BACULOVIRUS EXPRESSION SYSTEM
20200407696 ยท 2020-12-31
Assignee
Inventors
Cpc classification
C12N2710/14041
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2710/14121
CHEMISTRY; METALLURGY
C12N2710/14143
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C12N2710/14144
CHEMISTRY; METALLURGY
C12N2750/14151
CHEMISTRY; METALLURGY
C12N2710/14043
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
A01K67/033
HUMAN NECESSITIES
Abstract
The present disclosure relates to a heterologous recombinant baculovirus (rBV) expression system for the production of foreign heterologous proteins in insect cells. This system comprises a recombinant baculovirus backbone within a genome with a deletion in the cathepsin gene into which foreign gene cassettes can be integrated, and an insect cell that can be infected by the v-cath-rBV, and in which the foreign proteins and/or viral vectors or particles are expressed.
Claims
1. A recombinant baculovirus (rBV) DNA backbone, comprising: a chitinase gene a deletion of the v-cath gene; and a DNA fragment enabling integration of one or more foreign protein expression cassettes into the backbone such that the one or more foreign protein or proteins expressed in the insect cell is less degraded than it is when expressed from an rBV backbone without the deletion.
2. The rBV DNA backbone of claim 1, wherein the DNA fragment comprises a DNA sequence homologous to two sequences flanking the one or more foreign protein expression cassettes in a donor plasmid.
3. The rBV DNA backbone of claim 1, wherein the DNA fragment is derived from bMON14272.
4. The rBV DNA backbone of claim 3, wherein the DNA fragment comprises an origin of replication.
5. The rBV DNA backbone of claim 3, wherein the DNA fragment further comprises a reporter gene.
6. The rBV DNA backbone of claim 1, further comprising a selection marker expression gene cassette integrated into the cath-v deletion.
7. A recombinant baculovirus (rBV) genome, comprising: the rBV DNA backbone of claim 1; and a foreign protein expression cassette, comprising: at least one foreign protein gene; an insect cell promoter operably linked to the at least one foreign gene; and two DNA sequences, enabling the foreign protein expression cassette to integrate into the rBV DNA backbone.
8. The rBV genome of claim 7, wherein the at least one foreign protein gene in the foreign expression cassette compromises at least one viral protein gene and/or at least one mammalian protein gene.
9. The rBV genome of claim 8, wherein the viral protein gene encodes an AAV protein, an adenoviral protein, a retroviral protein, an SV40 protein, or a Herpes simplex viral protein.
10. The rBV genome of claim 9, wherein the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein or at least one SV40VP1 major capsid protein.
11. The rBV genome of claim 7, wherein the two DNA sequences enabling the foreign protein expression cassette to integrate into the DNA backbone are homologous to the DNA sequence in the rBV DNA backbone or are transposable elements.
12. A recombinant baculovirus (rBV) genome, comprising: the rBV DNA backbone of claim 6; and a foreign protein expression cassette, comprising: at least one foreign protein gene; an insect cell promoter operably linked to the at least one foreign gene; and two DNA sequences, enabling the foreign protein expression cassette to integrate into the rBV DNA backbone.
13. A recombinant baculovirus vector or particle comprising: the rBV genome of claim 7; and at least one baculoviral capsid protein.
14. The recombinant baculovirus vector or particle of claim 13, wherein the rBV genome comprises DNA encoding at least one AAV capsid protein.
15. A recombinant baculovirus vector or particle comprising: the rBV genome of claim 12; and at least one baculoviral capsid protein.
16. An insect cell comprising the recombinant baculovirus vector or particle of claim 13.
17. The insect cell of claim 16, further comprising at least one foreign protein expressed from the foreign protein expression cassette in the rBV backbone of the rBV genome.
18. An insect cell comprising the recombinant baculovirus vector or particle of claim 15.
19. A heterologous expression system comprising: the rBV vector or particle of claim 13; and an insect cell susceptible to infection, and capable of expressing the at least one foreign protein encoded, by the rBV backbone in the rBV vector or particle.
20. The heterologous expression system of claim 19, wherein the rBV vector or particle comprises an rBV backbone comprising a foreign protein expression cassette, the foreign protein expression cassette comprising a sequence encoding at least one AAV capsid protein.
21. A heterologous expression system comprising: the rBV vector or particle of claim 15; and an insect cell susceptible to infection, and capable of expressing the at least one foreign protein encoded, by the rBV backbone in the rBV vector or particle.
22. A non-viscous insect cell lysate, comprising: the recombinant baculovirus (rBV) genome of claim 7; and at least one foreign protein encoded by the rBV genome and expressed in the lysate.
23. The non-viscous insect cell lysate of claim 22, wherein the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein.
24. A non-viscous insect cell lysate, comprising: the recombinant baculovirus (rBV) genome of claim 12; and at least one foreign protein encoded by the rBV genome and expressed therein.
25. A method of producing a foreign protein in an insect cell, comprising: infecting the insect cell with the recombinant baculovirus vector or particle of claim 13; culturing the infected cell under conditions conducive for the expression of the foreign protein gene; and isolating the foreign protein from the insect cell.
26. The method of claim 25, wherein the at least one foreign protein is at least one recombinant AAV capsid protein.
27. A recombinant AAV capsid protein produced by the method of claim 26.
28. A method of producing a foreign protein in an insect cell, comprising: infecting the insect cell with the recombinant baculovirus vector or particle of claim 15; culturing the infected cell under conditions conducive for the expression of the foreign protein gene; and isolating the foreign protein from the insect cell.
Description
DESCRIPTION OF THE DRAWING
[0038] The foregoing and other objects of the present disclosure, the various features thereof, as well as the disclosure itself may be more fully understood from the following description, when read together with the accompanying drawings in which:
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DESCRIPTION
[0058] The disclosures of these patents, patent applications, and publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein. The instant disclosure will govern in the instance that there is any inconsistency between the patents, patent applications, and publications and this disclosure.
[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The initial definition provided for a group or term herein applies to that group or term throughout the present specification individually or as part of another group, unless otherwise indicated.
[0060] The term bacmid refers to a shuttle vector that can be propagated in both E. coli and insect cells. A v-cath bacmid is a bacmid having a deletion in the v-cathepsin gene.
[0061] The term recombinant baculovirus (rBV) DNA backbone refers to a bacmid comprising a baculovirus genome as described by Luckow et al. (1993) J. Virol. 67(8):4566, that contains a bacterial origin of replication, an antibiotic resistant gene and the mini-att Tn7 site enabling the integration of an expression cassette into the backbone, and a cathepsin gene.
[0062] A v-cath rBV backbone or v-cath DNA backbone is a bacmid having a deletion in the v-cathepsin gene and into which foreign gene cassettes including viral and/or mammalian genes can be inserted. The terms v-cath and a deletion in the v-cath (or cathepsin) gene are used interchangeably herein.
[0063] The term recombinant baculovirus (rBV) genome is used herein to mean a baculovirus DNA genome including at least one expression cassette encoding at least one foreign protein. When the rBV genome includes a deleted v-cath gene, it is referred to as v-cath-rBV genome.
[0064] An rBV vector refers to a recombinant baculovirus carrying a rBV genome and encased within the baculovirus capsid and which is capable of infecting an insect cell.
[0065] A viral particle refers to a biological entity comprising a shell formed by the expression and operative assembly within a cell, of capsid proteins, and genetic information in the form of RNA or DNA.
[0066] A selection marker gene encompasses those genes that encode a selection marker protein useful for identifying or selecting an E. coli cell that has been successfully transformed by the bacmid, and for identifying and selecting an insect or mammalian cell successfully infected by the rBV such as, but not limited to, a colorimetric protein or an antibiotic-resistance protein.
[0067] A selection marker gene cassette is a DNA sequence that encodes a non-native selection marker gene operably linked to an E. coli or insect promoter and comprising two insertion sequences which has enabled the integration of the cassette into the DNA backbone.
[0068] As used herein, the term foreign protein refers to a protein not encoded by a wild type baculovirus genome. Such proteins include, but are not limited to, non-insect proteins such as viral proteins and mammalian proteins.
[0069] A foreign protein expression cassette is a DNA sequence encoding at least one non-baculoviral protein such as a viral and/or mammalian protein, operably linked to an insect promoter enabling expression in an insect cell, and may further comprise a DNA sequence operably linked to a mammalian gene promoter enabling expression in a mammalian cell. The foreign gene expression cassette may further link to a selection marker gene and insertion sequences enabling integration of the foreign gene expression cassette into the recombinant baculovirus DNA backbone.
[0070] A donor plasmid is a DNA vector or plasmid that has the foreign protein expression cassette flanked by recombination elements such as transposons which can be used to transfer the foreign protein expression cassette to the bacmid to generate the recombinant baculovirus (rBV) genome.
[0071] The present disclosure relates to a recombinant baculovirus (rBV) expression system for the production of foreign heterologous proteins, including mammalian proteins, in insect cells and which are useful for gene therapy. This system comprises a recombinant baculovirus genome with a deletion in the cathepsin gene (v-cath-rBV) into which foreign gene cassettes can be integrated, and an insect cell that can be infected by the v-cath-rBV, and in which the foreign proteins and/or viral vectors or particles are expressed or produced.
[0072] Insect cells infected by rBV with chitinase A and v-cathepsin deletion are commonly used for expression of recombinant proteins, particularly AAV capsid proteins (Kaba et al. (2004) J. Virol. Meth. 122(1): 113-118; Galibert et al. (2018) PLoS One 13(11): e0207414). However, the deletion of both chiA and v-cath results in a gelatinous lysate due to the absence of chitinase A which cleaves the chitin-rich membrane of insect cells. Isolation of proteins from this viscous lysate is decreased owing gelatinous nature of the lysate.
[0073] The present system unexpectedly enables the efficient production of foreign proteins of interest, and viral vectors and particles, without degradation and in an amount and infectivity level sufficient to be useful for therapeutic purposes. Relative to systems using infection of insect cells with rBV having both a chitinase A gene deletion and a v-cathepsin gene deletion, use of the present system rBV leads to greater AAV yields and greater structural integrity of the AAV capsid, especially in certain AAV mutants. This system also enables the direct expression of mammalian genes in an insect cell.
v-cath-Baculovirus Backbone
[0074] A baculovirus DNA backbone according to the disclosure comprises a deletion of the cathepsin gene. One v-cath DNA backbone according to the disclosure is shown in
[0075] In some rBV backbones, a selection marker cassette is integrated into the v-cath deletion. For example, the v-cath deletion can be replaced with a chloramphenicol (CAT) selection marker expression cassette (CAT promoter-CAT ORF-polyA) flanked by two FRTs (see
[0076] Another representative v-cath rBV DNA backbones is shown in
[0077] The rBV v-cath DNA backbone according to the disclosure also comprises a chitinase gene (at positions 105,282 to 106,937 in
v-cath Backbone Synthesis
[0078] The v-cath backbone can be created from a bacmid comprising the WT baculovirus genome (AcMNPV (NC_001623) into which the composite fragment (Kan LacZ+mini-att Tn7 mini-F replication) is inserted into the polyhedrin region as depicted in bMON14272, (see EXAMPLE 2) or synthesized de novo.
[0079] If starting from the bacmid, the CAT selection marker expression cassette flanked by two flippase recognition targets (FRTs) can be PCR-amplified with primers 2846 (5-TAATAAATGACTGCAGTAGACGCAAGTTCGTTTCTCATACCACAGGCGTTT CCATATGAATATCCTCCTTA-3) (SEQ ID NO:1) and 6281 (5-ATAACTAGTCAATAATCAATGTCGTGTAGGCTGGAGCTGCTTCGAA-3) (SEQ ID NO:2) and plasmid pKD3 as template. The GFP (or other selection marker) expression cassette can be PCR-amplified with primers 5701 (5-GACATTGATTATTGACTAGTTATTAATAGT-3) (SEQ ID NO:3) and 6282 (5-GAACAAAATTTTGTTTTATTTGTTTGTGTACGGCGTTGTAAACAGCGCGGT TAGATCCAGACATGATAAGAT-3) (SEQ ID NO:4) and plasmid V376 as template. The two PCR fragments then can be joined together to form a larger PCR fragment with primers 6298 (5-TAATAAATGACTGCAGTAGACGCAA-3) (SEQ ID NO:5) and 6299 (5-GAACAAAATTTTGTTTTATTTGTTTGTGTA-3) (SEQ ID NO:6) and the two PCR fragments as templates. This large PCR fragment can be recombined into the v-cath region between nucleotides 107,034 and 107,904 to disrupt the v-cath gene via the lambda red system (Datsenko et al. (2000) Proc. Nat.l Acad. Sci. USA 97(12): 6640-6645; and Thomason (2014) Curr. Protoc. Mol. Biol. 106: 1 16 11-39). The junction sequence between CAT expression and GFP expression cassettes and remaining v-cath is shown in
[0080] The v-cath DNA backbone without a selection marker gene cassette can be created from a bacmid, for example bMON14272, or synthesized de novo. If starting from the bacmid, the CAT selection marker expression cassette flanked by two flippase recognition targets (FRTs) can be PCR-amplified with primers 2845 (5-GAACAAAATTTTGTTTTATTTGTTTGTGTACGGCGTTGTAAACAGCG CGGTT GTGTAGGCTGGAGCTGCT-3) (SEQ ID NO:7) and 2846 (5-TAATAAATGACTGCAGTAGACGCAAGTTCGTTTCTCATACCACAG GCGTT TCCATATGAATATCCTCCTTA-3) (SEQ ID NO:1) and plasmid pKD3 as template. This PCR fragment containing the CAT expression cassette flanked by two FRTs can be recombined into the v-cath region between nucleotides 107,034 and 107,904 to disrupt the v-cath gene via the lambda red system (Datsenko et al. (2000) Proc. Nat.l Acad. Sci. USA 97(12): 6640-6645; Thomason (2014) Curr. Protoc. Mol. Biol. 106: 1 16 11-39). After selection of the bacmid DNA and confirmation of the cathepsin deletion, the CAT expression cassette can be removed with the FLP-FRT recombination technology, leaving only one FRT site in the bacmid as shown in
v-cath rBV Genome
[0081] The rBV genome according to the disclosure is capable of replicating in an E. coli cell and in an insect cell It comprises a v-cath DNA backbone as described above, and a foreign protein expression cassette integrated in the v-cath rBV genome. The foreign protein expression cassette includes a gene or genes encoding foreign proteins of interest to be expressed in an insect cells, as well as a gene or genes encoding other proteins of interest to be expressed in mammalian cells. Useful genes encoding foreign proteins of interest for expression in insect cells include, but are not limited to, viral proteins and/or mammalian proteins.
[0082] Useful viral proteins to be expressed can form the structural part or capsid of a vector carrying a mammalian gene of interest and which is deliverable to mammalian cells. For example, the foreign protein expression cassette can include genes encoding AAV viral proteins, e.g., Rep and capsid (Cap) proteins (
[0083] Useful mammalian proteins that can be directly expressed in insect cells include, but are not limited to, human immunoglobulins, human serum albumins, erythropoietin-alpha, and Factor VIII.
[0084] The foreign protein cassette also includes control elements including, but not limited to, an insect cell promoter which enables expression of operably linked genes in an insect cell. Useful insect promoters include, but are not limited to, a polyhedron (polh), p10, OpIE2 or p6.9 insect promoter. If the cassette includes mammalian genes to be expressed in a mammalian cells, promoter enabling expression of these mammalian genes in the mammalian cell will be operably linked to that gene. Useful mammalian promoters include, but are not limited to, CMV, SV40, pGK, EF1a, synapsin, chicken beta actin, and CamKII promoter, etc.
[0085] The foreign protein expression cassette may also link to one or more additional selection marker gene. This marker gene is different than the selection marker gene in the selection marker expression cassette (if it is present in the rBV backbone) as described above which is expressed upon infection of the insect cell.
[0086] The foreign protein expression cassette is flanked by transposable DNA elements enabling it to be integrated into the rBV DNA backbone at specific nucleic acid sites or locations. Useful transposable DNA element include, but are not limited to, Tn7L and Tn7R (
[0087] As shown in
[0088] A diagram of an exemplary generic rBV genome with a v-cath deletion/CAT and GFP selection marker expression cassette insertion and the additional insertion of two foreign protein cassettes are shown in
Cell Culture
[0089] Cells that can be infected by the rBV vector or transformed by bacmid include insect cells or prokaryotic cells such as E. coli. Useful E. coli cells include, but are not limited to, Top10, DH5a, DH10B, TGI, BW23473, BW23474, MW003, Mwoo5, and BL21. Useful insect cells that can be infected by the rBV vector include, but are not limited to, Sf9, Sf21, Express Sf+, and S2 cells from the Fall Army worm (Spodoptera frugiperda), or BTI-TN-5B1-4 (High Five cells) from the cabbage looper Trichoplusia ni (Lepidoptera), D. melanogaster, and other cell lines. These cells are commercially available from a number of sources (e.g., ThermoFisher Scientific, ATCC, and Expression Systems). Insect cells are cultured in a medium conducive for maintenance and growth, such as, but not limited to Gibco insect media: ExpiSf CD Medium, Sf-900 III SFM, Express Five SFM, or SF-900 II SEM (ThermoFisher Scientific), ESF921 and ESFAF (Expression Systems).
rBV Infection
[0090] rBV infects insect cells upon contact under conditions conducive from the virus to enter the cell, e.g., by culturing the contacted cells at about 28 C. for about three days in a medium conducive for expression of the foreign proteins, e.g., in Gibco insect media (ExpiSf CD Medium, Sf-900 III SFM, Express Five SFM, or SF-900 II SEM (ThermoFisher Scientific), ESF921 or ESF AF media (Expression Systems). Successful infection can be monitored e.g., by expression of a visually detectable selection marker protein, or the expression of the gene for which had been incorporated into the rBV genome.
Foreign Protein Expression and Isolation
[0091] Foreign proteins including those which are the structural part of viral vectors carrying mammalian genes, or directly expressed from mammalian genes can be obtained from infected insect cells by lysing the cells and isolating the proteins from the lysate. Lysing can be accomplished with physical force (e.g., with a French Press or sonication), detergent-containing lysis buffer, or enzymatic digestion of the cell matrix with, e.g., chitinase that is naturally expressed by the baculovirus genome.
[0092] The expressed foreign proteins or produced viral particles can be isolated, for example, by chromatographic or electrophoresis methods or by centrifugation, e.g., on cesium chloride gradients.
[0093] These isolated and purified proteins can then be used, e.g., for therapeutic purposes or as research reagents. If the foreign protein is part of a viral vector that carries mammalian genes, the viral vector is isolated and then can be used to infect mammalian cells, e.g., for gene therapy.
Effect of the v-cath Deletion on Foreign Protein Expression
[0094] To demonstrate that deletion of the v-cath gene from the baculovirus genome had no effect on baculovirus replication, the replication of wild type rBV was compared with the replication of the v-cath-rBV according to the disclosure. Both rBVs carrying the same foreign (AAV capsid and rep or GFP) genes were used to infect insect (Sf9) cells. WT baculovirus and v-cath deletion mutant rBV titers were then determined to be similar, demonstrating that v-cath deletion has no negative impact on virus production (
[0095] To demonstrate that the foreign proteins expressed from v-cath rBV are not degraded, foreign protein expression in v-cath rBV-infected cells was compared with protein expression in WT-rBV-infected cells. The resulting synthesized AAV vectors were then purified from the cell lysates. After heating both types of AAV particles, their capsid proteins were examined by SDS-PAGE.
[0096] The results shown in
[0097] To demonstrate that v-cath rBVs can produce higher AAV yields than WT-rBVs, AAV7m8-luciferase and AAVphpb-luciferase vectors were produced in Sf9 cells infected with v-cath rBVs and WT-rBVs, respectively. When preparing cell lysates, the protease inhibitor Leupeptin was added to the lysis buffer for WT-rBV infected lysates to prevent degradation so that AAV production yield could be preserved. No protease inhibitor was added to v-cath rBV-infected lysates. After purification, the AAV vectors were quantified. The results are shown in Table 1.
TABLE-US-00001 TABLE 1 Comparison of AAV Production Yields Between -cath rBVs and WT-rBVs AAV production Folds of Lot no. Type of rBV Type of AAV yield (vg/L) difference 19-137 -cath-rBV AAV7m8- 1.66e+14 2.86 Luciferase 19-156 WT-rBV AAV7m8- 6.11e+13 1.05 Luciferase 19-145 -cath rBV AAVphp.b- 2.30e+14 3.97 Luciferase 19-175 WT-rBV AAVphp.b- 5.80e+13 1 Luciferase
[0098] These results show that foreign protein expression in v-cath rBV-transduced cells was 3 to 4 greater than the same foreign protein expression in WT-rBV-transduced cells.
[0099] It was also determined that AAV vectors produced with v-cath rBVs relative to those produced with WT-rBVs had greater infectivity in mammalian cells. Testing was done in HEK-293 cells using AAV vectors isolated from insect cells infected with either the WT-rBVs or the deletion mutants. GFP expression was recorded. The results shown in
[0100] Reference will now be made to specific examples illustrating the disclosure. It is to be understood that the examples are provided to illustrate exemplary embodiments and that no limitation to the scope of the disclosure is intended thereby.
EXAMPLES
Example 1
Insect Cell Culture
[0101] Sf9 cells (Expression Systems, Davis, Calif.) were cultured in Corning storage bottles at 28 C. in ESF921 or ESF AF media (Expression Systems) supplemented with 100 units/mL penicillin and 100 g/mL streptomycin (HyClone, Logan, Utah). The cells were split 1:4 once the cell density reaches about 810.sup.6 cells/mL for maintenance.
Example 2
Deletion of v-cath Gene from Baculovirus Backbone
[0102] The protocol of lambda red system (Thomason (2014) Curr. Protoc. Mol. Biol. 106: 16 11-394) was used to perform the deletion. Briefly, a 1.1 kB fragment containing the chloramphenicol acetyltransferase (CAT) expression cassette flanked by two FRTs (
[0103] Colonies containing the bacmid with v-cath deletion were verified by DNA sequencing analysis and designated as DH10Bac-v-cath. One of these colonies was chosen to prepare competent cells which were used for generation of recombinant baculovirus without v-cath.
Example 3
Recombinant Baculovirus Generation
[0104] Recombinant baculovirus containing the genes of interest were generated using recombinant baculovirus shuttle vectors (bacmids) that can recombine with a donor plasmid according to manufacturer's protocol (Invitrogen, Carlsbad, Calif.). Briefly, the donor plasmids were diluted in sterile TE buffer (10 mM Tris-HCL, 1 mM EDTA, pH 8.0) to a concentration of 2 ng/L, and 2 L of the diluted plasmid DNA was used to transform 20 L of DH10Bac-wild type (wt)- or DH10Bac-v-cath-competent cells. After 2 days of incubation on the LB-agar plates at 37 C., white colonies were picked and miniprep bacmid DNAs prepared according to manufacturer's protocol (Invitrogen).
[0105] The miniprep bacmid DNAs were then used to transfect Sf9 cells to generate recombinant baculoviruses according to manufacturer's protocol (Invitrogen) with modifications. Briefly, 5 g miniprep bacmid DNA and 5 l GenJet reagent (SignaGene Labs, Rockville, Md.) were each diluted in 100 l of ESF AF media (Expression Systems) in sterile 1.5 mL microfuge tubes. The diluted GenJet reagent was transferred to the diluted bacmid DNA tube and mix by gentle pipette up and down for 3 times. After incubation at room temperature for about 30 min, 0.8 mL ESF AF media was added to the GenJet-bacmid mixture and mixed by pipette up and down 3 times. Sf9 cells were plated on 6-well plate at density of 1.510.sup.6 cells/well in 2 mL ESF AF media and incubated at 28 C. in an incubator for about 30 min to attach. The media from each well was removed and the GenJet-bacmid mixture was then added. After incubation at 28 C. in the incubator overnight, 1 mL of ESF AF media was added and the plate was incubated at 28 C. for a total of 4 days for recombinant baculovirus to be generated. The recombinant baculoviruses in the media were collected and stored at 4 C. under dark.
[0106] The recombinant baculoviruses generated from DH10Bac-wt and DH10Bac-v-cath were designated as WT-rBV, and v-cath rBV, respectively.
Example 4
Impact of v-cath Deletion on rBV Replication
[0107] To determine if deletion of the v-cath gene affected replication of baculovirus, three pairs of WT-rBV and v-cath rBV were used. The first pair WT-rBV-Cap6-Rep and v-cath-rBV-Cap6-Rep each carries AAV6 capsid gene encoding VP1, VP2, and VP3 and AAV2 rep gene encoding rep78 and rep52. The second pair WT-rBV-GFP and v-cath rBV-GFP each carries GFP gene encoding the green fluorescent protein. The third pair WT-rBV-Cap7m8-Rep and v-cath rBV-Cap7m8-Rep each carries AAV7m8 capsid gene encoding VP1, VP2, and VP3 and AAV2 rep gene encoding rep78 and rep52.
[0108] All the rBVs generated were used to infect Sf9 cells for amplification. Briefly, 1 mL of each rBV was added to 200 mL of Sf9 cells at density of 210.sup.6 cells/mL in a Corning culture bottle, respectively, and the rBV amplification was carried out for 3 days at 28 C. and 180 rpm in a shaker incubator (New Brunswick, Hauppauge, N.Y.). The supernatants were harvested by centrifugation at 2,000 rpm for 10 min to remove the cell pellets. The rBV titers in the supernatants were determined by the quantitative polymerase chain reaction (QPCR) method as described in EXAMPLE 5.
Example 5
Quantification of rBV
[0109] To determine the titers of recombinant baculoviruses, a specific QPCR method for rBV titration developed in Virovek was employed. Briefly, 50 l rBV supernatant was mixed with 50 L 0.2% SDS solution and heated at 95 C. for 30 min to release the rBV DNA. The rBV DNA was diluted 1:100 with QPCR dilution buffer (10 g/mL yeast tRNA (Sigma Aldrich, Saint Louis, Mo.), 0.01% Tween 80, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA) and the copy numbers of rBV were determined with Chromo 4 Four-Color Real-time Detection System (Bio-Rad, Hercules, Calif.) using primers corresponding to the gentamicin gene (3065: 5-ATTTGACTTGGTCAGGGCCG-39 (SEQ ID NO:8) and 3066: 5-TGTTACGCAGCAGGGCAGTC-3 (SEQ ID. NO:9)) and SYBR Green PCR Master Mix (ThermoFisher Scientific, Fremont, Calif.). One plaque forming unit (pfu) was empirically determined to contain average of 20 copies of rBV genomes.
Example 6
AAV Vector Production and Purification
[0110] Recombinant baculoviruses were used to infect insect cells to produce AAV vectors. Briefly, 10 moi of recombinant baculovirus containing AAV Rep and Cap genes were co-infected with 5 moi of recombinant baculovirus containing the GFP marker gene flanked by AAV ITRs for 3 days at 28 C. Cell pellets were collected by centrifugation at 3000 rpm for 10 min. The cell pellets were lysed in SF9 lysis buffer (50 mM Tris-HCl, pH 7.8, 50 mM NaCl, 2 mM MgCl.sub.2, 1% Sarkosyl, 1% Triton X-100, and 140 units/mL Benzonase nuclease (Sigma Aldrich) by sonication. Cell debris was removed by centrifugation at 8,000 rpm for 20 min. The cleared lysates of about 23 mL each were transferred to ultraclear centrifuge tubes for SW28 rotor (Beckman Coulter, Brea, Calif.), followed by 10 mL of 1.32 g/cc and 5 mL of 1.55 g/cc CsCl solutions and centrifuged at 28,000 rpm at 15 C. for about 20 hours. The AAV vector band was visualized with a beam light shining underneath and collected with a syringe needle. The collected AAV vectors were transferred into another centrifuge tube for a 70.1 ti rotor (Beckman Coulter) which was then filled with 1.38 g/cc CsCl solution and sealed. After centrifugation at 65,000 rpm for about 20 hours, the AAV vector band was visualized with a beam light shining underneath and collected with a syringe needle. The AAV vectors were buffer exchanged with PD-10 desalting columns (GE Healthcare Bio-Sciences, Pittsburgh, Pa.). After filter sterilization, the AAV vectors were used for further experiments.
Example 7
AAV Vector Quantification
[0111] AAV vectors in crude lysates or in purified form were quantified with QPCR according to protocol described by Aurnhamme et al. (Hum. Gene Ther. Meth. (2012) 23(1): 18-28) with modifications. Briefly, AAV samples were first diluted 1:100 with QPCR dilution buffer and contaminating DNA was removed by incubating 10 l diluted AAV with 1 l (2 units) DNaseI enzyme (New England Biolabs) in 39 l DNaseI digestion buffer (10 mM Tris-HCl, pH 8.0, 2.5 mM MgCl.sub.2, 0.5 mM CaCl.sub.2) at 37 C. for 1 hour. The DNase I enzyme was inactivated by mixing with 50 l of 200 mM EDTA and heating at 95 C. for 30 min. The treated AAV samples were further diluted 1:200, and 10 l of each AAV sample was used in the Chromo4 QPCR machine (Bio-Rad, Hercules, Calif.) to determine the copy numbers of AAV vector genome.
Example 8
Preservation of Capsid Integrity in v-cath rBV-Produced AAV Vectors
[0112] AAV vectors were produced by co-infection of Sf9 cells with v-cath rBVs or WT-rBV and purified by two rounds of cesium chloride ultracentrifugation as described in EXAMPLE 6. Equal amounts (110.sup.11 vg) of purified AAV particles were heated at 95 C. for 5 min. Capsid proteins were separated by SDS-PAGE and stained with a Simply Blue staining kit to determine the amount of degradation, if any, of the capsid proteins produced by each type of rBV.
Example 9
Infectivity of rBV-Produced AAV Vectors
[0113] AAV vectors produced in Sf9 cells with v-cath rBVs or WT-rBVs were purified and quantified as described above in EXAMPLE 7. These AAV vectors were used to transduce HEK-293 cells for comparison of their infectivities. The HEK-293 cells (ATCC-CRL-1573, Manassas, Va.) were cultured in DMEM media (Mediatech, Manassas, Va.) supplemented with 100 units of Penicillin-Streptomycin (Corning, Corning, N.Y.) with 10% FBS (Hyclone, Logan, Utah) in Corning 12-well cell culture plate in a CO.sub.2 incubator at 37 C. until about 70% confluent. The AAV samples were diluted each in 1 mL of DMEM containing 20 m etoposide (A.G. Scientific, San Diego, Calif.) but without FBS to obtain 3.0e+9 vg/mL. After the old media was removed from the plate, 0.5 mL of diluted AAV sample was added to each well, and the plate was incubated in the CO.sub.2 incubator at 37 C. overnight. The next morning, 0.5 mL DMEM medium containing 20% FBS and 100 units of Penicillin-Streptomycin was added to each well, and the transduction was carried out for 2 to 3 days. GFP-expressing cells were recorded with the Nikon Eclipse TS100 fluorescence microscope (Nikon Instruments, Melville, N.Y.).
Example 10
Expression of SV40 Capsid Proteins in v-cath rBV-Infected Insect Cells
[0114] Recombinant baculovirus carrying SV40 capsid genes was used to infect insect cells to express the SV40 capsid proteins. Briefly, 10 moi of the recombinant baculovirus were added to 300 mL Sf9 cells and incubated for 3 days at 28 C. Cell pellets were collected by centrifugation at 3000 rpm for 10 min. The cell pellets were lysed in SF9 lysis buffer (50 mM Tris-HCl, pH 7.8, 50 mM NaCl, 2 mM MgCl.sub.2, 1% Sarkosyl, 1% Triton X-100, and 140 units/mL Benzonase nuclease (Sigma Aldrich) by sonication. Cell debris was removed by centrifugation at 8,000 rpm for 20 min. The cleared lysate of about 23 mL was transferred to ultraclear centrifuge tube for SW28 rotor (Beckman Coulter, Brea, Calif.), followed by 10 mL of 1.32 g/cc and 5 mL of 1.55 g/cc CsCl solutions and centrifuged at 28,000 rpm at 15 C. for about 20 hours. The SV40 virus-like band was visualized with a beam light shining underneath and collected with a syringe needle. The collected SV40 virus-like particles were transferred into another centrifuge tube for a 70.1 ti rotor (Beckman Coulter) which was then filled with 1.38 g/cc CsCl solution and sealed. After centrifugation at 65,000 rpm for about 20 hours, the SV40 virus-like particle band was visualized with a beam light shining underneath and collected with a syringe needle. The SV40 virus-like particles were buffer exchanged with PD-10 desalting columns (GE Healthcare Bio-Sciences, Pittsburgh, Pa.). After filter sterilization, the SV40 virus-like articles were used for further experiments.
Example 11
Expression of Human Antibody Heavy and Light Chains in v-cath rBV-Infected Insect Cells
[0115] Recombinant baculovirus carrying the human antibody heavy chain and light chain expression cassettes was used to infect Sf9 cells for protein expression. Briefly, 10 moi of rBVs were used to infect 300 mL Sf9 cells for 3 days at 28 C. and both supernatant and cell pellet were harvested respectively. The cell pellet was lysed in the Sf9 lysis buffer, as described in EXAMPLE 6, and the cleared lysate was collected. Expressed human antibody in the supernatant and lysate were purified with protein-A agarose and analyzed by SDS-PAGE.
Example 12
Removal of the Selection Marker Expression Cassette by FLP/FLPe Expression
[0116] Two versions of cathepsin-deleted baculovirus DNA backbones were constructed: one with the CAT expression cassette flanked by two FRTs and the other with the CAT expression cassette flanked by two FRTs plus the GFP expression cassette integrated into the cathepsin-deletion region.
[0117] To remove the CAT expression cassette between FRT sites from the baculovirus backbone, the following experiment was performed. Glycerol stocks of bacteria containing DH10Bac-cath were streak on an LB plate containing 10 g/mL tetracycline and 25 g/mL chloramphenicol and were grown overnight (ON) at 37 C. The following evening a well-grown colony was picked and grown ON in 1 mL LB media containing 10 g/mL tetracycline and 25 g/mL chloramphenicol at 37 C. with agitation. The following morning, 30 L of the ON culture was diluted into 1.4 mL of LB media containing 10 g/mL tetracycline and 25 g/mL chloramphenicol and grown at 37 C. to an OD.sub.600 of between 0.3-0.5. The cell pellet was collected by centrifugation at 11,000 rpm for 30 sec. After removing the supernatant, the cell pellet was put on ice and resuspended in 1 mL ice-cold 10% glycerol. The cell pellet was centrifuged again at 11,000 rpm for 30 sec to remove most of the supernatant, leaving 20-30 L in the tube to resuspend the cell pellet. One L (500 ng/L) of plasmid pCP20, containing the FLP recombinase (The ODIN, Oakland, Calif.) was added to the resuspended cells kept on ice and mixed briefly. The cells were then transferred to a chilled electroporation cuvette (Molecular Bioproducts, Inc., Cat #5510-11, Fischer Scientific) and electroporated with the Bacteria Setting on the BioRad MicroPulser machine (Hercules, Ca). After electroporation, the cells were added to 1 mL LB media without antibiotics, and incubated at 30 C. for 2 hr with agitation. One hundred L of the cell solution was plated on an LB plate containing 100 g/mL ampicillin (Thermo Fisher Scientific, Waltham, Mass.), 50 g/mL kanamycin (Thermo Fisher Scientific, Waltham, Mass.), and 10 g/mL tetracycline (Thermo Fisher Scientific, Waltham, Mass.), and cultured at 30 C. ON. Eleven well-grown colonies were picked, streaked on an LB plate without antibiotics, and cultured at 43 C. ON to express the recombinase, which removed the chloramphenicol expression cassettes located between 2 FRT sites through recombination. The next morning, bacteria from each colony were removed with a pipette tip and resuspended in 20 L cold Milli Q-purified (Millipore Sigma) water.
[0118] PCR reactions were performed to verify the removal of the DNA sequence between the 2 FRT sites using 2 L resuspended bacteria from each colony. Forward primer 6298 (5-TAATAAATGACTGCAGTAGACGCAA-3) (SEQ ID NO: 5), and reverse primer 6299 (5-GAACAAAATTTTGTTTTATTTGTTTGTGTA-3) (SEQ ID NO:6) were used to verify the removal of the CAT expression cassette from DH10Bac-v-cath containing the CAT expression cassette flanked by two FRTs plus the GFP expression cassette. Forward primer 2847 (5-CTACGAGCGCATAATTGCGA-3) (SEQ ID NO:10) and reverse primer 2848 (5-GTTTGGTCATGTAGTTAACTTTG-3) (SEQ ID NO:11) were used to verify the removal of the CAT expression cassette from DH10Bac-v-cath containing only the FRT flanked CAT expression cassette. The PCR condition shown below in Table 2 were used.
TABLE-US-00002 TABLE 2 Step Temperature Time Initial Denaturation 98 C. 30 seconds 32 Cycles 98 C. 10 Seconds 58 C. 20 Seconds 72 C. 1 Minute 30 Seconds Final Extension 72 C. 2 Minutes Hold 4 C. As Needed
[0119] After the PCR reactions, the amplified PCR fragments were electrophoresed on a 1% agarose gel. As shown in
[0120] For DH10Bac-v-cath containing only the CAT expression cassette flanked by two FRTs, from the 8 colonies that had undergone the removal process only 3 colonies (#1, #5, and #7) showed PCR amplification of a fragment size of 651 bps, indicating the removal of CAT expression cassette (
EQUIVALENTS
[0121] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described specifically herein. Such equivalents are intended to be encompassed in the scope of the following claims.