Crude Drug Composition For Preventing Or Treating Respiratory Diseases
20200405798 ยท 2020-12-31
Inventors
- Mi Won Son (Gyeonggi-do, KR)
- Min Jung Bae (Jeollabuk-do, KR)
- Won Woo Lee (Seoul, KR)
- Doo Suk Lee (Gyeonggi-do, KR)
Cpc classification
A61K36/31
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A61K36/31
HUMAN NECESSITIES
A61K36/53
HUMAN NECESSITIES
A61K9/0095
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61K2236/331
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K36/31
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A61K36/53
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to a pharmaceutical composition for preventing or treating respiratory diseases and a food composition for preventing or relieving respiratory diseases comprising as an active ingredient two or more mixed extracts selected from the group consisting of a Brassicae Semen extract, an Adenophorae Radix extract, a Lonicerae Folium extract and a Perillae Semen extract. A composition comprising mixed extracts of Brassicae Semen, Adenophorae Radix, Lonicerae Folium and Perillae Semen of the present disclosure has an advantage of preventing respiratory diseases and relieving the symptoms of respiratory diseases, restores damages in the lung tissue, inhibits aging action and inflammation induced by inflammation-inducing substances such as fine dust, and has an excellent antioxidant effect. More particularly, the composition of the present disclosure increases the expression of a telomerase which extends the length of a telomere.
Claims
1. A composition comprising a mixed extract of two or more selected from the group consisting of a Brassicae Semen extract, an Adenophorae Radix extract, a Lonicerae Folium extract, and a Perillae Semen extract.
2. The composition of claim 1, wherein the extracts are obtained by extraction with an organic solvent, water, or a mixed solvent thereof.
3. The composition of claim 2, wherein the organic solvent is selected from the group consisting of a C1 to C6 lower alcohol, petroleum ether, hexane, benzene, chloroform, methylene chloride, ether, ethyl acetate, and acetone.
4. The composition of claim 1, wherein the respiratory disease is selected from the group consisting of a cold, rhinitis, pharyngitis, laryngitis, pharyngolaryngitis, pneumonia, acute or chronic bronchitis, asthma, and chronic obstructive pulmonary disease.
5-6. (canceled)
7. A Method for prevention, alleviation, or treatment of a respiratory disease comprising: administering a composition to a subject in need thereof, the composition comprising a mixed extract of two or more selected from the group consisting of a Brassicae Semen extract, an Adenophorae Radix extract, a Lonicerae Folium extract, and a Perillae Semen extract.
8. The method of claim 7, wherein the extracts are obtained by extraction with an organic solvent, water, or a mixed solvent thereof.
9. The method of claim 8, wherein the organic solvent is selected from the group consisting of a C1 to C6 lower alcohol, petroleum ether, hexane, benzene, chloroform, methylene chloride, ether, ethyl acetate, and acetone.
10. The method of claim 7, wherein the respiratory disease is selected from the group consisting of a cold, rhinitis, pharyngitis, laryngitis, pharyngolaryngitis, pneumonia, acute or chronic bronchitis, asthma, and chronic obstructive pulmonary disease.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
DETAILED DESCRIPTION
[0083] Hereinafter, the present disclosure will be described in more detail with reference to examples. These examples are only for illustrating the present disclosure more specifically, and it would be apparent to those skilled in the art that the scope of the present disclosure is not limited by these examples according to the gist of the present disclosure.
EXAMPLES
[0084] Throughout the present specification, the % used to express the concentration of a specific material, unless otherwise particularly stated, refers to (wt/wt) % for solid/solid, (wt/vol) % for solid/liquid, and (vol/vol) % for liquid/liquid.
Preparative Examples
[0085] Preparative Example 1: Preparation of complex extract (mixed extract) of four kinds of herbal medicines
[0086] Washed and dried Brassicae Semen, Adenophorae Radix, Lonicerae Folium, and Perillae Semen were used in tests. The herbal medicines Brassicae Semen, Adenophorae Radix, Lonicerae Folium, and Perillae Semen were mixed at a weight ratio of 1:1:1:1 to a total of 60 g, and 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added thereto, followed by extraction while well stirring at room temperature for 72 hours. The extract was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a powder-type complex extract (mixed extract) of herbal medicines. The yield was 12-13%.
[0087] Preparative Example 2: Preparation of complex extract (mixed extract) of three kinds of herbal medicines
[0088] Washed and dried Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were used in tests. The herbal medicines Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were mixed at a weight ratio of 1:1:1 to a total of 60 g, and 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added thereto, followed by extraction while well stirring at room temperature for 72 hours. The extract was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a powder-type complex extract (mixed extract) of herbal medicines. The yield was about 12-14%.
[0089] Preparative Example 3: Preparation of complex extracts (mixed extracts) of three kinds of herbal medicines according to various mixing ratios
[0090] Washed and dried Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were used in tests. The herbal medicines Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were mixed at weight ratios shown in Table 1 to a total of 30 g, and 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added thereto, followed by extraction while stirring at room temperature for 72 hours. Each of the extracts was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a total of seven types of complex herbal medicine extract powders. The yields thereof are shown in Table 1.
TABLE-US-00001 TABLE 1 Brassicae Adenophorae Lonicerae Yield Classification Semen Radix Folium (%) Preparative Example 1 1 1 14.30 3-1 Preparative Example 2 1 1 14.40 3-2 Preparative Example 4 1 1 13.42 3-3 Preparative Example 1 2 1 17.46 3-4 Preparative Example 1 4 1 17.40 3-5 Preparative Example 1 1 2 13.15 3-6 Preparative Example 1 1 4 11.96 3-7
[0091] Preparative Example 4: Preparation of complex extracts (mixed extracts) of three kinds of herbal medicines according to various concentrations of extraction solvent (ethanol)
[0092] Washed and dried Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were used in tests. The herbal medicines Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were mixed at the weight ratio (w/w) in Preparative Example 3-1 to a total of 30 g, and 25, 50, 70, and 90% ethanol aqueous solutions having a volume 10 times the weight were added thereto, followed by extraction while well stirring at room temperature for 72 hours. Each of the extracts was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a total of four types of complex herbal medicine extract powders. The yields thereof are shown in Table 2.
TABLE-US-00002 TABLE 2 Ethanol aqueous solution Yield Classification concentration (%) (%) Note Preparative 25 14.38 Same preparation Example 4-1 method as in Preparative Example 3-1 Preparative 50 14.22 Example 4-2 Preparative 70 11.76 Example 4-3 Preparative 90 8.23 Example 4-4
[0093] Preparative Example 5: Preparation of complex herbal medicine extract (mixed extract) through hot-water extraction
[0094] Washed and dried Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were used in tests. The herbal medicines Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were mixed at the weight ratio (w/w) in Preparative Example 3-1 to a total of 30 g, and distilled water having a volume 10 times the weight was added thereto, followed by reflow extraction at a temperature of 90 C. for 3 hours. The extract was filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a complex herbal medicine extract powder, and the yield thereof was about 15.38%.
[0095] Comparative Example 1: Preparation of single-herbal medicine extracts
[0096] Washed and dried Brassicae Semen, Adenophorae Radix, and Lonicerae Folium were used in tests. To 30 g of each of the herbal medicines Brassicae Semen, Adenophorae Radix, and Lonicerae Folium, 25% (v/v) ethanol aqueous solution having a volume 10 times the weight was added, followed by extraction while well stirring at room temperature for 72 hours. The extracts were filtered, concentrated under reduced pressure at 50-65 C., and then freeze-dried, thereby obtaining a total of three types of single herbal medicine extract powders. The yields thereof are shown in Table 3.
TABLE-US-00003 TABLE 3 Classification Kind of herbal medicine Yield (%) Comparative Example 1-1 Brassicae Semen 11.21 Comparative Example 1-2 Adenophorae Radix 17.71 Comparative Example 1-3 Lonicerae Folium 10.56
Test Examples
[0097] Test Example 1: Lung tissue damage inhibitory effect of complex extract of four kinds of herbal medicines in PPE-induced emphysema mouse models
[0098] In order to investigate a lung tissue damage inhibitory effect of the complex herbal medicine extract of the present disclosure prepared in Preparative Example 1, the following test was carried out.
[0099] After 7-week-old male C57BL/6 mice (Raonbio, Korea) were acclimated for at least one week, the animals were classified into (1) a normal group, (2) a group with emphysema induction and complex herbal medicine extract administration (test group), and (3) a group with emphysema induction and distilled water administration (negative control group). For the induction of emphysema in the test group and the negative control group, 0.25 U of porcine pancreatic elastase (PPE, Millipore, USA) was administered as a single drop into the mouse trachea. For the normal group, phosphate buffered saline (PBS) was administered as a single drop into the mouse trachea.
[0100] For the test group, the complex extract of four kinds of herbal medicines dissolved in distilled water was orally administered once/day at a dose of 200 mg/kg for three weeks from one week before PPE administration. For the normal group and the negative control group, only distilled water was orally administered. After the last administration of the complex extract of four kinds of herbal medicines or distilled water, the mice were anesthetized with carbon dioxide and the lung tissue was extracted. The extracted lung tissue was fixed in formalin and subjected to hematoxylin and eosin staining (H&E staining). The images taken by observing the lung tissue with an optical microscope (X100) are shown in
[0101] As shown in
[0102] It could be therefore verified that the complex extract of four kinds of herbal medicines of the present disclosure showed a lung tissue damage inhibitory effect in the emphysema mouse models.
[0103] Test Example 2: Anti-aging effect of complex extract of four kinds of herbal medicines on fine dust-induced cell aging of pulmonary epithelial cell line
[0104] In order to investigate an anti-aging effect of the complex herbal medicine extract of the present disclosure prepared in Preparative Example 1, the following test was carried out.
[0105] The human pulmonary endothelial cell line NCI-H292 cells (ATCC, USA) were incubated in the incubator of 5% CO.sub.2 and 37 C. by using RPMI media (Corning, USA) containing 10% fetal bovine serum (FBS). The cells were prepared on a 96-well plate at 110.sup.4 cells per well, and stabilized for 24 hours. After the cells were stabilized, the cell supernatant was removed, and then the cells were treated with the complex herbal medicine extract in Preparative Example 1 at 200 g/ml, followed by incubation for 1 hour. Then, the cells were further treated with 50 g/ml fine dust (particulate matter 10, PM10, NIST, USA) (test group). The normal group was treated with neither the complex herbal medicine extract nor fine dust, and the negative control group was treated with only fine dust. After five days, the cells were fixed in formalin, and then the degree of cell aging was investigated through senescence beta-galactosidase staining.
[0106] As shown in
[0107] Test Example 3: Telomerase expression increasing effect of complex extract of four kinds of herbal medicines in pulmonary endothelial cell line (anti-aging effect)
[0108] NCI-H292 cells were prepared on a 100 pi () plate at 110.sup.6 cells and stabilized. After 24 hours, the cells were treated with the complex herbal medicine extract in Preparative Example 1 at concentrations of 100 and 200 g/ml. After 24 hours, the cells were collected and proteins were extracted, and then western blotting was performed using an antibody (ab32020, Abcam, USA) for human telomerase reverse transcriptase (hTERT), which is a catalytic small unit of telomerase.
[0109] As shown in
[0110] Test Example 4: Inhibitory effect(anti-inflammatory effect) of complex extract of four kinds of herbal medicines on LPS-induced nitric oxide (NO) production in macrophage cell line
[0111] The mouse macrophage cell line Raw 264.7 cells (ATCC, USA) were incubated in the incubator of 5% CO2 and 37 C. by using RPMI media (Invitrogen, USA) containing 10% fetal bovine serum (FBS). The cells were prepared on a 24-well plate at 2.510.sup.5 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with the complex extract of four kinds of herbal medicines in Preparative Example 1 at concentrations of 0.5, 1, 2, and 4 mg/mL. After 1 hour, the cells were further treated with 100 ng/mL LPS. After 24 hours, the cell supernatant was collected and subjected to Griess test for measuring the change in NO production, and the concentration of NO was calculated using the standard curve according to the concentration of sodium nitrite (NaNO.sub.2) (
[0112] As shown in
[0113] Test Example 5: Lung tissue damage inhibitory effect of complex extract of three kinds of herbal medicines in emphysema mouse models induced by PPE
[0114] In order to investigate a lung tissue damage inhibitory effect of the complex extract of three kinds of herbal medicines (Brassicae Semen, Adenophorae Radix, and Lonicerae Folium) of the present disclosure prepared in Preparative Example 2, the following test was carried out.
[0115] After 7-week-old male C57BL/6 mice (Raonbio, Korea) were acclimated for at least one week, the animals were classified into (1) a normal group, (2-4) groups with emphysema induction and complex herbal medicine extract (50, 100, 200 mg/kg) administration (test groups), and (3) a group with emphysema induction and distilled water administration (negative control group). For the induction of emphysema in the test groups and the negative control group, 1 unit of porcine pancreatic elastase (PPE, Millipore, USA) was administered as a single drop into the mouse trachea. For the normal group, phosphate buffered saline (PBS) was administered as a single drop into the mouse trachea.
[0116] For the test groups, the complex herbal medicine extracts dissolved in distilled water were orally administered once/day at doses of 50, 100, and 200 mg/kg, respectively, for three weeks from one week before PPE administration. For the normal group and the negative control group, only distilled water was orally administered. After the last administration of the complex herbal medicine extracts or distilled water, the mice were anesthetized with carbon dioxide and the lung tissue was extracted. The extracted lung tissue was fixed in formalin and subjected to hematoxylin and eosin staining (H&E staining). The images taken by observing the lung tissue with an optical microscope (X200) are shown in
[0117] As shown in
[0118] It could be therefore verified that the complex extracts of three kinds of herbal medicines of the present disclosure showed a lung tissue damage inhibitory effect in the emphysema mouse models.
[0119] Test Example 6: Inflammatory factor expression inhibitory effect (anti-inflammatory effect) of complex extract of three kinds of herbal medicines in macrophage cell line induced by LPS
[0120] The mouse macrophage cell line Raw 264.7 cells (ATCC, USA) were incubated in the incubator of 5% CO.sub.2 and 37 C. by using RPMI media (Invitrogen, USA) containing 10% fetal bovine serum (FBS). The cells were prepared on a 24-well plate at 2.510.sup.5 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with 100 ng/mL LPS and the complex extract of three kinds of herbal medicines in Preparative Example 2 at concentrations of 0.5, 1, and 2 mg/mL. After 24 hours, the cell supernatant was removed, and then RNA was separated from the cells by using TRIzol (Invitrogen, USA). Thereafter, cDNA obtained through RT-PCR was used to perform qPCR using primers specific to the inflammatory factors IL-6, IL-1, and iNOS and the SYBR green probe (Takara, Japan). The RNA expression change value obtained from qPCR was expressed as a relative change of GAPDH mRNA as a standard gene compared with a non-treatment group (
TABLE-US-00004 TABLE4 Nucleotide Gene Direction Sequence(5to3) SEQIDNO GAPDH Forward AGCCTCGTCCCGTAGACAA 1 Reverse AATCTCCACTTTGCCACTGC 2 IL-6 Forward TTGGTCCTTAGCCACTCCTTC 3 Reverse TAGTCCTTCCTACCCCAATTTCC 4 IL-1 Forward TGTGCAAGTGTCTGAAGCAGC 5 Reverse TGGAAGCAGCCCTTCATCTT 6 iNOS Forward CGAAACGCTTCACTTCCAA 7 Reverse TGAGCCTATATTGCTGTGGCT 8
[0121] As shown in
[0122] Test Example 7: Antioxidative factor expression increasing effect (antioxidative effect) of complex extract of three kinds of herbal medicines in macrophage cell line induced by LPS
[0123] In order to investigate the effect of the complex extract of three kinds of herbal medicines of the present disclosure prepared in Preparative Example 2 on the expression of the antioxidative factor heme oxygenase-1 (HO-1) in macrophages induced by LPS, the test was carried out by the same method as in Test Example 6 except that qPCR was performed by using primers specific to HO-1 and SYBR green probe (Takara, Japan). The RNA expression change value obtained from the qPCR results was expressed as a relative change of GAPDH mRNA as a standard gene compared with a non-treatment group (
TABLE-US-00005 TABLE5 Nucleotide Gene Direction Sequence(5to3) SEQIDNO GAPDH Forward AGCCTCGTCCCGTAGACAA 1 Reverse AATCTCCACTTTGCCACTGC 2 HO-1 Forward CAGGTGATGCTGACAGAGGA 9 Reverse GAGAGTGAGGACCCACTGGA 10
[0124] As shown in
[0125] Test Example 8: Inflammatory factor expression inhibitory and antioxidative factor expression increasing effects (anti-inflammatory and antioxidative effects) of complex herbal medicine extract according to mixing ratio in macrophage cell line treated with LPS
[0126] In order to investigate anti-inflammatory and antioxidative effects of the complex extracts of three kinds of herbal medicines in Preparative Example 3 according to the ratio in the macrophage cell line induced by LPS (Sigma, US), qPCR was performed by using the primers specific to IL-6, IL-1, iNOS, and HO-1 genes and the SYBR green probe (Takara, Japan). The detailed test procedure was the same as in Test Examples 6 and 7, and the primer sequences for the mouse genes used in the test are shown in Tables 4 and 5 above.
[0127] As shown in
[0128] Test Example 9: Anti-inflammatory and antioxidative effects of complex herbal medicine extract according to hot-water extraction and the concentrations of extraction solvent (ethanol) in macrophage cell line induced by LPS
[0129] In order to investigate anti-inflammatory and antioxidative effects of the complex herbal medicine extracts in Preparative Example 4 according to the concentration of an extraction solvent (ethanol) and the hot-water complex herbal medicine extract in Preparative Example 5, qPCR was performed by using the primers specific to IL-6, iNOS, and HO-1 and the SYBR green probe (Takara, Japan). The detailed test procedure was the same as in Test Examples 6 and 7, and the primer sequences for the mouse genes used in the test are shown in Tables 4 and 5 above.
[0130] As shown in
[0131] Test Example 10: Anti-inflammatory effects of single herbal medicine extract and complex herbal medicine extract in pulmonary inflammation mouse model induced by LPS
[0132] In order to investigate the pulmonary inflammation inhibitory effect of single and complex extracts of three kinds of herbal medicines, the following test was carried out. After 7-week-old male C57BL/6 mice (Raonbio, Korea) were acclimated for at least one week, the animals were classified into (1) a normal group, (2) a group with LPS induction and distilled water administration (negative control group), (3) to (5) groups with LPS induction and single herbal medicine extract administration, and (6) a group with LPS induction and complex herbal medicine extract administration.
[0133] The complex extract of three kinds of herbal medicines in Preparative Example 2 dissolved in distilled water and the single extracts of three kinds of herbal medicines in Comparative Example 1 dissolved in distilled water were orally administered to the test groups of (3) to (6) at 500 mg/kg once/day for five days, and only distilled water was orally administered to the normal group and the negative control group.
[0134] The induction of acute pulmonary inflammation in the test groups and the negative control group was performed by administering 50 g of LPS (Sigma, US) dissolved in 50 l of phosphate buffered saline (PBS) as a single drop into the mouse trachea 24 hours before the end of the test. For the normal group, phosphate buffered saline (PBS) was administered as a single drop into the mouse trachea.
[0135] After the last administration of the herbal medicine extracts or distilled water, the mice were sacrificed with carbon dioxide, and then the lung tissue was separated, and RNA was extracted by using TRIzol (Invitrogen, USA). Thereafter, cDNA obtained through RT-PCR was used to perform qPCR using primers specific to the inflammatory factors IL-1, IL-6, and TNF- and the SYBR green probe (Takara, Japan). The RNA expression change value obtained from qPCR was expressed as a relative change of GAPDH mRNA as a standard gene compared with a non-treatment group. The primer sequences for mouse genes used in the test are shown in Table 6.
TABLE-US-00006 TABLE6 Nucleotide Gene Direction Sequence(5to3) SEQIDNO GAPDH Forward AGCCTCGTCCCGTAGACAA 1 Reverse AATCTCCACTTTGCCACTGC 2 IL-6 Forward TTGGTCCTTAGCCACTCCTTC 3 Reverse TAGTCCTTCCTACCCCAATTTCC 4 IL-1 Forward TGTGCAAGTGTCTGAAGCAGC 5 Reverse TGGAAGCAGCCCTTCATCTT 6 TNF- Forward AAGCCTGTAGCCCACGTCGTA 11 Reverse GGCACCACTAGTTGGTTGTCTTTG 12
[0136] As shown in