BACTERIAL BIOFILMS AND CANCER
20200405779 ยท 2020-12-31
Assignee
Inventors
- Cynthia L. Sears (Baltimore, MD, US)
- Christine Craig (Baltimore, MD, US)
- Drew M. Pardoll (Brookeville, MD)
Cpc classification
G01N33/56916
PHYSICS
A61K45/06
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
G01N2800/52
PHYSICS
A61P35/00
HUMAN NECESSITIES
International classification
A61P35/00
HUMAN NECESSITIES
Abstract
Compositions for the treatment of colorectal cancer target bacterial biofilms in the gastrointestinal tract. Methods of treatment include one or more agents which target bacteria and the bacterial biofilms.
Claims
1. A method of treating cancer in a subject, comprising administering a therapeutically effective amount of one or more agents which are bactericidal, bacteriostatic and/or inhibit growth or activity of bacteria in a bacterial biofilm in the subject's gastrointestinal tract, wherein the bacterial biofilm comprises at least one bacterial type from Bacteroides and at least one bacterial type from Enterobacteriaceae; thereby treating the subject.
2. The method of claim 2, wherein the one or more agents which are bactericidal, bacteriostatic and/or inhibit growth or activity of bacteria comprise antibacterial agents, antibiotics, probiotics, mucosal protective agents, adjuvants, vaccines, antibodies, small molecule inhibitors, mucosal antigen specific immune cell modulating agents, anti-inflammatory agents, anti-cytokine agents, cytokines, antigen presenting cells, small molecule compounds, small molecule inhibitors of toxins, antisense oligonucleotides, antibiotics, species-specific bacteriophages, toxins, membrane destabilizing agents, antibacterial or antimicrobial compounds, siRNA reagents, antibodies, antibody fragments bearing epitope recognition sites, such as Fab, Fab, F(ab)2 fragments, Fv fragments, single chain antibodies, antibody mimetics (such as DARPins, affibody molecules, affilins, affitins, anticalins, avimers, fynomers, Kunitz domain peptides and monobodies), peptoids, aptamers; cytokines, cellular factors, enzymes, immune cell modulating agents, adoptive cell therapeutics, peptides, organic or inorganic molecules, natural or synthetic compounds, or combinations thereof.
3. The method of claim 1, wherein the at least one bacterial type from Bacteroides is enterotoxigenic Bacteroides fragilis (ETBF) and the at least one bacterial type from Enterobacteriaceae is Escherichia coli (E. coli).
4. The method of claim 3, wherein the E. coli comprise polyketide synthase (pks) genes.
5. The method of claim 3, wherein the E. coli encode or express a colibactin genotoxin.
6. The method of claim 3, wherein the enterotoxigenic Bacteroides fragilis (ETBF) encode or express a Bacteroides fragilis toxin (bft).
7. The method of claim 1, wherein the ETBF and E. coli co-colonize the subject's gastrointestinal tract.
8. The method of claim 2, wherein the one or more antibiotics comprise: clindamycin, beta-lactams, macrolides, chloramphenicol, aminoglycosides, fluoroquinolones, carbapenems, sulbactam or combinations thereof.
9. (canceled)
10. The method of claim 2, wherein the administered one or more agents are B cell activating factor (BAFF), cytokines, adjuvants, immunogens, peptides, vectors expressing one or more peptides, or combinations thereof.
11. The method of claim 10, wherein vectors expressing one or more peptides are administered and the peptides comprise one or more epitopes of ETBF and/or E. coli.
12. The method of claim 2, wherein the administered one or more agents are cytotoxic for ETBF and/or E. coli.
13. The method of claim 2, wherein the administered one or more agents inhibit bacterial adherence to the subject's gastrointestinal tract.
14. The method of claim 2, wherein the administered one or more agents comprise an anti-cytokine agent that inhibits IL-17 induction by ETBF bacteria.
15. The method of claim 2, wherein the administered one or more agents comprise a probiotic agent that comprises one or more species of selected from the group consisting of Bacteroides, Prevotella, Porphyromonas, Fusobacterium, Sutterella, Bilophila, Campylobacter, Wolinella, Butyrovibrio, Megamonas, Desulfomonas, Desulfovibrio, Bifidobacterium, Lactobacillus, Eubacterium, Actinomyces, Eggerthella, Coriobacterium, Propionibacterium, non-spore-forming anaerobic gram-positive bacilli, Bacillus, Peptostreptococcus Peptococcus, Acidaminococcus, Ruminococcus, Megasphaera, Gaffkya, Coprococcus, Veillonella, Sarcina, Clostridium, Aerococcus, Streptococcus, Enterococcus, Pediococcus, Micrococcus, Staphylococcus, Corynebacterium, Enterobacteriaceae, Pseudomonadaceae or combinations thereof.
16. The method of claim 1, further comprising administering to the subject a chemotherapeutic agent.
17. The method of claim 1, wherein the cancer is colorectal cancer (CRC).
18. A composition comprising a therapeutically effective amount of one or more antibacterial agents and/or one or more probiotics, wherein the antibacterial agents are bactericidal and/or bacteriostatic for enterotoxigenic Bacteroides fragilis (ETBF) and Escherichia coli (E. coli).
19. The composition of claim 18, further comprising one or more probiotics and/or chemotherapeutic agents.
20. A method of preventing colorectal cancer or treating a subject for colorectal cancer, comprising administering to the subject an antimicrobial agent and/or probiotic, wherein colibactin (clbB) and Bacteroides fragilis toxin (bft) are detected in mucosa of a subject's gastrointestinal tract, or A method of treating a neoplastic condition in a subject comprising: detecting a bacterial biofilm within the gastrointestinal tract of a subject; and administering an antimicrobial agent or a probiotic agent to the subject in an amount effective to reduce the size of the bacterial biofilm; thereby, treating or preventing a neoplastic condition in the subject; or A method of treating colorectal cancer, comprising administering a chemotherapeutic agent and a pharmaceutical composition comprising a therapeutically effective amount of an antimicrobial agent to a subject in need thereof, wherein the antimicrobial agents comprise one or more bactericidal and/or bacteriostatic agents for enterotoxigenic Bacteroides fragilis (ETBF) and/or Escherichia coli (E. coli), or A method of treating colorectal cancer, comprising administering a one or more immune modulating agents and a pharmaceutical composition comprising a therapeutically effective amount of an antimicrobial agent to a subject in need thereof, wherein the antimicrobial agents comprise one or more bactericidal and/or bacteriostatic agents for enterotoxigenic Bacteroides fragilis (ETBF) and/or Escherichia coli (E. coli).
21-27. (canceled)
28. A kit for detecting enterotoxigenic Bacteroides fragilis (ETBF) and Escherichia coli (E. coli) comprising: a synthetic oligonucleotide conjugated to a detectable label, wherein the synthetic oligonucleotide specifically hybridizes to Bacteroides fragilis or Bacteroides fragilis toxin (bft); and, a synthetic oligonucleotide conjugated to a detectable label, wherein the synthetic oligonucleotide specifically hybridizes to Escherichia coli or colibactin (clbB); or, one or more antibodies specific for one or more epitopes of ETBF and/or E. coli.
29-40. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063] AOM mice at 15 weeks. Data represent box-and-whisker plot (line, median; box, interquartile range; whiskers, 10.sup.th and 90.sup.th percentiles) of 3 independent experiments (total 9-10 mice per group). Overall significance was calculated using the Kruskal-Wallis test and the overall p value is shown; Mann-Whitney U was used for two group comparisons, p value: ****, P<0.0001. NS=non-significant.
[0064]
[0065]
[0066]
[0067]
DETAILED DESCRIPTION
[0068] Individuals with sporadic colorectal cancer (CRC) frequently harbor abnormalities in the composition of the gut microbiome; however, the microbiota associated with precancerous lesions in hereditary CRC remains largely unknown.
[0069] Accordingly, colonic mucosa of patients with familial adenomatous polyposis (FAP), who develop benign precursor lesions (polyps) early in life were studied. Patchy bacterial biofilms composed predominately of Escherichia coli and Bacteroides fragilis were identified. Genes for colibactin (clbB) and Bacteroides fragilis toxin (bft), encoding secreted oncotoxins, were highly enriched in FAP patients' colonic mucosa compared to healthy individuals. Tumor-prone mice cocolonized with E. coli (expressing colibactin), and enterotoxigenic B. fragilis showed increased interleukin-17 (IL-17) in the colon and DNA damage in colonic epithelium with faster tumor onset and greater mortality, compared to mice with either bacterial strain alone. These data provide evidence for an unexpected link between early neoplasia of the colon and tumorigenic bacteria.
Treatment of Cancer
[0070] When healthy, the colon is covered by a mucus layer that segregates the microbiota from direct contact with the host colonic epithelium. Breaches of this protective mucus layer with resulting increased contact between mucosal microbiota and the colonic epithelial cells has been proposed as a critical first step in inciting changes in tissue biology and/or inflammation that yield chronic colonic disease such as inflammatory bowel disease. Concomitant with increased access to the mucosal epithelium, microbial community communication (such as quorum sensing) has been predicted to change, modifying bacterial structure and function and often resulting in biofilm formation. Biofilms have been defined as aggregations of microbial communities encased in a polymeric matrix that adhere to either biological or non-biological surfaces. Biofilms that invade the mucus layer and come into direct contact with mucosal epithelial cells have indicated pathology although limited detection of biofilms in otherwise histologically normal mucosa has been observed in the colon. Biofilms characterize numerous chronic mucosal disease states in and outside of the colon (including inflammatory bowel diseases, cystic fibrosis, pharyngo-tonsillitis, otitis media, rhinosinusitis, urethritis and vaginitis) where direct bacterial contact with epithelial cells results in perturbed epithelial function and chronic inflammation. However, no association of biofilms with CRC pathologic states has been reported.
[0071] Accordingly, in certain embodiments, a method for treating cancer, e.g. colorectal cancer (CRC) in a subject, comprises administering a therapeutically effective amount of one or more agents which are bactericidal, bacteriostatic and/or inhibit growth or activity of bacteria in a bacterial biofilm in the subject's gastrointestinal tract, wherein the bacterial biofilm comprises at least one bacterial type from Bacteroides and at least one bacterial type from Enterobacteriaceae.
[0072] In certain embodiments, the at least one bacterial type from Bacteroides is enterotoxigenic Bacteroides fragilis (ETBF) and the at least one bacterial type from Enterobacteriaceae is Escherichia coli (E. coli). In certain embodiments, the E. coli bacteria comprise polyketide synthase (pks) genes. In certain embodiments, the E. coli bacteria encode colibactin genotoxin and the enterotoxigenic Bacteroides fragilis (ETBF) encode a Bacteroides fragilis toxin. In certain embodiments, the ETBF and E. coli co-colonize the subject's gastrointestinal tract.
[0073] In certain embodiments, the method of treating a subject suffering from colorectal cancer includes administration of one or more chemotherapeutic agents.
[0074] In other embodiments, a method of preventing colorectal cancer or treating a subject for colorectal cancer, comprises administering to the subject an antimicrobial agent and/or probiotic, wherein colibactin (clbB) and Bacteroides fragilis toxin (bft), are detected in mucosa of a subject's gastrointestinal tract. In certain embodiments, the antibacterial agents inhibit: growth, activity or are bactericidal to enterotoxigenic Bacteroides fragilis (ETBF) and/or Escherichia coli (E. coli).
[0075] In other embodiments, a method of treating a neoplastic condition in a subject comprises (i) detecting a bacterial biofilm within the gastrointestinal tract of a subject; and (ii) administering an antimicrobial agent or a probiotic agent to the subject in an amount effective to reduce the size of the bacterial biofilm. In certain embodiments, the bacterial biofilm is detected within the colon of the subject and comprises enterotoxigenic Bacteroides fragilis (ETBF) and Escherichia coli (E. coli). In certain embodiments, the ETBF and/or E. coli are detected by one or more assays comprising in situ hybridization, blotting, polymerase chain reaction (PCR), immunoassays, reporter assays, or any combinations thereof. In some embodiments, the bacterial biofilm is positive for colibactin (clbB) and Bacteroides fragilis toxin (bft).
[0076] In certain embodiments, a method of treating colorectal cancer, comprises administering a chemotherapeutic agent and a pharmaceutical composition comprising a therapeutically effective amount of an antimicrobial agent to a subject in need thereof, wherein the antimicrobial agents comprise one or more bactericidal and/or bacteriostatic agents for enterotoxigenic Bacteroides fragilis (ETBF) and/or Escherichia coli (E. coli). In certain embodiments, the method further complies administering a probiotic.
[0077] Compositions: In certain embodiments, compositions for preventing or treating colorectal cancer comprises a therapeutically effective amount of one or more antibacterial agents and/or one or more probiotics, wherein the antibacterial agents are bactericidal and/or bacteriostatic for enterotoxigenic Bacteroides fragilis (ETBF) and Escherichia coli (E. coli).
[0078] In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of one or more bactericidal and/or bacteriostatic agents for enterotoxigenic Bacteroides fragilis (ETBF) and/or Escherichia coli (E. coli). In certain embodiments, the pharmaceutical composition comprises a probiotic agent, a chemotherapeutic agent or a combination thereof.
[0079] In certain embodiments, the antibacterial agents or agents are bactericidal, bacteriostatic and/or inhibit growth or activity of bacteria comprise antibacterial agents, probiotics, mucosal protective agents, vaccines, antibodies, mucosal antigen specific immune cell modulating agents, anti-inflammatory agents, anti-cytokine agents, cytokines, small molecule compounds, antisense oligonucleotides, antibiotics, species-specific bacteriophages, small molecule inhibitors, toxins, membrane destabilizing agents, antibacterial or antimicrobial compounds, siRNA reagents, antibodies, antibody fragments bearing epitope recognition sites, such as Fab, Fab, F(ab).sub.2 fragments, Fv fragments, single chain antibodies, antibody mimetics (such as DARPins, affibody molecules, affilins, affitins, anticalins, avimers, fynomers, Kunitz domain peptides and monobodies), peptoids, aptamers; cytokines, cellular factors, enzymes, immune cell modulating agents, adoptive cell therapeutics, peptides, organic or inorganic molecules, natural or synthetic compounds and the like, or combinations thereof. In certain embodiments, the antibacterial agents comprise one or more antibiotics comprising: clindamycin, beta-lactams, macrolides, chloramphenicol, aminoglycosides, fluoroquinolones, carbapenems, sulbactam or combinations thereof. Examples of beta lactams include, without limitation: carbenicillin, cefoperazone, cefamandole and penicillin. In certain embodiments, the mucosal antigen specific immune cell modulating agents comprise: B-cell activating factor (BAFF), cytokines, peptides, vectors expressing one or more peptides, or combinations thereof. The peptides comprise one or more antigenic epitopes of ETBF and/or E. coli inducing an antigen specific immune response. In certain embodiments, the anti-cytokine agent inhibits IL-17 induction by ETBF bacteria.
[0080] In certain embodiments, the at least one bacterial type from Bacteroides is enterotoxigenic Bacteroides fragilis (ETBF) and the at least one bacterial type from Enterobacteriaceae is Escherichia coli (E. coli). In certain embodiments, the E. coli bacteria comprise polyketide synthase (pks) genes. In certain embodiments, the E. coli bacteria encode colibactin genotoxin and the enterotoxigenic Bacteroides fragilis (ETBF) encode a Bacteroides fragilis toxin.
[0081] In certain embodiments, the ETBF and E. coli co-colonize the subject's gastrointestinal tract.
[0082] In certain embodiments, the antibacterial agent is bactericidal for ETBF and/or E. coli. In other embodiments, the antibacterial agents inhibits bacterial adherence to the subject's gastrointestinal tract.
[0083] In certain embodiments, the probiotic agent comprises one or more species of selected from the group consisting of Bacteroides, Prevotella, Porphyromonas, Fusobacterium, Sutterella, Bilophila, Campylobacter, Wolinella, Butyrovibrio, Megamonas, Desulfomonas, Desulfovibrio, Bifidobacterium, Lactobacillus, Eubacterium, Actinomyces, Eggerthella, Coriobacterium, Propionibacterium, non-spore-forming anaerobic gram-positive bacilli, Bacillus, Peptostreptococcus Peptococcus, Acidaminococcus, Ruminococcus, Megasphaera, Gaffkya, Coprococcus, Veillonella, Sarcina, Clostridium, Aerococcus, Streptococcus, Enterococcus, Pediococcus, Micrococcus, Staphylococcus, Corynebacterium, Enterobacteriaceae, Pseudomonadaceae or combinations thereof.
[0084] In certain embodiments, the composition comprises one or more chemotherapeutic agents. Examples of chemotherapeutic agents include Erlotinib (TARCEVA, Genentech/OSI Pharm.), Bortezomib (VELCADE, Millennium Pharm.), Fulvestrant (FASLODEX, Astrazeneca), Sutent (SU11248, Pfizer), Letrozole (FEMARA, Novartis), Imatinib mesylate (GLEEVEC, Novartis), PTK787/ZK 222584 (Novartis), Oxaliplatin (Eloxatin, Sanofi), 5-FU (5-fluorouracil), Leucovorin, Rapamycin (Sirolimus, RAPAMUNE, Wyeth), Lapatinib (GSK572016, GlaxoSmithKline), Lonafarnib (SCH 66336), Sorafenib (BAY43-9006, Bayer Labs.), and Gefitinib (IRESSA, Astrazeneca), AG1478, AG1571 (SU 5271; Sugen), alkylating agents such as Thiotepa and CYTOXAN cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozcicsin, carzcicsin and bizcicsin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gamma1I and calicheamicin omegaI1 (Angew Chem. Intl. Ed. Engl. (1994) 33:183-186); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, anthramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, strcptonigrin, strcptozocin, tubcrcidin, ubenimcx, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacytidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2,2-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosinc; arabinoside (Ara-C); cyclophosphamidc; thiotcpa; taxoids, e.g., TAXOL paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), and TAXOTERE doxetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0085] Also included as chemotherapeutic agents are: (i) anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX tamoxifen), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and FARESTON toremifene; (ii) aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASE megestrol acetate, AROMASIN exemestane, formestanie, fadrozole, RIVISOR vorozole, FEMARA letrozole, and ARIMIDEX anastrozole; (iii) anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); (iv) aromatase inhibitors; (v) protein kinase inhibitors; (vi) lipid kinase inhibitors; (vii) antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in abherant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; (viii) ribozymes such as a VEGF expression inhibitor (e.g., ANGIOZYME ribozyme) and a HER2 expression inhibitor; (ix) vaccines such as gene therapy vaccines, for example, ALLOVECTIN vaccine, LEUVECTIN vaccine, and VAXID vaccine; PROLEUKIN rIL-2; LURTOTECAN topoisomerase 1 inhibitor; ABARELIX rmRH; (x) anti-angiogenic agents such as bevacizumab (AVASTIN, Genentech); and (xi) pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0086] Currently available chemotherapies and their dosages, routes of administration and recommended usage are known in the art and have been described in such literature as the Physician's Desk Reference (60th ed., 2006). Routes of administration include parenterally, intravenously, subcutaneously, intracranially, intrahepatically, intranodally, intraureterally, subureterally, subcutaneously, and intraperitoneally.
[0087] In one embodiment, a therapeutically effective amount of an antibacterial or antimicrobial agent (e.g., antibiofilm agent) described herein for a method of treating cancer is an amount of sufficient to induce apoptosis of cancer cells of the subject as compared to in the absence of one or both such agents. In other embodiments, the amount(s) that is safe and sufficient to treat, delay the development of a tumor, and/or delay further growth of the tumor. In some embodiments, the amount can thus cure or result in amelioration of the symptoms of cancer and tumor growth, slow the course of cancer progression, slow or inhibit a symptom of cancer, slow or inhibit the establishment of secondary symptoms of cancer or inhibit the development of a secondary symptom of the cancer. For example, an effective amount of an antimicrobial agent described herein can inhibit further tumor growth, cause a reduction in size or even completely halt tumor growth, shrink the sizes of tumor, even complete regression of tumor, and reduce clinical symptoms associated with tumor. In certain embodiments, an effective amount for treating cancer is an amount of an antimicrobial agent described herein sufficient to result in a reduction or complete removal of the symptoms of the disorder, disease, or medical condition. In some embodiments, an effective amount for treating or ameliorating a disorder, disease, or medical condition is an amount sufficient to result in a reduction or complete removal of the symptoms of the disorder, disease, or medical condition. In the case of tumor (e.g., a cancerous tumor), the therapeutically effective amount of the antimicrobial agent may reduce the number of cancer cells; reduce the primary tumor size; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the disorder. To the extent the antimicrobial agent may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic. For cancer therapy, efficacy in vivo can, for example, be measured by assessing the duration of survival, time to disease progression (TTP), the response rates (RR), duration of response, and/or quality of life. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal to receive the therapeutic agent, and the purpose of the administration. Thus, it is not possible or prudent to specify an exact therapeutically effective amount. However, for any given case, an appropriate effective amount can be determined by a skilled artisan according to established methods in the art using only routine experimentation. In one embodiment, as used herein, the term treat or treatment refers to reducing or alleviating at least one adverse clinical symptom associated with cancer, e.g., pain, swelling, low blood count etc. In another embodiment, the term treat' or treatment refers to slowing or reversing the progression neoplastic uncontrolled cell multiplication, i.e. shrinking existing tumors and/or halting tumor growth. In another embodiment, the term treat' or treatment refers to inducing apoptosis in cancer or tumor cells in the subject.
[0088] Immune Modulating Agents and Mucosal Immunity: In certain embodiments, the compositions comprise one or more immune-modulating agents which are involved in activating and maintaining an antigen specific immune response. In certain embodiments, the agents activate and maintain antigen specific mucosal immunity.
[0089] The mucosal immune system (MIS) provides protection against toxic elements that enter the body through mucous membranes. The MIS comprises the largest immune organ in the human body. It can be viewed as a single layer epithelium covered by mucus and anti-microbial proteins that is reinforced by various aspects of innate and adaptive immunity (McGhee and Fujihashi 2012; Inside the Mucosal Immune System. PLoS Biol 10, e1001397).
[0090] In its simplest form, the MIS can be divided into inductive and effector sites based on their anatomical and functional properties. The mucosal inductive sites are collectively called mucosa-associated lymphoid tissue (MALT) and include gut-associated lymphoid tissues (GALT), nasopharyngeal-associated lymphoid tissue (NALT) and lymphoid sites. The MALT provides a continuous source of memory B and T cells that then move into effector sites. Mucosal effector sites include the lamina propia regions of the gastrointestinal, upper respiratory and reproductive tracts as well as secretory glandular tissues. These sites contain antigen-specific mucosal effector cells such as IgA-producing plasma cells, and memory B and T cells.
[0091] Proinflammatory cytokines such as tumor necrosis factor (TNF), IFN-, and IL-13, are upregulated in the inflamed mucosa. Other agents include: growth factors, cytokines and lymphokines such as -interferon, gamma-interferon, platelet derived growth factor (PDGF), GC-SF, GM-CSF, TNF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-6, IL-8, IL-10 and IL-12 as well as fibroblast growth factor, surface active agents such as immune-stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analog including monophosphoryl Lipid A (MPL), muramyl peptides, quinone analogs and vesicles such as squalene and squalene, and hyaluronic acid may also be used and administered.
[0092] CD4.sup.+ T cells acquire distinct functional properties in response to signals conveyed by commensal and pathogenic microbe-activated cells of the innate immune system. T-helper type 1 (T.sub.H1) and T.sub.H2 cells control intracellular microorganisms and helminths, respectively, whereas the induced regulatory T cells (iTreg) suppress excessive immune responses. T.sub.H17 cells secrete IL-17, IL-17F, and IL-22, and have significant roles in protecting the host from bacterial and fungal infections, particularly at mucosal surfaces. T.sub.H17 cells are most abundant at steady state in gut-associated tissues, particularly the small intestinal lamina propria (SI LP), where they accumulate only in the presence of luminal commensal microbiota.
[0093] B-cells also play an important role in the humoral as well as cellular immune response. Immature B-cells originate in bone marrow and migrate to spleen, where they become transitional B-cells, whereas some of them further differentiate into mature B-cells. Generally, the presence of the B-cell activating factor (BAFF) is of essential importance for normal development of B-cells.
[0094] B-cell activating factor (BAFF, also called BLyS, Tall-1, or TNFSF13), a member of the TNF (tumor necrosis factor) family, is an important cytokine that controls B-cell survival and maturation. BAFF triggers the production of specific subclasses of antibodies in the B-cells, such as IgG, IgA, and IgE, and is also involved in the immunological class-switching reactions. It seems that the aberrant signaling in the pathways that require BAFF is closely related to numerous diseases, e.g. allergies, autoimmune diseases, infections as well as some cancer diseases, in which dysregulation occurs both at the level of humoral and cellular immunity (Cerutti A, Puga I, Cols M: Innate control of B cell responses. Trends Immunol. 2011 May; 32(5):202-11; Lied G A, Berstad A.: 48. Functional and clinical aspects of the B-cell-activating factor (BAFF): a narrative review. Scand J Immunol. 2011 January; 73(1):1-7.; Cancro M P: The BLyS family of ligands and receptors: an archetype for niche-specific homeostatic regulation. Immunol Rev. 2004 December; 202:237-49). BAFF is an important factor in numerous immunostimulatory reactions (Tertilt C, J et al. Infect Immun. 2009 July; 77(7):3044-55).
[0095] Accordingly, in certain embodiments, a method of treating colorectal cancer comprises administering to a subject in need of such treatment, a pharmaceutical composition comprising a therapeutically effective amount of one or more antimicrobial agents for enterotoxigenic Bacteroides fragilis (ETBF) and/or Escherichia coli (E. coli) and one or immune activating agents to induce an antigen specific immune response. In certain embodiments, the immune activating agents induce a mucosal immune response. In certain embodiments, the subject is further treated with a probiotic agent, a chemotherapeutic agent or a combination thereof. In certain embodiments, an anti-cytokine agent inhibits IL-17 induction by ETBF bacteria.
[0096] In certain embodiments, a subject is administered a vaccine expressing or comprising immunogenic peptides wherein the peptides comprise one or more epitopes of ETBF and/or E. coli for inducing an antigen specific immune response.
[0097] Probiotics: A therapy that can be administered alone or in conjunction with one or more of the therapies discussed herein, is probiotic therapy. Probiotic therapy is intended to mean the administration of organisms and substances which help to improve the environment of the intestinal tract by inhibiting the disproportional growth of bacteria which produce toxins in the intestinal tract. For example, in healthy humans, the small intestine is colonized by lactobacilli (e.g., L. acidophilus), Bifidobacterium, gram-negative anaerobes, enterococci, and Enterobacteriaceae; the large intestine is colonized mainly by obligate or facultative anaerobes (e.g., Bacteroides sp., gram-positive anaerobic cocci, Clostridium sp., non-spore forming gram-positive rods, Enterobacteriaceae (mainly E. coli), and enterococci). Some of these bacteria produce substances which suppress harmful bacteria; for example, bifidobacteria produce lactic and acetic acid, decreasing the pH of the intestines. They can also activate macrophages, which also help suppress harmful bacteria.
[0098] Probiotic agents comprise one or more of the following normal inhabitants of the human intestinal tract: any species of Bacteroides, Prevotella, Porphyromonas, Fusobacterium, Sutterella, Bilophila, Campylobacter, Wolinella, Butyrovibrio, Megamonas, Desulfomonas, Desulfovibrio, Bifidobacterium, Lactobacillus, Eubacterium, Actinomyces, Eggerthella, Coriobacterium, Propionibacterium, other genera of non-sporeforming anaeroibic gram-positive bacilli, Bacillus, Peptostreptococcus (and newly created genera originally in Peptostreptococcus), Peptococcus, Acidaminococcus, Ruminococcus, Megasphaera, Gaffkya, Coprococcus, Veillonella, Sarcina, certain of the species of Clostridium, Aerococcus, Streptococcus, Enterococcus, Pediococcus, Micrococcus, Staphylococcus, Corynebacterium, and species of the genera comprising the Enterobacteriaceae and Pseudomonadaceae, as well as mixtures thereof.
[0099] Certain strains for supplementation are those that are typically permanent residents of the human intestinal tract and which do not produce toxins. Normal human intestinal flora are better adapted to the environment (bile acids, anaerobic conditions, etc.) of the human intestinal tract, and are more likely to survive and colonize the human intestinal tract. Certain species such as L. bulgaricus and S. thermophilus, for example, are commonly used as probiotics, but are not normal constituents of human gut flora, and such species apparently do not colonize the intestinal tract well.
[0100] A probiotic therapy can be designed to be administered as a mixture of a large number of species that are normal, benign inhabitants of the gut, optionally in the general proportion in which they are found in healthy humans. For example, E. coli is-a common enteric inhabitant, but makes up only about 1/1000 of the bowel flora found in healthy humans, so would be a relatively small proportion of a probiotic mixture. Alternatively, the probiotic can be designed in different proportions to facilitate displacement of harmful bacteria or to prevent further adherence to the gut mucosa of harmful bacteria.
[0101] Certain probiotic diet items have also been described, e.g., fermented vegetables (sauerkraut, kimchi, collars, kale, celery), yogurt drinks, tempeh, natto and fermented raw milk (e.g., kefir, yogurt).
[0102] Delivery Agents: Delivery vehicles as used herein, include any types of molecules for delivery of the compositions embodied herein, both for in vitro or in vivo delivery. Examples, include, without limitation: nanoparticles, colloidal compositions, lipids, liposomes, nanosomes, carbohydrates, organic or inorganic compositions and the like. In certain embodiments, the delivery vehicles comprise vaccines, peptides, adjuvants, immune-modulating agents, which can be administered with the antibacterial agents embodied herein.
[0103] The compositions of the invention can be delivered to an appropriate cell of a subject. This can be achieved by, for example, the use of a polymeric, biodegradable microparticle or microcapsule delivery vehicle, sized to optimize phagocytosis by phagocytic cells such as macrophages. For example, PLGA (poly-lacto-co-glycolide) microparticles approximately 1-10 m in diameter can be used. The polynucleotide is encapsulated in these microparticles, which are taken up by macrophages and gradually biodegraded within the cell, thereby releasing the composition(s). A second type of microparticle is intended not to be taken up directly by cells, but rather to serve primarily as a slow-release reservoir of the composition(s) that is taken up by cells only upon release from the micro-particle through biodegradation. These polymeric particles should therefore be large enough to preclude phagocytosis (i.e., larger than 5 m and preferably larger than 20 m). Another way to achieve uptake of the composition(s) is using liposomes, prepared by standard methods. The composition(s) can be incorporated alone into these delivery vehicles or co-incorporated with tissue-specific antibodies, for example antibodies that target cell types that are commonly infected.
[0104] In some embodiments, the compositions of the invention can be formulated as a nanoparticle, for example, nanoparticles comprised of a core of high molecular weight linear polyethylenimine (LPEI) complexed with DNA and surrounded by a shell of polyethyleneglycol modified (PEGylated) low molecular weight LPEI.
Pharmaceutical Compositions
[0105] In certain embodiments, the present invention provides for a pharmaceutical composition comprising an antimicrobial agent or probiotic agent of the present invention. The antimicrobial agent or probiotic agent can be suitably formulated and introduced into a subject or the environment of the cell by any means recognized for such delivery.
[0106] Such compositions typically include the agent and a pharmaceutically acceptable carrier. As used herein the language pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
[0107] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0108] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0109] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0110] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0111] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798.
[0112] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0113] The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
[0114] In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0115] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
[0116] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For a compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
[0117] A therapeutically effective amount of an antibiotic agent and/or a probiotic agent for preventing formation and/or reducing the size of a biofilm in a subject (i.e., an effective dosage) depends upon the antibiotic agent and/or probiotic agent selected. For instance, single dose amounts of an antibiotic agent in the range of approximately 1 pg to 1000 mg may be administered; in some embodiments, 10 pg, 30 pg, 100 pg, or 1000 pg, or 10 ng, 30 ng, 100 ng, or 1000 ng, or 10m, 30m, 100m, or 1000m, or 10 mg, 30 mg, 100 mg, or 1000 mg may be administered. In some embodiments, 1-5 g of the compositions can be administered. The compositions can be administered from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of an antibiotic agent and/or a probiotic agent can include a single treatment or, preferably, can include a series of treatments.
[0118] Suitable amounts of an antibiotic agent and/or a probiotic agent must be introduced and these amounts can be empirically determined using standard methods. Exemplary effective concentrations of individual antibiotic agents and/or probiotic agents in the gut of a subject can be 500 millimolar or less, 50 millimolar or less, 10 millimolar or less, 1 millimolar or less, 500 nanomolar or less, 50 nanomolar or less, 10 nanomolar or less, or even compositions in which concentrations of 1 nanomolar or less can be used.
[0119] The pharmaceutical compositions can be included in a kit, container, pack, or dispenser together with instructions for administration.
Dosage
[0120] Dosage of one or more antibiotic, probiotic, or, optionally, other cancer therapy agents of the invention can be determined by one of skill in the art and can also be adjusted by the individual physician in the event of any complication. Typically, the dosage ranges from 0.001 mg/kg body weight to 5 g kg body weight. In some embodiments, the dosage range is from 0.001 mg/kg body weight to 1 g kg body weight, from 0.001 mg kg body weight to 0.5 g/kg body weight, from 0.001 mg/kg body weight to 0.1 g/kg body weight, from 0.001 mg/kg body weight to 50 mg/kg body weight, from 0.001 mg/kg body weight to 25 mg/kg body weight, from 0.001 mg/kg body weight to 10 mg/kg body weight, from 0.001 mg/kg body weight to 5 mg/kg body weight, from 0.001 mg/kg body weight to 1 mg/kg body weight, from 0.001 mg/kg body weight to 0.1 mg/kg body weight, from 0.001 mg/kg body weight to 0.005 mg/kg body weight. Alternatively, in some embodiments the dosage range is from 0.1 g/kg body weight to 5 g/kg body weight, from 0.5 g/kg body weight to 5 g/kg body weight, from 1 g/kg body weight to 5 g/kg body weight, from 1.5 g/kg body weight to 5 g/kg body weight, from 2 g/kg body weight to 5 g/kg body weight, from 2.5 g/kg body weight to 5 g/kg body weight, from 3 g/kg body weight to 5 g/kg body weight, from 3.5 g/kg body weight to 5 g/kg body weight, from 4 g/kg body weight to 5 g/kg body weight, from 4.5 g/kg body weight to 5 g/kg body weight, from 4.8 g/kg body weight to 5 g/kg body weight. In one embodiment, the dose range is from 5 g/kg body weight to 30 g/kg body weight. Alternatively, the dose range will be titrated to maintain serum levels between 5 g/mL and 30 g/mL.
[0121] Administration of the doses recited above can be repeated for a limited period of time. In some embodiments, the doses are given once a day, or multiple times a day, for example but not limited to three times a day. In one embodiment, the doses recited above are administered daily for several weeks or months. The duration of treatment depends upon the subject's clinical progress and responsiveness to therapy, e.g., shrinkage of tumor sizes. Continuous, relatively low maintenance doses are contemplated after an initial higher therapeutic dose.
[0122] Efficacy testing can be performed during the course of treatment using the methods described herein, e.g., ultrasound, MRI and CT to monitor the shrinkage in size of the tumors in the treated subject. A decrease in size of the tumors during and after treatment indicates that the treatment is effective in reducing tumor size. Measurements of the degree of severity of a number of symptoms associated with cancerous tumors are also noted prior to the start of a treatment and then at later specific time period after the start of the treatment. A skilled physician will be able to ascertain the tumor sizes and related symptoms by known methods in the art and those described herein.
Combination Therapies
[0123] In a specific embodiment, cycling therapy involves the administration of a first cancer therapeutic for a period of time, followed by the administration of a second cancer therapeutic for a period of time, optionally, optionally followed by the administration of a third cancer therapeutic for a period of time and so forth, and repeating this sequential administration, i.e., the cycle in order to reduce the development of resistance to one of the cancer therapeutics, to avoid or reduce the side effects of one of the cancer therapeutics, and/or to improve the efficacy of the cancer therapeutics.
[0124] When two therapeutically effective regimens are administered to a subject concurrently, the term concurrently is not limited to the administration of the cancer therapeutics at exactly the same time, but rather, it is meant that they are administered to a subject in a sequence and within a time interval such that they can act together (e.g., synergistically to provide an increased benefit than if they were administered otherwise). When two prophylactically effective regimens are administered to a subject concurrently, the term concurrently is not limited to the administration of the cancer therapeutics at exactly the same time, but rather, it is meant that they are administered to a subject in a sequence and within a time interval such that they can act together (e.g., synergistically to provide an increased benefit than if they were administered otherwise). For example, the cancer therapeutics may be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, they should be administered sufficiently close in time so as to provide the desired therapeutic effect, preferably in a synergistic fashion. The combination cancer therapeutics can be administered separately, in any appropriate form and by any suitable route. When the components of the combination cancer therapeutics are not administered in the same pharmaceutical composition, it is understood that they can be administered in any order to a subject in need thereof. For example, a first therapeutically effective regimen can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of the second cancer therapeutic, to a subject in need thereof. In another embodiment, a first prophylactically effective regimen can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of the second cancer therapeutic, to a subject in need thereof. In various embodiments, the cancer therapeutics are administered 1 minute apart, 10 minutes apart, 30 minutes apart, less than 1 hour apart, 1 hour apart, 1 hour to 2 hours apart, 2 hours to 3 hours apart, 3 hours to 4 hours apart, 4 hours to 5 hours apart, 5 hours to 6 hours apart, 6 hours to 7 hours apart, 7 hours to 8 hours apart, 8 hours to 9 hours apart, 9 hours to 10 hours apart, 10 hours to 11 hours apart, 11 hours to 12 hours apart, no more than 24 hours apart or no more than 48 hours apart. In one embodiment, the cancer therapeutics are administered within the same office visit. In another embodiment, the combination cancer therapeutics are administered at 1 minute to 24 hours apart.
[0125] In a specific embodiment, the combination therapies have the same mechanism of action. In another specific embodiment, the combination therapies each have a different mechanism of action.
[0126] While various embodiments of the present invention have been described above, it should be understood that they have been presented by way of example only, and not limitation. Numerous changes to the disclosed embodiments can be made in accordance with the disclosure herein without departing from the spirit or scope of the invention. Thus, the breadth and scope of the present invention should not be limited by any of the above described embodiments.
[0127] All documents mentioned herein are incorporated herein by reference. All publications and patent documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication or patent document were so individually denoted. By their citation of various references in this document, applicants do not admit any particular reference is prior art to their invention.
EXAMPLES
Example 1: Patients with Familial Adenomatous Polyposis Harbor Colonic Biofilms Containing Tumorigenic Bacteria
[0128] Biofilms on normal mucosa of sporadic CRC patients are associated with a pro-oncogenic state (6, 7), suggesting that biofilm formation is an epithelial event influencing CRC. To test the hypothesis that biofilm formation may be an early event in the progression of hereditary colon cancer, the mucosa of FAP patients were examined at clinically indicated colectomy.
Materials and Methods
[0129] Patient Selection and Sample Acquisition: Polyps and paired normal tissues were collected from patients with a clinical FAP phenotype undergoing colon surgery at Johns Hopkins Hospital. A subset of patients underwent genetic counseling and mutational analysis confirming a mutation in the APC gene (Table 1). Control subjects (colonoscopy and surgical) included individuals without a history of CRC, inflammatory bowel disease, or antibiotic usage within three months (Table 2,
[0130] Fluorescent in situ hybridization: Carnoy's fixed, paraffin-embedded tissues were sectioned to 5 m thickness and de-waxed following standard procedures. Sections were stained with Periodic acid Schiff (PAS) to confirm mucus presence and preservation and successive sections were hybridized with the Eub338 universal bacterial probe (Table 4). Slides were imaged using a Nikon E800 microscope with NIS elements software. Samples that were determined to have a bacterial presence by universal probe were next analyzed by the more specific probe set listed in Table 4 (Life Technologies). Probes were applied to slides at a concentration of 2 pmol/l in prewarmed hybridization buffer (900 mM NaCl, 20 mM Tris pH 7.5, 0.01% SDS, 20% formamide). Slides were incubated at 46 C. in a humid chamber for 2 hours, and washed at 48 C. for 15 minutes in wash buffer (215 mM NaCl, 20 mM Tris pH 7.5, 5 mM EDTA). Slides were mounted using ProLongGold antifade reagent (Life Technologies).
[0131] Biofilm quantification: As previously published (6), bacterial biofilms were defined as invasive bacterial aggregates within the colon mucus with a bacterial density >10.sup.9 bacteria/mL. Bacterial biofilms were quantified for longitudinal distance along the epithelium and density using slides hybridized with the universal bacterial probe (Table 4). When possible, up to five biofilm measurements were taken across the length of the histologic section (some samples did not have five patches of biofilm, in these cases all present biofilms were measured). Relative biofilm species quantification was performed using tissues hybridized with the universal bacterial probe along with group and B. fragilis and E. coli species specific probes (Tables 3and 4). Because tissue sections were similar qualitatively within an individual patient, one tissue section per patient was selected for E. coli and B. fragilis quantification. For quantification, images were taken at 100 magnification and individual bacterial cells (all bacteria, E. coli, and B. fragilis) in a 1010 m space were counted. Five 1010 m boxes on a single tissue section were counted per patient to determine the relative biofilm composition as a percentage.
Microbial Culture
[0132] Detection of pks+E. coli and ETBF by culture: Tissue stored at 80 C. was utilized for microbial culture and selective amplification and identification of E. coli and B. fragilis isolates. Two to four mucosal samples per patient were available for microbiology culture analysis (Tables 1 and 2). An approximately 3 mm diameter punch of mucosal samples from surgically-resected control tissue, FAP polyp, FAP paired normal, or colonoscopy biopsy was placed in tryptic soy broth (TSB) or peptone yeast glucose bile broth (PYGB) and grown in aerobic or anaerobic conditions, respectively, at 37 C. for up to 48 hours. Microbial growth was pelleted and an aliquot preserved at 80 C. for PCR detection of clbB and E. coli (TSB culture) and bft and B. fragilis (PYGB culture). The remaining pellet was diluted and plated on semi-selective agar (aerobic TSB culture plated on MacConkey agar and anaerobic PYGB culture plated on BBE agar) for single colony identification. A total of fifty Lac.sup.+ or bile-esculin.sup.+ colonies was selected for PCR from each sample. PCR detection was performed using clbB primers (163 bp product) or bft primers (281 bp product) (Table 6).
[0133] Bacterial Strains and Mouse Experiments: Two mouse colon tumorigenesis models were utilized: Apc.sup.+/716 heterozygous multiple intestinal neoplasia (Min) mice (9) and specific pathogen free (SPF) C57BL/6J mice treated with AOM (10 mg/kg weekly for 6 weeks). In shorter experiments (<6 weeks) using the AOM model, AOM was given weekly until the time of mouse harvest. Prior to inoculation of bacterial strains in either mouse model, 6-week-old mice were given water containing 500 mg/L cefoxitin for 48 hours. Cefoxitin treatment results in an absence of detectable bacteria by culture or 16S rRNA qPCR by 24 hours (15). After removal of antibiotic water for 24 hrs, mice were inoculated by oral gavage with 10.sup.8 colony-forming units (cfu) ETBF (piglet 86-5443-2-2), 10.sup.8 cfu pks+E. coli (murine NC101, expressing a fluorescent ampicillin resistance plasmid sfGFP-pBAD) or a mixture containing 10.sup.8 cfu of each strain. Akkermansia muciniphila was obtained from ATCC (ATCC BAA-835). ETBF was grown as previously described (9); pks+E. coli was grown overnight in LB broth in a shaking incubator; and A. muciniphila was grown anaerobically overnight in brain heart infusion broth. Colonization was confirmed and quantified by collection and cultivation of stool on selective media for NC101::sfGFP and ETBF (MacConkey plates with ampicillin or BHI plates with 10 g/ml clindamycin and 200 g/ml gentamicin, respectively) (
[0134] Mucosal colonization was confirmed and quantified on approximately 200 g of tissue collected from the terminal 2 cm of the distal mouse colon. Tissue samples were washed by placing the tissue in 500 l of 0.016% DTT saline followed by 30 sec vortex (speed 7-8), pelleting the tissue and discarding the DTT saline. After two washes, the tissue was homogenized and plated on selective media as described previously (13). Additional experiments were conducted with strains ETBF:bft (15) and NC101:pks (10). Mice were sacrificed at specified time-points, unless otherwise noted for poor health and/or excessive weight loss (defined as 20% total body weight). Germ-free C57BL/6 mice were similarly inoculated with ETBF or pks+E. coli (mono-colonization) or a mixture of ETBF/pks+E. coli (co-colonization) and harvested at 48-60 hours after inoculation. Preliminary experiments determined that mono-colonized or co-colonized germ-free mice expired by 72 hrs after bacterial inoculation.
[0135] Lamina propria lymphocyte isolation: Mouse colon was removed, flushed, and tissue was minced before enzymatic digestion with 400 U/ml liberase and 0.1 mg/ml DNAse1 (Roche Diagnostics). Lymphocytes were isolated by percoll gradient separation (GE Healthcare life Science).
[0136] Flow cytometry: For surface marker staining, 1-210.sup.6 cells were stained in 1 mL of 1 PBS with the LIVE/DEAD Fixable Aqua viability kit according to manufacturer's instructions (ThermoFisher Scientific), washed in an additional 2 mL of 1 PBS by centrifugation at 1500 rpm for 3 min, and then resuspended in 100 L of 1 PBS containing 2% fetal calf serum and 1 g of MOUSE FC BLOCK (BD Biosciences) for 10 minutes prior to the addition of the following fluorochrome-conjugated anti-mouse antibodies at the manufacturers' recommended concentrations for 30 min on ice: CD11b-PerCP/Cy5.5 (Clone M1/70, Biolegend), CD11c-APC (Clone N418, Miltenyi Biotec), MHC II (I-A/I-E)-APC/Cy7 (Clone M5/114.15.2, Biolegend), Ly6C-BV421 (Clone HK1.4, Biolegend), CD64-PE/Cy7 (Clone X54-5/7.1, Biolegend), F4/80-BV650 (Clone BM8, Biolegend), Ly6G-AF700 (Clone 1A8, Biolegend) or CD3-PerCP/Cy5.5 (Clone 145-2C11, eBioscience), CD4-BV605 (Clone RM4-5, Biolegend), CD8-PE (Clone 53-6.7, Biolegend), TCR-APC (Clone eBioGL3, eBioscience) and CD19-BV421 (Clone 6D5, Biolegend),. Stained cells were washed in 2 mL of 1 PBS containing 2% fetal calf serum by centrifugation at 1500 rpm for 3 min prior to resuspension in buffer and acquisition on a flow cytometer. Flow cytometry analysis of IL-17-producing cells (
[0137] Quantitative real-time PCR (IL-17a):An approximately 200 mg segment of distal mouse colon was processed for RNA isolation immediately following colon removal. Tissue was homogenized by bead beating in buffer ALS (Qiagen) and then run through a tissuelyzer column (Qiagen). The resultant solution was utilized for RNA extraction with RNeasy kit according to the manufacturer's recommended procedures. Transcription to complementary DNA was carried out using superscript III (Invitrogen). All qPCRs were performed in triplicate with TAQMAN primer/probe for IL-17a and 18s (as reference gene)(Applied Biosystems), and TAQMAN 2 mastermix (Applied Biosystems). The level of target mRNA was determined by the delta delta CT method.
[0138] ELISA for Fecal IgA: Nunc maxisorp plates were coated with 50 g/l Collagen I, Rat tail (Gibco) in 0.2 acetic acid overnight on a shaker at 4 C. Plates were subsequently washed twice with PBS before adding 10.sup.9 bacteria/ml in PBS (bacterial cultures were grown overnight and rinsed three times in PBS). Plates were incubated overnight at 37 C. in aerobic or anaerobic conditions (for NC101 and ETBF respectively). After incubation, plates were rinsed three times with PBS and fixed in 4% paraformaldehyde. Fixative was removed and plates were rinsed three times with PBS before blocking with 5% milk in PBS 0.05% tween 20 (PBST) for 1 hour at room temperature on a shaker. Fecal supernatants were prepared from 4 week stool samples resuspended at a concentration of 1 g/ml and centrifuged at 50 g for 10 minutes. Fecal supernatant was applied at 1:100 dilution in 2% milk PBST for 2 hours at room temperature on a shaker. Plates were rinsed three times in PBS followed by application of HRP-Goat Anti-mouse IgA (Life Technologies) at 1:1000 in 2% milk PBST for 1 hour at room temperature. Plates were rinsed three times in PBS and developed with TMB substrate (KPL).
[0139] Cell culture and mucus digestion assay: HT29-MTX-E12 cells were grown on transwell inserts (12 mm diameter, pore size 0.4 m-Costar) in Dulbecco's modified Eagles Medium (DMEM) supplemented with 10% FCS at a density of 7.510.sup.4 cells per insert for 21 days. After confluence, the cells were treated with 10 m DAPT (Sigma Aldrich) in the basolateral compartment for 6 days to stimulate mucus production, the apical compartment contained DMEM only. The media were refreshed every 2-3 days. After 21 days, tight junction formation was confirmed with trans-epithelial resistance measurements (TEER).
[0140] For mucus assays ETBF was grown in BHI (supplemented with hemin, vitamin K and L-cysteine) in an anaerobic jar for 24-48 hours until an OD of 1.0 (9). Akkermansia mucinophila was grown in BHI with N.sub.2 overlayed gas while shaking at 37 C. for 48 hours until OD 1.0. Escherichia coli NC101-GFP was grown in BHI overnight while shaking at 37 C. until OD 1.0. Next, bacteria were pelleted and resuspended at OD 0.2 in DMEM supplemented with 1% FCS and 10% BHI. Sterile DMEM with 1% FCS was added to the basolateral compartment and resuspended bacteria or medium control (DMEM with 1% FCS and 10% BHI) was added to the apical compartment at time 0 h. At 24 hours, cells were washed in warm PBS twice, fixed in Carnoy's solution for 10 minutes, dehydrated in 100% ethanol and cleared with xylene for 10 minutes. Next, liquid paraffin (58 C.) was added to the bottom and top of the transwell insert. Paraffinized membranes were embedded in the right orientation for sectioning at 5 m. Sections were stained with alcian blue for mucus visualization.
[0141] Mucus depth was quantified in each condition in 5 random fields (40 magnification) of 100 m length by measuring mucus depth every 10 m on a VISIONTEK (Sakura). Median mucus depth for each condition was calculated.
[0142] Immunohistochemistry: Formalin-fixed (10%), paraffin-embedded tissues were sectioned (5 m) and stained. Slides were de-paraffinized and rehydrated following standard procedures. Slides were steamed in citrate buffer pH 6.0 for 45 minutes for antigen retrieval, and allowed to cool to room temperature, followed by blocking of endogenous peroxidase activity for 10 minutes with 3% hydrogen peroxide. Slides were blocked for 30 minutes in 10% normal goat serum, followed by primary antibody application overnight (1/500 rabbit antiH2AX [Bethyl Laboratories, IHC00008]). Slides were incubated with HRP-conjugated anti-rabbit IgG (Leica Biosystems, PV6119) for 30 minutes followed by DAB chromogen development for 10 minutes. All sections were counterstained with hematoxylin prior to mounting.
[0143] Immunohistochemistry (IHC) quantification: Because no regional differences (proximal, mid, distal colon) in H2AX staining were identified, six crypts were selected for H2AX quantification from each mouse; 2 each from the proximal, middle, and distal mouse colon. Only crypts displaying proper colon surface to crypt cross-sectional orientation, permitting counting of all cells and those cells with H2AX staining, were selected for quantification. Positive cells (containing 3 or more nuclear foci) were counted along with total number of cells in the crypt and a resulting percentage was determined. H2AX IHC staining shown for distal colon (
[0144] Statistical Analysis: Data were analyzed using the nonparametric unpaired, two-tailed Mann-Whitney U test for two group comparisons, nonparametric Kruskal-Wallis test for multiple group comparisons, log rank test or X.sup.2 tests as labeled for each figure. For multiple group comparison achieving statistical significance with Kruskal-Wallis testing, we then performed subsequent two group comparisons of biological interest using Mann-Whitney U testing. For assessment across the 6 cell groups displayed in
Results
[0145] Surgically resected tissues preserved in Carnoy's fixative from five patients with FAP and one with juvenile polyposis syndrome were initially screened (Table 1). Colon biopsies from individuals undergoing screening colonoscopy or surgical resections served as controls (n=20, Table 2). Polyps and macroscopically normal tissue were labeled with a panbacterial 16S ribosomal RNA (rRNA) fluorescence in situ hybridization (FISH) probe. Each FAP patient exhibited bacterial invasion through the mucus layer scattered along the colonic axis (
[0146] Specimens with bacterial biofilms were further screened by additional 16S rRNA probes to recognize the major phyla detected in biofilms of sporadic CRC; namely, Bacteroides/Prevotella, Proteobacteria, Lachnospiraceae, and Fusobacteria. Notably, FAP biofilms were composed predominantly of mucus-invasive Proteobacteria (about 60 to 70%) and Bacteroides (10 to 32%) (Table 3). Fusobacteria were not detected, and Lachnospiraceae were rare (<3%) by quantitative FISH analysis (Table 3).
[0147] Additional probe sets (Table 4) identified the predominant biofilm members as E. coli and B. fragilis (
[0148] Molecular subtypes of both E. coli and B. fragilis, were the two dominant biofilm members identified in direct contact with host colon epithelial cells in the FAP patients tested. E. coli containing the polyketide synthase (pks) genotoxic island (encodes the genes responsible for synthesis of the colibactin genotoxin) induces DNA damage in vitro and in vivo along with colon tumorigenesis in azoxy-methane (AOM)-treated interleukin-10 (IL-10)deficient mice (10), whereas, enterotoxigenic Bacteroides fragilis (ETBF) induces colon tumorigenesis in Apc.sup.Min/+ mice (9). Human epidemiological studies have associated ETBF and pks+E. coli with inflammatory bowel disease and sporadic CRC (10-13). Thus, banked frozen mucosal tissues were cultured from 25 FAP patients (two polyps and two normal tissues per patient when available, Table 1) and 23 healthy individuals (mucosal sample from surgical resection or one ascending and one descending colon biopsy per colonoscopy subject, Table 2) for the presence of pks+E. coli and ETBF. The mucosa of FAP patients was significantly associated with pks+E. coli (68%) and ETBF (60%) compared to healthy subject mucosa (22% pks+E. coli and 30% ETBF) (
[0149] The high frequency of pks+E. coli and ETBF co-colonization in FAP colons highlights the importance of understanding the potential effects of simultaneously harboring these two carcinogenic bacteria. Consequently, two murine models, AOM treatment without DSS (see materials and methods) and Apc.sup.Min716/+ mice were used to test the hypothesis that pks+E. coli and ETBF cocolonization enhances colon tumorigenesis compared to monocolonization with either bacterium. The rate of spontaneous colon tumorigenesis is very low in both model systems.
[0150] Specific pathogen-free wild-type mice were treated with the carcinogen AOM and mono-inoculated or co-inoculated with canonical strains of pks+E. coli (the murine adherent and invasive strain, NC101) and ETBF (strain 086-5443-2-2) (9, 10). Fecal ETBF or pks+E. coli colonization was similar under mono-colonization or co-colonization conditions, persisting until colon tumor formation was assessed at 15 weeks after colonization (
[0151] Apc.sup.Min716/+ mice co-colonized with ETBF and pks+E. coli exhibited enhanced morbidity with rapid weight loss and significantly increased mortality (P<0.0001) [loss of 80% of the mice (n=8) by 8 weeks and the remaining 20% (n=2) at 12 weeks after colonization]. In contrast, 90% (n=9) and 100% (n=10) of mice mono-colonized with ETBF or pks+E. coli, respectively, survived 15 weeks after colonization (
[0152] Consistent with enhanced tumorigenesis, histopathological analysis revealed significantly increased colon hyperplasia and mucosal micro-adenomas in co-colonized AOM-treated mice compared to mono-colonized mice (
[0153] Of particular interest was IL-17, as the tumorigenic potential of ETBF in Apc.sup.Min716/+ mice has been attributed, in part, to IL-17 (9). Because bft was necessary for synergistic tumor induction under co-colonization conditions (
[0154] Because the general lymphoid panel revealed a marked B cell influx across all colonization groups (
[0155] Although fecal colonization of both pks+E. coli and ETBF was equivalent under both mono- and co-colonization conditions (
[0156] Taken together, these data provide evidence that co-colonization with ETBF and pks+E. coli, found in more than half of FAP patients (in contrast to less than 25% of controls), promotes enhanced carcinogenesis through two distinct but complementary steps: (i) mucus degradation enabling increased pks+E. coli adherence, inducing increased colonic epithelial cell DNA damage by colibactin (
[0157] ETBF and pks+E. coli commonly colonize young children worldwide. Thus, the results provide evidence that persistent co-colonization in the colon mucosa from a young age may contribute to the pathogenesis of FAP and potentially even those who develop sporadic CRC because APC loss or mutation occurs in the vast majority of sporadic CRC. It was noted that pks+E. coli are phenotypic and genotypic adherent and invasive E. coli (AIEC) (14). Despite this designation, derived primarily from in vitro cell culture experiments, the canonical pks+E. coli strain (NC101) used in these experiments was only cultivatable from the colon lumen in the absence of concomitant ETBF colonization in our mouse model. This ETBF-dependent shift to marked mucosal pks+E. coli colonization is consistent with the observations that ETBF and pks+E. coli co-colonize FAP colon biofilms, where both bacteria invade and cocolonize the mucus layer throughout the FAP colon. These findings provide evidence that analysis of coexpression of bft and clbB have value in general screening and potential prevention of CRC.
TABLE-US-00001 TABLE 1 Patient ID Age Sex Race Operation Mutation Analyses
M Caucasian Proctocolectomy ND Micro culture 1420 16 F Caucasian Colectomy ND Micro culture 1
27 F Caucasian Colectomy ND Micro culture 2017 8 F Caucasian Proctocolectomy ND Micro culture 221
16 M Caucasian Proctocolectomy ND Micro culture 2544 7 F Caucasian Proctocolectomy ND Micro culture 2732 25 F Caucasian Proctocolectomy ND Micro culture 2735 35 M Caucasian Proctocolectomy ND Micro culture 2
91
F African American Partial Proctocolectomy ND Micro culture 2904 18 F Caucasian Proctocolectomy ND Micro culture 2
27 22 M Caucasian Proctocolectomy ND Micro culture 3024 53 M Caucasian Proctocolectomy ND Micro culture
02
M Caucasian Proctocolectomy ND Micro culture 3037 9 M Caucasian Proctocolectomy ND Micro culture
4
F Caucasian Proctocolectomy ND Micro culture 3174 17 F Caucasian Colectomy ND Micro culture
27 M African American Proctocolectomy ND Micro culture
5
5 F Caucasian Colectomy ND Micro culture
1 25 M Caucasian Proctocolectomy ND Micro culture 3775* 51 F Caucasian Colectomy MYH
FISH, Micro culture
71 27 M African American Proctocolectomy ND
FISH, Micro culture 3973*a 27 F Caucasian Colectomy ND
FISH, Micro culture
0 M Caucasian Colectomy APC
FISH, Micro culture
.sup.b 51 F African American Colectomy APC
FISH, Micro culture
M Caucasian Proctocolectomy APC
FISH, Micro culture Abreviations: ND, not determined, micro = aerobic and anaerobic microbiology culture (see methods); FISH = flourescent in situ
*attenuated phenotype ajuvenile polyposis .sup.bPatient received oral antibiotics 24 hours prior to surgery
indicates data missing or illegible when filed
TABLE-US-00002 TABLE 2 ontrol
ubject
etadata Patient
Age Sex Race Analyses 3714 33 F Caucasian Micro
ulture 3723 49 F Caucasian Micro
ulture 3724 66 M Hispanic Micro
ulture 3730 61 F Caucasian Fish,
icro
ulture 3734 57 F Caucasian Fish,
icro
ulture 3737 52 F Caucasian Fish,
icro
ulture S55 60 F African
merican Fish,
icro
ulture S56 52 F African
merican Fish,
icro
ulture S57 52 M Caucasian Fish,
icro
ulture S58 57 F African
merican Fish,
icro
ulture S59 77 M African
merican Fish,
icro
ulture S60 45 F Caucasian Fish,
icro
ulture S61 58 M Caucasian Fish,
icro
ulture S62 64 M African
merican Fish,
icro
ulture S63 74 F African
merican Fish,
icro
ulture S64 61 M African
merican Fish,
icro
ulture S65 67 F African
merican Fish,
icro
ulture S66 49 F African
merican Fish,
icro
ulture S67 67 F Caucasian Fish,
icro
ulture S68 47 F African
merican Fish,
icro
ulture S69 57 M Caucasian Fish,
icro
ulture S70 59 F Caucasian Fish,
icro
ulture S71 52 F African
merican Fish,
icro
ulture Abbreviations:
icro = as
or
able
1;
ISH = as
or
able
TABLE-US-00003 TABLE 3
& Patient
Samples
Samples with
E. coli
ID
(
) (
) (
) (
) (
) (
Abbreviations:
Patient received oral antibiotics 24 hours prior to surgery
indicates data missing or illegible when filed
TABLE-US-00004 TABLE4 TableS4FISHProbes Probe Refer- ProbeTarget(s) Name Fluorophore ProbeSequence(5-3) ence KingdomBacteriaexcept and
Eub338 Cy3,Alexa GCTGCCTCCCGTAGGAGT 1 405 Fusobacteria Fus714 Alexa488 GGCTTCCCCATCGGCATT 2 Prevotella,Bactemides PRV
RedX GCACGCTACTTGGCTGG 3
{Bacteroides,Parabacteroides, CFB286 Alexa514 TCCTCTCAGAACCCCTAC 4 Prevotella} Betaproteobacteria Bet42a Alexa647 GCCTTCCCACTTCGTTT 5 Gammaproteobacteria Gam42a Alexa647 GCCTTCCCACATCGTTT 5 Lachnospiraceae Lac435 TesasRedX TCTTCCCTGCTGATAGA 6 Enterobacteriaceaeexcept Ent186 Alexa555 CCCCCWCTTTGGTCTTGC 7 Proteusspp Bacteroidesfragilis S-S-Bfrag- Alexa633 GTTTCCACATCATTCCACTG 8 998-a-A-20 Escherichiacoli Eco1531 HRP-
-488 CACCGTAGTGCCTCGTCATCA 9 Escherichiacoli Eco1161 HRP-
-488 GCATAAGCGTCGCTGCCG 10
indicates data missing or illegible when filed
TABLE-US-00005 TABLE 5 IS
P
Remnants Colonoscopy
Patient timrepoint Biofilm E.
oli
B
ragilis 1 1 + + + 2 + + 3 + + 2 1 + + 2 + + 3 3 1 + + 2 + + 3 + + 4 1 + + 5 1 6 1 7 1 8 1 2 + 9 1 10 1 11 1 2 + + + 12 1 13 1 2 + 14 1
[0158] Colonoscopy time points represents serial numbering of colon mucosa over 16 months in post-colectomy FAP patients.
TABLE-US-00006 TABLE6 Product size Primertarget PrimerName Sequence(5-3) Reference (bp) Akkermansia AM1[S-St-Muc- CAGCACGTGAAGGTGGGGAC 11 NA mucinophila165 1129-a-a-20] (Taqman)(FIG.S10) AM2[S-St-Muc- CCTTGCGGGTTGGCTTCAGAT 1437-a-a-20] A.muc165 MEX]ACTGGGCATTGTAGTACGTGTGCA[BHO1] ThisStudy Probe E.Colipks(Taqman) clbB-F GCGCATCCTCAAGAGTAAATA 12 NA (FIG.S10) clbB-R GCGCTCTATGCTCATCAACC pksProbe FAM]TATTCGACACAGAACAACGCCGGT[BHO1] Thisstudy E.colipks(FIG.1D) clbB-F GCAACATACTCGCCCAGCT Thisstudy 163 clbB-R TCTCAAGGCGTTGTTGTTTG B.fragilistoxin blt-F GCGAACTCGGTTTATGCAGT Thisstudy 280 (tift)(FIG.1D) blt-R GTTGTAGACATCCCACTGGC
TABLE-US-00007 TABLE 7 Table S7 P-value of Mann-Whitney test (FIG. 3E) Comparasion ILC Th17 Tc17 Y T17 NKT IL-17 tot ETBF vs. pks + E. coli 0.0159 0.0159 0.0571 0.0159 0.0159 0.0159 pks + E. coli vs. co-infection 0.0159 0.0159 0.0159 0.0159 0.0571 0.0159 ETBF vs. Co-infection >0.9999 0.2222 0.5556 0.0079 0.3929 0.0556
REFERENCES
[0159] E. R. Fearon, B. Vogelstein, Cell 61, 759-767 (1990). [0160] F. M. Giardiello et al., Gastroenterology 106, 1542-1547 (1994). [0161] C. Dejea, E. Wick, C. L. Sears, Future Microbiol. 8, 445-460 (2013). [0162] A. Swidsinski et al., Gut 56, 343-350 (2007). [0163] A. Swidsinski, V. Loening-Baucke, A. Herber, J. Physiol. Pharmacol. 60 (Suppl 6), 61-71 (2009). [0164] C. M. Dejea et al., Proc. Natl. Acad. Sci. U.S.A. 111, 18321-18326 (2014). [0165] C. H. Johnson et al., Cell Metab. 21, 891-897 (2015). [0166] J. S. Son et al., PLOS ONE 10, e0127985 (2015). [0167] S. Wu et al., Nat. Med. 15, 1016-1022 (2009). [0168] J. C. Arthur et al., Science 338, 120-123 (2012). [0169] T. P. Prindiville et al., Emerg. Infect. Dis. 6, 171-174 (2000). [0170] M. Prorok-Hamon et al., Gut 63, 761-770 (2014). [0171] A. Boleij et al., Clin. Infect. Dis. 60, 208-215 (2015). [0172] M. Martinez-Medina et al., J. Clin. Microbiol. 47, 3968-3979 (2009) [0173] K. J. Rhee, S. Wu, X. Wu, D. L. Huso, B. Karim, A. A. Franco, S. Rabizadeh, J. E. Golub, L. E. Mathews, J. Shin, R. B. Sartor, D. Golenbock, A. R. Hamad, C. M. Gan, F. Housseau, C. L. Sears, Induction of persistent colitis by a human commensal, enterotoxigenic Bacteroides fragilis, in wild-type C57BL/6 mice. Infect. Immun. 77, 1708-1718 (2009). doi:10.1128/IAI.00814-08 Medline.
[0174] While various embodiments of the present invention have been described above, it should be understood that they have been presented by way of example only, and not limitation. Numerous changes to the disclosed embodiments can be made in accordance with the disclosure herein without departing from the spirit or scope of the invention. Thus, the breadth and scope of the present invention should not be limited by any of the above described embodiments.