FC-GAMMA RECEPTOR MUTANTS
20200408778 ยท 2020-12-31
Assignee
Inventors
- Sang Taek JUNG (Gyeonggi-do, KR)
- Migyeong Jo (Gyeonggi-do, KR)
- Sanghwan Ko (Seoul, KR)
- Bora Hwang (Gyeonggi-do, KR)
Cpc classification
C12N5/00
CHEMISTRY; METALLURGY
A61K38/1774
HUMAN NECESSITIES
G01N33/6845
PHYSICS
C07K2319/24
CHEMISTRY; METALLURGY
C07K2317/94
CHEMISTRY; METALLURGY
G01N2500/04
PHYSICS
C07K14/70535
CHEMISTRY; METALLURGY
C07K2319/31
CHEMISTRY; METALLURGY
C07K16/22
CHEMISTRY; METALLURGY
G01N33/53
PHYSICS
C12N15/00
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
International classification
Abstract
The present disclosure relates to a polypeptide including an Fc-gamma receptor mutant. The Fc-gamma receptor mutant of the present disclosure is optimized by substituting a part of an amino acid sequence of an Fc-gamma receptor with a different amino acid sequence, so as to provide an excellent selective binding ability to immunoglobulins. Therefore, it can be usefully used for increasing in vivo half-life of drugs, detecting and purifying immunoglobulins, inhibiting organ transplant rejections, or preventing or treating autoimmune diseases.
Claims
1. A polypeptide comprising an Fc-gamma receptor mutant, wherein the mutant is one in which the 117th amino acid and the 159th amino acid of the sequence of the wild-type Fc-gamma receptor of SEQ ID NO 43 or SEQ ID NO 49 are changed.
2. The polypeptide according to claim 1, wherein the mutant is an Fc-gamma receptor mutant containing a sequence wherein the 117th amino acid from SEQ ID NO 43 or SEQ ID NO 49 is substituted with asparagine (N) and the 159th amino acid is substituted with glutamine (Q).
3. The polypeptide according to claim 2, wherein the mutant is an Fc-gamma receptor mutant further comprising one or more amino acid substitution selected from a group consisting of the 55th amino acid, the 86th amino acid, the 119th amino acid, the 127th amino acid and the 171st amino acid.
4. The polypeptide according to claim 3, wherein the mutant is an Fc-gamma receptor mutant comprising one or more amino acid substitution selected from a group consisting of substitution of the 55th amino acid with histidine (H), substitution of the 86th amino acid with aspartic acid (D), substitution of the 119th amino acid with methionine (M) or valine (V), substitution of the 127th amino acid with leucine (L) and substitution of the 171st amino acid with glutamic acid (E).
5. The polypeptide according to claim 1, wherein the mutant comprising the amino acid substitution has improved binding ability to an Fc region of an IgG antibody when compared with the wild-type Fc-gamma receptor.
6. A nucleic acid molecule encoding the polypeptide according to claim 1.
7. A vector comprising the nucleic acid molecule according to claim 6.
8. A host cell comprising the vector according to claim 7.
9. A composition comprising the polypeptide according to claim 1, a nucleic acid molecule encoding said polypeptide or a vector comprising said nucleic acid molecule.
10. The composition according to claim 9, wherein the composition is for detecting an IgG antibody or an Fc region of the IgG antibody comprised in a sample.
11. A kit for detecting an IgG antibody or an Fc region of the IgG antibody, which comprises the composition according to claim 10.
12. The composition according to claim 9, wherein the composition is a pharmaceutical composition for immunosuppression.
13. The composition according to claim 9, wherein the composition is a pharmaceutical composition for suppressing organ transplant rejection.
14. The composition according to claim 9, wherein the composition is a pharmaceutical composition for preventing or treating autoimmune disease.
15. A method for suppressing immunity or organ transplant rejection, which comprises a step of administering the composition according to claim 9.
16. A method for preventing or treating autoimmune disease, which comprises a step of administering the composition according to claim 9.
17. A fusion protein or peptide wherein the polypeptide according to claim 1 is bound to a physiologically active protein or a physiologically active peptide, wherein the fusion protein or peptide has increased in vivo half-life due to increased retention in vivo.
18. A method for preparing a polypeptide comprising an Fc-gamma receptor mutant, which comprises: a) a step of culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the polypeptide according to claim 1; and b) a step of recovering a polypeptide expressed by the host cell.
19. A method for purifying an IgG antibody or an FE region of the IgG antibody comprised in a sample, which comprises: a) a step of binding the polypeptide according to claim 1 to a sample comprising an IgG antibody or an Fe region of the IgG antibody by mixing them together; and b) a step of purifying the IgG antibody or the Fc region of the IgG antibody with the polypeptide bound.
20. A method for screening an Fe-gamma receptor mutant with improved binding ability for an IgG antibody or an Fc region of the IgG antibody, which comprises: a) a step of establishing an Fc-gamma receptor mutant library including a sequence wherein the 117th amino acid from SEQ ID NO 43 or SEQ ID NO 49 is substituted with asparagine (N) and the 159th amino acid is substituted with glutamine (Q); and b) a step of screening an Fc-gamma receptor mutant with improved binding ability for an IgG antibody or an Fc region of the IgG antibody when compared with the Fc-gamma receptor mutant including only the substitution of the two amino acid sequences from the library.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
BEST MODE
[0141] Hereinafter, the present disclosure will be described in detail through examples. However, the following examples are for illustrative purposes only and it will be apparent to those of ordinary skill in the art that the scope of the present disclosure is not limited by the examples.
EXAMPLES
Example 1. Construction of FcRIIa Mutant Library
[0142] Random mutation-introduced FcRIIa genes were prepared using MJ #160 and MJ #161 primers based on the pMopac12-NlpA-FcRIIa-FLAG vector so that about 0.2% of random mutation occurred in FcRIIa. In addition, focused inserts with various amino acids introduced were prepared by introducing the degenerate codon NNK at the IgG Fc binding site of FcRIIa using MJ #160, MJ #161, p788, p789, p790, p791, p792 and p793 primers (Table 1). The prepared two inserts were treated with the SfiI (New England Biolab) restriction enzyme and ligated with the vector. Then, an FcRIIa mutant library (library size: 2.210.sup.9) was constructed by transforming into E. coli Jude1 ((F [Tn10(Tet.sup.r)proAB.sup.+lac1.sup.q(lacZ)M15] mcrA(mrr-hsdRMS-mcrBC)80dlacZM15 lacX74 deoR recA1 araD139(ara leu)7697 galUgalKrpsLendAInupG) (
TABLE-US-00001 TABLE1 Primer# Sequence(5.fwdarw.3) P788(SEQIDNO1) GCGGGGTTTGCAGCACCAGMNNMNNMNNAAGCAC GGTCAGATGCACCG P789(SEQIDNO2) CGGTGCATCTGACCGTGCTTNNKNNKNNKCTGGTGC TGCAAACCCCGC P790(SEQIDNO3) GCTTTTGCCATTCTGAAAAAAGGTCACTTTMNNCAG MNNMNNATCTTTCCAGCTATGGCAACGCAG P791(SEQIDNO4) CTGCGTTGCCATAGCTGGAAAGATNNKNNKCTGNN KAAAGTGACCTTTTTTCAGAATGGCAAAAGC P792(SEQIDNO5) GCGGAATGCTAAAGGTCGGATCCAGMNNAGAMNNT TTCTGMNNTTTGCCATTCTGAAAAAAGGTCACTTTC ACC P793(SEQIDNO6) GGTGAAAGTGACCTTTTTTCAGAATGGCAAANNKCA GAAANNKTCTNNKCTGGATCCGACCTTTAGCATTCC GC IIaFwNdeI(SEQIDNO7) GCGGAATTCCATATGCAGGCTGCCCCACCGAAAG IIaRvHindIII(SEQIDNO8) TAAGGGAAGCTTAATCACGCCCATCGGTGAGC MJ#1(SEQIDNO9) CCAGGCTTTACACTTTATGC MJ#2(SEQIDNO10) CTGCCCATGTTGACGATTG MJ#112(SEQIDNO11) CAGCGGTTTATCTTTCCAGCTATGGC MJ#113(SEQIDNO12) GCCATAGCTGGAAAGATAAACCGCTGNNKNNGGTG NNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#114(SEQIDNO13) GCCATAGCTGGAAAGATAAACCGCTGNNKGATGTG NNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#115(SEQIDNO14) GCCATAGCTGGAAAGATAAACCGCTGNNKTTTGTGN NKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ#116(SEQIDNO15) GCCATAGCTGGAAAGATAAACCGCTGNNKCATGTG NNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#117(SEQIDNO16) GCCATAGCTGGAAAGATAAACCGCTGNNKATTGTG NNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#118(SEQIDNO17) GCCATAGCTGGAAAGATAAACCGCTGNNKTATGTG NNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#119(SEQIDNO18) GCCATAGCTGGAAAGATAAACCGCTGNNKNNGGTG NWKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#120(SEQIDNO19) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTG GCGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#121(SEQIDNO20) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTG GGCTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#122(SEQIDNO21) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTG CCGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#123(SEQIDNO22) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTG CGTTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#124(SEQIDNO23) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTG TGGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCT C MJ#160(SEQIDNO24) CGCAGCGAGAGGCCCAGCCGGCCATG MJ#161(SEQIDNO25) CGCAATTCGGCCCCCGAGGCCCC MJ#162(SEQIDNO26) CGCAGCGAGCGCGCACTCCATGCAGGCTGCCCCACC MJ#163(SEQIDNO27) CCCTAAAATCTAGAAATCACGCCCATCGGTGAGC MJ#197(SEQIDNO28) CGGGAAAATTTCTTGGATTTTCCATTCTGGAAGAA MJ#198(SEQIDNO29) GCTGGAAGGACAAGCCTCTGGTCAATGTCGTGTTCT TCCAGAATGGAAAATCCAAGAAATTTTCCCG MJ#199(SEQIDNO30) CGCAATTCGGCCCCCGAGGCCCCGGGCTCTTGGACA GTGATGGTCACAGGCTTG MJ#200(SEQIDNO31) CAGCCCAGCTACCATTTCAAGGCCAAC MJ#201(SEQIDNO32) GTTGGCCTTGAAATGGTAGCTGGGCTG MJ#202(SEQIDNO33) CATAGGCTACACGCAGTACTCATCCAAGC MJ#203(SEQIDNO34) GCTTGGATGAGTACTGCGTGTAGCCTATG
Example 2. Screening of FcRIIa Mutant Library Through Bacterial Culture and Flow Cytometry
[0143] 1 mL of the established FcRIIa mutant library cells were cultured for 4 hours in a Terrific broth (TB) medium containing 2% (w/v) glucose and chloramphenicol (40 g/mL) under the condition of 37 C. while shaking at 250 rpm. The cultured library cells were inoculated to a TB medium at 1:100 and then cultured to OD.sub.600 0.6 at 37 C. while shaking at 250 rpm. Then, after culturing at 25 C. for 20 minutes for cooling, 1 mM isopropyl-1-thio--D-galactopyranoside (IPTG) was added to induce expression. After the culturing was completed, the cells were recovered and centrifuged at 14,000 rpm for 1 minute through OD.sub.600 normalization. After harvesting, the cells were resuspended by adding 1 mL of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 minute. This washing process was repeated twice. After resuspending in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer cell membrane was removed by rotating at 37 C. for 30 minutes. After centrifuging and discarding the supernatant, the remainder was resuspended by adding 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8] and then centrifuged. After resuspending in 1 mL of a mixture solution prepared by 1 mL of solution A and 20 L of a 50 mg/mL lysozyme solution, the peptidoglycan layer was removed by rotating at 37 C. for 15 minutes. After centrifuging and removing the supernatant, the remainder was resuspended in 1 mL PBS. 300 L of the resulting solution was taken, combined with 700 L of PBS and a human serum IgG-FITC probe (Sigma Aldrich), and then labeled with the fluorescent probe in spheroplasts by rotation at room temperature. After the labeling, followed by washing once with 1 mL of PBS, the top 3% cells exhibiting high fluorescence were recovered by flow cytometry (S3 cell sorter; Bio-Rad) and the sorted cells were sorted again to increase purity. After amplifying genes by PCR from the resorted sample using MJ #160 and MJ #161 primers and Taq polymerase (Biosesang), a gene-amplified sub-library was constructed by ligation with SfiI restriction enzyme treatment and transformation. After repeating this procedure for a total of 4 rounds, SH2A40 mutants (SEQ ID NOS 36 and 44) showing higher affinity for human serum IgG than wild-type FcRIIa (SEQ ID NOS 35 and 43) were screened by analyzing the 40 individual clones (
Example 3: Cloning, Expression and Purification of Isolated SH2A40 Mutant for Expression in Mammalian Cells
[0144] In order to express the screened SH2A40 mutant in HEK293F cells, pMAZ-FcRIIa (wild type) and pMAZ-FcRIIa mutant (SH2A40) were prepared by gene amplification by PCR using Vent polymerase and MJ #162 and MJ #163 primers, followed by ligation by treatment with BssHII and XbaI (New England Biolab) restriction enzymes. The genes cloned into the mammalian cell expression vector pMAZ were transfected into HEK293F cells and expressed temporarily at a scale of 300 mL. After culturing was completed, the cells were removed by centrifuging at 2,000 rpm for 10 minutes, and the supernatant was taken and equilibrated using 25PBS. The resulting solution was filtered through a 0.2-m bottle top filter (Merck Millipore). After adding 1 mL of a Ni-NTA agarose (Qiagen) slurry equilibrated with PBS, the solution was stirred at 4 C. for 16 hours and then flown into a polypropylene column (Thermo Fisher Scientific). The pass-through solution was taken, bound to a resin and then washed sequentially with 50 mL of 1PBS, 25 mL of 10 mM imidazole buffer, 25 mL of 20 mM imidazole buffer and 200 L of 250 mM imidazole buffer. Elution was performed with 2.5 mL of 250 mM imidazole buffer. The collected protein was concentrated with Amicon Ultra-4 (Merck Millipore) and purified by SDS-PAGE (Bio-Rad) (
Example 4: ELISA Using Rituximab Consisting of IgG1 Subclass for Analysis of Activity and Binding Ability of FcRIIa Protein Produced Through Mammalian Cell Culturing
[0145] 50 L of rituximab diluted to 4 g/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto a Flat Bottom Polystyrene High Bind 96 well microplate (Costar) at 4 C. for 16 hours and then blocked in 100 L of 5% BSA (in 0.05% PBST) at room temperature for 2 hours. After washing with 180 L of 0.05% PBST for 4 times, 50 L of FcRIIa proteins serially diluted with a blocking solution were added to each well and incubated at room temperature for 1 hour. After the washing, antibody reaction was conducted using 50 L of anti-His-HRP conjugate (Sigma-Aldrich) at room temperature for 1 hour and washing was conducted. After color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4. Then, analysis was conducted using the Epoch microplate spectrophotometer (BioTek). All the experiments were conducted in duplicates. Through ELISA, the binding ability for the Fc region of rituximab and wild-type FcRIIa, SH2A40 could be compared and analyzed. SH2A40 showed a binding ability similar to that of WT FcRIIa because a N-linked canonical glycosylation motif was newly generated (
Example 5. Cloning for Expression of MBP-FcRIIa Protein, Expression in E. coli, and Purification
[0146] In order to produce the screened SH2A40 as a soluble protein, PCR was conducted using IIa_Fw_NdeI and IIa_Rv_HindIII primers. After treating with NdeI and HindIII (New England Biolab) and ligating with the pET22b-MBP-TEV site-His vector, the product was transformed into BL21 (DE3) cells. The cells were precultured in a TB medium containing 2% (w/v) glucose and ampicillin (100 g/mL) at 37 C. while shaking at 250 rpm. The cultured cells were inoculated into a TB medium at 1:100 and then cultured until OD.sub.600 0.6 at 37 C. while shaking at 250 rpm. Subsequently, after culturing the cells at 18 C. for 20 minutes for cooling, expression was induced for 14 hours by adding 1 mM IPTG. After the culturing was finished, the cells were harvested by centrifuging at 7,000 rpm for 10 minutes. The cells were sonicated (5 seconds on/10 seconds off, 100 cycles) for lysis and centrifuged at 15,000 rpm for 30 minutes. The supernatant was filtered through a 0.45-m syringe filter. The filtered supernatant was bound to a Ni-NTA resin, washed with 100 mL of 10 mM imidazole buffer and 100 mL of 20 mM imidazole buffer, and then eluted with 4 mL of 50 mM imidazole buffer. The eluted sample was buffer-exchanged with 50 mM Tris-HCl and MBP-SH2A40 was cleaved into MBP and SH2A40 using TEV-GST. Then, TEV-GST and the MBP protein were removed using GST resin and amylose resin and only pure SH2A40 was obtained (
Example 6. Analysis of Binding Ability to IgG1 of FcRIIa Mutant Expressed in E. coli by ELISA
[0147] ELISA was conducted to investigate the activity of SH2A40. 50 L of rituximab diluted to 4 g/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4 C. for 16 hours and blocked with 100 L of 4% skim milk (GenomicBase) (in 0.05% PBST) at room temperature for 2 hours. After washing with 180 L of 0.05% PBST for 4 times, 50 L of WT FcRIIa and SH2A40 serially diluted with 1% skim milk (in 0.05% PBST) were added to each well and incubated at room temperature for 1 hour. After washing, antibody reaction was conducted at room temperature for 1 hour using 50 L of anti-His-HRP conjugate (Sigma). After washing, followed by color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4 and analysis was conducted using the Epoch microplate spectrophotometer (BioTek) (
Example 7: Construction of FcRIIa Mutant Library without Formation of N-Linked Canonical Glycosylation Motif
[0148] A library was constructed to screen FcRIIa mutants with high affinity for IgG Fc with no N-linked canonical glycosylation motif (N-X-S/T) formed in the FcRIIa mutant (SH2A40: K117N, L159Q). The library was constructed while focusing at V116, K117 and T119 positions where N-linked canonical glycosylation motif was formed in SH2A40. The library was constructed using SH2A40 as a template. A reduced codon was used in order to avoid unpaired Cys (
[0149] 1. Sub-Library-1: No Asn or Cys Formation at 117th Position
[0150] pMopac12-NlpA-FcRIIa(SH2A40)-FLAG was used as a template. NNK degenerate codon was used for the 116th and 119th positions to code 20 amino acids, NNG reduced codon was used for the 117th position to code 13 amino acids, and primers coding individual amino acids were used for the 5 remaining amino acids (Gln, Phe, His, Ile, Tyr). The fragment-1 at the front 116th position of the FcRIIa gene was amplified using MJ #160 and MJ #112 primers and Vent polymerase (New England Biolab), and the fragment-2 on the rear side was amplified using a mixture of MJ #113-MJ #118 at the same ratio and MJ #161. The prepared two fragments were assembled with Vent polymerase and treated with SfiI (New England Biolab) restriction enzyme.
[0151] 2. Sub-Library-2: No Ser, Thr or Cys Formation at 119th Position
[0152] pMopac12-NlpA-FcRIIa(SH2A40)-FLAG was used as a template. NNK degenerate codon was used for the 116th and 117th positions to code 20 amino acids, NNG reduced codon was used for the 119th position to code 12 amino acids, and primers coding individual amino acids were used for the 5 remaining amino acids (Ala, Gly, Pro, Arg, Trp). The fragment-1 at the front 116th position of the FcRIIa gene was amplified using MJ #160 and MJ #112 primers and Vent polymerase (New England Biolab), and the fragment-2 on the rear side was amplified using a mixture of MJ #119-MJ #124 at the same ratio and MJ #161. The prepared two fragments were assembled with Vent polymerase and treated with SfiI (New England Biolab) restriction enzyme.
[0153] An FcRIIa library was constructed by transforming the two sub-library genes treated with the restriction enzymes were ligated into Jude1 (theoretical library size: 4.310.sup.4, experimental library size: 6.310.sup.8).
Example 8: Isolation of Mutants Such as MG2A28, MG2A45, Etc. Using Established Library by Flow Cytometry (Affinity Analysis for Human Serum IgG)
[0154] The established library was incubated at 37 C. for 4 hours in 25 mL of TB+2% glucose medium in a 250-mL flask, inoculated to a 500-mL flask containing 100 mL of TB medium at 1:100, and then cultured until OD.sub.600=0.6. After cooling at 25 C. and 250 rpm for 20 minutes, overexpression was conducted at 25 C. and 250 rpm for 5 hours by adding 1 mM IPTG. After the overexpression, OD.sub.600 value was measured and a normalized amount of the cells were collected by centrifugation at 14,000 rpm for 1 minute. After resuspending the cells by adding 1 mL of 10 mM Tris-HCl (pH 8.0), centrifugation was conducted for 1 minute. This washing procedure was repeated twice. After resuspending in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer cell membrane was removed by rotating at 37 C. for 30 minutes. After centrifuging and removing the supernatant, resuspension was performed by adding 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8]. The resulting solution was centrifuged. After resuspending in 1 mL of a mixture solution prepared by 1 mL of solution A and 20 L of a 50 mg/mL lysozyme solution, the peptidoglycan layer was removed by rotating at 37 C. for 15 minutes. After centrifuging and removing the supernatant, the remainder was resuspended in 1 mL PBS. 300 L of the resulting solution was taken, combined with 700 L of PBS and a human serum IgG-FITC probe (Sigma Aldrich), and then labeled with the fluorescent probe in spheroplasts by rotation at room temperature. After the labeling, followed by washing once with 1 mL of PBS and diluting 20 times in PBS, the top 3% cells exhibiting high fluorescence were recovered by flow cytometry (S3 cell sorter; Bio-Rad). For more effective screening, the sorted cells were sorted again. After amplifying genes by PCR from the resorted cells using MJ #1 and MJ #2 primers and Taq polymerase (Biosesang), a gene-amplified sub-library was constructed by ligation with SfiI restriction enzyme treatment and transformation. After repeating this procedure for a total of 3 rounds, mutants showing higher affinity for the Fc region of human serum IgG were screened by base sequence analysis of more than 50 individual clones (
Example 9: Cloning, Expression and Purification of Isolated Mutant for Expression in Mammalian Cells
[0155] In order to express MG2A28 (SEQ ID NOS 37 and 45) and MG2A45 (SEQ ID NOS 38 and 46) from among the screened mutants in HEK293F cells, pMAZ-FcRIIa mutant (MG2A28) and pMAZ-FcRIIa mutant (MG2A45) were prepared by gene amplification by PCR using Vent polymerase and MJ #162 and MJ #163 primers, followed by ligation by treatment with BssHII and XbaI (New England Biolab) restriction enzymes. The genes cloned into the mammalian cell expression vector pMAZ were transfected into HEK293F cells and expressed temporarily at a scale of 300 mL. After culturing was completed, the cells were removed by centrifuging at 2,000 rpm for 10 minutes, and the supernatant was taken and equilibrated using 25PBS. The resulting solution was filtered through a 0.2-m bottle top filter (Merck Millipore). After adding 1 mL of a Ni-NTA agarose (Qiagen) slurry equilibrated with PBS, the solution was stirred at 4 C. for 16 hours and then flown into a polypropylene column (Thermo Fisher Scientific). The pass-through solution was taken, bound to a resin and then washed sequentially with 50 mL of 1PBS, 25 mL of 10 mM imidazole buffer, 25 mL of 20 mM imidazole buffer and 200 L of 250 mM imidazole buffer. Elution was performed with 2.5 mL of 250 mM imidazole buffer. The collected protein was concentrated with Amicon Ultra-4 (Merck Millipore) and purified by SDS-PAGE (Bio-Rad) (
Example 10: ELISA for Analyzing Binding Ability of Mutants for Fc Using Rituximab Consisting of IgG1 Subclass
[0156] 50 L of rituximab diluted to 4 g/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4 C. for 16 hours and blocked with 100 L of 5% BSA (in 0.05% PBST) at room temperature for 2 hours. After washing with 180 L of 0.05% PBST for 4 times, 50 L of FcRIIa mutants serially diluted with a blocking solution were added to each well and incubated at room temperature for 1 hour. After washing, antibody reaction was conducted at room temperature for 1 hour using 50 L of anti-His-HRP conjugate (Sigma). After washing, followed by color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4 and analysis was conducted using the Epoch microplate spectrophotometer (BioTek) (
Example 11: Measurement of K.SUB.D .Value of FcRIIa Mutant and Rituximab Through Biolayer Interferometry
[0157] In order to measure the binding ability of IgG1, which is an IgG subclass accounting for about 70% or more of human serum and mainly used in various antibody drugs, to Fc, the affinity of FcRIIa mutants was measured using rituximab. The binding ability of the FcRIIa mutants was measured using Blitz (Fortebio). For stable analysis, rituximab antibody was immobilized to an amine-reactive 2nd generation (AR2G) biosensor (Fortebio) diluted with 40 g/mL of a sodium acetate (pH 5.0) solution, and binding ability was analyzed by reacting with FcRIIa mutants (wild-type SH2A40, MG2A28, MG2A45) serially diluted with 1 kinetics buffer (Fortebio) (
Example 12: Establishment of FcRIIa Error Prone PCR Library Based on MG2A28 and MG2A45 for Affinity Maturation
[0158] In order to construct an FcRIIa mutant library based on MG2A28 and MG2A45, error prone PCR was conducted using pMopac12-NlpA-FcRIIa (MG2A28, MG2A45)-FLAG as a template. The error prone PCR technique using Taq polymerase (Takara) was employed to introduce random point mutation to the FcRIIa region. PCR was conducted such that the two mutants MG2A28 and MG2A45 exist at the same ratio of 50%:50% in the library. Point mutation was introduced into 0.3% of nucleotides of the total FcRIIa genes using MJ #160 and MJ #161 primers. Then, an FcRIIa library was constructed through treatment with SfiI restriction enzyme, ligation and transformation into Jude1 (library size: 2.610.sup.9, experimental error rate: 0.32%). In the library, the FcRIIa mutants were displayed on the inner membrane of E. coli.
Example 13: Isolation of Mutants Such as MG2A28.1, MG2A45.1, Etc. Using Established Library and Flow Cytometry (Analysis of Affinity for Human Serum IgG)
[0159] The established library was incubated at 37 C. for 4 hours with a vial (1 mL) of 25 mL of TB+2% glucose medium in a 250-mL flask, and then inoculated in a 500-mL flask containing 100 mL of TB medium at 1:100. After culturing until OD.sub.600=0.6, followed by cooling at 25 C. and 250 rpm for 20 minutes, overexpression was performed at 25 C. and 250 rpm for 5 hours by adding 1 mM IPTG. After the overexpression, OD.sub.600 value was measured and a normalized amount of the cells were collected by centrifugation at 14,000 rpm for 1 minute. After resuspending the cells by adding 1 mL of 10 mM Tris-HCl (pH 8.0), centrifugation was conducted for 1 minute. This washing procedure was repeated twice. After resuspending in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer cell membrane was removed by rotating at 37 C. for 30 minutes. After centrifuging and removing the supernatant, resuspension was performed by adding 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8]. The resulting solution was centrifuged. After resuspending in 1 mL of a mixture solution prepared by 1 mL of solution A and 20 L of a 50 mg/mL lysozyme solution, the peptidoglycan layer was removed by rotating at 37 C. for 15 minutes. After centrifuging and removing the supernatant, the remainder was resuspended in 1 mL PBS. 300 L of the resulting solution was taken, combined with 700 L of PBS and a human serum IgG-FITC probe (Sigma Aldrich), and then labeled with the fluorescent probe in spheroplasts by rotation at room temperature (1-2 rounds: 20 nM, 3 round: 5 nM). After the labeling, followed by washing once with 1 mL of PBS and diluting 20 times in PBS, the top 3% cells exhibiting high fluorescence were recovered by flow cytometry (S3 cell sorter; Bio-Rad). For more effective screening, the sorted cells were sorted again. After amplifying genes by PCR from the resorted cells using MJ #1 and MJ #2 primers and Taq polymerase (Biosesang), a gene-amplified sub-library was constructed by ligation with SfiI restriction enzyme treatment and transformation. After repeating this procedure for a total of 5 rounds, fluorescence intensity due to binding to IgG-FITC of more than 70 individual clones was analyzed. Through this, the mutants showing high affinity for the Fc region of human serum IgG were screened. It was confirmed through base sequencing that an MG2A28-based mutant and an MG2A45-based mutant were isolated (
Example 14: Cloning for Expression of Isolated Mutants, Expression and Purification in Mammalian Cells
[0160] In order to express MG2A28.1 (SEQ ID NOS 39 and 47) and MG2A45.1 (SEQ ID NOS 40 and 48) from among the screened mutants in HEK293F cells, pMAZ-FcRIIa mutant (MG2A28.1) and pMAZ-FcRIIa mutant (MG2A45.1) were prepared by gene amplification by PCR using Vent polymerase and MJ #162 and MJ #163 primers, followed by ligation by treatment with BssHII and XbaI (New England Biolab) restriction enzymes. The genes cloned into the mammalian cell expression vector pMAZ were transfected into HEK293F cells and expressed temporarily at a scale of 300 mL. After culturing was completed, the cells were removed by centrifuging at 2,000 rpm for 10 minutes, and the supernatant was taken and equilibrated using 25PBS. The resulting solution was filtered through a 0.2-m bottle top filter (Merck Millipore). After adding 1 mL of a Ni-NTA agarose (Qiagen) slurry equilibrated with PBS, the solution was stirred at 4 C. for 16 hours and then flown into a polypropylene column (Thermo Fisher Scientific). The pass-through solution was taken, bound to a resin and then washed sequentially with 50 mL of 1PBS, 25 mL of 10 mM imidazole buffer, 25 mL of 20 mM imidazole buffer and 200 L of 250 mM imidazole buffer. Elution was performed with 2.5 mL of 250 mM imidazole buffer. The collected protein was concentrated with Amicon Ultra-4 (Merck Millipore) and purified by SDS-PAGE (Bio-Rad) (
Example 15: ELISA for Analyzing Binding Ability of Mutants for Fc Using Rituximab Consisting of IgG1 Subclass
[0161] 50 L of rituximab diluted to 4 g/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4 C. for 16 hours and blocked with 100 L of 5% BSA (in 0.05% PBST) at room temperature for 2 hours. After washing with 180 L of 0.05% PBST for 4 times, 50 L of FcRIIa mutants serially diluted with a blocking solution were added to each well and incubated at room temperature for 1 hour. After washing, antibody reaction was conducted at room temperature for 1 hour using 50 L of anti-His-HRP conjugate (Sigma). After washing, followed by color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4 and analysis was conducted using the Epoch microplate spectrophotometer (BioTek) (
Example 16: Measurement of K.SUB.D .Value of FcRIIa Mutant and Rituximab Through Biolayer Interferometry
[0162] In order to measure the binding ability of IgG1, which is an IgG subclass accounting for about 70% or more of human serum and mainly used in various antibody drugs, to Fc, the affinity of FcRIIa mutants was measured using rituximab. The binding ability of the FcRIIa mutants was measured using Blitz (Fortebio). For stable analysis, rituximab antibody was immobilized to an amine-reactive 2nd generation (AR2G) biosensor (Fortebio) diluted with 40 g/mL of a sodium acetate (pH 5.0) solution, and binding ability was analyzed by reacting with FcRIIa mutants (MG2A28.1, MG2A45.1) serially diluted with 1 kinetics buffer (Fortebio) (
Example 17: Analysis of Binding Ability to Mouse Serum IgG by ELISA for Mammalian Experiment Using Mouse Model
[0163] 50 L of mouse serum IgG diluted to 4 g/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4 C. for 16 hours and blocked with 100 L of 5% BSA (in 0.05% PBST) at room temperature for 2 hours. After washing with 180 L of 0.05% PBST for 4 times, 50 L of FcRIIa mutants (wild type, MG2A28, MG2A45, MG2A28.1, MG2A45.1) serially diluted with a blocking solution were added to each well and incubated at room temperature for 1 hour. After washing, antibody reaction was conducted at room temperature for 1 hour using 50 L of anti-His-HRP conjugate (Sigma). After washing, followed by color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4 and analysis was conducted using the Epoch microplate spectrophotometer (BioTek) (
Example 18: Introduction of Point Mutation for Investigation of Affinity for Fc of FcRIIb Having about 96% Homology to FcRIIa
[0164] Experiment was conducted to analyze the effect of the screened point mutants on FcRIIb (SEQ ID NOS 41 and 49). For this, the pMopac12-NlpA-FcRIIb-FLAG plasmid was used as a template, and the Quikchange site directed mutagenesis (Agilent) technique was employed to introduce R55H and L159Q from among the MG2A45.1 point mutations (R55H, K117N, T119V, L159Q, V171E) to the FcRIIb gene. MJ #200, MJ #201, MJ #202 and MJ #203 primers were used for introduction of each point mutation. After conducting PCR using Pfu turbo polymerase (Agilent), incubation was performed at 37 C. for 3 hours for DpnI (New England Biolab) restriction enzyme treatment. After transformation of the prepared gene, it was confirmed through base sequencing that the point mutation was introduced successfully. The assembly PCR technique was used for introduction of the three point mutations K117N, T119V and V171E. A plasmid with R55H and L159Q introduced by Quikchange site directed mutagenesis was used as a template. Two fragments were amplified using MJ #160, MJ #197, MJ #198 and MJ #199 primers and vent polymerase (New England Biolab), and MJ #160 and MJ #199 were assembled. Then, through SfiI restriction enzyme treatment, ligation, transformation and base sequencing, the preparation of the pMopac12-NlpA-FcRIIb(MG2B45.1)-FLAG gene in which all the five point mutations of MG2A45.1 was inserted was completed.
Example 19: Comparison of Affinity of Wild-Type FcRIIb and MG2A45.1 Mutation-Introduced FcRIIb (MG2B45.1) for Human Serum IgG-FITC
[0165] The affinity of the FcRIIb mutant (MG2B45.1) (SEQ ID NOS 42 and 50) for human serum IgG-FITC was compared with that of the wild-type FcRIIb. An inoculum precultured in 5 mL of TB+2% glucose medium was inoculated to 5 mL of TB medium at 1:100 until OD.sub.600=0.6. After cooling at 25 C. and 250 rpm for 20 minutes, overexpression was performed at 25 C. and 250 rpm for 5 hours by adding 1 mM IPTG. After the overexpression, OD.sub.600 value was measured and a normalized amount of the cells were collected by centrifugation at 14,000 rpm for 1 minute. After resuspending the cells by adding 1 mL of 10 mM Tris-HCl (pH 8.0), centrifugation was conducted for 1 minute. This washing procedure was repeated twice. After resuspending in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer cell membrane was removed by rotating at 37 C. for 30 minutes. After centrifuging and removing the supernatant, resuspension was performed by adding 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8]. The resulting solution was centrifuged. After resuspending in 1 mL of a mixture solution prepared by 1 mL of solution A and 20 L of a 50 mg/mL lysozyme solution, the peptidoglycan layer was removed by rotating at 37 C. for 15 minutes. After centrifuging and removing the supernatant, the remainder was resuspended in 1 mL PBS. 300 L of the resulting solution was taken, combined with 700 L of PBS and a human serum IgG-FITC probe (Sigma Aldrich), and then labeled with the fluorescent probe in spheroplasts by rotation at room temperature (1-2 rounds: 20 nM, 3 round: 5 nM). After the labeling, followed by washing once with 1 mL of PBS and diluting 20 times in PBS, the fluorescence signal from the human IgG-FITC bound to FcRIIb was analyzed using Guava (Merck Millipore) (
Example 20: Cloning of Bevacizumab scFv and Bevacizumab scFv-FcRIIa Mutant for Investigation of Increase in Serum Half-Life
[0166] The VH gene was amplified using the heavy chain of bevacizumab as a template and using Vent polymerase and BR #1 and BR #2 primers, and the VL gene was amplified using the light chain bevacizumab as a template and using BR #4 and BR #5 primers. The amplified genes were assembled using a GS linker introduced into a BR #3 primer, and bevacizumab scFv was prepared through treatment with BssHII and XbaI (New England Biolab) restriction enzymes, ligation and cloning into the pMAZ vector, which is a vector for expression in mammalian cells. The wild-type FcRIIa and FcRIIa mutant were amplified using BR #6 and BR #7 primers, respectively. The amplified FcRIIa genes was assembled using a GS linker introduced into BR #6 to obtain bevacizumab scFv-FcRIIa wild type and bevacizumab scFv-MG2A45.1 genes. pMAZ-bevacizumab scFv, pMAZ-bevacizumab scFv-FcRIIa wild type and pMAZ-bevacizumab scFv-MG2A45.1 were prepared by treating the amplified genes with BssHII and XbaI (New England Biolab) restriction enzymes, ligating and cloning into the pMAZ vector, which is a vector for expression in mammalian cells. The primers used in this example are described in Table 2.
TABLE-US-00002 TABLE2 Primer# Sequence(5.fwdarw.3) BR#1(SEQIDNO51) CGCAGCGAGCGCGCACTCCGAGGTGCAGCTGGTGGA GAGC BR#2(SEQIDNO52) ACTAGAGACAGTCACCAGTGTACCCT BR#3(SEQIDNO53) AGGGTACACTGGTGACTGTCTCTAGTGGTGGAGGCG GATCAGGCGGTGGCGGCAGTGGAGGGGGTGGTAGCG GCGGAGGAGGTTCCGACATCCAGATGACTCAATCAC CCAGT BR#4(SEQIDNO54) CCCTAAAATCTAGATCACTAGTGATGGTGATGATGAT GTGATCCGCCGGTCCGCTTAATCTCCACTTTGGTTC BR#5(SEQIDNO55) GGTCCGCTTAATCTCCACTTTGGTTC BR#6(SEQIDNO56) GAACCAAAGTGGAGATTAAGCGGACCGGCGGAGGCG GGAGTCAGGCTGCCCCACCGAAAG BR#7(SEQIDNO57) TTTTAGGGTCTAGATCACTAGTGATGGTGATGATGAT GTGATCCGCCAATCACGCCCATCGGTGAGCTG
Example 21: Expression and Purification of Bevacizumab scFv and Bevacizumab scFv-FcRIIa Mutant
[0167] The prepared genes were expressed in Expi 293F cells temporarily at a scale of 300 mL. After culturing was completed, the cells were removed by centrifuging at 7500 rpm for 15 minutes, and the supernatant was taken and equilibrated using 25PBS. The resulting solution was filtered through a 0.2-m bottle top filter (Merck Millipore). After adding 1 mL of a Ni-NTA agarose (Qiagen) slurry equilibrated with PBS, the solution was stirred at 4 C. for 16 hours and then flown into a polypropylene column (Thermo Fisher Scientific). Then, the solution washed sequentially with 25 mL of 10 mM imidazole buffer, 25 mL of 20 mM imidazole buffer and 250 L of 250 mM imidazole buffer. Elution was performed with 4 mL of 250 mM imidazole buffer. The collected protein was concentrated with Amicon Ultra-4 (Merck Millipore) and purified by SDS-PAGE (Bio-Rad) (
Example 22: ELISA Using VEGF for Analysis of Activity and Binding Ability of Bevacizumab scFv and Bevacizumab scFv-FcRIIa Mutant Produced Through Mammalian Cell Culturing
[0168] 50 L of VEGF (Genscript) diluted to 500 ng/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4 C. for 16 hours and blocked with 100 L of 5% BSA (in 0.05% PBST) at room temperature for 1 hour. After washing with 180 L of 0.05% PBST for 4 times, 50 L of bevacizumab scFv, bevacizumab scFv-FcRIIa-wild type and bevacizumab scFv-MG2A45.1 proteins serially diluted with a blocking solution were added to each well and incubated at room temperature for 1 hour. After washing, 50 L of 20 g/mL human serum IgG was added to each well in order to prevent crosslinking between the Fc domain of the secondary antibody anti-His antibody-HRP conjugate (Sigma-Aldrich) and FcRIIa, and reaction was conducted at room temperature for 1 hour. After washing, antibody reaction was conducted at room temperature for 1 hour using 50 L of anti-His-HRP conjugate. After washing, followed by color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4 and absorbance was analyzed at 450 nm using the Epoch microplate spectrophotometer (BioTek). All the experiments were conducted in duplicates. Through ELISA, the binding activity of the bevacizumab scFv fused with the RIIa mutants for the VEGF could analyzed. As a result, it was confirmed that the FcRIIa wild type and the FcRIIa mutant MG2A45.1 retain the characteristic VEGF binding ability of bevacizumab scFv after fusion with bevacizumab scFv (
Example 23: ELISA Using Rituximab for Analysis of Activity and Binding Ability of Bevacizumab scFv and Bevacizumab scFv-FcRIIa Mutant Produced Through Mammalian Cell Culturing
[0169] 50 L of rituximab diluted to 4 g/mL with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) was immobilized onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4 C. for 16 hours and blocked with 100 L of 5% BSA (in 0.05% PBST) at room temperature for 1 hour. After washing with 180 L of 0.05% PBST for 4 times, 50 L of bevacizumab scFv, bevacizumab scFv-FcRIIa-wild type and bevacizumab scFv-MG2A45.1 proteins serially diluted with a blocking solution were added to each well and incubated at room temperature for 1 hour. After washing, antibody reaction was conducted at room temperature for 1 hour using 50 L of anti-His-HRP conjugate (Sigma-Aldrich). After washing, followed by color development by adding 50 L of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific), the reaction was terminated by adding 50 L of 2 M H.sub.2SO.sub.4 and absorbance was analyzed using the Epoch microplate spectrophotometer (BioTek). All the experiments were conducted in duplicates. Through ELISA, it was confirmed that bevacizumab scFv-FcRIIa wild type and bevacizumab scFv-FcRIIa-MG2A45.1 excluding bevacizumab scFv without FcRIIa retain binding ability to rituximab consisting of IgG1 Fc. In addition, it was confirmed that the MG2A45.1 fusion protein with improved binding ability to Fc shows increased binding ability to rituximab, which reveals that the characteristics of wild type FcRIIa and its mutant MG2A45.1 are retained after fusion with bevacizumab scFv (
[0170] While the exemplary embodiments have been shown and described, it will be understood by those skilled in the art that various changes in form and details may be made thereto without departing from the spirit and scope of this disclosure as defined by the appended claims. Therefore, it is intended that this disclosure not be limited to the particular exemplary embodiments disclosed as the best mode contemplated for carrying out this disclosure, but that this disclosure will include all embodiments falling within the scope of the appended claims.