim 15, wherein the sequences of gag, pol and rev genes of the lentivirus, the coding sequence of the viral envelope protein, and the coding sequence of the Tet-On transactivator protein, or the coding sequence of the Tet-On transactivator protein and the coding sequence of the repressor CymR protein of Cumate operon are integrated into the genome of the host cell using an SB transposon system, and then the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest is further integrated into the genome of the host cell using a PB transposon system; or the sequences of gag, pol and rev genes of the lentivirus, the coding sequence of the viral envelope protein, and the coding sequence of the Tet-On transactivator protein, or the coding sequence of the Tet-On transactivator protein and the coding sequence of the repressor CymR protein of Cumate operon are integrated into the genome of the host cell using a PB transposon system, and then the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest is further integrated into the genome of the host cell using an SB transposon system.
23. (canceled)
24. (canceled)
25. A producer cell for producing a retroviral vector carrying a nucleic acid fragment of interest, wherein the producer cell is integrated in the genome thereof with a sequence of gag and pol genes of a retrovirus, a coding sequence of a viral envelope protein, and a viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest; wherein each of the sequence of the gag and pol genes, the coding sequence of the viral envelope protein, and the viral genome transcriptional cassette sequence carrying the nucleic acid fragment of interest has IR/DR sequences for recognition by an SB transposase or ITR sequences for recognition by a PB transposase at both ends thereof, and both the IR/DR sequences and the ITR sequences are present in the producer cell.
26-53. (canceled)
54. A method for preparing the lentiviral vector packaging/producer cell of claim 61, comprising: introducing sequences of gag, pol and rev genes of a lentivirus and a coding sequence of a vesicular stomatitis virus glycoprotein (VSV-G) into a host cell, wherein the transcription of one or more of the gag, pol and rev genes and the coding sequence of VSV-G is under a single control of a Tet-On inducible expression system or under a dual control of a Tet-On inducible expression system and a Cumate inducible expression system.
55-60. (canceled)
61. A lentiviral vector packaging/producer cell, comprising sequences of gag, pol and rev genes of a lentivirus and a coding sequence of a vesicular stomatitis virus glycoprotein (VSV-G), wherein the transcription of one or more of the gag, pol and rev genes and the coding sequence of VSV-G is under a single control of a Tet-On inducible expression system or under a dual control of a Tet-On inducible expression system and a Cumate inducible expression system, when under the single control of the Tet-On inducible expression system, the transcription of rev is under the control of a TRE.sub.3G sequence, and/or the transcription of the coding sequence of VSV-G is under the control of a TRE.sub.3G-intron sequence, and/or the transcription of gag and pol is under the control of a eukaryotic promoter-intron sequence or a TRE.sub.3G-intron sequence; when under the dual control of the Tet-On inducible expression system and the Cumate inducible expression system, the transcription of rev is under the control of a TRE.sub.advCuO sequence, a TRE.sub.advCuO-intron sequence, a TRE.sub.3G sequence, a TRE.sub.3GCuO sequence or a TRE.sub.3GCuO-intron sequence, and/or the transcription of VSV-G is under the control of a TRE.sub.advCuO sequence, a TRE.sub.advCuO-intron sequence, a TRE.sub.3G-intron sequence or a TRE.sub.3GCuO-intron sequence, and/or the transcription of gag and pol is under the control of a eukaryotic promoter-intron sequence, a TRE.sub.adv-intron sequence, a TRE.sub.advCuO-intron sequence, a TRE.sub.3G-intron sequence or a TRE.sub.3GCuO-intron sequence.
62-67. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
DETAILED DESCRIPTION
[0129] The following examples are provided to illustrate the technical solutions of the present disclosure and shall not be construed as limiting the scope and spirit of the present disclosure.
Example 1: Methods for Constructing Plasmids
[0130] Molecular cloning techniques used in the following examples, such as PCR amplification of DNA fragments, restriction enzyme digestion of DNA fragments, gel recovery of DNA fragments, T4 DNA ligase ligation of two or more DNA fragments, transformation of ligation-competent cells, plasmid miniprep and identification, are all well known in the art. The following reagents are involved in the examples below: PCR enzyme (Thermo, F-530S); restriction enzyme (NEB); T4 DNA ligase (Invitrogen, 15224041); DNA fragment gel recovery kit (Omega, D2500-02); plasmid mini kit (TIANGEN, DP 105-03); competent cells (XL-10 Gold, Hu Nanfenghui Biotech Co., Ltd., JZ 011); the nucleic acid sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18 were synthesized by GenScript and used in the construction of the plasmids of the present disclosure, and the plasmid sequencing and identification was performed by Invitrogen. Maps of some of the plasmids used in the following examples are shown in
[0131] 1. Construction of plasmids 18BF007 and 18BF004: the synthetic sequences SEQ ID NO: 2 (2900 bp) and SEQ ID NO: 3 (1386 bp) were digested with NotI and AsiSI, and ligated to NotI and AsiSI restriction sites of plasmid 18BF003 (SEQ ID NO: 1, 1893 bp), respectively, to construct plasmids 18BF007 and 18BF004, respectively.
[0132] 2. Construction of plasmids 18BF011 and 18BF063: the 18BF007 plasmid was digested by MluI and SphI; and a fragment of 1730 bp was recovered by gel and ligated to MluI and SphI restriction sites of plasmid 18BF003, to construct a plasmid 18BF011. The synthetic sequence SEQ ID NO: 4 (915 bp) was digested by MluI and ClaI and ligated to MluI and ClaI restriction sites of 18BF007 to replace a CMV promoter, to construct a plasmid 18BF063.
[0133] 3. Construction of plasmids 18BF072, 18BF071, 19BF249, 19BF248, 19BF247, 19BF246, 18BF070 and 18BF069: the rev gene fragment (380 bp) was PCR-amplified using pRSV-Rev (Addgene, #12253) as a template, C-rev-F (SEQ ID NO: 34) and C-rev-R (SEQ ID NO: 35) as primers, and then digested with ClaI and XhoI and ligated to ClaI and XhoI restriction sites of plasmid 18BF063, to construct a plasmid 18BF072. The synthetic sequences SEQIDNO:5 (887 bp), SEQIDNO:6 (897 bp) and SEQIDNO:7 (852 bp) were digested by MluI and ClaI and ligated to MluI and ClaI restriction sites of 18BF072 to replace a TRE.sub.3GCuO-BGI fragment, and thereby constructing plasmids 18BF071, 19BF249 and 19BF248, respectively. Plasmids 18BF072, 18BF071, 19BF249 and 19BF248 were digested with BstBI, and fragments of 4147 bp (18BF072), 4119 bp (18BF071), 4129 bp (19BF249) and 4084 bp (19BF248) were recovered by gel and ligated with T4 ligase to construct plasmids 19BF247, 19BF246, 18BF070 and 18BF069, respectively.
[0134] 4. Construction of plasmids 18BF068, 18BF067, 19BF245, 19BF244, 19BF243, 19BF242, 18BF066, 18BF065 and 19BF254: the VSV-G gene fragment (1565 bp) was PCR-amplified using pMD2.G (Addgene, #12259) as a template, C-VSVG-F (SEQ ID NO: 32) and C-VSVG-R (SEQ ID NO: 33) as primers, and then digested with ClaI and XhoI and ligated to ClaI and XhoI restriction sites of plasmid 18BF063, to construct a plasmid 18BF068. The synthetic sequences SEQIDNO:5 (887 bp), SEQIDNO:6 (897 bp) and SEQIDNO:7 (852 bp) were digested by MluI and ClaI and ligated to MluI and ClaI restriction sites of 18BF068 to replace a TRE.sub.3GCuO-BGI fragment, and thereby constructing plasmids 18BF067, 19BF245 and 19BF244, respectively. Plasmid 18BF068 was digested with ClaI and XhoI, and a 1550 bp fragment was recovered by gel and ligated to the ClaI and XhoI sites of plasmids 19BF247, 19BF246, 18BF070 and 18BF069 to replace the rev gene, and thereby constructing plasmids 19BF243, 19BF242, 18BF066 and 18BF065, respectively. The synthetic sequence SEQ ID NO: 8 (887 bp) was digested by SpeI and PvuII, and ligated to AvrII and PmeI restriction sites of plasmid 18BF068, to construct a plasmid 19BF254.
[0135] 5. Construction of plasmids 18BF074, 19BF131, 19BF130, 19BF251, 19BF250, 19BF126, 19BF129, 19BF128 and 18BF076: RRE fragment (400 bp) was PCR-amplified using pMDLg/pRRE (Addgene, #12251) as a template, C-RRE-F (SEQ ID NO:36) and C-RRE-R (SEQ ID NO:37) as primers; gag/pol gene fragment (4336 bp) was PCR-amplified using C-GagPol-F (SEQ ID NO:38) and C-GagPol-R (SEQ ID NO:39) as primers; and then the above two DNA fragments were respectively digested with XbaI/XhoI and EcoRI/XbaI, and ligated to EcoRI and XhoI restriction sites of plasmid 18BF007 to construct a plasmid 18BF074. The synthetic sequences SEQIDNO:4 (915 bp), SEQIDNO:5 (887 bp), SEQIDNO:6 (897 bp) and SEQIDNO:7 (852 bp) were digested by MluI and EcoRI and ligated to MluI and EcoRI restriction sites of 18BF074 to replace a CMV-BGI fragment, and thereby constructing plasmids 19BF131, 19BF130, 19BF251 and 19BF250, respectively. Plasmids 18BF074, 19BF131, 19BF130 and 19BF250 were digested with BstBI, and fragments of 8758 bp (18BF074), 8494 bp (18BF131), 8466 bp (19BF130) and 8421 bp (19BF250) were recovered by gel and ligated with T4 ligase to construct plasmids 19BF126, 19BF129, 19BF128 and 18BF076, respectively.
[0136] 6. Construction of plasmids 19BF257, 19BF256, 19BF075 and 19BF074: the synthetic sequences SEQ ID NO: 9 (633 bp) and SEQ ID NO: 10 (1496 bp) were digested with the ClaI and XhoI and the SpeI and AgeI, respectively, and ligated in sequence to the ClaI and XhoI restriction sites and the AvrII and AgeI restriction sites of the plasmid 18BF007 to construct a plasmid 19BF073. The synthetic sequence SEQ ID NO: 11 (1979 bp) was digested by MluI and AgeI, and ligated to MluI and AgeI restriction sites of the 18BF007 plasmid to replace a CMV-BGI-MCS-pA fragment, and thereby constructing a plasmid 18BF008. The synthetic sequences SEQ ID NO: 12 (768 bp) and SEQ ID NO: 13 (765 bp) were respectively digested by ClaI and XhoI, and then respectively ligated to the ClaI and XhoI restriction sites of plasmid 18BF008, to construct plasmids 18BF085 and 18BF084 respectively. The synthetic sequence SEQ ID NO: 10 (1496 bp) was digested by SpeI and AgeI, and then respectively ligated to AvrII and AgeI restriction sites of plasmid 18BF085 and plasmid 18BF084, to construct plasmids 19BF257 and 19BF256 respectively. The plasmid 19BF073 was digested with SpeI and AgeI, and a fragment of 3821 bp was recovered by gel and respectively ligated to AvrII and AgeI restriction sites of plasmids 18BF085 and 18BF084 to construct plasmids 19BF075 and 19BF074 respectively.
[0137] 7. Construction of plasmids 18BF019 and 18BF031: the synthetic sequences SEQ ID NO: 15 (1044 bp) and SEQ ID NO: 14 (1320 bp) were respectively digested by the BamHI and XhoI and the XhoI and BglII, and ligated to BamHI and BglII restriction sites of plasmid 18BF011 to construct a plasmid 18BF019. The synthetic sequences SEQ ID NO: 16 (1806 bp) and SEQ ID NO: 14 (1320 bp) were respectively digested by the BamHI and XhoI and the XhoI and BglII, and ligated to BamHI and BglII restriction sites of plasmid 18BF011 to construct a plasmid 18BF031.
[0138] 8. Construction of plasmids 18BF094, 19BF255, 18BF091, 18BF096 and 19BF252: plasmids 18BF071 and 19BF254 were digested with PacI and AvrII respectively, and the DNA fragments of 1762 bp and 3838 bp were recovered by gel, and the two recovered fragments were ligated to PacI and AvrII restriction sites of plasmid 18BF004, to construct plasmids 18BF094 and 19BF255 respectively. The plasmid 18BF068 was digested with PacI, AvrII and PvuI, and a DNA fragment of 2975 bp was recovered by gel, and the recovered fragment was ligated to the PacI and AvrII restriction sites of plasmid 18BF004 to construct a plasmid 18BF091. The plasmid 18BF074 was digested with PacI and PmeI, and a DNA fragment of 6428 bp was recovered by gel and ligated to the PacI and PmeI restriction sites of plasmid 18BF004 to construct a plasmid 18BF096. The plasmid 19BF074 was digested with SpeI and PmeI, and a DNA fragment of 6513 bp was recovered by gel and ligated to the SpeI and PmeI restriction sites of plasmid 18BF004 to construct a plasmid 19BF252.
[0139] 9. Construction of plasmids 19BF081, 19BF217 and 19BF218: a PGK gene fragment (706 bp) was PCR-amplified by using pRRLSIN.cPPT.PGK-GFP. WPRE (Addgene, #12252) as a template and hPGK-F (SEQ ID NO:40) and hPGK-R (SEQ ID NO:41) as primers; a luciferase gene fragment (1728 bp) was PCR-amplified by using pGL3-Basic (Promega, E1751) as a template and Luc-F (SEQ ID NO:42) and Luc-R (SEQ ID NO:43) as primers; and then the above two DNA fragments were respectively digested with the MluI and BamHI (a fragment of 538 bp by gel-recovery) and the BamHI and XhoI, and ligated to MluI and XhoI restriction sites of plasmid 19BF126 to replace the original fragment of plasmid DNA, thereby constructing a plasmid 18YYH26. The total RNA of HepG2 (ATCC HB-8065) cells and healthy human peripheral mononuclear cells (PBMC) was extracted and purified by TRIzol (ThermoFisher 15596026); a cDNA library was prepared by using the mixed total RNA of HepG2 and PBMC as a template according to the instruction of SuperScript IV (ThermoFisher 18090010); the gene fragment of F8cHA was PCR-amplified by using the cDNA library as a template and F8V1-F (SEQ ID NO:44) and F8V1HA-R(SEQ ID NO:45) as primers (7116 bp of PCR product in length, 18 bp to 7070 bp of PCR product is identical to 172 bp to 7224 bp in NM 000132.3 sequence by DNA sequencing); and then it is digested with ClaI and XhoI and ligated to ClaI and XhoI restriction sites of plasmid 19BF126 to replace the original fragment of plasmid DNA, thereby constructing a plasmid 19BF215. Two DNA fragments of 2317 bp and 2154 bp were PCR-amplified by using plasmid 19BF215 as a template and using the F8V1F (SEQ ID NO:44) and FP-BDDF8-R(SEQ ID NO:47) and the FP-BDDF8-F (SEQ ID NO:46) and F8V1HA-R(SEQ ID NO:45) as primers respectively; the two DNA fragments were ligated by fusion PCR, and a gene fragment of BDDF8cHA (4434 bp) was PCR-amplified by using F8V1F (SEQ ID NO:44) and F8V1HA-R(SEQ ID NO:45) as primers; and then it is digested with ClaI and XhoI and ligated to ClaI and XhoI restriction sites of plasmid 19BF126 to replace the original fragment of plasmid DNA, thereby constructing a plasmid 19BF216. The synthetic sequence SEQ ID NO: 18 (3610 bp) was digested by SpeI and AgeI, and ligated to SpeI and AgeI restriction sites of plasmid 18BF004, to construct a plasmid 19BF080. The synthetic sequence SEQ ID NO: 17 (1320 bp) was digested by XhoI and BglII, and ligated to Xho I and BamH I restriction sites of plasmid 19BF080, to construct a plasmid 19BF214. Plasmids 18YYH26, 19BF215, and 19BF216 were digested with Pac I and Xho I, respectively, and the DNA fragments of 2272 bp, 7792 bp and 5110 bp were recovered by gel, and the recovered fragments were ligated to the Pac I and Xho I restriction sites of plasmid 19BF214, to construct plasmids 19BF081, 19BF217 and 19BF218, respectively.
[0140] 10. Construction of plasmids 18BF022, 18BF033 and 19BF078: the synthetic sequence SEQ ID NO: 17 (1320 bp) was digested with Xho I and Bgl II and ligated to the Xho I and Bgl II restriction sites of plasmid 18BF007 to construct plasmid 18BF022. The plasmid 18BF022 was digested with Mlu I, Age I and Pvu I, and a DNA fragment of 3052 bp was recovered by gel and ligated to the Mlu I and Age I restriction sites of plasmid 18BF004 to construct a plasmid 18BF033. The synthetic sequence SEQ ID NO: 18 (3610 bp) was digested by Spe I and Age I, and ligated to Spe I and Age I restriction sites of plasmid 18BF007 to replace the original fragment of plasmid DNA, thereby constructing a plasmid 19BF077. The plasmid 19BF081 was digested with Pac I and Nde I, and a DNA fragment of 3598 bp was recovered by gel and ligated to the Pac I and Nde I restriction sites of plasmid 19BF077 to construct a plasmid 19BF078.
TABLE-US-00001 TABLE 1 Information for Primers primer name primer sequence (5′-3′) 32 C-VSVG-F GCTCATCGATGCCACCATGAAGTGCCTTTTGTACTTAG 33 C-VSVG-R CAGGCTCGAGCTATTACTTTCCAAGTCGGTTCATC 34 C-rev-F CGATATCGATGCCACCATGGCAGGAAGAAGCGGA 35 C-rev-R CATGCTCGAGTTACTATTCTTTAGCTCCTGACTC 36 C-RRE-F CATGGATCTAGAAGGAGCTTTGTTCCTTG 37 C-RRE-R CAGGCTCGAGAAGCTTGTGTAATTGTTAATTTC 38 C-GagPol-F GCACGAATTCGCCACCATGGGTGCGAGAGCGTC 39 C-GagPol-R GCAGTCTAGACTATTAATCCTCATCCTGTCTACTTG 40 hPGK-F CATACGCGTGCTTGATATCGAATTCCACG 41 hPGK-R CAGATGAACTTCAGGGTCAGCTTG 42 Luc-F TCAGGATCCATCTGCGATCTAAGTAAGCTTG 43 Luc-R TCAACTCGAGCTAGAATTACACGGCGATC 44 F8V1-F GTCAGATCGATGCCACCATGCAAATAGAG 45 F8V1HA-R CCTGCTCGAGTCATGCATAATCAGGCACGTCATAGGGGTAGCTGCCGTA GAGGTCCTGTG 46 FP-BDDF8- CCATTGAACCAAGAAGCTTCTCTCAAAACCCACCAGT F 47 FP-BDDF8- ACTGGTGGGTTTTGAGAGAAGCTTCTTGGTTCAATGG R
TABLE-US-00002 TABLE 2 Description of sequence elements Description of sequence elements 1 18BF003_pma-MCS plasmid sequence (1893 bp) 2 NotI-IR/DR-HS4I-CMV-BGI-MCS- hGHpA-HS4I-IR/DR-AsiSI (2900 bp) 3 NotI- PB3′ITR-HS4I-MCS-HS4I-PB5′ITR-AsiSI (1386 bp) 4 MluI-TRE.sub.3GCuO-BGI-ClaI-EcoRI (915 bp) 5 MluI-TRE.sub.3G-BGI-ClaI-EcoRI (887 bp) 6 MluI-TRE.sub.advCuO-BGI-ClaI-EcoRI (897 bp) 7 MluI-TRE.sub.adv-BGI-ClaI-EcoRI (852 bp) 8 SpeI-SV40p-optiBSD-SV40pA-PvuII-AgeI (887 bp) 9 Clal-optiCymR-XhoI (633 bp) 10 SpeI-SV40p-optiHygroR-SV40pA-AgeI (1496 bp) 11 MluI-CAGGS-BGI(C&R)-MCS-SV40pA-AgeI (1979 bp) 12 ClaI-optirtTA.sub.3G-XhoI (768 bp) 13 ClaI-rtTA.sub.adv-XhoI (765 bp) 14 XhoI-IRES-ECFP-BglII(1320 bp) 15 BamHI-optiSB-XhoI (1044 bp) 16 BamHI-optiPB-XhoI (1806 bp) 17 XhoI-IRES-EGFP-BglII (1320 bp) 18 Spel-RSV-LTR-phi-Gag (334)-RRE-cppt-MCS-WPRE-ppt-LTR-SV40pA-SV40p-optiPuorR- SV40pA-AgeI (3610 bp) 19 TRE.sub.3G response element sequence used in the present disclosure 20 TRE.sub.3GCuO complex response element sequence used in the present disclosure 21 TRE.sub.adv response element sequence used in the present disclosure 22 TRE.sub.advCuO complex response element sequence designed in the present disclosure 23 IR/DR sequence of SB transposon 24 PB3′ITR sequence of PB transposon 25 PB5′ITR sequence of PB transposon 26 intron sequence of human β-globulin (BGI) 27 nucleic acid sequence encoding CymR 28 nucleic acid sequence encoding rtTA.sub.3G 29 nucleic acid sequence encoding rtTA.sub.adv 30 nucleic acid sequence encoding SB transposase 31 nucleic acid sequence encoding PB transposase
TABLE-US-00003 TABLE 3 Description of functional elements of plasmids Description of functions IR/DR(L/R) inverted repeat (IR) and direct repeat (DR) of SB transposon system, SEQ ID NO: 23 or its complementary sequence PB3′ITR/PB5′ITR inverted terminal repeat of PB transposon system (3 terminal/5 terminal), SEQ ID NO: 24/SEQ ID NO: 25 or the complementary sequence thereof HS4I 4 core isolator sequence of chicken beta-globulin highly sensitive position BGI intron sequence of human β-globulin, SEQ ID NO: 26 CMV strong expression promoter sequence of human cytomegalovirus RSV promoter sequence of respiratory syncytial virus MCS multiple cloning site of restriction enzyme CAGGS chimeric promoter sequence of cytomegalovirus promoter enhancer part and chicken β-actin promoter BGI (C&R) chimeric intron sequence of chicken β-actin and rabbit β-globulin TRE.sub.3GCuO response element sequence of Tet-On (based on TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, SEQ ID NO: 20 TRE.sub.advCuO response element sequence of Tet-On (based on TRE.sub.adv) and Cumate complex inducible expression system designed in the present disclosure, SEQ ID NO: 22 TRE.sub.3G/TRE.sub.adv response element sequence of Tet-On inducible expression system, TRE.sub.3G: SEQ ID NO: 19/TRE.sub.adv: SEQ ID NO: 21 SV40p Simian vacuolar virus 40 promoter sequence hPGK promoter sequence derived from human phosphoglycerate kinase gene IRES ribosome entry site sequence gag/pol gene sequence encoding type I HIV virus gag and pol (identical to Addgene#12251 sequence) phi packaging signal sequence of lentiviral RNA genome RRE rev protein response element sequence LTR long terminal repeat sequence of lentivirus, sequence containing the cis-acting element required for reverse transcription replication, the 3′LTR sequence in the present disclosure with deleted U3 sequence. gag (334) 1-334 bp sequence at the 5′terminal of HIV-1 gag protein coding sequence, containing 10 stop codons designed by point-mutations. cppt central polypurine tract sequence ppt polypurine tract sequence VSV-G gene sequence encoding vesicular stomatitis vims G glycoprotein (with the same sequence as Addgene, #12259) rev gene sequence encoding rev protein (with the same sequence as Addgene, #12253) WPRE post-transcriptional regulatory sequence of woodchuck hepatitis virus optiPB codon-optimized gene sequence encoding PiggyBac (PB) transposase, SEQ ID NO: 31 optiSB codon-optimized gene sequence encoding Sleeping Beauty (SB) transposase, SEQ ID NO: 30 EGFP gene sequence encoding green fluorescent protein ECFP Gene sequence encoding cyan fluorescent protein Luciferase (Luc) Gene sequence encoding luciferase polyA polyadenylation sequence of transcription terminator (hGHpA human growth factor (hGHpA/SV40pA) terminator/SV40pA simian vacuolar virus 40 terminator) optiCymR codon-optimized coding sequence for repressor CymR protein of Cumate inducible expression system, SEQ ID NO: 27 optirtTA.sub.3G codon-optimized coding sequence for Tet-On Inducible Expression System rtTA.sub.3G transactivator, SEQ ID NO: 28 rtTA.sub.adv coding sequence for Tet-On Inducible Expression System rtTA.sub.adv transactivator, SEQ ID NO: 29 optiBSD codon optimized sequence encoding blasticidin resistance gene optiHygroR codon optimized sequence encoding hygromycin resistance gene optiPuroR codon optimized sequence encoding puromycin resistance gene F8cHA gene sequence encoding human coagulation factor 8 (with C-terminal HA tag, consistent with NM_000132.3 sequence) BDDF8cHA gene sequence encoding human coagulation factor 8 with deletion of B protein domain(with C-terminal HA tag)
TABLE-US-00004 TABLE 4 Plasmid numbers and names Plasmid name 18BF003 pma-MCS 18BF007 pmaSBT3-2xHS4I-CMV-BGI-MCS 18BF004 pmaHPBT-2xHS4I-MCS 18BF011 pmaCMV-BGI-MCS 18BF063 pmaSBT3-2xHS4I-TRE.sub.3GCuO-BGI-MCS 18BF072 pmaSBT3-2xHS4I-TRE.sub.3GCuO-BGI-rev 18BF071 pmaSBT3-2xHS4I-TRE.sub.3G-BGI-rev 19BF249 pmaSBT3-2xHS4I-TRE.sub.advCuO-BGI-rev 19BF248 pmaSBT3-2xHS4I-TRE.sub.adv-BGI-rev 19BF247 pmaSBT3-2xHS4I-TRE.sub.3GCuO-rev 19BF246 pmaSBT3-2xHS4I-TRE.sub.3G-rev 18BF070 pmaSBT3-2xHS4I-TRE.sub.advCuO-rev 18BF069 pmaSBT3-2xHS4I-TRE.sub.adv-rev 18BF068 pmaSBT3-2xHS4I-TRE.sub.3GCuO-BGI-VSVG 18BF067 pmaSBT3-2xHS4I-TRE.sub.3G-BGI-VSVG 19BF245 pmaSBT3-2xHS4I-TRE.sub.advCuO-BGI-VSVG 19BF244 pmaSBT3-2xHS4I-TRE.sub.adv-BGI-VSVG 19BF243 pmaSBT3-2xHS4I-TRE.sub.3GCuO-VSVG 19BF242 pmaSBT3-2xHS4I-TRE.sub.3G-VSVG 18BF066 pmaSBT3-2xHS4I-TRE.sub.advCuO-VSVG 18BF065 pmaSBT3-2xHS4I-TRE.sub.adv-VSVG 19BF254 pmaSBT3-2xHS4I-TRE.sub.3GCuO-BGI-VSVG-optiBSD 18BF074 pmaSBT3-2xHS4I-CMV-BGI-gag/pol-RRE 19BF131 pmaSBT3-2xHS4I-TRE.sub.3GCuO-BGI-gag/pol-RRE 19BF130 pmaSBT3-2xHS4I-TRE.sub.3G-BGI-gag/pol-RRE 19BF251 pmaSBT3-2xHS4I-TRE.sub.advCuO-BGI-gag/pol-RRE 19BF250 pmaSBT3-2xHS4I-TRE.sub.adv-BGI-gag/pol-RRE 19BF126 pmaSBT3-2xHS4I-CMV-gag/pol-RRE 19BF129 pmaSBT3-2xHS4I-TRE.sub.3GCuO-gag/pol-RRE 19BF128 pmaSBT3-2xHS4I-TRE.sub.3G-gag/pol-RRE 18BF076 pmaSBT3-2xHS4I-TRE.sub.adv-gag/pol-RRE 19BF073 pmaSBT3-2xHS4I-CMV-BGI-optiCymR-optiHygroR 18BF008 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-MCS 18BF085 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-optirtTA.sub.3G 18BF084 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-rtTA.sub.adv 19BF257 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-optirtTA.sub.3G-optiHygroR 19BF256 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-rtTA.sub.adv-optiHygroR 19BF075 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-optirtTA.sub.3G-CMV-BGI-optiCymR-optiHygroR 19BF074 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-rtTA.sub.adv-CMV-BGI-optiCymR-optiHygroR 18BF019 pmaCMV-BGI-optiSB-IRES-ECFP 18BF031 pmaCMV-BGI-optiPB-IRES-ECFP 18BF094 pmaHPBT-2xHS4I-TRE.sub.3G-BGI-rev 19BF255 pmaHPBT-2xHS4I-TRE.sub.3GCuO-BGI-VSVG-optiBSD 18BF091 pmaHPBT-2xHS4I-TRE.sub.3GCuO-BGI-VSVG 18BF096 pmaHPBT-2xHS4I-CMV-BGI-gag/pol-RRE 19BF252 pmaHPBT-2xHS4I-CAGGS-BGI(C&R)-rtTA.sub.adv-CMV-BGI-optiCymR-optiHygroR 18YYH26 pmaSBT3-2xHS4I-hPGK-Luc 19BF215 pmaSBT3-2xHS4I-CMV-F8cHA 19BF216 pmaSBT3-2xHS4I-CMV-BDDF8cHA 19BF080 pmaHPBT-2xHS4I-LVRSV-MCS-optiPuroR 19BF214 pmaHPBT-2xHS4I-LVRSV-MCS-IRES-EGFP-optiPuroR 19BF081 pmaHPBT-2xHS4I-LVRSV-hPGK-Luc-IRES-EGFP-optiPuroR 19BF217 pmaHPBT-2xHS4I-LVRSV-CMV-F8cHA-IRES-EGFP-PuroR 19BF218 pmaHPBT-2xHS4I-LVRSV-CMV-BDDF8cHA-IRES-EGFP-optiPuroR 18BF022 pmaSBT3-2xHS4I-CMV-BGI-MCS-IRES-EGFP 18BF033 pmaHPBT-2xHS4I-CMV-BGI-MCS-IRES-EGFP 19BF077 pmaSBT3-2xHS4I-LVRSV-MCS-optiPuroR 19BF078 pmaSTB3-2xHS4I-LVRSV-hPGK-Luc-IRES-EGFP-optiPuroR
Example 2: Construction of Lentivirus Producer Cell Lines by Using SB and PB Double-Transposon System
[0141] 1. Verification of the Specificity of SB and PB Transposon Systems
[0142] Before constructing a lentivirus producer cell line by using the SB and PB double-transposon system, it is necessary to demonstrate the specificity of the SB and PB transposon system, that is, whether the SB and PB transposase can only recognize the respective transposon binding sequence. The specificity verification experiment was carried out by transfecting SB/PB transposon plasmid (18BF022/18BF033) and SB/PB transposase plasmid (18BF019/18BF031) carrying EGFP into 293T cells, and then detecting the EGFP signal loss rate in 293T cells in serial passage to evaluate whether the two sets of transposon systems can work in a cross way, and the specific steps were as follows:
[0143] 293T cells (ATCC, CRL3216) were cultured at 37° C. and 5% CO.sub.2, and the medium was a DMEM complete medium (DMEM (Sigam, D6429) supplemented with 10% FBS (ExCell, 11H 116). 293T cells were seeded in a 6-well plate (Corning, 3516) at 8E5 cells per well. After 24 hours of culture, a transfection reagent was prepared in accordance with the calcium phosphate transfection protocol as described in “MolecμLar Cloning: A Laboratory Manual (Fourth edition) Chapter 15, Michael R. Green, Cold Spring Harbor Laboratory Press, 2012”, and 200 μL of the transfection reagent containing 0.12 mol/L calcium chloride, 1×HEPES buffer and 5.5 μg total plasmid was added into per well. Wherein the transposon plasmids of SB and PB were 18BF022 and 18BF033, respectively, and the reporter genes were both EGFP. The SB and PB transposase plasmids were 18BF019 and 18BF031, respectively. The transposon plasmid and the transposase plasmid were co-transfected with calcium phosphate at a molar mass of 10:1. A total of 6 co-transfection combinations were set up in the experiment, namely, (1) SB transposon and SB transposase (18BF022+18BF019); (2) PB transposon and PB transposase (18BF033+18BF031); (3) SB transposon and PB transposase (18BF022+18BF031); (4) PB transposon and SB transposase (18BF033+18BF019); (5) SB transposon and empty plasmid (18BF022+18BF003); (6) PB transposon and empty plasmid (18BF033+18BF003). After 6 hours of transfection, the medium was changed to a new DMEM complete medium. After 24 hours of transfection, the cells were digested with pancreatin (Sigam, T4799) and flow cytometry (ACEA, NovoCyte3130) was used to detect the EGFP-positive proportion and the median fluorescence intensity (MFI) of the cells, and this data was recorded as data for generation P1. Then, the cells were cultured under the condition of no screening pressure and maintained for passage every three days, the EGFP-positive proportion and the MFI value were detected by flow cytometry for each passage, and a total of 5 consecutive passages were recorded.
[0144]
[0145] 2: Construction of Lentivirus Producer Cell Lines by Using SB and PB Double-Transposon System with Different Plasmid Combinations
[0146] In this example, by utilizing the characteristics of the SB and PB transposon systems that can efficiently integrate gene fragments into the cell genome and do not interfere with each other, the genes rev, VSV-G, gag/pol used for lentivirus packaging, the viral genome transcriptional cassette carrying a nucleic acid fragment of interest, and the coding sequence of activator rtTA and/or repressor CymR protein in the inducible expression system were combined in different ways, and then were transfected by SB and/or PB transposon system for one time or two times; and then the cells were screened to construct a producer cell line for stably producing a lentivirus vector, wherein the experimental flow refers to
[0147] The first round of transfection and screening experiment of cell lines: 293T cells were seeded in a 60 mm culture dish with 1.5E6 cells per culture dish and were cultured in 3 ml DMEM complete medium at 37° C. and 5% CO.sub.2 for 24 hours. Cells were transfected according to the PEI method as follows: 500 μL of transfection reagent was added to each 60 mm culture dish during transfection, wherein the transfection reagent contains 9.5 μg of total plasmid; regarding the amount of plasmid added in each experimental group, please refers to Table 5, and the mass ratio of the total plasmid to PEI MAX (Polysciences, 24765-1) was 1:4; the plasmids and PEI MAX were uniformly mixed, and added to the culture dish after standing for 15 minutes; after 3 hours of transfection, the culture medium was changed to a DMEM complete culture medium, and the transfection operation was completed. After 24 hours of transfection, the cells were digested by pancreatin and were all seeded in a 100 mm petri dish (Corning, 430167). Cell drug-screening was performed by the screening resistance as shown in Table 5, and continuous screening was performed under the drug pressure for at least 3 passages until the cell line was stable, wherein the screening concentration of hygromycin (Shenggong A600230-0001) was 200 μg/ml. After the cells grew stably, the drug was removed and the cells were introduced into a DMEM complete medium for culture.
[0148] The second round of transfection and screening experiment of cell lines: the 8 cell lines constructed in the first round of transfection and screening experiment in Table 5, i. e., EuLV-F2 (deposited at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1 West Beichen Road, Chaoyang District, Beijing) on Apr. 13, 2020 with CGMCC No. 19674), EuLV-F3, EuLV-F4, EuLV-F5, EuLV-F7, EuLV-F8, EuLV-F9 and EuLV-F10, were respectively seeded in 8 60 mm culture dishes with 1.5E6 cells, and cultured for 24 hours. The cells were transfected according to the PEI method, and the amount of plasmid added in each experimental group was shown in Table 6. After 24 hours of transfection, the cells were digested by pancreatin and were all seeded in a 100 mm culture dish. Cell drug-screening was performed by the screening resistance as shown in Table 6, and continuous screening was performed under the drug pressure for at least 3 passages until the cell line was stable, wherein the screening concentration of puromycin (Aladdin P113126) was 2.5m/ml, and the screening concentration of Blasticidin (also known as Blasticidin S or Blastidin-S HCl, Aladdin B139600) was 10 μg/ml. After the cells grew stably, the drug was removed and the cells were introduced into a DMEM complete medium for culture. 8 cell lines, EuLV-F2-S2, EuLV-F3-S3, EuLV-F4-S4, EuLV-F5-S5, EuLV-F7-S7, EuLV-F8-S8, EuLV-F9-S9 and EuLV-F10-S10, were constructed in the second round of transfection and screening experiment. Among them, the EuLV-F2-S2 cell strain was deposited at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1 West Beichen Road, Chaoyang District, Beijing) on Apr. 13, 2020 with CGMCC No. 19675.
[0149] The virus-producing capacity of the stable lentivirus producer cell line was detected by a HT1080 cell Luciferase virus titer detection method. The 12 cell lines EuLV-NC-SB, EuLV-NC-PB, EuLV-F1, EuLV-F2-S2, EuLV-F3-S3, EuLV-F4-S4, EuLV-F5-S5, EuLV-F6, EuLV-F7-S7, EuLV-F8-S8, EuLV-F9-S9 and EuLV-F10-S10 were seeded in a 6-well plate (Corning 3516) with 8E+05 cells per well and cultured at 37° C. and 5% CO.sub.2 in a DMEM complete medium. After 24 hours of culture, the medium was changed to a DMEM complete medium containing an inducer of 1 μg/ml DOX (doxycycline hydrochloride, Sangon Biotech (Shanghai), A600889), 200 μg/ml Cumate (Aladdin, 1107765) and 5 mmol/L sodium butyrate (Sigma, 303410), to induce virus production. The lentivirus produced by a transient transfection of plasmid in 293T cell was set as a positive control, and the specific method was as follows: 293T cells were seeded at 8E+05 cells per well in a 6-well plate, and a transfection reagent (5 μg of total DNA, wherein the molar ratio of 19BF081: pMD2.G (Addgene 12259): pMDLg/PRRE (Addgene 12251): pRSV-Rev (Addgene 12253)=1:1:1:1, and the mass ratio of total DNA to PEI MAX was 1:4) was added after 24 hours of culture. 2 hours after transfection, the inducer (final concentration of 5 mmol/L sodium butyrate, 1 μg/ml DOX, 200 μg/ml Cumate) was added as above. The HT1080 cell Luciferase virus titer detection method was performed as follows: after 24 hours of adding the inducer to the cells of the experimental group and the control group, HT1080 cells were seeded into a 96-well plate (Corning 3916) with 1E4 cells per well in a DMEM complete medium. After 48 hours of induction of virus production, the medium containing the lentivirus was collected and centrifuged at 14000 rpm for 10 minutes to collect the virus supernatant. 1 hour before the addition of the virus samples, the medium of HT1080 cells was replaced with a DMEM complete medium containing 8 μg/ml polybrene (Sigam, H9268). After that, 50 μL of virus solution to be detected was added to each well of the 96-well plate, 50 μL of DMEM complete medium was added to a negative control well, and each sample and control was provided with duplicate wells. After 48 hours of culture, relative light unit RLU of each well was detected using a Steady-Glo® Luciferase Assay System (Promega, E2610) kit according to the instruction (Promega, FB037), wherein the detection instrument was a fluorescence microplate reader (Perkin Elmer Victor V).
[0150]
TABLE-US-00005 TABLE 5 Plasmid information for the first round of cell transfection experiment in the cell line construction regulatory transfer empty element gag/pol VSV-G rev vector transposase plasmid total original (μg) (μg) (μg) (μg) (μg) (μg) (μg) plasmid screening EuLV cell line 19BF074 18BF074 18BF068 18BF071 19BF078 18BF019 18BF003 (μg) resistance F1 293T 0.68 3.37 0.49 0.34 3.63 0.55 0.45 9.50 Hygromycin F2 293T 0.68 3.37 0.49 0.34 0.00 0.34 4.29 9.50 Hygromycin F3 293T 0.68 3.37 0.00 0.34 3.63 0.51 0.98 9.50 Hygromycin F4 293T 0.68 3.37 0.00 0.34 0.00 0.30 4.81 9.50 Hygromycin F5 293T 0.68 0.00 0.49 0.34 0.00 0.13 7.87 9.50 Hygromycin NC-SB 293T 0.68 3.37 0.49 0.34 3.63 0.00 1.00 9.50 Hygromycin regulatory transfer empty name of element gag/pol VSV-G rev vector transposase plasmid total cell line original (μg) (μg) (μg) (μg) (μg) (μg) (μg) plasmid screening EuLV cell line 19BF252 18BF096 18BF091 18BF094 19BF081 18BF031 18BF003 (μg) resistance F6 293T 1.34 2.66 0.96 0.67 2.87 0.66 0.34 9.50 Hygromycin F7 293T 1.34 2.66 0.96 0.67 0.00 0.47 3.39 9.50 Hygromycin F8 293T 1.34 2.66 0.00 0.67 2.87 0.57 1.39 9.50 Hygromycin F9 293T 1.34 2.66 0.00 0.67 0.00 0.38 4.45 9.50 Hygromycin F10 293T 1.34 0.00 0.96 0.67 0.00 0.28 6.25 9.50 Hygromycin NC-PB 293T 1.34 2.66 0.96 0.67 2.87 0.00 1.00 9.50 Hygromycin
TABLE-US-00006 TABLE 6 Plasmid information for the second round of cell transfection in the cell line construction regulatory transfer empty original element gag/pol VSV-G rev vector transposase plasmid total name cell line (μg) (μg) (μg) (μg) (μg) (μg) (μg) plasmid screening EuLV EuLV 19BF252 18BF096 19BF255 18BF094 19BF081 18BF031 18BF003 (μg) resistance F2-S2 F2 0.00 0.00 0.00 0.00 3.63 0.24 5.63 9.50 Puromycin F3-S3 F3 0.00 0.00 0.49 0.00 0.00 0.05 8.97 9.50 Blasticidin F4-S4 F4 0.00 0.00 1.03 0.00 3.08 0.31 5.08 9.50 Puromycin F5-S5 F5 0.00 3.37 0.00 0.00 3.63 0.48 2.02 9.50 Puromycin regulatory transfer empty name of element gag/pol VSV-G rev vector transposase plasmid total cell line original (μg) (μg) (μg) (μg) (μg) (μg) (μg) plasmid screening EuLV cell line 19BF074 18BF074 19BF254 18BF071 19BF078 18BF019 18BF003 (μg) resistance F7-S7 F7 0.00 0.00 0.00 0.00 2.87 0.17 6.47 9.50 Puromycin F8-S8 F8 0.00 0.00 0.96 0.00 0.00 0.08 8.46 9.50 Blasticidin F9-S9 F9 0.00 0.00 0.45 0.00 3.37 0.24 5.44 9.50 Puromycin F10-S10 F10 0.00 2.66 0.00 0.00 2.87 0.34 3.63 9.50 Puromycin
Example 3: Optimization of Induced Expression of Lentiviral Genes Rev, VSV-G and gag/pol
[0151] In this example, the induced expression of rev, VSV-G, and gag/pol genes was optimized. The main optimization conditions include three main aspects: (1) the selection of transactivator rtTA of the Tet-On inducible system; (2) the optimization of the inducible expression system includes the single control optimization of TRE.sub.adv and TRE.sub.3G response elements based on the Tet-On inducible system and the complex control optimization of TRE.sub.advCuO and TRE.sub.3GCuO response elements based on the Tet-On and Cumate complex inducible expression system; (3) and whether a spliceable intron is linked between the 3′ end of a promoter or a response element of inducible expression system and the 5′ end of the regulated nucleic acid sequence. Based on the above three aspects, 8 combinations of inducible response element and intron and two Tet-On transactivators rtTA.sub.adv and rtTA.sub.3G were designed and tested to regulate the expression of lentivirus packaging genes gag/pol, VSV-G and rev, and the virus-producing titer and leaky titer of lentivirus were optimized based on various conditions. Refer to Example 1 for detailed information of plasmid construction, and the specific steps were as follows:
[0152] 1. Construction of 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR Cells
[0153] Regarding the experimental procedures of 293T cell culture, PEI transfection and hygromycin screening, please refer to Example 2.293T cells were seeded at 1.5E+06 cells per 60 mm culture dish, and cultured in DMEM (Sigam, D6429) complete medium supplemented with 10% FBS (ExCell, 11H116) at 37° C. and 5% CO.sub.2. After 24 hours of culture, transfection was carried out according to the PEI method, wherein the amount of total plasmid was 5.5 μg. The transfection was performed with plasmids 19BF074:18BF019 at a molar ratio of 10:1 to obtain 293T-rtTA.sub.adv-CymR cells; and the transfection was performed with plasmids 19BF075:18BF019 at a molar ratio of 10:1 to obtain 293T-rtTA.sub.3G-CymR cells. After transfection, a screening of 200 μg/ml hygromycin drug was performed for at least three passages. After the growth of cells under the pressure of drug screening was consistent with that of the original 293T cells, the following experiments were performed.
[0154] 2. Screening and Optimization of the Gene Expression Regulation Mode of Rev, VSV-G and gag/pol by a Single Plasmid Replacement Method
[0155] In 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells, 8 Rev plasmids, 8 VSV-G plasmids, and 9 gag/pol plasmids constructed in Example 1 were used to replace the plasmid pRSV-Rev (Addgene, #12253) expressing rev, the plasmid pMD2.G (Addgene, #12259) expressing VSV-G, and the plasmid pMDLg/pRRE (Addgene, #12251) expressing gag/pol, respectively; by using 19BF081 plasmid as a transfer vector plasmid of viral genome transcriptional cassette carrying a nucleic acid fragment of interest, viruses were prepared by PEI transient transfection in the presence or absence of DOX and Cumate inducers, and the virus-producing titer and leaky titer were evaluated by the method of HT1080 cell Luciferase virus titer detection. Under each experimental condition, only one test plasmid of inducible expression was replaced, and the other co-transformed plasmids were non-inducible expression plasmids. The eight rev test plasmids were 18BF072, 18BF071, 19BF249, 19BF248, 19BF247, 19BF246, 18BF070, and 18BF069; the eight VSV-G test plasmids were 18BF068, 18BF067, 19BF245, 19BF244, 19BF243, 19BF242, 18BF066 and 18BF065; the 9 gag/pol test plasmids were 18BF074, 19BF131, 19BF130, 19BF251, 19BF250, 19BF129, 19BF128, 18BF076 and 19BF126; the positive controls were plasmids pMD2.G, pRSV-Rev and pMDLg/pRRE. The experimental procedure was as follows:
[0156] The screened stable 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells were seeded in a 24-well plate at 1.5E+05 cells per well, and the culture volume was 500 μL. After 24 hours of culture, transfection was performed according to the PEI method, and 50 μl of transfection mixture was added to each well, which contained 0.8 μg of total plasmid and 3.2 μg of PEI. In the 0.8 μg of total plasmid, the molar ratio of corresponding plasmids of rev, VSV-G, gag/pol and 19BF081 was 1:1:1:1. The vector of the present disclosure was used to replace only pRSV-Rev plasmid in the rev optimization experimental group, to replace only pMD2.G plasmid in the VSV-G experimental group, to replace only pMDLg/pRRE plasmid in gag/pol experimental group; pMD2.G, pRSV-Rev and pMDLg/pRRE plasmids were transfected in the positive control group to prepare lentivirus. The plasmid and PEI were mixed well, allowed to stand for 15 minutes and added to a 24-well plate, and each sample was provided with duplicate wells. After 3 hours of transfection, the medium was changed to a complete medium containing 5 mmol/L sodium butyrate, and then 1 μg/ml DOX and 200 μg/ml Cumate inducers were added to one of the duplicate wells for each sample, which was set as an induction group; another well was added with an equal amount of medium, which was set as a non-induction group. After 48 hours of culture, the virus supernatant from each well was collected, and the RLU value of each sample under induction and non-induction conditions was detected according to the Luciferase virus titer detection method based on HT1080 cell in Example 2. The results were shown in
[0157]
[0158] Based on the results of induced virus-producing titer and non-induced leaky titer, the preferred regulatory elements for rev are TRE.sub.advCuO (18BF070), TRE.sub.advCuO-BGI (19BF249), TRE.sub.3G(19BF246), TRE.sub.3GCuO (19BF247) and TRE.sub.3GCuO-BGI (18BF072), wherein TRE.sub.3G, TRE.sub.3GCuO and TRE.sub.3GCuO-BGI are more preferred, and the corresponding average induced RLU and induced/leaky virus-producing titer ratio in 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells are (1) TRE.sub.3G (19BF246): 6.80E+05 RLU, 135 times and 9.24E+05 RLU, 322 times; (2) TRE.sub.3GCuO (19BF247): 6.34E+05 RLU, 275 times and 7.79E+05 RLU, 279 times; (3) TRE.sub.3GCuO-BGI (18BF072): 7.46E+05 RLU, 105 times and 4.96E+05 RLU, 68 times. Among them, for Tet-On single inducible system, the preferred transactivator is rtTA.sub.3G, and the preferred response element is TRE.sub.3G; for Tet-On and Cumate complex inducible system, the preferred response element is TRE.sub.3G, TRE.sub.3GCuO and TRE.sub.3GCuO-BGI.
[0159] Based on the results of induced virus-producing titer and non-induced leaky titer, the preferred regulatory elements for VSV-G are TRE.sub.advCuO (18BF066), TRE.sub.advCuO-BGI (19BF245), TRE.sub.3G-BGI (18BF067) and TRE.sub.3GCuO-BGI (18BF068), and the corresponding average induced RLU and induced/leaky virus-producing titer ratio in 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells are (1) TRE.sub.advCuO (18BF066): 3.34E+05 RLU, 1323 times and 3.35E+05 RLU, 974 times; (2) TRE.sub.advCuO-BGI (19BF245): 5.96E+05 RLU, 506 times and 4.62E+05 RLU, 886 times; (3) TRE.sub.3G-BGI (18BF067): 4.22E+05 RLU, 110 times and 4.27E+05 RLU, 629 times; and (4) TRE.sub.3GCuO-BGI (18BF068): 8.09E+05 RLU, 1539 times and 5.76E5 RLU, 1260 times. Among them, for Tet-On single inducible system, the preferred transactivator is rtTA.sub.3G, and the preferred response element is TRE.sub.3G-BGI; for Tet-On and Cumate complex inducible system, the preferred response element is TRE.sub.adv-CuO-BGI, TRE.sub.3GCuO-BGI, and more preferably is TRE.sub.3GCuO-BGI.
[0160] Based on the results of induced virus-producing titer and non-induced leaky titer, under the condition that no intron (BGI) sequence was linked between the 3′ end of the response element and the 5′ end of gag/pol coding sequence, the detection titer was below 1000 RLU, which was close to the background value, in the induction group and the non-induction group; in the absence of introns downstream from the CMV promoter (19BF126), the detection titer also decreased to 19.4% of that in the presence of introns (18BF074), indicating that the spliceable intron sequence linked between the promoter and gag/pol coding sequence was an important condition for high expression of gag/pol coding sequence. By transfection of gag/pol plasmid containing introns, the average induced RLU and induced/leaky virus-producing titer in 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells were (1) TRE.sub.adv-BGI (19BF250): 8.60E+05 RLU, 87 times and 6.43E+05 RLU, 135 times; (2) TRE.sub.advCuO-BGI (19BF251): 9.01E+05 RLU, 413 times and 6.21E+05 RLU, 326 times; (3) TRE.sub.3G-BGI (19BF130): 7.53E+05 RLU, 257 times and 7.16E+05 RLU, 333 times; and (4) TRE.sub.3GCuO-BGI (19BF131): 8.22E+05 RLU, 641 times and 8.47E+0.5 RLU, 692 times; (5) CMV-BGI (18BF074): 1.28E+06 RUL and 1.10E+06 RLU. Since the expression of gag/pol coding sequence is also regulated by the rev protein, the regulation of gag/pol coding sequence was not necessary. Based on the above results, the regulatory elements of gag/pol coding sequence were preferably CMV-BGI, TRE.sub.adv-BGI, TRE.sub.adv-CuO-BGI, TRE.sub.3G-BGI and TRE.sub.3GCuO-BGI. For Tet-On single inducible system, the regulatory elements were preferably TRE.sub.3G-BGI and CMV-BGI; for Tet-On and Cumate complex inducible system, the response elements were preferably CMV-BGI, TRE.sub.adv-BGI, TRE.sub.advCuO-BGI, TRE.sub.3G-BGI and TRE.sub.3GCuO-BGI, more preferably CMV-BGI, TRE.sub.advCuO-BGI, TRE.sub.3GCuO-BGI, and still more preferably CMV-BGI and TRE.sub.3GCuO-BGI. With respect to the above results regarding the selection of the promoter for gag/pol coding sequence, those skilled in the art can reasonably expect that results similar to those of the CMV-BGI design can be obtained when the transcription of gag/pol is regulated using a combination of other eukaryotic promoters commonly used in the art (e.g., PGK, CAGGS, EF1a, RSV, SV40, etc.) other than the CMV promoter and other introns commonly used in the art other than BGI.
[0161] 3. Comprehensive Optimization of Combinations of Rev, VSV-G and gag/pol Expression Plasmid Based on the Above Preferred Regulatory Elements
[0162] According to the experimental results of the above single-plasmid-replacement method for screening and optimization of rev, VSV-G and gag/pol gene expression, (1) rev: plasmids of 18BF072, 19BF247 and 19BF246; (2) VSV-G: plasmids of 18BF068 and 18BF067; (3) gag/pol: plasmids of 18BF074, 19BF131, and 19BF130 were selected and combined as shown in Table 7 in 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells. According to the above method of preparing lentivirus by transient transfection in a 24-well plate, virus was prepared in the presence and absence of DOX and Cumate inducers, and the virus-producing titer and leaky titer were estimated by the HT1080 cell Luciferase virus titer detection method. The experimental conditions such as cell inoculation, the amount of plasmids and the molar ratio of each plasmid, PEI transfection, transfection and liquid exchange, induction of virus-producing, and HT1080 cell Luciferase titer detection were the same as that in the single-plasmid-replacement screening experiment of this Example, and the results were shown in
[0163] As shown in
[0164] As shown in
TABLE-US-00007 TABLE 7 Transfection combinations of Rev, VSV-G and gag/pol expression plasmid amount of total molar sample number rev VSV-G gag/pol GOI plasmid (μg) ratio 293T- 19BF246 + 18BF067 + 18BF074 19BF246 18BF067 18BF074 19BF081 0.8 1:1:1:1 rtTAadv- 19BF246 + 18BF067 + 19BF130 19BF246 18BF067 19BF130 19BF081 0.8 1:1:1:1 CymR 19BF246 + 18BF067 + 19BF131 19BF246 18BF067 19BF131 19BF081 0.8 1:1:1:1 19BF246 + 18BF068 + 18BF074 19BF246 18BF068 18BF074 19BF081 0.8 1:1:1:1 19BF246 + 18BF068 + 19BF130 19BF246 18BF068 19BF130 19BF081 0.8 1:1:1:1 19BF246 + 18BF068 + 19BF131 19BF246 18BF068 19BF131 19BF081 0.8 1:1:1:1 19BF247 + 18BF067 + 18BF074 19BF247 18BF067 18BF074 19BF081 0.8 1:1:1:1 19BF247 + 18BF067 + 19BF130 19BF247 18BF067 19BF130 19BF081 0.8 1:1:1:1 19BF247 + 18BF067 + 19BF131 19BF247 18BF067 19BF131 19BF081 0.8 1:1:1:1 19BF247 + 18BF068 + 18BF074 19BF247 18BF068 18BF074 19BF081 0.8 1:1:1:1 19BF247 + 18BF068 + 19BF130 19BF247 18BF068 19BF130 19BF081 0.8 1:1:1:1 19BF247 + 18BF068 + 19BF131 19BF247 18BF068 19BF131 19BF081 0.8 1:1:1:1 18BF072 + 18BF067 + 18BF074 18BF072 18BF067 18BF074 19BF081 0.8 1:1:1:1 18BF072 + 18BF067 + 19BF130 18BF072 18BF067 19BF130 19BF081 0.8 1:1:1:1 18BF072 + 18BF067 + 19BF131 18BF072 18BF067 19BF131 19BF081 0.8 1:1:1:1 18BF072 + 18BF068 + 18BF074 18BF072 18BF068 18BF074 19BF081 0.8 1:1:1:1 18BF072 + 18BF068 + 19BF130 18BF072 18BF068 19BF130 19BF081 0.8 1:1:1:1 18BF072 + 18BF068 + 19BF131 18BF072 18BF068 19BF131 19BF081 0.8 1:1:1:1 PC pRSV-Rev pMD2.G pMDLg/pRRE 19BF081 0.8 1:1:1:1 293T- 19BF246 + 18BF067 + 18BF074 19BF246 18BF067 18BF074 19BF081 0.8 1:1:1:1 rtTA3G- 19BF246 + 18BF067 + 19BF130 19BF246 18BF067 19BF130 19BF081 0.8 1:1:1:1 CymR 19BF246 + 18BF067 + 19BF131 19BF246 18BF067 19BF131 19BF081 0.8 1:1:1:1 19BF246 + 18BF068 + 18BF074 19BF246 18BF068 18BF074 19BF081 0.8 1:1:1:1 19BF246 + 18BF068 + 19BF130 19BF246 18BF068 19BF130 19BF081 0.8 1:1:1:1 19BF246 + 18BF068 + 19BF131 19BF246 18BF068 19BF131 19BF081 0.8 1:1:1:1 19BF247 + 18BF067 + 18BF074 19BF247 18BF067 18BF074 19BF081 0.8 1:1:1:1 19BF247 + 18BF067 + 19BF130 19BF247 18BF067 19BF130 19BF081 0.8 1:1:1:1 19BF247 + 18BF067 + 19BF131 19BF247 18BF067 19BF131 19BF081 0.8 1:1:1:1 19BF247 + 18BF068 + 18BF074 19BF247 18BF068 18BF074 19BF081 0.8 1:1:1:1 19BF247 + 18BF068 + 19BF130 19BF247 18BF068 19BF130 19BF081 0.8 1:1:1:1 19BF247 + 18BF068 + 19BF131 19BF247 18BF068 19BF131 19BF081 0.8 1:1:1:1 18BF072 + 18BF067 + 18BF074 18BF072 18BF067 18BF074 19BF081 0.8 1:1:1:1 18BF072 + 18BF067 + 19BF130 18BF072 18BF067 19BF130 19BF081 0.8 1:1:1:1 18BF072 + 18BF067 + 19BF131 18BF072 18BF067 19BF131 19BF081 0.8 1:1:1:1 18BF072 + 18BF068 + 18BF074 18BF072 18BF068 18BF074 19BF081 0.8 1:1:1:1 18BF072 + 18BF068 + 19BF130 18BF072 18BF068 19BF130 19BF081 0.8 1:1:1:1 18BF072 + 18BF068 + 19BF131 18BF072 18BF068 19BF131 19BF081 0.8 1:1:1:1 PC pRSV-Rev pMD2.G pMDLg/pRRE 19BF081 0.8 1:1:1:1
Example 4: Optimization of the Ratio of Stable Integration of rtTA-CymR, Rev, VSV-G and gag/pol Fragments in the Cell Genome
[0165] High-efficiency production of lentivirus requires high expression level of viral gene after induction and an appropriate relative expression ratio of each viral gene. The expression level of each gene is mainly affected by the efficiency of the promoter or induction response element and the copy number of integrated into the cell genome. The efficiency of the transposon system to stably integrate the nucleic acid fragment of interest into the cell genome is affected by the length of gene fragment. The longer the nucleic acid fragment of interest is, the lower the integration efficiency becomes. Therefore, according to the length of the nucleic acid fragment of interest, the ratio of transposon plasmids during transient transfection when constructing a stable cell line can be adjusted to optimize the integration ratio of each fragment. In this Example, one preferred plasmid combination optimized in Example 3, 19BF075, 19BF246, 18BF068 and 19BF131 plasmids, was used as an example; firstly, by adjusting the molar ratio of rev, VSV-G and gag/pol single packaging gene plasmids for transient transfection during the cell line construction, the relationship between the amount of transfection plasmid added and the copy number integrated into the host cell, and the virus-producing capability of the constructed cells, were determined; then, by optimizing the molar ratio of single or multiple key genes for transient transfection during the cell line construction, the optimal copy number of genome integration and the optimal molar ratio of genome integration were determined. Based on the optimal ratio of genome integration determined in this Example, and according to the virus-producing efficiency of each promoter/response element shown in Example 3 or the compared expression-efficiency of other promoters/response elements not included in the present disclosure, the optimized insertion copy number and molar ratio of other plasmids or combinations can be derived, and thus falling within the scope of the claims supported by this Example.
[0166] 1. The Effect of Adjusting the Ratio of Single-Gene Insertion on the Virus-Producing Ability of Packaging Cell Lines
[0167] Regarding the experimental procedures of cell culture, PEI transfection and hygromycin screening, please refer to Examples 2.293T cells were seeded at 1.5E+06 cells per 60 mm culture dish, and cultured in DMEM (Sigam, D6429) complete medium supplemented with 10% FBS (ExCell, 11H116) at 37° C. and 5% CO.sub.2. After 24 hours of culture, transfection was performed by PEI method and according to the contents of various plasmids as shown in Table 8 (the mass ratio of PEI to DNA was 4:1). After transfection, a screening of 200 μg/ml hygromycin drug was performed for at least three passages until the cell line grew stably, and a total of 17 lentivirus packaging cell lines from EuLV-R1 to R17 were constructed. After the cell lines are stabilized, referring to the method of preparing viruses in a 24-well plate in Example 3, EuLV-R1 to R17 cell lines were seeded in a 24-well plate with 1.5E+05 cells per well, and the 19BF081 plasmid was used as a transfer vector plasmid and was transfected into the above EuLV-R1 to R17 cells by PEI transient transfection (19BF081 plasmid: 0.28 μg, empty plasmid 18BF003: 0.52 μg, total plasmid 0.80 μg. The mass ratio of PEI and DNA was 4:1). After 6 hours of transfection, the medium was changed and inducers were added (final concentration of 1 μg/ml DOX, 200 μg/ml Cumate and 5 mmol/L sodium butyrate) to induce virus-production. After 48 hours, the culture supernatant was collected and the virus-producing titers of EuLV-R1 to R17 cells were detected by the HT1080 cell Luciferase virus titer detection method.
[0168] EuLV-R1 to R17 were seeded in a 24-well plate with 1.5E+05 cells per well. After 48 hours of culture, the cells were collected to extract genomic DNA and to absolutely quantify the following items by qPCR: the copy numbers of rtTA and CymR genes integrated into the genome of EuLV-R1 to R5 cell lines; the copy number of rev gene integrated into the genome of EuLV-R1 and EuLV-R6 to R9 cell lines; the copy number of VSV-G gene integrated into the genome of EuLV-R1 and EuLV-R10 to R13 cell lines; the copy numbers of gap/pol genes integrated into the genome of EuLV-R1 and EuLV-R14 to R17 cell lines; and the specific method was as follows. 1.0E+06 cells from each of the above cell lines were collected, and genomic gDNA was extracted according to the instructions of the Genomic DNA Purification Kit (TIANGEN, DP304-03), and the purified gDNA was adjusted to 50 ng/μl with the elution buffer in the kit. Plasmids 19BF074, 18BF072, 18BF068 and 18BF074 were used as standard samples for HygroR (to detect the copy numbers of rtTA and CymR), rev, VSV-G, and gag/pol genes, and diluted with deionized water to 47.9 ng/μl, 23.8 ng/μl, 30.0 ng/μl and 47.6 ng/μl, respectively; under such concentrations, each plasmid corresponded to 5.0E+09 copy number per microliter sample. The 4 standard samples were further diluted to 8.0E+06 copy number per microliter, and then were diluted in two-fold gradient to 1.56E+04 copy number per microliter, and the 10 diluted samples of the 4 standard samples were used as the qPCR standard curve of each gene to be detected. 2 μl of the above cell gDNA sample and the qPCR standard curve sample for each gene were added to qCPR reagent, and made up to 20 μl with water; wherein, the qCPR reagent comprises 10 μl NovoStart Probe qPCR SuperMix and 0.4 μl ROX I dye (Novoprotein Scientific Inc. E091-01A), and 0.4 μl each of the forward and reverse primers and Taqman probe at a concentration of 10 μM (synthesized from General Biosystems (Anhui) Co., Ltd., the specific information for primers and probes was shown in Table 10, among which the forward and reverse primers and probe of HygroR were: SEQ ID NO: 51, SEQ ID NO:52, SEQ ID NO:53, respectively; the forward and reverse primers and probe of rev were: SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, respectively; the forward and reverse primers and probe for VSV-G were: SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, respectively; the forward and reverse primers and probe of gag/pol were: SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, respectively). PCR reaction was performed on a ABI 7900 real-time PCR detector under the AQ program and following the steps as follows: 95° C. 5 minutes start, 95° C. 30 seconds-60° C. 30 seconds-72° C. 30 seconds for 40 cycles, and 60° C. 30 seconds. The copy number of the gene to be tested in each sample was calculated based on the standard curve and the CT value of the sample, and then the copy number of the gene per cell was calculated according to 6 pg genomic DNA per cell.
[0169] The results were shown in
[0170] 2. Further Adjustment of the Copy Number and Relative Ratio of VSV-G and gag/pol Integrated into the Genome to Optimize the Virus-Producing Ability of EuLV Packaging Cell Line
[0171] Based on the above results, the copy number and relative ratio of VSV-G and gag/pol fragment integrated into the cell genome were the key to optimize the virus-producing ability of EuLV packaging cell lines, and the total transfection and molar ratio of VSV-G and gag/pol fragments needs to be further optimized. Consistent with the above method of constructing EuLV packaging cell line using SB transposon system, EuLV-VG1 to VG5 packaging cell lines were further constructed based on the contents of each plasmid shown in Table 9. After each cell line was screened by hygromycin to grow stably, by using the same method as the above-mentioned method of preparing lentivirus in a 24-well plate, the virus was prepared with the 19BF081 plasmid as the plasmid of gene of interest and the luciferase virus titer was detected by HT1080 cells; at the same time, by using the qPCR quantitative method described above, the copy number of VSV-G and gag/pol fragments per cell integrated in the genomic DNA of each cell line was detected and the results were shown in
[0172] The results were shown in
TABLE-US-00008 TABLE 8 Amount of each plasmid transiently transfected during the construction of EuLV-R1 to R17 packaging cell line Transfection amount of each plasmid (μg) amount cell molar of total number ratio 19BF075 19BF246 18BF068 19BF131 19BF019 18BF003 plasmid R1 1:1:1:1 0.7 0.3 0.4 0.7 0.2 2.7 5.0 R2 2:1:1:1 1.3 0.3 0.4 0.7 0.2 2.1 5.0 R3 3:1:1:1 2.0 0.3 0.4 0.7 0.3 1.3 5.0 R4 4:1:1:1 2.6 0.3 0.4 0.7 0.3 0.7 5.0 R5 5:1:1:1 3.3 0.3 0.4 0.7 0.4 0 5.0 R6 1:2:1:1 0.7 0.6 0.4 0.7 0.2 2.4 5.0 R7 1:3:1:1 0.7 0.9 0.4 0.7 0.3 2 5.0 R8 1:4:1:1 0.7 1.2 0.4 0.7 0.3 1.7 5.0 R9 1:5:1:1 0.7 1.5 0.4 0.7 0.4 1.3 5.0 R10 1:1:2:1 0.7 0.3 0.8 0.7 0.2 2.3 5.0 R11 1:1:3:1 0.7 0.3 1.2 0.7 0.3 1.8 5.0 R12 1:1:4:1 0.7 0.3 1.7 0.7 0.3 1.3 5.0 R13 1:1:5:1 0.7 0.3 2.1 0.7 0.4 0.8 5.0 R14 1:1:1:2 0.7 0.3 0.4 1.3 0.2 2.1 5.0 R15 1:1:1:3 0.7 0.3 0.4 2.0 0.3 1.3 5.0 R16 1:1:1:4 0.7 0.3 0.4 2.6 0.3 0.7 5.0 R17 1:1:1:5 0.7 0.3 0.4 3.3 0.4 0 5.0
TABLE-US-00009 TABLE 9 Amount of each plasmid transiently transfected during the construction of VG1 to VG9 cell lines Transfection amount of each plasmid (μg) amount cell molar of total number ratio 19BF075 19BF246 18BF068 19BF131 19BF019 18BF003 plasmid VG1 3:3:1:12 0.8 0.4 0.2 3.2 0.3 0.1 5.0 VG2 3:3:2:12 0.8 0.4 0.3 3.1 0.3 0.1 5.0 VG3 3:3:3:12 0.8 0.4 0.5 3.0 0.4 0 5.0 VG4 3:3:4:12 0.7 0.3 0.6 2.9 0.4 0.1 5.0 VG5 3:3:5:12 0.7 0.3 0.8 2.8 0.4 0 5.0
TABLE-US-00010 TABLE 10 Information of primers and Taqman probe sequences 5′ 3′ purification modifi- modifi- name sequence (5′ to 3′) method cation cation 48 Gag-taqman-F01 GGAGCTAGAACGATTCGCAGTTA PAGE 49 Gag-taqman-R01 TGATCCTGTCTGAAGGGATGGT PAGE 50 Gag-Probe-01 TCCTGGCCTGTTAGAAA HPLC FAM MGB 51 Hygro-taqman-F01 TGCTCCGCATTGGTCTTGA PAGE 52 Hygro-taqman-R01 CTTCGGACGATTGCATCACA PAGE 53 Hygro-Probe-01 ATGCTGCTTGGGCGC HPLC FAM MGB 54 REV-taqman-F01 AGGAATAGAAGAAGAAGGTGGAGAG PAGE A 55 REV-taqman-R01 GCACAGGCTCCGCAGATC PAGE 56 REV-Probe-01 ATTCGATTAGTGAACGGATC HPLC FAM MGB 57 VS VG-taqman-F01 ATTGCCCGTCAAGCTCAGAT PAGE 58 VS VG-taqman-R01 CCGTCTGCTTGAATAGCCTTGT PAGE 59 VSVG-Probe-01 TACAAGTCAAAATGCCCAAGAG HPLC FAM MGB
Example 5: Construction of EuLV293T3rd Lentivirus Packaging Cell Line and Screening of High-Throughput Monoclones
[0173] The process of constructing EuLV293T3rd lentivirus packaging cell line was shown in
[0174] 1. Construction of the Initial EuLV293T3rd Lentivirus Packaging Cell Line by Plasmid Transfection and Cell Line Screening
[0175] The specific experimental method was as follows. Regarding the experimental procedures of cell culture, PEI transfection and hygromycin screening, please refer to Examples 2, 3 and 4.293T cells (ATCC, CRL3216) were seeded in a 60 mm dish at 1.5E+06 cells per dish and cultured at 37° C. 5% CO.sub.2 for 24 hours, wherein the medium was 3 ml DMEM complete medium (Sigma, D6429) supplemented with 10% FBS (ExCell, 11H116). Plasmid transfection was performed by a PEI transfection method, wherein the amount of total plasmid was 5 μg, the mass ratio of PEI to the total plasmid was 4:1; EuLV293T3rd-SB16 cell was transfected and constructed at the molar ratio of plasmids 19BF257:19BF246:18BF067:19BF130:18BF019 being 3:3:2:12:2; EuLV293T3rd-SB28 was transfected and constructed at the molar ratio of plasmids 19BF075:19BF246:18BF068:19BF131:18BF019 being 3:3:2:12:2. After 24 hours of transfection, the cells were all seeded into a 100 mm culture dish for continuous culture, and 200 μg/ml hygromycin (Sangon Biotech A600230-0001) was added for screening. This screening pressure was maintained for at least 3 passages of subculture until the cells were stable. The judgment is based on: (1) the growth rate of the cells was the same as that of original 293T cells, (2) the SB transposase expression plasmid 18BF019 substantially disappeared in the constructed cells, which was characterized by the proportion of ECFP positive cells being reduced to less than 1%, and (3) the proportion of live cells was more than 95%. Based on the above criteria, the initial cell lines of EuLV293T3rd-SB16 (SB16 cells for short) regulated by the Tet-On single inducible expression system and EuLV293T3rd-SB28 (SB28 cells for short) regulated by the Tet-On and Cumate complex inducible expression system were obtained.
[0176] 2. Screening of EuLV293T3rd-SB16 and EuLV293T3rd-SB28 High-Yielding Monoclonal Packaging Cell Line
[0177] The specific experimental method was as follows. The screening process of SB16 and SB28 high-yielding monoclonal cell lines was shown in
[0178]
[0179] Regarding the 384-well plate monoclonal screening, the specific experimental steps were as follows. The SB16 and SB28 initial cells constructed above were cultured in a DMEM complete medium at 37° C. and 5% CO.sub.2 to a monolayer of 70% confluence. By the limiting dilution method, cells were seeded in a 384-well plate at the density of one cell per well, and 5 384-well plates for SB16 and SB28 cells, respectively. After seeding for 2 hours until the cells adhered to the wall, sample wells with only one cell were observed and marked by an inverted microscope (Olympus IX71), and other sample wells were discarded. The medium was changed to a fresh DMEM complete medium on the 5th and 9th days after seeding; on the 10th day, the monoclonal cells with a confluence greater than 50% were seeded into a 96-well plate at 2E+04 cells per well, and a total of 271 strains of SB16 monoclonal cells and 313 strains of SB28 cells were obtained.
[0180] Regarding the 96-well plate monoclonal screening, the specific experimental steps were as follows. After culturing the cells obtained from the monoclonal screening step of 384-well plate for 24 hours, the cells were seeded at 5E+03 and 2.5E+04 cells per well in two new 96-well plates, and used for the subculture and the induced virus-producing detection of lentivirus. In the step of induced virus production of monoclonal cells, a positive control of lentivirus was prepared by transiently transfecting 293T cells, and the method was as follows: 293T cells were seeded into a 96-well plate at 2.5E+04 cells per well; after 24 hours of culture, the virus was prepared by transient transfection of plasmids via the PEI method (the total DNA amount was 0.3 μg, wherein the molar ratio of plasmid 19BF081:pMD2.G:pMDLg/PRRE:pRSV-Rev was 1:1:1:1, and the mass ratio of total DNA to PEI MAX was 1:4). 2 hours after transfection, the inducers (final concentration of 2 mmol/L sodium butyrate, 1 μg/ml DOX, 200 μg/ml Cumate) were added, and the cells were subjected to further culture for 48 hours and centrifugation at 4500 rpm for 15 minutes to collect supernatant virus. The method for inducing virus production by monoclonal cells in a 96-well plate was as follows: the above-mentioned monoclonal cells to be tested, which were seeded at 2.5E+04 cells per well in a 96-well plate, were cultured for 24 hours, and then transfection reagents were added (the amount of total DNA was 0.3 μg, wherein the amount of 19BF081 added was the same as the above positive control, the amount of remaining plasmid was made up to 0.3 μg with 18BF003, and the mass ratio of total DNA to PEI MAX was 1:4). Afterwards, the method of inducing virus production and recovering the virus supernatant was the same as the method of preparing the positive control. According to the HT1080 cell Luciferase virus titer detection method described in Example 2, the RLU value of the positive control and each sample of monoclonal cells for inducing virus production was detected. Then, according to the results of Luciferase virus titer, the monoclonal cells with RLU values higher than the positive control were selected in the order of from high RLU value to low RLU value, to obtain 87 SB16 monoclonal cells and 94 SB28 monoclonal cells.
[0181] Regarding the monoclonal screening in 24-well plate and 6-well plate, the specific experimental steps were as follows. The screening process of high-yield monoclonal cells in 24-well plate and 6-well plate was substantially the same as the aforementioned monoclonal screening in 96-well plate. During subculture, the seeding density of 24-well plate was 2E+04 cells per well, and that of 6-well plate was 2E+05 cells per well. In the step of inducing virus production of monoclonal cells, the seeding density of 24-well plate was 1E+05 cells per well, and the seeding density of 6-well plate was 8E+05 cells. When transfecting plasmids by the PEI method, the amount of total DNA per well in a 24-well plate was 1.2 μg, and that in a 6-well plate was 5 μg, and other transfection conditions such as the ratio of each plasmid and the ratio of DNA to PEI were consistent with the above experimental method. According to the results of the HT1080 cell Luciferase virus titer detection method, in the stage of monoclonal screening in 24-well plate, 30 high-yielding packaging cell lines were screened respectively from 87 SB16 and 94 SB28 monoclonal cells. In the monoclonal screening stage of 6-well plate, 9 strains of SB16 and SB28 monoclonal high-yielding packaging cells were further screened from 30 strains of cells respectively and the numbers of final screened monoclonal cells were shown in Table 11.
TABLE-US-00011 TABLE 11 List of high-yielding packaging cell clone numbers EuLV293T.sup.3rd-SB28 high-yielding clone number EuLV293T.sup.3rd-SB16-3A5 EuLV293T.sup.3rd-SB28-1A3 EuLV293T.sup.3rd-SB16-3C1 EuLV293T.sup.3rd-SB28-1C2 EuLV293T.sup.3rd-SB16-3C3 EuLV293T.sup.3rd-SB28-1C3 EuLV293T.sup.3rd-SB16-3C4 EuLV293T.sup.3rd-SB28-1C4 EuLV293T.sup.3rd-SB16-3D3 EuLV293T.sup.3rd-SB28-1C6 EuLV293T.sup.3rd-SB16-4A1 EuLV293T.sup.3rd-SB28-2B5 EuLV293T.sup.3rd-SB16-4A5 EuLV293T.sup.3rd-SB28-2C3 EuLV293T.sup.3rd-SB16-4B1 EuLV293T.sup.3rd-SB28-2C6 EuLV293T.sup.3rd-SB16-4C4 EuLV293T.sup.3rd-SB28-2D1
[0182] 3. Suspension Adaptation of High-Yielding EuLV293T3rd Monoclonal Packaging Cell and Detection of Virus-Packaging Ability
[0183] The specific experimental method was as follows. The 18 strains of monoclonal cells obtained in Table 11 were seeded at 5E+05 cells/ml and 20 ml per bottle into a 125 ml shake flask (Corning 431143) for suspension adaptation, wherein the medium was Freestyle293 (Gibco®FreeStyle™ 293Expression Medium 12338018), the culture conditions were 37° C., 5% CO.sub.2, and shaked with a shaking distance of 1.9 cm and a rotating speed of 140 rpm. The cells were subcultured when growing to 2.5E+06 cells/ml, and were cultured continuously until there was no obvious cell cluster and the doubling time was less than 24 hours, to obtain the suspension culture cell line of the above 18 strains of cell. The virus preparation method of the suspension cultured SB16 and SB28 cell lines was as follows. After the above cells were cultured in suspension to a density of 2.5E+06 cells/ml, the cells were harvested by centrifugation at 1000 rpm for 3 minutes, resuspended in a fresh Freestyle293 medium and adjusted to a cell density of 4E+06 cells/ml. The cell suspension was introduced to a 96-deep well plate at 0.5 ml per well, and 50 μL of PEI transfection reagent prepared in a DMEM medium was added, wherein the PEI transfection reagent contained 7.5 μg PEI MAX and 2.5 μg total DNA (containing 1 μg 18BF081 and 1.5 μg 18BF003). After mixed, the cells were further cultured on a culture shaker, and the culture conditions were 37° C., 5% CO.sub.2, and shaked with a shaking distance of 1.0 cm and a rotating speed of 1000 rpm. After 2 hours, the inducers (final concentration of 2 mmol/L sodium butyrate, 1 μg/ml DOX, 200 μg/ml Cumate) were added, and the cells were subjected to further culture for 48 hours and centrifugation at 1500 rpm for 15 minutes to collect supernatant virus. Afterwards, the virus titer was detected according to the HT1080 cell Luciferase virus titer detection method as described in Example 2. The detection result was shown in
Example 6: Detection of Optimization Degree of EuLV293T3rd Optimal Virus-Producing Packaging Cell Line
[0184] At the time of packaging the lentivirus by transient transfection of transfer-vector plasmid, the optimal virus-producing monoclonal packaging cell line screened in Example 5 was co-transformed with other expression plasmids of rev, gag/pol, and VSV-G lentivirus packaging genes regulated by a constitutively active promoter, to detect whether continuous increase of the expression of virus packaging genes can further increase the virus-producing titer of packaging cells, thereby determining whether each packaging gene fragment in the cell line reached saturation and whether the relative proportion of each virus packaging gene fragment was optimized. 6 high-yielding adherent cell lines and 5 high-yielding suspended cell lines were selected from Example 5 for the above experiment. The names and numbers of the cell lines were shown in Table 12.
TABLE-US-00012 TABLE 12 The numbers of EuLV293T3rd preferred high-yielding adherent cell lines and suspension cell lines Numbers of adherently numbers of suspension cultured high-yielding cell lines cultured high-yielding cell lines 1 EuLV293T3rd-SB16-3A5 Sus-EuLV293T3rd-SB16-3C3 2 EuLV293T3rd-SB16-3C3 Sus-EuLV293T3rd-SB16-3D3 3 EuLV293T3rd-SB16-4A5 Sus-EuLV293T3rd-SB16-4A5 4 EuLV293T3rd-SB28-1A3 Sus-EuLV293T3rd-SB28-1A3 5 EuLV293T3rd-SB28-1C2 Sus-EuLV293T3rd-SB28-1C2 6 EuLV293T3rd-SB28-2C6
[0185] Experiment of supplementing lentivirus packaging gene of adherently cultured high-yielding cell lines: The adherent high-yielding cell lines shown in Table 12 were cultured at 37° C., 5% CO.sub.2, in a DMEM complete medium. Afterwards, each cell was seeded in different wells of a 6-well plate at 8E+05 cells per well, and transfections were performed according to the calcium phosphate transfection method in Example 2. During transfection, 200 μL of transfection reagent, containing 0.12 mol/L calcium chloride, 1×HEPES buffer, and 6.8 μg total plasmid amount, was added to each well. Table 13 showed the combination and amount of plasmids in each experimental group, wherein the 18BF084 plasmid expressed the rtTA.sub.adv transactivator; 19BF081 was a transfer plasmid transcribing the lentiviral genome carrying the hPGK-Luciferase-IRES-EGFP nucleic acid fragment of interest; pMD2.G (Addgene, 12259) expressed VSV-G protein; pMDLg/pRRE expressed gag and pol protein; pRSV-Rev expressed rev protein. After 6 hours of transfection, the medium was changed to a DMEM complete medium containing 5 mM sodium butyrate, and 1 μg/ml DOX and 200 μg/ml Cumate inducers were added to the samples that need to be added with inducer according to Table 13. After 48 hours of culture, the lentivirus-producing ability of each adherent cell line was detected according to the HT1080 cell Luciferase virus titer detection method as described in Example 2, and the results were shown in
[0186] Experiment of supplementing lentivirus packaging gene of suspension culture high-yielding cell lines: the suspended cell lines shown in Table 12 were cultured at 37° C., 8% CO.sub.2, in the medium of FreeStyle (Gibco® FreeStyle™ 293 Expression Medium, 12338018), and shaked with a shaking distance of 1.9 cm and a rotating speed of 140 rpm. Two hours before transfection, each suspended cell line was seeded in a 96-well deep-well plate at 4E+06 cells per well with a culture volume of 1 ml. The cells were transfected according to the PEI method in Example 5, and 100 μL of transfection sample, containing 2.5 μg of total plasmid and 7.5 μg of PEI, was added to each well during transfection. The amount of plasmid added in each experimental group was shown in Table 14. After transfection, the deep-well plate was cultured in an environment with a shaking distance of 1 mm and a rotating speed of 1000 rpm/min. After 3 hours of transfection, the sodium butyrate with a final concentration of 2 mM was added, and 1 μg/ml DOX and 200 μg/ml Cumate inducers were added to the samples that need to be added with inducer according to Table 14. After 48 hours of further culture, the virus-producing ability of each suspended cell was detected according to the HT1080 cell Luciferase virus titer detection method as described in Example 2. The result was shown in
TABLE-US-00013 TABLE 13 Names and amounts of various plasmids in each experimental group in the experiment of supplementing lentivirus packaging gene of adherently cultured high-yielding cell lines amount of transfection plasmid (μg) amount inducer pRSV- pMDLg/ of total DOX & 18BF084 pMD2.G Rev pRRE 18BF081 18BF003 plasmid experimental group Cumate (μg) (μg) (μg) (μg) (μg) (μg) (μg) 1 negative control − 0.00 0.00 0.00 0.00 0.00 0.00 0.00 2 non-induction − 0.00 0.00 0.00 0.00 2.26 4.54 6.80 3 induction + 0.00 0.00 0.00 0.00 2.26 4.54 6.80 4 rtTA.sub.adv + 2.26 0.00 0.00 0.00 2.26 2.28 6.80 5 VSV-G + 0.00 0.76 0.00 0.00 2.26 3.78 6.80 6 rev + 0.00 0.00 0.49 0.00 2.26 4.05 6.80 7 gag/pol + 0.00 0.00 0.00 1.03 2.26 3.51 6.80 8 VSV-G + rev + 0.00 0.76 0.49 0.00 2.26 3.29 6.80 9 VSV-G + gag/pol + 0.00 0.76 0.00 1.03 2.26 2.75 6.80 10 rev + gag/pol + 0.00 0.00 0.49 1.03 2.26 3.02 6.80 11 VSV-G + rev + gag/pol + 0.00 0.76 0.49 1.03 2.26 2.26 6.80 12 VSV-G + rev + gag/pol − 0.00 0.76 0.49 1.03 2.26 2.26 6.80 293T- positive control − 0.00 1.51 0.97 2.06 2.26 0.00 6.80 PC of adherent 293T transient transfection
TABLE-US-00014 TABLE 14 Names and amounts of cplasmids in each experimental group in the experiment of supplementing lentivirus packaging gene of suspension culture high-yielding cell lines amount of transfection plasmid (μg) amount inducer pRSV- pMDLg/ of total experimental DOX & 18BF084 pMD2.G Rev pRRE 18BF081 18BF003 plasmid group Cumate (μg) (μg) (μg) (μg) (μg) (μg) (μg) 1 negative control − 0.00 0.00 0.00 0.00 0.00 0.00 0.00 2 non-induction − 0.00 0.00 0.00 0.00 1.00 1.50 2.50 3 induction + 0.00 0.00 0.00 0.00 1.00 1.50 2.50 4 rtTA.sub.adv + 1.00 0.00 0.00 0.00 1.00 0.50 2.50 5 VSV-G + 0.00 0.25 0.00 0.00 1.00 1.25 2.50 6 rev + 0.00 0.00 0.15 0.00 1.00 1.35 2.50 7 gag/pol + 0.00 0.00 0.00 0.34 1.00 1.16 2.50 8 VSV-G + rev + 0.00 0.25 0.15 0.00 1.00 1.10 2.50 9 VSV-G + gag/pol + 0.00 0.25 0.00 0.34 1.00 0.91 2.50 10 rev + gag/pol + 0.00 0.00 0.15 0.34 1.00 1.01 2.50 11 VSV-G + rev + gag/pol + 0.00 0.25 0.15 0.34 1.00 0.76 2.50 12 VSV-G + rev + gag/pol − 0.00 0.25 0.15 0.34 1.00 0.76 2.50 293T- positive control − 0.00 0.50 0.30 0.70 1.00 0.00 2.50 PC of adherent 293T transient transfection
Example 7: Construction of a Variety of Lentivirus Producer Cell Lines Based on the High-Yielding Packaging Cell Lines EuLV293T3rd-SB16-3D3 and EuLV293T3rd-SB28-1C2
[0187] In this example, transfer-vector plasmids containing three different nucleic acid fragments of interest were stably integrated into the genomes of EuLV293T3rd-SB16-3D3 (hereinafter referred to as 3D3) and EuLV293T3rd-SB28-1C2 (hereinafter referred to as 1C2) packaging cells by the PB transposon system, and six lentivirus producer cell lines that stably produce three different lentiviruses were screened and obtained respectively. The above three transfer-vector plasmids of viral genome transcriptional cassette carrying a nucleic acid fragment of interest were: (1) 19BF081 (hPGK-Luciferase-IRES-EGFP, the length of lentiviral genome was 5.7kbp); (2) 19BF218 (the coagulation factor 8 sequence with the B protein domain deleted, CMV-BDDF8cHA-IRES-EGFP, the length of lentiviral genome was 8.5 kbp); (3) 19BF217 (the full length sequence of coagulation factor 8, CMV-F8cHA-IRES-EGFP, the length of lentiviral genome was 11.2 kbp). In order to facilitate the detection of lentivirus-producing titer of the above producer cell lines, the above nucleic acid fragments of interest were all linked with an IRES-EGFP sequence, and regarding the detailed method of constructing plasmids, please refers to Example 1. Afterwards, under adherent culture conditions, the virus-producing ability of these stable lentivirus producer cell lines was compared with that of the cells obtained by the method of transiently transfecting 293T with the same transfer plasmid to produce lentivirus. Afterwards, two types of cells constructed based on 3D3 and 1C2 and carrying the 19BF081 transfer vector were subjected to suspension culture in serum-free medium, and under such conditions, the induced virus-producing titers and the leaky virus-producing titers under non-induced conditions were detected. The method for constructing a stable lentivirus producer cell line of the present disclosure can be used to construct a stable lentivirus producer cell line carrying any nucleic acid fragment of interest.
[0188] Based on 3D3 and 1C2 cells, a producer cell line for the stable production of three different lentiviruses was constructed, and the specific steps were as follows. 3D3 and 1C2 cells were seeded in a 6-well plate at 1.5E+06 cells per well in 3 ml DMEM complete medium, cultured at 37° C. and 5% CO.sub.2 for 24 hours, and then transfected by PEI method, wherein the amount of total plasmid was 5.5 ug, the molar ratio of transfer plasmid: PB transposase plasmid (18BF031) was 10:1, and the amount of total PEI was 22 ug. The transfer plasmids were 19BF081, 19BF218 and 19BF217 respectively. 24 hours after transfection, 2.5 μg/ml puromycin (Aladdin P113126) was added to screen for at least 3 passages until the cell line was stable. Six lentivirus stable producer cell lines were obtained, namely 3D3-19BF081, 3D3-19BF218, 3D3-19BF217, 1C2-19BF081, 1C2-19BF218 and 1C2-19BF217.
[0189] The virus-producing ability of cells obtained by the method of stable lentivirus producer cell line and that obtained by transient transfection method were compared, and the specific steps were as follows. The above 6 kinds of obtained cells were seeded in a 6-well plate at 8E+05 cells per well in a DMEM complete medium, and cultured at 37° C. and 5% CO.sub.2 for 24 hours, and then the medium was changed to a fresh DMEM complete medium, and inducers (final concentration of 2 mmol/L sodium butyrate, 1 μg/ml DOX and 200 μg/ml Cumate) were added. After an additional 48 hours of culture, the virus supernatant was collected by centrifugation at 4500 rpm for 15 minutes. The method of preparing the virus by transiently transfecting 293T cells was the same as the method of preparing the positive control lentivirus described in Example 5, wherein the molar ratio of the transfer-vector plasmid: pMD2.G: pMDLg/PRRE: pRSV-Rev was 1:1:1:1, and the transfer-vector plasmids were 19BF081, 19BF218 and 19BF217 respectively.
[0190] The transfection titer of the above virus sample was detected based on the EGFP positive rate method of HT1080 cells, and the specific steps were as follows. HT1080 cells (ATCC CCL-121) were seeded in a 24-well plate (Corning 3524) at 5E+04 cells per well under the same culture conditions as 293T. After 24 hours, at least 3 wells were taken, digested with trypsin, and counted; the other wells were changed to 500 μL of DMEM complete medium containing 8 μg/mL polybrene (Sigma H9268). The virus solution was diluted to a variety of detection concentrations with DMEM complete medium, and then 100 μL of the diluted virus solution was added to the 24-well plate used for culturing HT1080 cells; a variety of dilution concentrations were detected for each virus sample; 100 μL of DMEM complete medium was added to the negative control, mixed, and cultured for 48 hours. Afterwards, the EGFP positive rate in each well was detected by flow cytometer (Aisen NovoCyte Flow Cytometer). A dilution with an EGFP positive rate of 15%-30% was selected to calculate the lentivirus titer according to the following formula. Lentivirus titer (TU/ml)=dilution factor×(cell count result of 24-well plate×positive rate)/0.1 ml. The experimental result was shown in
[0191] The virus-producing titers and leaked-virus titers of 3D3-19BF081 and 1C2-19BF081 cells under suspension culture conditions were detected, and the specific steps were as follows. According to the cell suspension adaptation method described in Example 5, 3D3-19BF081 and 1C2-19BF081 cells were adapted to suspension culture. When the suspended cells growed to 2.5E+06 cells/ml, the cells were harvested by centrifugation at 1000 rpm/min for 3 minutes, and adjusted to a cell density of 4E+06 cells/ml with a fresh Freestyle293 medium. The cell suspension was introduced to a 50 ml centrifuge tube at 5 ml/tube, and an induction group added with inducers (final concentration of 2 mmol/L sodium butyrate, 1 μg/ml DOX, 200 μg/ml Cumate) and a non-induction group added with DMEM medium were provided and cultured for 48 hours on a shaker, and then the supernatant viruses were collected by centrifugation at 4500 rpm for 15 minutes. The positive control was a virus prepared by transiently transfecting 293T cells cultured in the same suspension culture condition, and the specific steps were as follows. Plasmid transfection was performed by a PEI transfection method, wherein the amount of total plasmid was 12.5m, the mass ratio of PEI to the total plasmid was 4:1, and the molar ratio of plasmid 19BF081: pMD2.G:pMDLg/PRRE 1:pRSV-Rev was 1:1:1:1. After 6 hours of transfection, sodium butyrate was added at a final concentration of 2 mmol/L, and the culture was continued until the virus sample was recovered by centrifugation. Afterward, the RLU value of each sample was detected according to the HT1080 cell Luciferase virus titer detection method as described in Example 2, and the results were shown in