Sequencing chicken antibody repertoires following hyperimmunization and the identification of antigen-specific monoclonal antibodies
20200407426 ยท 2020-12-31
Inventors
- Jeff Fagerlund (Lakeville, MN, US)
- Bradley M. Mitteness (Ghent, MN, US)
- Connie Phillips (Ankeny, IA, US)
Cpc classification
C07K16/1242
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
International classification
Abstract
Neutralizing antibodies through recombinant protein expression were identified by mining antibody repertoires by high-throughput second generation sequencing. Sequencing across the majority of light and heavy chain variable regions of chicken immunoglobulins was performed at two immunological time points: a non-immune (naive) state and a post-hyperimmunization state. The mRNA was extracted from unsorted and unselected PBMC populations and identification of antigen-specific antibody sequences leveraged the significant disparity of abundance of an individual B cell clone in non-immune and immunized states. Through bioinformatic analysis, candidate amino acid sequences for variable heavy chain and light chains were identified. Recombinant polypeptides with the binding domains having the identified amino acid sequences for variable heavy chain and light chains were expressed and screened using immunoassays to confirm antigen-specificity.
Claims
1. A composition comprising a recombinant polypeptide having a binding domain, wherein the binding domain comprises a variable light chain domain and a variable heavy chain domain, the amino acid sequence of the variable heavy chain domain and the variable light chain domain determined by analysis of the antibody repertoire from birds hyperimmunized with an antigen of interest, wherein the recombinant polypeptide binds the antigen of interest after expression in an expression system, the glycosylation profile of the recombinant polypeptide determined by the expression system.
2. The composition of claim 1 wherein the recombinant polypeptide is a recombinant monoclonal antibody.
3. The composition of claim 1 wherein the recombinant polypeptide is a single-chain variable fragment (scFv) polypeptide.
4. The composition of claim 1 wherein the recombinant polypeptide is expressed and isolated from an in vitro protein expression system, the protein expression systems selected from bacterial, mammalian, insect, and plant expression systems.
5. The composition of claim 4, wherein the expression system is a bacterial expression system and the recombinant polypeptide is not glycosylated.
6. The composition of claim 1, wherein the birds are chickens.
7. The composition of claim 1, wherein the antigen of interest is Mannheimia haemolytica outer membrane protein (Omp) and/or M. haemolytica leukotoxin.
8. The composition of claim 3 wherein the scFv polypeptides are selected from SEQ ID NO:15-SEQ ID NO:35.
9. A composition comprising a recombinant DNA molecule, wherein the recombinant DNA molecule comprises DNA sequences that encode a recombinant polypeptide of claim 1.
10. The composition of claim 9 wherein the recombinant DNA molecule can be expressed in bacterial expression systems, mammalian expressions systems, insect expression systems, plant expression systems or combinations thereof.
11. A method for identifying and expressing the binding domains for an antigen comprising: isolating nucleic acids from peripheral blood mononuclear cells of birds from samples collected prior to hyperimmunization and after hyperimmunization; reverse transcribing the mRNA in the samples after enriching the samples for mRNA; amplifying the variable regions of the heavy chains and light chains of the immunoglobulin genes using primers; sequencing across the majority of light and heavy chain variable regions of the immunoglobulins; identifying variable heavy chain amino acid sequences and variable light chain amino acid sequences; and expressing polypeptides comprising the identified variable heavy chain amino acid sequences and variable light chain amino acid sequences in an in vitro expression system.
12. The method of claim 11 wherein the antigen comprises Mannheimia haemolytica outer membrane protein (Omp) and/or M. haemolytica leukotoxin.
13. The method of claim 11 wherein a binding domain comprises the variable heavy chain and the variable light chain amino acid sequences, the binding domain in a scFv polypeptide.
14. The method of claim 11 wherein a binding domain comprises the variable heavy chain and the variable light chain amino acid sequences, the binding domain in a rmAb.
15. The method of claim 13 wherein the scFv polypeptides are selected from SEQ ID NO:15-SEQ ID NO:35.
16. A method for preventing disease in an animal comprising administering a composition comprising a recombinant polypeptide having a binding domain capable of binding one or more disease antigens, wherein the binding domain of the recombinant polypeptide comprises amino acid sequences of variable regions from a light chain and a heavy chain identified from the antibody repertoire of birds hyperimmunized with the one or more disease antigens.
17. The method of claim 16, wherein the recombinant polypeptides are expressed in a bacterial expression system.
18. The method of claim 16, wherein the birds are chickens.
19. The method of claim 16, wherein the antigen is Mannheimia haemolytica outer membrane protein (Omp) and/or M. haemolytica leukotoxin.
20. The method of claim 16 wherein the disease is bovine respiratory disease.
21. The method of claim 16, wherein the recombinant polypeptide is a scFv polypeptide.
22. The method of claim 16, wherein the recombinant polypeptide is a rmAb.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
DESCRIPTION OF THE EMBODIMENTS
[0034] In the following detailed description, reference is made to the accompanying drawings that form a part hereof and in which are shown, by way of illustration, specific embodiments in which the invention may be practiced. These embodiments are described in sufficient detail to enable those skilled in the art to practice the invention. Other embodiments may be utilized, and structural, logical, mechanical, electrical, and other changes may be made.
[0035] The present description includes methods for identifying the amino acid sequences of binding domains of antibodies in the antibody repertoire generated when birds are hyperimmunized with an antigen of interest. The method also includes expressing the DNA constructs encoding these binding domains in a recombinant expression system. The binding domains, when expressed in the recombinant expression system, can be identified that are able to bind specifically to the antigen of interest. In one embodiment, the binding domains expressed in the recombinant expression system bind and/or neutralize the antigen that was initially used to hyperimmunize the birds. The binding domains can be part of a single-chain variable fragment (scFv) polypeptide and/or they can be part of a recombinant monoclonal antibody (rmAb).
[0036] The present description also includes compositions of polypeptides wherein the binding domains of the polypeptides are recombinant products and are capable of binding and/or neutralizing an antigen. In an embodiment, the antigen is the same or similar to the antigen used to hyperimmunize birds. The binding domains of the polypeptides include amino acid sequences from variable regions of a heavy chain immunoglobulin molecule and amino acid sequences from variable regions of a light chain immunoglobulin molecule. The amino acid sequences of the variable regions of the light chain and the heavy chain can be determined based on the antibody repertoire generated due to the hyperimmunization of the bird and the analysis of the resultant mRNA levels in the peripheral mononuclear blood cells (PBMC) of the hyperimmunized bird. The variable regions of the heavy and light chains can be part of a single-chain variable fragment (scFv) polypeptide and/or they can be part of a recombinant monoclonal antibody (rmAb).
[0037] The present description can include a method of obtaining antibodies such as monoclonal antibodies. The method can include sequencing across the majority of light and heavy chain variable regions of chicken immunoglobulin genes performed at two immunological time points: a non-immune (nave) state and a post-hyperimmunization state. Through deep sequencing of immunoglobulin heavy and light chain messenger RNA transcripts, the antibody population dynamics can be examined following an immune response event such as hyperimmunization. Antigen-specific monoclonal antibody sequences can be identified using the methods described herein.
[0038] The method may include extended read lengths surpassing 400 base pairs. A study average sequencing depth can exceed 10.sup.6 unfiltered reads for each antibody chain. Since mRNA can be extracted from unsorted PBMC populations, identification of antigen-specific antibody sequences leveraged the significant disparity of abundance of an individual B cell clone in non-immune and hyperimmunized states. A greedy incremental clustering algorithm, CD-HIT described in Weizhong Li et al. (Bioinformatics, 17 282-283 and Bioinformatics, 18, 77-82), can be used to observe shifts in immune state frequencies and candidate antigen-specific monoclonal antibodies can be defined as products of rare non-immune B cell clones that were massively expanded and can become highly abundant in the post-immunized state. Conditional rule sets can be utilized that require multiple criteria to be met or exceeded. Candidates from a large database can be efficiently selected for, in a nonbiased manner, using this criteria. In one embodiment, 14 candidates were selected from an input pool of over 82,000 sequences.
[0039] The candidates can be tested to confirm antigen-specificity via immunoassay screening of transiently expressed recombinant monoclonal antibodies. Identification of suitable rmAb or scFv can then be overexpressed in an in vitro culture system and isolated for therapeutic use. In one embodiment, the scFvs may be expressed in bacterial or mammalian expression systems. In another embodiment, the rmAbs may be expressed in a mammalian expression systems. Other expression systems such as yeast, insects, plants and the like may also be used and all are within the scope of this description.
[0040] In one embodiment, the present description can include a method for identifying the amino acid sequences of the binding domains of antibody molecules and expressing these binding domains in a recombinant expression system.
[0041] The method can include hyperimmunizing (104) a bird with an antigen of interest. In one embodiment, the bird is a chicken. While the invention is illustrated by the use of chickens to produce avian antibodies, other fowl including turkeys, ducks, geese, ostrich, Emu, pheasant, pigeon, quail, etc. or combination thereof, may be used.
[0042] The antigen can be a variety of antigens and can include one or more immunogenic antigen. The immunogen selected for hyperimmunization can be a well-defined antigen with a known antigenic determinant (or epitope) so that the most abundant sequences in the antibody repertoire would be specific for the target of interest. The antigen can be whole microorganisms such as bacteria, viruses, fungi, parasites and the like. The antigen can also be parts of the microorganisms, lysates or macromolecules from the microorganisms. The microorganisms can be, for example, bacteria such as Pasteurella, (e.g. Pasteurella multocida), Mannheimia, (e.g. Mannheimia haemolytica) and Haemophilus groups, Mycoplasma, and viruses of the respiratory groups such as bovine respiratory syncytial virus (BRSV), bovine viral diarrhea (BVD), parainfluenza (PI.sub.3), infectious bovine rhinotrocheitus (IBR), swine influenza, (H.sub.iN.sub.i,H.sub.3N.sub.2), Rotavirus and combinations of the same. In one embodiment, the antigen is the purified outer membrane protein (OMP) from Mannheimia haemolytica. In another embodiment, the antigen is leukotoxin from M. haemolytica.
[0043] The birds may be administered more than one antigen. In one embodiment, the antigens administered are the purified outer membrane protein (OMP) from Mannheimia haemolytica and leukotoxin from M. haemolytica.
[0044] The birds may be hyperimmunized by a variety of methods and can include administering the antigen by any suitable route that elicits an immune response. The antigen(s) may be administered by, for example, intramuscular, intraperitoneal, sub-cutaneous and/or oral routes. In one embodiment, the antigen(s) is administered intramuscularly in a wing of the bird. A post-hyperimmunization sample may be collected from the bird at about 5 to about 10 days after the last antigen administration. A post-hyperimmunization sample collected outside of this interval is also within the scope of this disclosure. In one embodiment, a post-hyperimmunization sample is collected after about 6 days after the last antigen administration.
[0045] Hyperimmunization may include administering multiple doses of one or more antigens and these doses may be administered, for example, at intervals of 1 to 10 days. In one embodiment, the birds were hyperimmunized by administering antigen on day 1, followed by a booster on day 7 and the hyperimmunized sample was collected on day 13. In one embodiment, the amount of antigen in the booster is about the same as the amount in the primary administration. Boosters and primary injections having different amounts of antigens are also within the scope of this description. The use of a booster, the interval between the primary injection and the booster and the interval between the final antigen administration and the sample collection can vary and all are within the scope of the description.
[0046] Samples can be collected from the birds prior to hyperimmunization (pre-HI) and after hyperimmunization (post-HI). In one embodiment, the sample collected can be venous blood. After hyperimmuzation, the post-HI samples may also be spleen cells and bone marrow plasma cells. The peripheral blood mononuclear cells can be separated (108) and obtained from the pre-HI sample and from the post-HI sample.
[0047] The method can also include analyzing the antibody repertoire of the pre-HI samples and the post-HI samples. Knowing the repertoire prior to hyperimmunization can allow for calculation of clonal frequency changes that can be explained by B cell clonal expansion during the adaptive immune response. Analyzing the antibody repertoire can include, for example, a number of steps that isolate and enrich the desired nucleic acids and identify the prevalent amino acid sequences of the variable regions of antibodies present in the samples. The RNA can be isolated (112) from the pre-HI samples and post-HI samples. The RNA can also be enriched for the mRNA by using a polyA tail enrichment method as described below in the Examples. The mRNA can then be reverse transcribed (116) to cDNA as described below in the Examples.
[0048] The cDNA from the pre-HI samples and the post-HI samples can be selectively amplified (120). The amplification can be targeted to the variable regions of the heavy and light chain antibody genes. Primers can be designed to amplify the variable regions of the light chain genes and the heavy chain genes.
[0049] Amplicons can be generated using the primers and purified. The amplicons can be of variable length depending on the location of the primer and the size of the variable region. Amplicons can be, for example, between about 200 bases and about 1000 bases. In one embodiment, the amplicons can be between about 200 bases and about 500 bases.
[0050] The amplicons can be used to generate sample libraries from pre-HI and post-HI samples. The libraries can then be sequenced using high-throughput second generation sequencing. A variety of sequencing methods and strategies can be used. In one embodiment, Ion Torrent sequencing libraries are prepared and sequenced. Other methods of sequencing that can be used include, for example, other second-generation systems such as Illuminia, 454 pyrosequencing, as well as 3.sup.rd generation systems such as single-molecule real-time sequencing.
[0051] The increased throughput of second-generation sequencing, formerly known as next generation sequencing, can be used in antibody repertoire research by expanding the depth of sampling from the repertoire population. Because statistical reasoning can require sequencing depth to exceed the number of samples, second generation sequencing can give a much broader sense of the antibody repertoire. In addition to the increased number of reads, it is also constantly improving its weakness of shorter read lengths. The Ion Torrent platform can increase sequence read lengths from 200 to 400 base pairs. Doubling the read lengths can allow nearly full sequencing of the variable regions; certainly across the three hypervariable regions.
[0052] Unfiltered sequence reads can then be passed through inclusion criteria checkpoints (128) selecting for genuine reads. These checkpoints first retain sequences with both the forward and reverse primer sequence. The second inclusion criterion then keeps only those passing the first that also are within the size range of 200 to 500 nucleotides. Nucleotide sequences can be converted to amino acids and only reads in the correct reading frame without stop codons being used.
[0053] To assess antibody sequence abundance within the repertoire in the pre-HI and post-HI samples, CDR3 regions of both heavy chains (CDRH3) and light chains (CDRL3) can be isolated by leveraging distinctly conserved flanking residue motifs and clustered by similarity (132). Some highly abundant CDR3s sequences can be identified in the pre- and post-HI samples (136).
[0054] In one embodiment, the top four most abundant CDR3 of the heavy chains (CDRH3s) may compose about 4 to about 13% of the repertoire of CDRH3 sequences in the post-HI samples. Additionally, the four most dominant CDRH3s from the post-HI sample antibody repertoires can be found to be minimally contributing to the pre-HI sample antibody repertoire at 0.221-1.499%. The four most dominant CDRH3 sequences in the antibody repertoire of the pre-HI sample may be seen at a similar frequency of about 2-20%, but these sequences can minimally contribute to the antibody repertoire in the post-HI samples at about 0.317 to about 1.8%.
[0055] Amino acid sequences of variable heavy chains can be identified as described herein (140). In order to express a functional binding domain, variable light chain sequences may be identified that can be paired with the variable heavy chain amino acid sequences. The pairing of the variable light chain amino acid sequences with the variable heavy chain amino acid sequences may be determined by identifying light chain amino acid sequences that are approximately similar in abundance (144) to the amino acid sequences of variable heavy chains. This can provide compatible V.sub.H amino acid sequences and V.sub.L amino acid sequences that can lead to the expression of a functional binding domain that binds an antigen.
[0056] In one embodiment, the V.sub.H amino acid sequences and V.sub.L amino acid sequences may be combined to form a functional domain and the combination may be similar to the combination of V.sub.H amino acid sequences and V.sub.L amino acid sequences seen in vivo in the chickens. In some embodiments, V.sub.H amino acid sequences and V.sub.L amino acid sequences can be combined that are compatible for binding an antigen even though they may not be a naturally occurring combination of V.sub.H amino acid sequences and V.sub.L amino acid sequences in the chicken.
[0057] In order to isolate V.sub.H amino acid sequences and V.sub.L amino acid sequences that can lead to the expression of a functional binding domain that binds an antigen, a recombinant DNA molecule can be constructed that includes a gene encoding the V.sub.H amino acid sequences and V.sub.L amino acid sequences, e.g. a scFv gene (148). The recombinant DNA molecule can also include other genes, e.g. ampicillin resistance, and elements, e.g. regulatory elements, necessary for expression of the V.sub.H amino acid sequences and V.sub.L amino acid sequences in an expression system. In one embodiment, the recombinant DNA molecule can include a scFv gene that encodes V.sub.H amino acid sequences and V.sub.L amino acid sequences. In another embodiment the recombinant DNA molecule can include a rmAb gene(s) that encodes a rmAb that include the V.sub.H amino acid sequences and V.sub.L amino acid sequences.
[0058] Due to the redundancy in the genetic code, there can be variation in the nucleic acid sequences of an scFv gene that corresponds to a scFv polypeptide. In other words, there can be more than one scFv gene that encodes for a specific polypeptide. For example, the scFv amino acid sequence as shown in SEQ ID NO: 15 can be encoded by variants of a scFv gene. Therefore, all of the scFv genes with nucleic acid sequences, when expressed, resulting in the expression of SEQ ID NO:15 are within the scope of this disclosure. Any scFv genes that encode an identified scFv polypeptide are within the scope of this disclosure.
[0059] The nucleic acid sequence of an scFv gene corresponding to an scFv polypeptide can be synthesized to optimize gene expression for the selected gene expression system. The optimization of the nucleic acid sequence of the scFv gene can include, for example, optimizing the nucleic acid sequence of each scFv gene based on codon usage in the desired expression system. In addition, other factors that improve the expression of scFv genes can include codon adaptability, mRNA structure and the like. In one embodiment, the amino acid sequences of the scFv polypeptide can be provided to a commercial gene synthesis vendor, e.g. GenScript in Piscataway, N.J. The nucleic acid sequence of the scFv gene can be determined by algorithms that identify the optimal codons based on the desired expression system, e.g. E. coli expression system and on the specific amino acid sequence desired.
[0060] Expression of V.sub.H amino acid sequences and V.sub.L amino acid sequences can be achieved using a variety of techniques. The V.sub.H amino acid sequences and V.sub.L amino acid sequences can be expressed as a recombinant polypeptide with a functional binding domain. The recombinant polypeptide can be a scFv polypeptide, a rmAb and the like.
[0061] The scFv gene encoding the encoding a V.sub.H amino acid sequence and a V.sub.L amino acid sequence may by inserted into an expression system (152). The expression system can include an expression plasmid. The scFv gene can be inserted into an expression plasmid where the scFv gene will be expressed to form the corresponding scFv polypeptide. A variety of suitable expression systems and expression plasmids are known and can be suitable in the expression of scFv genes. Suitable expression systems can include bacterial expression systems, mammalian expression systems, yeast expression systems, insect cell expression systems, plant cell expression systems and the like. Expression systems, for example, can be E. coli expression systems, CHO cell expression systems, and the like.
[0062] In one embodiment, the V.sub.H amino acid sequences and V.sub.L amino acid sequences are expressed as a recombinant scFv polypeptide. The scFv polypeptide is encoded by a corresponding scFv gene that can include DNA encoding a V.sub.H amino acid sequence and also can include DNA encoding V.sub.L amino acid sequence (148). The scFv gene may also include DNA that encodes linker sequences. The linker sequences can include peptides between the V.sub.H amino acid sequence and V.sub.L amino acid sequence. The linker sequences can be between about 3 amino acids and about 30 amino acids. Linker peptides outside of this range may also be included. The linker peptide can be rich in glycine for flexibility and/or serine or threonine for solubility and can either connect the N-terminus of the variable heavy chain and the C-terminus of the variable light chain, or vice versa. In one embodiment, the linker peptide is a 17 amino acid sequence including serine and glycine as shown, for example, in SEQ ID NO:15 from amino acid 122 to amino acid 138. Other sizes and combinations of amino acids are also within the scope of this description.
[0063] In one embodiment, the scFv gene is inserted into an expression plasmid for expression in E. coli, e.g. pET151 plasmid (156) as shown in
[0064] The V.sub.H amino acid sequences and V.sub.L amino acid sequences can be expressed as a rmAb. The rmAb can be encoded by a corresponding gene or genes that can include DNA encoding a V.sub.H amino acid sequence, DNA encoding V.sub.L amino acid sequence and DNA encoding the constant regions of a monoclonal antibody. In addition, DNA encoding the hinge region and the unique-to-chicken 4.sup.th constant region (CH4) may also be included. The rmAb may have one, two, three and/or four of the constant regions of the chicken antibodies included in the rmAb. Since neutralization occurs by passive immunity, the constant region (Fc) is optional and may or may not be included.
[0065] In one embodiment, the candidate antibody gene sequences can be synthesized and TOPO-directionally inserted into T7-regulated bacterial expression plasmids. In other embodiments, mammalian expression systems with a cytomegalovirus promoter can be used. Other expression plasmids may also be used and all are within the scope of this disclosure.
[0066] The recombinant polypeptide may be glycosylated when expressed in recombinant expression system. The glycosylation of the recombinant polypeptides can vary and can be dependent on the specific expression system utilized. In one embodiment, the glycosylation of the recombinant polypeptide can be, for example, based on the glycosylation in CHO expression system. Other suitable glycosylation can also be part of the recombinant polypeptide. Recombinant polypeptides may or may not include the same glycosylation profile as the glycosylation profile in the naturally occurring antibodies purified from birds. In other words, the antibodies purified from birds may have a different glycosylation profile than the glycosylation profile of the recombinant polypeptides expressed in expression systems. Recombinant polypeptides without any glycosylation, e.g. aglycosylated recombinant polypeptides, are also within the scope of this invention.
[0067] Expression of the scFv polypeptides or binding domains can be constitutive or inducible. In one embodiment, the expression of scFv polypeptides is induced during the final hours of growth.
[0068] In some embodiments, expression of the scFv polypeptides may result in the binding domain folding properly to bind an antigen. In some embodiments, the expression of the recombinant scFv polypeptide may need further processing prior to formation of a functional binding domain. Processing of the polypeptide can lead to successful protein folding resulting in binding of the antigen. In one embodiment, the expression of the scFv polypeptide can form inclusion bodies. The scFv polypeptide may be solubilized and refolded (160) for successful protein folding resulting in antigen binding. In one embodiment, refolding the protein may result in changes in disulfide bond formation that can lead to formation of functional binding domains. Other methods to process the recombinant polypeptides into an active state may also be used.
[0069] The recombinant polypeptides expressed, e.g. scFv polypeptides or rmAb, can be screened (164) for antigen binding and specificity. Any suitable antigen specificity screening protocols may be used and all are within the scope of this disclosure. In one embodiment, an indirect ELISA screening assay is used as described below in the Examples. In another embodiment, a phage display library screening may be used.
[0070] The recombinant polypeptides that have specificity for the antigen can be identified. Recombinant polypeptides that include the functional binding domains that have specificity for the antigens can be included in the therapeutic compositions described herein.
[0071] The present description can also include methods for preventing disease in an animal. The method can include hyperimmunizing a bird, e.g. a chicken, with one or more disease antigens. Samples from the bird are obtained at a pre-HI immunological time point and at a post-HI immunological time point as described above. Using the methods described herein, recombinant polypeptides, e.g. scFv polypeptides and/or rmAbs, can be identified, expressed in an expression system and screened for binding and/or neutralizing the one or more disease antigens. Candidate recombinant polypeptides that can bind and/or neutralize the disease antigens can be included in therapeutic compositions and administered to the animal for prevention of disease.
[0072] In one embodiment, the method can include hyperimmunizing birds with antigens from Mannheimia haemolytica. In some embodiments, the antigen may be the outer membrane protein, leukotoxin or combinations thereof. The recombinant polypeptides with functional binding domains that have specificity for the antigens from Mannheimia haemolytica can be included in the therapeutic compositions for preventing diseases associated with Mannheimia haemolytica.
[0073] The present description can also include a method for generating specific recombinant polypeptides that can bind and/or neutralize an antigen of interest in an in vitro expression system. This can result in the production of large amounts of the recombinant polypeptides that are specific to an antigen(s) of interest and can be included in therapeutic compositions. The method can include administering one or more disease antigens to a bird and identifying the amino acid sequences of the variable light chain and variable heavy chains of the antibody repertoire generated in the hyperimmunized state of a bird. Candidate amino acid sequences can be identified for the variable light chain and variable heavy chain sequences. Recombinant DNA molecules can be synthesized that encode at least these portions of the variable light chains and variable heavy chain regions. The recombinant DNA molecules can also include DNA encoding linker peptide sequences, constant regions of the antibody molecules or other amino acid sequences for generating a functional binding domain. The recombinant DNA molecules can be expressed in an in vitro expression system as described herein and screened for specificity to the initial antigen of interest. Recombinant polypeptides that can bind the antigen of interest in a screening assay can be identified and used in expression systems to generate large quantities. Identification, expression and purification of these recombinant polypeptides specific for an antigen of interest results is advantageous for use in therapeutic compositions with considerable cost savings.
[0074] The present description also includes compositions. The compositions can be therapeutic compositions that can include recombinant polypeptides. The recombinant polypeptides can be scFv polypeptides, rmAb polypeptides and the like. The recombinant polypeptides can include a functional binding domain for binding and/or neutralizing an antigen. The binding domains are recombinant products that encompass all of the recombinant polypeptide or a portion of the recombinant polypeptide. The binding domains can be part of or all of the scFv polypeptides. The binding domain can be part of an rmAb. In other words, scFv polypeptides and rmAbs can include the amino acid sequences necessary to form a binding domain of an antigen. The scFvs or rmAbs, once expressed, can include a functional binding domain that can bind and/or neutralize an antigen when expressed in expression systems. This can result in compositions of potently neutralizing antibodies through recombinant protein expression.
[0075] The binding domain of the recombinant polypeptide can include amino acid sequences from the variable light chain domain and amino acid sequences from the variable heavy chain domain. The binding domain of the recombinant polypeptide can bind and/or neutralize an antigen. In some embodiments, the antigen that the binding domain binds and/or neutralizes after expression and successful folding is the same antigen or epitope that was initially used to hyperimmunize birds for identifying the amino acid sequences of the binding domain.
[0076] In one embodiment, the antigen is the same or similar to the antigen used to hyperimmunize birds. The binding domains of the polypeptides can include amino acid sequences from variable regions of a heavy chain immunoglobulin molecule and amino acid sequences from variable regions of a light chain immunoglobulin molecule. The amino acid sequences of the variable regions of the light chain and the heavy chain can be determined based on the antibody repertoire generated due to the hyperimmunization of the bird and the analysis of the resultant mRNA levels in the serum of the hyperimmunized bird. The variable regions of the heavy and light chains can be part of a single-chain variable fragment (scFv) polypeptide and/or they can be part of a recombinant monoclonal antibody (rmAb).
[0077] The recombinant polypeptides in the therapeutic compositions may be generated in a bacterial expression system, a mammalian expression system and the like. In one embodiment, the therapeutic composition may include a single recombinant polypeptide. In another embodiment, the therapeutic composition may include two or more recombinant polypeptides. The two or more polypeptides may be directed to the same antigen but have different specificities. The recombinant polypeptides in the composition may be directed to different disease antigens.
[0078] The recombinant polypeptides can be characterized. The characterization can be used to identify the specific recombinant polypeptides that may be used alone or in combinations in a therapeutic composition. The precise epitope and effect of neutralization by the recombinant polypeptides can be determined. The recombinant polypeptides can be characterized by locating binding sites on the antigen, quantifying binding affinities and the stability of rmAbs, optimized expression of scFvs or whole IgG with relevant glycosylation profiles or any confirmation of lab engineered rmAbs including but not limited to: nanobody, diabody, tribody and the like.
[0079] In one embodiment, the recombinant polypeptide may be aglycosylated. In other embodiments, the recombinant polypeptides may have glycosylation profiles that are different than the glycosylation profile of antibodies that are naturally occurring in the birds, e.g. chicken antibodies. The rmAbs may also be conjugated with other molecules to act as delivery vehicles for biomolecules or chemicals. In one embodiment, biconjugation with an antibody can be used as prodrug therapy, antibody-directed enzyme prodrug therapy (ADEPT), where an inactive antibiotic is first given (prodrug) and only when it can interact with the conjugated Ab does it become active and lethal to bacteria. The Ab can be bound to the specific pathogen and confer pathogen-specific antibiotic targeting.
[0080] In one embodiment, the therapeutic compositions can include recombinant scFv polypeptides against the antigens leukotoxin and/or OMP. The therapeutic compositions can include any scFv polypeptides that bind and/or neutralize the leukotoxin and/or the OMP.
[0081] In some embodiments, the therapeutic compositions can include the scFv polypeptides of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34 or combinations thereof.
[0082] The therapeutic composition can also include additives, carriers and the like in order to improve the utility of the composition during or after administration to an animal.
[0083] The therapeutic compositions may be administered to animals including humans and other mammals. The composition may be administered to agriculture animals such as cattle, swine, poultry and the like.
[0084] The present description also includes compositions that include the recombinant DNA molecules that encode the recombinant polypeptides described herein. In one embodiment, the present description includes the recombinant DNA molecule illustrated in
EXAMPLES
Example 1
[0085] Materials and Methods
[0086] Chickens. Eighteen White Bovans, approximately 26 weeks old, were enrolled and individually caged with colored leg bands for identifying the five study groups. There were three hens in each of the five study groups, one group of two hens acted as the adjuvant control, and one hen received no injections and served as a blood collection method control. Three of the five groups received three different concentrations of the immunogen. Vaccination histories included 13 immunizations, for the health of the bird, and included vaccines for both viral and bacterial avian pathogens. Traceable eggs, to be used for confirmation of immunogen efficacy and charting immune response curves over time, were hand-collected and the date of collection was recorded by marker on the egg shell.
[0087] Hyperimmunization and blood collection. The outer membrane protein (OMP) and leukotoxin from Mannheimia haemolytica were used. The vaccine (Nuplura) was used and included OMP purified from bacterial cultures and recombinant leukotoxin obtained from Novartis Animal Health US Inc. Larchwood, Iowa. The vaccine was diluted in combination with sterile-filtered PBS and the adjuvant Emulsigen-D was used purchased from MVP Laboratories, Omaha, Nebr. Three immunogen concentrations were formed: 1, 5, and 10; based on manufacturer's dosing recommendations of 22 l per kilogram of body weight. Prior to injections, the non-immune repertoire was sampled from venous blood collected by wing bleeds from all hens. The volume of blood collected varied, but a constant 1.0 ml collected for total RNA extraction into lithium heparin (BD) anticoagulated tubes, while the remainder allowed to clot and was saved for serum collection. Hens were hyperimmunized by 1.0 ml intramuscular injections (IM). Adjuvant control hens received identical 1.0 ml diluted adjuvant only, IM. Seven days following the primary, a boost was delivered in an identical manner as the primary IM injections. Thirteen days following the primary hyperimmunization, the post-state repertoire was sampled from venous blood collected from all hens in the second wing vein. Blood samples for both immunological time points were transported back to the laboratory on ice for same-day processing.
[0088] Sample processing and RNA extractions. Performed twice for the non-immune and hyperimmunized collections, PBMCs were isolated from anticoagulated blood by density gradient centrifugation (Lymphoprep gradient and SepMate columns, StemCell Technologies, Vancouver, BC, Canada). Blood samples were first diluted 1:2 in PBS+2% fetal bovine serum (FBS), then added to the gradient solution, which has a specific density for PBMCs. Using the specialized centrifuge columns, samples were centrifuged at 1200g for 10 minutes at room temperature. Supernatant, containing PBMCs, was decanted and washed once using the PBS+FBS solution. Cells were collected by centrifugation at 300g for 8 minutes at room temperature.
[0089] mRNA isolation. Isolated PBMCs were then immediately extracted using the mirVana kit (Ambion) purchased from ThermoFisher Scientific in Waltham, Mass. as described below and the total nucleic acid was stored at 75 C. Serum was also collected, from the clotted blood samples after centrifugation, and stored at 20 C.
[0090] Immediately following PBMC enrichment, cell pellets were lysed using 600 uL of mirVana Lysis Buffer and 60 uL miRNA Homogenate Additive (kit provided). Samples were fully suspended by vortexing followed by a 10 minute incubation on ice. Sets of eight sample mRNAs were isolated at a time, in a randomized order, using mRNA Direct Dynabeads (Ambion) purchased from ThermoFisher Scientific in Waltham, Mass. The purification kit isolates mRNA by their poly(A) tails.
[0091] Next, 600 uL of Acid-Phenol:Chloroform (kit provided) was added to denature unwanted DNA and keep RNA in an aqueous state. Samples were vortexed for 1 minute. To separate aqueous and organic layers, samples were then centrifuged at 18,000g for 5 min at room temperature. The aqueous (upper) layer, containing the RNA, was collected and sample volumes were recorded. Next, 1.25 times the sample volume of 200-proof ethanol was added to precipitate RNA and samples were again mixed by vortexing. Kit-supplied centrifugation columns were loaded with samples and RNA was bound to the column matrix by centrifugation at 10,000g for 15 seconds at room temperature. Multiple spins to bind RNA were necessary since columns hold only 700 uL. Sample portion that flowed through the column into a collection tube was discarded and bound sample RNA was washed to remove protein using 700 uL miRNA Wash 1. Keeping the centrifugation speed the same, columns were spun for 10 seconds. Flow-through fraction was again discarded. Sample RNA was washed twice with 500 uL kit-provided Wash 2/3 Solution and the same portion was discarded. To minimize Wash Solution carryover, sample columns were dried by centrifugation for 1 min. Using sterile and nuclease-free collection tubes, 100 uL of 95 C.-heated Elution Buffer was added to sample columns to release sample RNA. Extraction products were collected through centrifugation for 30 seconds. Samples of RNA were stored at 80 C.
[0092] mRNA Enrichment Protocol and Reverse Transcription
[0093] Sample RNA stored at 80 C. was thawed on ice for 1 hour. The samples were enriched for mRNA using Ambion mRNA Direct Dynabeads kit purchased from ThermoFisher Scientific in Waltham, Mass.). 132 uL of Magnetic beads were added to a 1.5 mL microcentrifuge tube and placed in a magnetic tube rack and allowed to pellet on the side of the centrifuge tube. Pipetted and discarded the storage solution. Tubes were removed from magnetic rack and suspended beads in 132 uL kit-provided Lysis/Binding Buffer. Next, 150 uL of Lysis/Binding buffer was added to thawed sample RNA. 30 uL of resuspended magnetic bead mixture was added to each microcentrifuge tube containing the diluted sample RNA. A five minute benchtop incubation allowed for the capture of polyadenylated RNA. To begin the washing steps, microcentrifuge tubes were loaded into the magnetic rack and supernatant was pipetted and discarded when the solution had cleared. Microcentrifuge tubes were removed from the magnetic rack and mRNA-bound magnetic beads were washed using 200 uL kit-provided Wash Solution A. Beads were suspended by gentle pipetting and then recollected in the magnetic rack. Supernatant was removed by pipetting and the samples were washed once more with Wash Solution A. Following the same process, samples were washed with 300 uL kit-provided Wash Solution B. Supernatant from each wash was discarded. To temporarily release the enriched sample mRNA, 50 uL of 80 C.-heated nuclease-free water was added and incubated on the benchtop for 30 seconds. Next, mRNA was recaptured onto the magnetic beads through the addition of 50 uL Lysis/Binding Buffer. Samples were incubated on the benchtop for 5 minutes. Repeated the two Wash Solution steps to further purify sample mRNA. To release mRNA for the second and final time, 10 uL of 80 C.-heated nuclease-free water was added and incubated on the benchtop for 30 seconds. Microcentrifuge tubes were placed in the magnetic rack and enriched sample mRNA was collected by a pipette and stored on ice.
[0094] Because cDNA is more tolerant to freeze/thaw cycles than mRNA, isolated mRNA was immediately reverse-transcribed using a RT enzyme Superscript III/VILO, Invitrogen kit purchased from ThermoFisher Scientific in Waltham, Mass.
[0095] The cDNA from the reverse transcription was stored at 20 C. The 20 l RT reaction volumes were comprised of: 4 l 5VILO reagent, 2 l 10Superscript reagent, 10 l PCR-grade water, and 4 l sample mRNA. The thermocycler was programmed for: 25 C. for 10 min, 42 C. for 60 min, 85 C. for 5 min, and a 4 C. temperature hold.
[0096] Sample cDNA was purified from reverse transcription enzymes and primer oligonucleotides by using AMPure XP magnetic bead purification kit purchased for Agencourt/Beckman Coulter in Indianapolis, Ind. Sample cDNA was purified by adding 1.8sample volume of AMPure magnetic beads. Mixture was incubated on the benchtop for 5 minutes. Bead mixture in the microcentrifuge tube was placed in the magnetic rack and, after clearing, supernatant was removed by pipetting and discarded. Leaving the microcentrifuge tubes in the magnetic rack, captured cDNA on the beads were washed using 30 uL freshly-prepared 70% ethanol. Following a 30 second incubation, wash solution was removed by pipette and discarded. Repeated the wash step twice. After removing the second wash, beads were dried to minimize ethanol contamination for 4 minutes on the benchtop. To release sample cDNA, microcentrifuge tubes were removed from the magnetic rack and 20 uL of Low TE Buffer was added and vortexed. Microcentrifuge tubes were once again placed in the magnetic rack and supernatant containing the purified sample was collected by pipette. Purified cDNA was stored at 20 C. until V.sub.H and V.sub.L gene amplification.
[0097] Amplification of V.sub.L and V.sub.H genes. From the 18 enrolled chickens, six were randomly selected for amplification and sequencing. Of the selected six, one being mandated to be an adjuvant control hen, the randomization resulted in the selection of two 10, two 1, and one 5 immunogen concentrations. The V.sub.L primers (FWD: AACCGTCAAGATCACCTGCTCC (SEQ ID NO:1), REV: GGTTGTCCCGGCCCCAAA (SEQ ID NO:2)) and V.sub.H primers (FWD: TCTGCAAGGCCTCCGGGTT (SEQ ID NO:3), REV: TTCGGTCCCGTGGCCCCA (SEQ ID NO:4)) were both designed to lay down in the end of the framework 1 region and amplify across the three CDRS to the start of framework 4 (
[0098]
[0099] Sequence library preparation and Ion Torrent sequencing. Purified V.sub.L and V.sub.H amplicons were quantified using a Qubit 2.0 fluorometer (dsDNA HS assay, Invitrogen, ThermoFisher Scientific in Waltham, Mass.).
[0100] A total of 24 libraries for the six chickens were preparedeach V.sub.L or V.sub.H amplification before and after hyperimmunization. To prepare the libraries, Ion Torrent's Ion Plus Library Preparation Kit were used purchased from Ion Torrent, Thermo Fisher, Carlsbad, Calif. Diluted samples in nuclease-free water to a sample input amount ranging between 45 ng and 95 ng. Maximizing sample input negated the need to amplify libraries, which introduces PCR-based errors. Total volume equaled 79 uL. Next, 20 uL 5 End Repair Enzyme and luL End Repair Enzyme (both kit provided) were added to samples, mixed by pipetting, and incubated on the benchtop for 20 minutes. After the ends of sample DNA had been repaired and ready for ligation, samples were purified by AMPure XP magnetic beads: A). Pipetted 180 uL bead solution (1.8 times the sample volume), mixed by pipetting 5 times, and incubated on the benchtop for 5 minutes. B).Placed microcentrifuge tubes in a magnetic rack and allowed beads to pellet for 3 minutes. Keeping tubes in the rack, supernatant was removed by pipette and 500 uL 70% ethanol (freshly prepared) was used to wash DNA-loaded beads. Repeated for a total of 2 washes. C). After removing the second wash, beads were dried to minimize ethanol contamination for 4 minutes on the benchtop. D). To release samples, microcentrifuge tubes were removed from the magnetic rack and 25 uL of Low TE Buffer (kit provided) was added and vortexed. E). Microcentrifuge tubes were once again placed in the magnetic rack and supernatant containing the purified sample was collected by pipette.
[0101] Matching non-immune and immunized repertoire samples' V.sub.L and V.sub.H concentrations, amplicon input amounts varied between 45-95 ng (within the accepted range of 10-100 ng) as allowed by the library protocol. Amplicon libraries received unique sequencing barcodes allowing two libraries to be sequenced on one Ion 316v2 BC chip. To ligate adapters and barcode oligonucleotides to sample amplicons, the following were added to 0.2 mL PCR microcentrifuge tubes in the following order: 25 uL purified sample DNA, 10 uL 10 Ligase Buffer, 2 uL Ion P1 Adapter, 2 uL Xpress Barcode, 2 uL dNTP Mix, 49 uL nuclease-free water, 2 uL DNA Ligase, and 8 uL Nick Repair Polymerase. Sample mixtures were loaded in a thermocycler and the following cycle was run: 25 C. 15 minutes, 72 C. 5 minutes, and a 4 C. hold. Processed sample libraries were purified for a second time using AMPure XP magnetic beads and eluted in 20 uL Low TE Buffer. Libraries stored at 20 C.
[0102] Ion Universal Library Quantification
[0103] Libraries were quantified by PCR (Universal Library Quantitation Kit, Ion Torrent ThermoFisher Scientific, Carlsbad, Calif.) and diluted in TE buffer to a concentration of 40 pM. Sample libraries were quantified by real time PCR prior to Ion Chef Ion Sphere Particle, (ISP) templating. Ion Chef ISP templating is a process in semiconductor sequencing, where a bead (ISP) captures one library read (one sequence theoretically). Through emulsion PCR to amplify that one read in a compartmentalized environment, the surface of the bead (ISP) is covered, or templated, with a monoclonal and singular ligated amplicon. Libraries were loaded in the Ion Chef, an automated library templating and chip-loading platform. After an overnight emulsion PCR program in the Ion Chef, the two loaded chips were sequenced, one per day, while the other was kept at 4 C. As with all the previous selection events, the sequencing order of the two chips was randomized. PCR reactions included the following: 1 uL Primer/probe, 10 uL Master Mix, 4 uL nuclease-free water, and 5 uL sample library diluted 210.sup.3 in water. Kit standards were diluted 1:10 in nuclease-free water to establish a five-point standard curve starting at 6.8 pM and ending at 6.810.sup.4 pM. Sample and standard reactions were loaded into a thermocycler and the following cycle program was run: 50 C. 2 minutes, 95 C. 20 seconds, and 40 cycles of 95 C. 1 second and 60 C. 20 seconds.
[0104] Following the PCR assay, library concentrations were calculated using the standard curve linear equation and accounting for the sample dilution factor. Libraries were diluted to 40 pM concentrations, in Low TE Buffer, and pooled pairwise as input into the Ion Chef automated templating system. Following the overnight Ion Chef preparation, one of the two loaded 316v2 BC sequencing chips was sequenced that day. The remaining chip was kept at 4 C. and sequenced the following day.
[0105] Sequencing statistics and details are summarized in Table 1.
TABLE-US-00001 TABLE 1 Nucleotides Inclusion Criteria 2 Reads Inclusion Criteria 1 between Reads Reads Reads 200bp Ion Chip ISP Barcoded with fwd with rev with both and Chicken ID Barcode Assignment loading clonality Reads primer primer primers 450bp Green 1 non-immune V.sub.L 85% 64% 1,174,882 452,064 58,589 53,881 53,257 (HI) 2 immunized V.sub.L 1,597,935 683,709 88,165 82,152 81,100 3 non-immune V.sub.H 79% 74% 1,881,348 1,021,036 148,049 142,234 141,405 4 immunized V.sub.H 1,253,992 693,484 333,335 316,346 315,142 Black/Red 5 non-immune V.sub.L 85% 64% 1,125,718 587,453 124,344 118,266 116,919 (HI) 6 immunized V.sub.L 1,898,071 849,609 184,531 173,327 171,569 7* non-immune V.sub.H 91% 75% 4,084,192* 2,273,362 486,462 456,733 452,692 8* immunized V.sub.H 90% 71% 3,778,522* 2,209,264 211,457 194,392 182,241 Yellow 9 non-immune V.sub.L 92% 71% 2,663,011 1,238,784 138,741 131,611 130,355 (HI) 10 immunized V.sub.L 866,009 422,564 60,299 57,220 56,691 11 non-immune V.sub.H 91% 68% 1,768,143 1,005,070 228,405 215,291 213,724 12 immunized V.sub.H 1,476,694 778,913 192,839 183,024 181,855 Blue 13 non-immune V.sub.L 88% 73% 1,751,682 826,748 68,497 64,773 64,008 (HI) 14 immunized V.sub.L 1,718,861 807,934 70,729 67,628 66,801 15 non-immune V.sub.H 94% 69% 1,924,087 1,085,642 240,598 231,625 230,407 16 immunized V.sub.H 1,666,537 956,727 208,507 197,764 196,263 Yellow/White 17 non-immune V.sub.L 88% 76% 1,031,682 443,541 139,642 131,262 130,219 (HI) 18 immunized V.sub.L 2,747,195 1,288,696 381,450 361,707 359,136 19 non-immune V.sub.H 91% 75% 1,927,656 1,081,595 306,582 294,428 293,102 20 immunized V.sub.H 1,868,625 1,053,350 262,553 248,998 247,562 Yellow/Black 21 non-immune V.sub.L 90% 68% 1,438,226 710,225 199,483 190,783 189,021 (adjuvant 22 immunized V.sub.L 1,991,610 941,121 275,386 261,391 259,371 control) 23 non-immune V.sub.H 87% 77% 1,803,074 1,032,044 196,231 187,124 183,991 24 immunized V.sub.H 1,804,181 1,076,754 202,091 186,642 183,731 Amino Acids Inclusion Criteria 3-5 Reads Reads with Reads in without correct Ion Chip ISP correct a stop CDR3 Chicken ID Barcode loading clonality frame codon motif Green 1 85% 64% 23,197 18,429 16,922 (HI) 2 35,921 28,047 25,606 3 79% 74% 47,127 15,950 14,134 4 107,813 42,613 38,730 Black/Red 5 85% 64% 59,309 51,146 48,377 (HI) 6 90,185 77,632 73,338 7* 91% 75% 148,254 49,823 42,833 8* 90% 71% 61,000 20,500 17,417 Yellow 9 92% 71% 45,000 33,555 30,575 (HI) 10 20,209 15,208 13,957 11 91% 68% 79,432 34,338 30,574 12 68,070 31,476 28,421 Blue 13 88% 73% 16,910 11,316 9,495 (HI) 14 19,469 13,550 11,583 15 94% 69% 80,230 32,314 29,859 16 69,020 30,367 28,310 Yellow/White 17 88% 76% 81,791 74,371 71,444 (HI) 18 217,602 195,860 187,711 19 91% 75% 100,389 45,433 41,642 20 83,252 36,206 32,726 Yellow/Black 21 90% 68% 104,536 91,232 87,395 (adjuvant 22 146,241 128,604 123,322 control) 23 87% 77% 63,893 24,916 22,590 24 63,748 23,779 21,257
[0106] In
[0107] In
[0108] Bioinformatic analysis. Total, unfiltered reads were processed from tabular files formatted from Ion Torrent fastq files. Working in RStudio, two inclusion criteria were applied to include reads that contained primer sequence and were of a size between 200 and 450 bp and to nucleotide reads that reduced a study average number of reads from 2.0110.sup.6 (SD=9.1110.sup.5) to 2.0310.sup.5 (SD=1.3810.sup.5). Included reads were then translated to their amino acid sequences where a third and fourth inclusion criteria further selected reads that had no stop codons and were in the correct reading frame. A fifth and final inclusion event involved implementing a motif search using ScanProSite, for CDRH3 (D-x(1,5)-[YF]-[YF]-C-x(1,75)-WGHGT) and CDRL3 (D-x(1,10)-[YF]-C-x(1,30)-FGAGTT). This tool not only selected for reads of interest, but indexed the CDR3 regions from reads. Further motif filtration yielded CDR3s defined as being the sequence of residues between the N-terminus Cys and the C-terminus Trp/Phe. The resulting indexed CDR3s were clustered using the CD-HIT webserver at 95% similarity for the CDRH3s and 90% for the shorter CDRL3s. Regardless of 95 or 90%, this allowed for one mismatch for the majority of CDR3s. Twelve data frames of CD-HIT results were then created: six V.sub.L and six V.sub.H. Shifts or changes in antibody frequencies between immune states for each CDR3 cluster were calculated and represented by the term Afrequency.
[0109] In
[0110] Candidate V.sub.H sequence selection. Using a custom, ad-hoc three-conditional ruleset, candidate antibody sequences were selected for further analysis. Ruleset parameters included the following dataset attributes: a minimum Hyperimmunized Frequency, a maximum Non-immune Frequency, and a minimum delta frequency. The objective of the ruleset was to select candidate antigen-specific CDRH3 sequences in a non-biased and high-throughput compatible manner. Success of the ruleset would be measured as not including Adjuvant-only control sequences. Applying the ruleset to a consolidated dataset of 82,000 sequences from all six chickens, the following conditions selected 14 candidates: a Hyperimmunized Frequency greater than 0.4%; a Non-immune Frequency of less than 0.2%; and a delta frequency greater than 30.
[0111] Ruleset R Code: [0112] c=df[df$Immunized.Frequency>0.004 & [0113] df$Corresponding.Nonimmune.Frequency<0.002 & [0114] df$Delta.Frequency>30, ID]
[0115] Pairing V.sub.L sequences with candidates. Abundant CDRL3 sequences were matched to the candidate V.sub.H sequences by relative rank orders from immunized repertoires.
[0116] Yolk antibody extraction. Egg yolk immunoglobulin (IgY) was extracted from dated eggs using a two-step polyethylene glycol 8000 (PEG 8000) process. Individual egg yolks were added to a 4.67% (w/v) PEG 8000 solution at a volumetric ratio of 1:3. Lipids and other precipitated components were removed through centrifugation at 9,000g for 15 minutes at 4 C. The supernatant, containing solubilized immunoglobulin, was decanted and added to a 37.5% (w/v) PEG 8000 solution at a volumetric ratio of 3:1. A second centrifugation at 10,000g for 15 minutes at 4 C. pelleted the precipitated IgY. Finally, the pellet was resuspended in sterile PBS with a volume equal to the original yolk. Purified IgY preparations were 0.2 m sterile filtered and stored at 20 C.
[0117] ELISA Confirming Antigen Specificity
[0118] Indirect ELISA. Each of the 21 refolded sample scFv preparations were diluted 1:100 in 1% BSA.
[0119] The immunogen in its native form was immobilized in treated 96 well flat-bottom polystyrene microtiter plate wells. Once coated, the wells were blocked using 1% bovine serum albumin (BSA). To maximize the number of sample replicates, both coated antigen and sample IgY were run at a single previously optimized dilution pairing of 1:10 and 1:600, respectively. After an hour with gentle orbital shaking at room temperature, unbound IgY was removed by an automated plate washer with a three-wash configuration. A secondary antibody, a goat anti-chicken HRP conjugated antibody was added to wells and the plate was returned to the shaker for one hour at room temperature. After a four-wash removing all unbound goat antibody, a two part chromogen substrate was combined and added to all wells for 10 minutes on the benchtop. The development was stopped with 1N H.sub.2SO.sub.4 after 30 min. on the benchtop and optical density values were read at 450 nm.
Results
[0120] Few, but highly abundant reads dominated the antibody repertoire regardless of immune state. As a result of clustering by similarity, dominant CDR3 sequences for each repertoire were revealed. The clustering algorithm took several hours to cluster each repertoire; the algorithm usually ran overnight with results in the morning. A study wide analysis for the non-immune CDRH3 repertoire, including the adjuvant control, of the top four clusters in terms of abundance resulted in frequencies: 2.817% (SD=0.033), 1.556% (SD=0.017), 1.107% (SD=0.011), and 0.714% (SD=0.003). For the immunized CDRH3 repertoire, the average frequencies of the top four were: 3.087% (SD=0.023), 1.286% (SD=0.005), 1.002% (SD=0.006), and 0.784% (SD=0.002). Table 2 shows an example of one of the twelve data frames constructed from the clustering data. The data frames were constructed in Rstudio following antibody sequence clustering. Representative CDRH3 sequences for each cluster are in rows, while columns contain data regarding the clusters' repertoire copy number, frequency, and change in (delta) frequency. Only the top 10 clusters are depicted (ranked by Hyperimmunized frequency); the actual data frame has a total of 13,503 clusters.
TABLE-US-00002 TABLE2 Corre- Corre- spond- spond- ing ing Non- Corre- CDRH3 HI Non- immune sponding HI Representative Residue Copy HI immune Copy Non-immune Delta Cluster CDRH3Sequence Length Number Frequency Cluster Number Frequency Frequency 0 CAKSANSGNPDAGEIDAW 18 2451 0.075227894 24 82 0.001980628 38.0 (SEQIDNO:5) 1 CAKNSFSSGYGWSAGTIDAW 20 709 0.021761149 87 37 0.000893698 24.3 (SEQIDNO:6) 2 CTRSSCGGDHESGCIDAW 18 701 0.021515607 14 115 0.002777711 7.7 (SEQIDNO:7) 3 CARGGAGHDIDRW 13 384 0.01178601 733 8 0.000193232 61.0 (SEQIDNO:8) 4 CAKTYRGGYCDNGDPCIGYR 24 342 0.010496915 1 453 0.010941765 1.0 IGAW (SEQIDNO:9) 5 CVKSDDGVCCDAYGIDAW 18 238 0.007304871 2 303 0.007318664 1.0 (SEQIDNO:10) 6 CAKGPSGYRYLVGNNIDAW 19 211 0.006476167 980 6 0.000144924 44.7 (SEQIDNO:11) 7 CTRSSCGGDHEAGCIDAW 18 203 0.006230625 9 143 0.003454023 1.8 (SEQIDNO:12) 8 CAKSAAGWCADAGIIDAW 18 184 0.005647463 447 12 0.000289848 19.5 (SEQIDNO:13) 9 CTRSSCGGDYEAGCIDAW 18 171 0.005248458 5 185 0.004468491 1.2 (SEQIDNO:14)
[0121] Areas of conservation surround the CDR3. The CDR3 search motifs were designed and optimized using high-confidence sequence data. The search motifs successfully identified a study wide average of 92.337% (SD=3.889) of all V.sub.L sequences, and 89.791% (SD=2.322) of all V.sub.H sequences.
[0122] CDR3 lengths of the two immune states' most abundant sequences can be significantly different. Using only the top 5% of sequences within repertoire distributions, paired t-tests were performed on the lengths of CDR3, in the two immune states, for each of the five hyperimmunized chicken repertoires. After multiple test corrections using Benjamini-Hochberg controlling the FDR, two of the five immunized repertoires had CDRH3 sequences that were significantly differently sized as compared to their non-immune state repertoire (p=0.03168 each). In both cases, the 5%-selected immunized repertoire had significantly longer CDRH3s than what was observed in their non-immune 5%-selected repertoires. No chicken had significantly longer or shorter CDRL3 sequence in their two immune states. Histograms of CDR3 length distributions for one chicken that had significantly different CDRH3 lengths are in
[0123] Significant antibody frequency shifts were observed between the two immune states. To compare frequency shifts in the six post-state (five immunized and one adjuvant) repertoires, 15 paired t-tests were performed. A 66 matrix comparing frequency shifts from a non-immune state to post-hyperimmunized repertoires in the six chickens is shown in Table 3. Yellow/Black is the adjuvant control, the other five received hyperimmunizations. Benjamini-Hocherg FDR corrected p-values from paired t-tests of Afrequency values are shown for each pairing. Bold and underlined p-values designate significance at a confidence interval of 95% or greater. Four of the five hyperimmunized chickens had significantly greater Afrequency values than the adjuvant control (p<0.0474, Bonferroni corrected). Additionally, when comparing Afrequency values within the five hyperimmunized chicken repertoires, all but one were not significantly different from one another (p>0.1058).
TABLE-US-00003 TABLE 3 yellow/white green blue black/red yellow yellow/black yellow/white 1 green 0.9483 1 blue 0.1058 0.2351 1 black/red
1 yellow 0.1317 0.0736 0.2486
1 yellow/black
0.5982
1
[0124] Amino acid diversity in the V.sub.H region includes homologous substitutions and complements the cited literature. To evaluate amino acid diversity in the 14 paired candidate V.sub.L and V.sub.H, including their derivatives, sequences were aligned to their respective IMGT germline sequences using Clustal Omega and are seen in
DISCUSSION
[0125] Ranking CDR3 sequences based on their repertoire frequency produced animal-specific dominant antibody sequences. Non-immune (pre-HI) samples were collected from the same animal prior to hyperimmunizations. Massive clonal expansions were observed of rare or completely absent B cell clones in the non-immune state, as a result of an active humoral immune response. Quantifying the fold-change of the frequency shift between the two immune states resulted in a measurement of delta frequency (Afrequency). Using complete immunized repertoire distributions, a comparison of Afrequency values between non-immune (pre-HI) and hyperimmunized (post-HI) was performed as shown in Table 2.
[0126] The CD-HIT clustering algorithm (Weizhong Li et al. (Bioinformatics, 17 282-283 and Bioinformatics, 18, 77-82) was used for ranking antibody sequences by their abundance. CD-HIT uses a greedy incremental approach as well as a short word filter and index table. The algorithm first sorted sequences based on length; designating one sequence as a representative for each discrete cluster. It then attempted to find the appropriate cluster for all remaining sequences. The algorithm used a short word filter, two to five peptides, or larger, and an index table to reduce the number of time-consuming pairwise alignments. If a cluster and the query sequence exceeded a minimal threshold similarity, the sequence was added. If no clusters could overcome the threshold, the query sequence would then become the representative of a new cluster. For this study, similarity thresholds at 96%, 95%, and 90%, were set and the short word filter utilized pentapeptide similarities.
[0127] The effects of somatic hypermutation are evident in the data, in candidate antibody sequences with the creation of candidate derivatives at critical residues. These derivatives were discovered by selecting all reads containing the dominant CDR3. To infer dominant CDR1 and CDR2 within the CDR3-defined reads, the full-length V.sub.L and V.sub.H reads were submitted for a second time to CD-HIT with a similarity threshold of 96%. This threshold was chosen since the average submitted V.sub.L read length was 86.49 bp (SD=1.34, n=35,846) that allowed for no more than three mismatches. Likewise, the average V.sub.H read length was 96.33 bp (SD=2.63, n=5,911). Subclusters of clearly dominant CDR1 and CDR2 regions resulted from this analysis. The two hypervariable regions were consistently clustered together such that the most frequent CDR1 always occurred with the most frequent CDR2. This observation was confirmed with manual individual after-the-fact searches for each CDR. The subclustering of CDR1 and CDR2 by abundance within the overall CDR3-defined read seems like an effective method of monitoring somatic hypermutation.
[0128] To obtain additional understanding of the PBMC sample populations, since cells had not been enumerated or sorted prior to RNA extraction, the reoccurrence rate was calculated of the most abundant non-immune repertoire sequences in the post-state repertoires, for each of the six chickens. Abundant sequences were used comprising the top 5% of the non-immune repertoire distribution and searched their corresponding post-state repertoires. Using only the most abundant non-immune V.sub.L and V.sub.H sequences, the distribution quickly approaches zero with the dominance of singleton reads, as seen in
[0129] The CDRH3 sequence had more uniqueness compared to the CDRL3. Whereas there were two instances of a non-unique CDRH3, the V.sub.L CDR3 had many more non-unique sequences between the six immunized repertoires. Several CDRL3s that ended up paired with candidate CDRH3s were not unique to the chicken it originated from. Of the six chicken's V.sub.H hyperimmunized repertoires, the most abundant cluster in the adjuvant control and the 10.sup.th-ranked cluster in one hyperimmunized hen had non-exclusive hyperimmunized state CDRH3 sequences. Looking at the non-exclusive cluster from the immunized chicken, in all six cases the cluster is more abundant in the immunized repertoire than it is in the non-immune repertoire. This may be explained by similar observations seen in the adjuvant control post-state repertoire where clusters' rank commonly increased; despite no intended antigen being delivered. Because an adjuvant enhances the immune system's response to antigen, the observation of an increasing CDR3 abundance in the post-state repertoires, and not necessarily a significant shift in its ranking, might explain this result. Supporting evidence is the complementary observation that the most abundant CDRL3 in the adjuvant control was also shared amongst all other chickens. This example of paired non-exclusivity supports the robustness of rank order pairing of antibody chains. In cases where shared CDR3 sequences were identified, either they were seen at counts of less than five, or they were numerous and spread across all 12 repertoires; both immune states for the six chickens. In these ubiquitous cases, there was no bias towards either immune state.
[0130] The sequences from the 24 samples were then individually clustered, at 90% similarity, at their CDR3 regions. Twelve merged datasets were generated that contained only pre-immune sequences that were also found in the post-immune repertoiretwo variable region databases for each of the six chickens. Relative population frequency changes were calculated, and along with abundance in both immune states, a custom thresholding rule was established which selected for sequences which were likely to be antigen-specific: rare or completely absent in the pre-immune repertoire, while being dominant in the post-immune repertoire. Fourteen CDRH3 sequences passed the thresholding ruleset and were paired with light chain sequences by similar relative abundance. In pairing the candidate V.sub.H sequences with their counterpart V.sub.L, two pairing methods were performed and yielded very similar results. Method 1 used the CDRL3 with the closest frequency percentage to the V.sub.H candidate. Method 2 used a rank ordering such that two CDR3s would be paired despite significant differences in their repertoire frequency. Comparing the two results by a homoscedastic two tailed t-test produced no significant differences (p=0.3188). In three cases, where the most abundant V.sub.H sequences of a chickens' immunized repertoire were to be paired, the two methods used the same V.sub.L sequence. In other V.sub.H candidates that were in consecutive clusters, the difference in pairing methods was off by one CDRL3 cluster. The rank order pairing was chosen as the method of V.sub.H-V.sub.L pairing as described by Reddy et al. (Nature Biotechnology, Vol. 28, p. 965-969, 2010). This resulted in success of 21-of-27 recombinantly expressed scFv s being antigen-specific.
[0131] A total of 21 candidate antigen-specific antibody sequences were identified (including different light chain pairings with the 14 heavy chains) and sequenced variable regions were spliced into scFv gene scaffolds. The scFv genes were expressed in E. coli BL21 (DE3) using a pET151 vector. Following solubilization of inclusion bodies and refolding, an indirect ELISA using the immunogen as antigen confirmed 16/21, or 12/14 selected candidate sequences were indeed antigen specific.
TABLE-US-00004 TABLE4 Antigen Screen ID scFvSequence Results CI81_1scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:15) VCKASGFTFSSYGMAWVRQA PGKGLEFVAGIAYSGSGTGY GSAVKGRATISRDNGQSTVR LQLNNLRAEDTGTYFCAKSA NSGNPDAGEIDAWGHGTEVI VSSGGGGSGGGGSGGGGSAV LAHTSGSLVQAALTEPASVS ANLGGTVKITCSGGGSSSYY GWYQQKSPGSAPVTVIYQDT ERPSNIPSRFSGSTSGSTAT LTITGVQADDEAVYFCGNED ITYVGVFGAGTTLTVL CI81_2scFv AVTLDESGGGLQTPGGGLSL miss (SEQIDNO:16) VCKASGFTFSSYDMGWMRQA PGKGLEFIAGISYSGSDTRY GSAVQGRATISRDNGQSTVR LQLNNLRAEDTGTYYCARGG AGHDIDRWGHGTEVIVSSGG GGSGGGGSGGGGSAVLAHTS GSLVQAALTEPASVSANLGG TVKITCSGSSGSYGWYQQKS PGSAPVTVIYRNDKRPSDIP SRFSGSKSGSTATLTITGVQ AEDEAVYYCGSADSSGAIFG AGTTLTVL CI81_3scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:17) VCKASGFTFSSYGMAWVRQA PGKGLEFVAGIAYSGSGTGY GSAVKGRATISRDNGQSTVR LQLNNLRAEDTGIYFCAKGP SGYRYLVGNNIDAWGHGTEV IVSSGGGGSGGGGSGGGGSA VLAHTSGSLVQAALTEPASV SANLGGTVKITCSGDPTYYG WYQKKSPGSAPVTLIYSNDK RPSDIPSRFSGSLSGSTNTL TITGVQVEDEAVYYCGSYDS TYDIIFGAGTTLTVL CI81_4scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:18) VCKASGFTFSDYGMQWVRQA PGRAGIVASISNSGSRTYYG AAVKGRATISRDDGQSTVRL QLYDLRAEDTGTYYCARTAG GCYACADDIDAWGHGTEVIV SSGGGGSGGGGSGGGGSAVL AHTSGSLVQAALTEPASVSA NLGGTVKITCSVDIIDDVTY YYGWHQQKSPGSAPVTVIYG DNQRPSDIPSRFSGSASGST ATLTITGVQADDEAVYFCGA YDSSDDVAIFGAGTTLTVL CI81_5scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:19) VCKASGFTFSSHGMGWVRQA PGKGLEFVASISNTGGGTAY GAAVKGRATISRDNGQSTVR LQLNNLRADDTATYYCARAP SSGYCNNVHIVDIIDTWGHG TEVIVSSGGGGSGGGGSGGG GSAVLAHTSGSLVQAALTEP ASVSANLGGTVKITCSGGSG YYGWFQQKSPGSAPVTVIYE NTKRPSDIPSRFSGSASGST ATLTITGVQVEDEAVYYCGN RDISYVAIFGAGTTLTVL CI81_6.1.1scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:20) VCKASGFTFSDYGMGWMRQA PGKGLEWVASVTYTGDETPF YAPAVQGRATISRDNGQSTV RLQLNSLRAEDTATYFCAKS PNSGIPNGAFIDTWGHGTEV IVSSGGGGSGGGGSGGGGSA VLAHTSGSLVQAALTEPASV SANLGGTVKITCSGSSGSYG WYQQKSPGSAPVTVIYADTK RPSDIPSRFSGSKSGSTGTL TITGVQAEDEAVYFCGGYED GTDVGIFGAGTTLTVL CI81_6.1.2scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:21) VCKASGFTFSDYGMGWMRQA PGKGLEWVASVTYTGDETPF YAPAVQGRATISRDNGQSTV RLQLNSLRAEDTATYFCAKS PNSGIPNGAFIDTWGHGTEV IVSSGGGGSGGGGSGGGGSA VLAHTSGSLVQAALTEPASV SANLGGTVKITCSGSSGSYG WYQQKSPGSAPVTVIYADTK RPSDIPSRFSGSTSGSTGTL TITGVQAEDEAVYFCGGYED GTDVGIFGAGTTLTVL CI81_6.1.3scFv AVTLDESGGGLQTPGGGLSL miss (SEQIDNO:22) VCKASGFTFSDYGMGWMRQA PGKGLEWVASVTYTGDETPF YAPAVQGRATISRDNGQSTV RLQLNSLRAEDTATYFCAKS PNSGIPNGAFIDTWGHGTEV IVSSGGGGSGGGGSGGGGSA VLAHTSGSLVQAALTEPASV SANLGGTVKITCSGSSGSYG WYQQKSPGSAPVTVIYADTK RPSDIPSRFSGSTSDSTGTL TITGVQAEDEAVYFCGGYED GTDVGIFGAGTTLTVL CI81_6.2.1scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:23) VCKASGFTFSDYGMGWMRQA PGKGLEWVASVTYTGDETPF YAPAVQGRATISRDNGQSTV RLQLNSLRAEDTATYFCAKS PNSGIPNGAFIDTWGHGTEV IVSSGGGGSGGGGSGGGGSA VLAHTSGSLVQAALTEPASV SANLGGTVKITCSGSSGSYG WYQQKSPGSAPVTVIYANTN RPSDIPSRFSGSKSGSTATL TITGVQAEDEAVYFCGGYED GTDVGIFGAGTTLTVL CI81_6.2.2scFv AVTLDESGGGLQTPGGGLSL miss (SEQIDNO:24) VCKASGFTFSDYGMGWMRQA PGKGLEWVASVTYTGDETPF YAPAVQGRATISRDNGQSTV RLQLNSLRAEDTATYFCAKS PNSGIPNGAFIDTWGHGTEV IVSSGGGGSGGGGSGGGGSA VLAHTSGSLVQAALTEPASV SANLGGTVKITCSGSSGSYG WYQQKSPGSAPVTVIYANTN RPSDIPSRFSGSPSGSTATL TITGVQAEDEAVYFCGGYED GTDVGIFGAGTTLTVL CI81_7.1scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:25) VCKASGFTFSDYGMGWMRQA PGKGLEWVAGISSSGSDTYY GAAVKGRATISRDNGQSTVR LQLNNLRTEDTATYFCAKSA NNMCDNTGCAAGQIDTWGHG TEVIVSSGGGGSGGGGSGGG GSAVLAHTSGSLVQAALTEP ASVSANLGGTVKITCSGGSG RYGWYQQKSPGSAPVTVIYA DTNRPSDIPSRFSGSKSGST ATLTITGVQADDEAVYYCGN YEGGFFNDIFGAGTTLTVL CI81_7.2scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:26) VCKASGFTFSDYGMGWMRQA PGKGLEWVAGIGSTGSSTYY GAAVKGRATISRDNGQSTVR LQLNNLRTEDTATYFCAKSA NNMCDNTGCAAGQIDTWGHG TEVIVSSGGGGSGGGGSGGG GSAVLAHTSGSLVQAALTEP ASVSANLGGTVKITCSGGSG RYGWYQQKSPGSAPVTVIYA DTNRPSDIPSRFSGSKSGST ATLTITGVQADDEAVYYCGN YEGGFFNDIFGAGTTLTVL CI81_8.1scFv AVTLDESGGGLQTPGGGLSL miss (SEQIDNO:27) VCKASGFTFSSHGMGWVRQA PGKGLEYVASITSIDDGETP FYAPAVQGRATISRDDGQST VRLQLNNLRAEDTGTYYCTK SPNSGIPNGAFIDTWGHGTE VIVSSGGGGSGGGGSGGGGS AVLAHTSGSLVQAALTEPAS VSANLGGTVKITCSGGGNNY GWHQQKSPGSAPVTVIYSND KRPSDIPSRFSGSASGSTGT LTITGVQAEDEAVYFCGGYD GNNGAFGAGTTLTVL CI81_8.2scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:28) VCKASGFTFSSHGMGWVRQA PGKGLEYVASITSIDDGETP FYAPAVQGRATISRDDGQST VRLQLNNLRAEDTGTYYCTK SPNSGIPNGAFIDTWGHGTE VIVSSGGGGSGGGGSGGGGS AVLAHTSGSLVQAALTEPAS VSANLGGTVKITCSGGGNNY GWHQQKSPGSAPVTVIYSSD KRPSDIPSRFSGSASGSTGT LTITGVQVEDEAVYFCGGYD GNNGAFGAGTTLTVL CI81_8.3scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:29) VCKASGFTFSSHGMGWVRQA PGKGLEYVASITSIDDGETP FYAPAVQGRATISRDDGQST VRLQLNNLRAEDTGTYYCTK SPNSGIPNGAFIDTWGHGTE VIVSSGGGGSGGGGSGGGGS AVLAHTSGSLVQAALTEPAS VSANLGGTVKITCSGGGNNY GWHQQKSPGSAPVTVIYSTD KRPSDIPSRFSGSASGSTAT LTITGVQVEDEAVYFCGGYD GNNGAFGAGTTLTVL CI81_9scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:30) VCKASGFTFNDYGMGWMRQA PGKGLEFVASITSATDNETP FYAPAVQGRATISRDNGQST VRLQLNNLRAEDTATYYCAK SPNSGIPNGAFTDTWGHGTE VIVSSGGGGSGGGGSGGGGS AVLAHTSGSLVQAALTEPAS VSANLGGTVKITCSGSRGSY GWYQQKSPGSAPVTVIYSND KRPSDIPSRFSGSRSGSTAT LIITGVRAEDEAVYFCGSYE GGFFNDIFGAGTTLTVL CI81_10scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:31) VCKASGFNFSDYNMGWVRQA PGKGLEWVAGIYSGYDTYYA TAVDGRATISRDDGQTTVRL QLDDLRAEDTGTYFCTRGAA PYYIDTWGHGTEVIVSSGGG GSGGGGSGGGGSAVLAHTSG SLVQAALTEPASVSANLGGT VKITCSGSSGSYGWYQQKSP GSAPVTVIYADTKRPSDIPS RFSGSTSGSTSTLTITGVQA EDEAVYFCGGYEDGIDVGIF GAGTTLTVL CI81_11scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:32) VCKASGFTFSSYAMGWMRQA PGKGLEFVAGIRGDGSSTWY ATAVQGHATISRDDGQSTLR LQLNNLRAEDTATYFCAKNG YDGNRWGAYSADSIDAWGHG TEVIVSSGGGGSGGGGSGGG GSAVLAHTSGSLVQAALTEP ASVSANLGGTVKITCSGSSG SYGWYQQKSPGSAPVTVIYA DTKRPSDIPSRFSGSTSGST STLTITGVQAEDEAVYFCGG YEDGIDVGIFGAGTTLTVL CI81_12scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:33) VCKASGFTFSDYGMGWMRQA PGKGLEFVASITSSIDNETP FYAPAVQGRATISRDDGQST VRLQLNDLRAEDTGTYYCAK SPNSGIPNGAFTETWGHGTE VIVSSGGGGSGGGGSGGGGS AVLAHTSGSLVQAALTEPAS VSANLGGTVKITCSGGGGSY YGWYQQKSPGSAPVTVIYSN NKRPSDIPSRFSGALSGSTV TLTITGVQAEDEAVYYCGSY DSSGGIFGAGTTLTVL CI81_13scFv AVTLDESGGGLQTPGGGLSL hit (SEQIDNO:34) VCKASGFTFSSFNMMWVRQA PGKSLEWVAGIQNIGSGTDY GAAVKGRATISRDNGQSTVR LQLNNLRAEDTGTYYCARGA GGCASCADDIDAWGHGTEVI VSSGGGGSGGGGSGGGGSAV LAHTSGSLVQAALTEPASVS ANLGGTVKITCSGGGGSYYG WYQQKSPGSAPVTVIYSNNK RPSDIPSRFSGALSGSTVTL TITGVQAEDEAVYYCGSYDS SGGIFGAGTTLTVL CI81_14scFv AVTLDESGGGLQTPGGGLSL miss (SEQIDNO:35) VCKASGFTFSSYTMNWVRQA PGKGLEWVAGINNFGNTTLR VAVKGRATISRDNGQTTVRL QLNNLRAEDTATYFCAKNAA GSCINCADNIDVWGHGTEVI VSSGGGGSGGGGSGGGGSAV LAHTSGSLVQAALTEPASVS ANLGGTVKITCSGSTYNYGW YQQKSPGSAPVTVIYYNDKR PSGIPSRFSGSKSGSTGTLT ITGVRAEDEAIYYCAGYDSN AGIFGAGTTLTVL
Example 2
[0132] Transient Expression in E. coli and ELISA Confirming Antigen Specificity
[0133] Vials of chemically-competent E. coli BL21 Star(DE3) from Invitrogen were thawed on ice for a minimum of one hour. Plasmid was received from Invitrogen's GeneArt Gene Synthesis service in the form of a 5 ug lyophilized pellet. That pellet was suspended in 50 uL nuclease-free water; creating a DNA concentration of 100 ng/uL. The plasmid preparations at a concentration of 100 ng/uL were then further diluted, using nuclease-free water, to a concentration of 5 ng/uL. Once the E. coli cells had thawed, 2 uL of the 5 ng/uL diluted plasmid was added to the vial and gently mixed by flicking. Following a 30 minute incubation on ice, allowing salts in the plasmid preparation to stabilize cell membranes, a precise 30 second heat-shock at 42 C. drove plasmids into cells. Vials were immediately returned to the ice bath. Next, 250 uL of S.O.C. media (kit provided) was added to vials which allowed cells to recover and began expressing the antibiotic resistance gene. Vials were incubated with shaking at 37 C. After 30 minutes, vials were used to inoculate 10 mL test tubes containing Luria-Bertani (LB) broth with 50 ug/mL carbenicillin antibiotic. Cultures were incubated overnight at 37 C. with shaking. The next morning, culture volumes were scaled up by inoculating 5% (v/v) 250 mL Erlenmeyer flasks with 80 mL LB broth supplemented with 50 ug/mL carbenicillin. Pre-warming the 80 mL media ensured a faster transition to logarithmic growth phase. Cultures were incubated at 37 C. 200 RPM for 2 hours and 45 minutes.
[0134] Once in logarithmic growth phase, expression of the scFv protein was induced by adding IPTG to a final culture concentration of 0.8 mM. IPTG was slowly pipetted into flasks with constant shaking and returned to 37 C. 200 RPM for 4 hours. To harvest recombinant protein, cultures were centrifuged to pellet E. coli for 10 minutes at 4,000g at 4 C. Spent culture media was discarded and cell pellets were stored by inverting centrifuge tubes at 80 C. To collect the expressed scFvs, E. coli pellets were pulled from 80 C. storage and cells were fully lysed using Novagen's BugBuster Lysis Buffer at 20% (v/v) of the culture volume. Since centrifuge tubes held approximately 40 mL, 5 mL of Lysis Buffer was added and cells were lysed by gently rocking on the benchtop for 20 minutes. Next, centrifuging tubes for 20 minutes at 16,000g 4 C. separated soluble (supernatant) and insoluble (pellet) protein. Both protein fractions were collected for analysis.
[0135] As determined by SDS-PAGE and evaluating protein bands, the recombinant scFv was found to be in the insoluble protein fraction; specifically in aggregates called inclusion bodies. Following failed attempts at histidine tag purifications, all 21 expressed scFvs were determined to be misfolded and required re-solubilization and subsequent refolding to restore proper folding and activity. The 21 scFv inclusion body preparations were further treated with Novagen's BugBuster Lysis Buffer; 20% (v/v) of the culture volume and the addition of lysozyme to a final concentration of 1000 U/mL. Preparations were rocked at 5 minutes on the benchtop to degrade membranes and release inclusion bodies. Another addition of Lysis Buffer, this time an equal volume of 1:10 diluted in nuclease-free water, was followed by maximum vortexing for 1 minute. Fully homogenized sample preparations were then centrifuged at 5,000g for 15 minutes at 4 C. to pellet inclusion bodies. Supernatants were discarded.
[0136] Inclusion bodies were next washed three times in an equal volume of 1:10 diluted Lysis Buffer and collected each time through centrifugation at the same speed, time and temperature. After sample inclusion bodies of recombinant scFv were purified from E. coli lysates, they were re-solubilized using Thermo Scientific's Inclusion Body Solubilization Reagent. Supplemented with 5 mM DTT for reconstructing disulfide bonds, 4 mL was added to each tube and inclusion bodies were homogenized by rocking on the benchtop for 30 minutes. A final centrifugation at 27,000g for 15 minutes separated unwanted debris. Approximately 4 mL of supernatant, containing the scFvs, were then loaded into 10,000 MWCO G2 dialysis cassettes (Thermo Scientific). A maximum of 4 cassettes at a time were dialyzed against 2L of 6M Urea at 4 C. Urea was stirred using a magnetic stir bar on a stir plate to maximize diffusion.
[0137] Recombinant scFvs were fully denatured for 6 hours before the stepwise addition of 8 portions of 250 mL 25 mM Tris-HCl, pH 7.5 every 6 or 12 hours, until the dialysis volume reached 3 L. The slow titration of tris buffer optimizes protein refolding. To remove traces of Urea, cassettes were transferred to 1 L of 25 mM Tris-HCl 150 mM NaCl pH 7.5, and dialyzed at 4 C. for 6 hours. Sample scFvs were finally collected from cassettes by needle and syringe, aliquoted into 500 uL volumes in microcentrifuge tubes, and stored at both 4 C. and 20 C.
[0138] The ELISA immune response curves, seen in
[0139] Timing the ASC migration from the germinal centers in lymph nodes to the bone marrow can be visualized by the response curve specific to IgG/IgY. The delay seen in egg yolk-derived IgY; IgY levels are representative of the circulating immunoglobulins approximately five to six days previously. Taking this delay into account, the ELISA further supports the post-state sampling time point of six days following the boost.
[0140]
[0141] This demonstrated the ability to sequence individual chickens' antibody repertoires at two immunological time points where major frequency shifts as a result of hyperimmunization could be observed. The sample richness of peripheral blood compared to bone marrow pales in comparison, but sampling bone marrow mandates a singular sampling time point.
[0142] Unselected and unsorted cells were used. Antibody light and heavy chain mRNA transcripts being targeted by the amplifying primers are not known to be antigen-experienced, or even the secreted form of the BCR. To have selected for only secreted forms of the BCR, the heavy chain reverse primer would have to be positioned further downstream into the C.sub.H4 region, where numerous hydrophilic residues reside. This would be impractical however, since moving the primer downstream would create an amplicon exceeding current Ion Torrent sequence read length limits. An additional consideration of this approach is that nave B cells can contribute transcripts to the repertoire alongside an antigen-experienced ASC. An improvement effecting sequencing read quality can allow for additional reads to be included, a possible solution might be in multiple and redundant amplification primers, or using 5 RACE (rapid amplification of cDNA ends).
[0143] Although the present invention has been described with reference to preferred embodiments, workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention.